Abstract: The present invention relates to a recombinant microorganism for producing putrescine or ornithine and a method for producing putrescine or ornithine using the same. Specifically the present invention relates to: a Corynebacterium sp. microorganism producing putrescine or ornithine which is engineered to weaken a transcriptional regulator of sugar metabolism (SugR) enhance citrate synthase (GltA) or perform both; and a method for producing putrescine or ornithine using the same.
1]The present invention relates to recombinant microorganisms and using them to produce putrescine or ornithine to a method of producing putrescine or ornithine.
[2]
BACKGROUND
[3]
Putrescine God found in Gram-negative bacteria and fungi, and are expected to play an important role in the metabolism of microorganisms due to the presence in high concentrations in a variety of species. In general, putrescine worn as an important raw material for synthesizing the polyamines nylon-4,6, is produced mainly by chemical synthesis. The chemical synthesis is composed of a three-step process which includes a hydrogenation step of using the stage and the high-pressure hydrogen using a catalytic oxidation step reaction, cyanides (cyanide) compound. Accordingly, putrescine more environmentally friendly to produce and God has a way of utilizing biomass that can reduce energy consumption are required.
[4]
Under this background, a method for producing putrescine using microorganisms, a method for producing putrescine in high concentrations by transforming the E. coli and Corynebacterium spp been published (International Patent Publication WO06 / 005603; International Patent Publication WO09 / 125924; Qian ZD et al, Biotechnol Bioeng 104 (4): 651-662, 2009; Schneider et al, Appl Microbiol Biotechnol 88 (4):....... 859-868, 2010; Schneider et al. , Appl Microbiol Biotechnol 95:.... 169-178, 2012).
[5]
[6]
Ornithine (ornithine) is a precursor used in the biosynthesis of arginine, proline and polyamines with a material which is widely found in plants, animals and microorganisms. Further, ornithine metabolism in vivo in higher animals generating elements from the amino acid or ammonia through the tin circuit plays an important role in the path to discharge from the body. Ornithine has also been used industrially to improve the nutritional supplements or liver failure and liver dysfunction drugs. A method of producing such a ornithine is a method using a method of processing a milk casein (casein) to the digestive enzymes and transformed with E. coli or Corynebacterium spp conversion is known (Registry No. 10-1372635 No. Republic of Korea; T . Gotoh et al, Bioprocess Biosyst Eng, 33:... 773-777, 2010).
[7]
[8]
On the other hand, metabolism transcription per character (transcriptional regulator of sugar metabolism) which is SugR Corey four known in tumefaciens as transcription regulators, the PTS system PEP- protein kinase phospho transferase (PEP-protein phosphotransferase system PTS of) the coding it is reported that inhibition of genes involved in the gene and the process (glycolysis) sugar (VF Wendisch, et al, J.Bacteriol.190:. 24, 8033-8044, 2008). Citrate synthase is an enzyme that can adjust the operation and the first and, TCA cycle rate in TCA cycle. There is Corynebacterium case of the mutant GltA activity is reduced in the Solarium it reported that aspartate and lysine production is increased (Shiio et al, Agric Biol Chem 46;.. 101-107, 1982).
[9]
Detailed Description of the Invention
SUMMARY
[10]
The present inventors that improves performance, putrescine or ornithine saensang when manipulating genes gltA encoding a gene sugR and citrate synthase (citrate synthase) encoding the sugar metabolism transcription regulators (transcriptional regulator of sugar metabolism) identified by the present invention has been completed.
[11]
Problem solving means
[12]
An object of the present invention to provide a recombinant microorganism capable of producing putrescine or ornithine, and a high yield.
[13]
Another object of the invention is to provide a method for producing putrescine or ornithine by using the microorganism.
[14]
Effects of the Invention
[15]
Enhance the metabolism transcription regulators (transcriptional regulator of sugar metabolism, SugR) a weakened and at the same time the citrate synthase (citrate synthase, GltA) per the genus Corynebacterium microorganism to produce putrescine, or ornithine to the present invention through that it was confirmed that the increase in ornithine and putrescine production of tin. The microorganism of the present invention in accordance can be widely used for industrial production of putrescine or ornithine, it is widely used in many polymer products in an effective and desired material providing means from the economic point of view and the environmental point of view of production to be used as a raw material It can be used.
[16]
Best Mode for Carrying Out the Invention
[17]
One aspect of the present invention i metabolism transcription regulators (transcriptional regulator of sugar metabolism, SugR) per) activity or weak compared to the endogenous activity, ii) citrate synthase (citrate synthase, GltA) enhanced activity compared to the endogenous activity or, or iii) the metabolism transcription regulators activate the genus Corynebacterium microorganism having a weakened and citrate synthase activity is mutated such that compared to their intrinsic activity, putrescine or ornithine-producing ability compared with the endogenous activity per to provide.
[18]
One embodiment of the present invention is the genus Corynebacterium microorganism metabolism transcription modulator activity inherent weakness with respect to the active and the citrate synthase activity of ornithine Mutated, putrescine or to be enhanced compared to the endogenous activity of tin per It provides a Corynebacterium spp with a production capacity.
[19]
Another embodiment of the present invention provides a microorganism of the genus Corynebacterium having the putrescine or ornithine-producing ability, comprising of the amino acid sequence of the The metabolic transcription per SEQ ID NO 1 or SEQ ID NO: 3.
[20]
Yet another embodiment of the present invention is the citrate synthase provides a genus Corynebacterium microorganism having putrescine or ornithine-producing ability, comprising of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
[21]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Brevibacterium Plastic boom ( Brevibacterium flavum ), and Brevibacterium lactofermentum ( Brevibacterium lactofermentum ) in the genus Corynebacterium microorganism having putrescine or ornithine-producing ability, which is selected from the group consisting of It provides.
[22]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism further ornithine dicarboxylic decarboxylase (ornithine decarboxylase, ODC) genus Corynebacterium having the mutation, the putrescine-producing ability to be activated is introduced into the It provides a microorganism.
[23]
Yet another embodiment of the present invention provides a microorganism of the genus Corynebacterium having the putrescine-producing ability, comprising of the amino acid sequence of the digital camera ornithine decarboxylase is SEQ ID NO: 17.
[24]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism is additionally i) ornithine carbamoyl transferase dehydratase (ArgF), ii) glutamate X Porter or iii) ornithine carbamoyl transferase dehydratase and the activity of glutamate X-Porter is to provide a Corynebacterium spp with putrescine or ornithine-producing ability mutated, so that the weakened compared to the endogenous activity.
[25]
Yet another embodiment of the present invention is composed of the ornithine carbamoyl transferase azepin is an amino acid sequence of SEQ ID NO: 9 or SEQ ID NO: consists of the amino acid sequence of 11, wherein the glutamate Expo emitter SEQ ID NO: 13 or SEQ ID NO: 15 which provides a Corynebacterium spp with putrescine or ornithine-producing ability.
[26]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism further acetyl gamma glutamyl phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase ( ArgB), and acetyl ornithine aminotransferase (ArgD) four corridor with the at least one active selected from the group of mutations that enhanced compared to the endogenous activity, putrescine or ornithine-producing ability consisting tumefaciens in It provides a microorganism.
[27]
Yet another embodiment of the present invention is the acetyl-gamma-glutamyl-phosphate reductase dehydratase is composed of the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21, acetyl glutamate synthase or ornithine acetyl transferase kinase is SEQ ID NO: 23 or consists of the amino acid sequence of SEQ ID NO: 25, acetyl glutamate kinase is composed of the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 29, acetyl ornithine aminotransferase is consisting of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 33, putrescine, or provide a Corynebacterium spp with ornithine-producing ability.
[28]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism provides the genus Corynebacterium microorganism having an additional acetyl transferase kinase activity is mutated so that the weakening, putrescine production than the endogenous activity Activity of .
[29]
Yet another embodiment of the present invention provides a microorganism of the genus Corynebacterium having the putrescine-producing ability, comprising of the amino acid sequence of the acetyl transferase kinase is SEQ ID NO: 35 or SEQ ID NO: 37.
[30]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism further SEQ ID NO: 39 or SEQ ID NO: 41 the amino acid activity of the protein consisting of the sequences are mutated such that intensified endogenous activity, putrescine-producing ability It has to offer Corynebacterium spp.
[31]
Another aspect of the invention
[32]
(I) culturing in a medium a microorganism of the genus Corynebacterium having the putrescine-producing ability or ornithine; And
[33]
(Ii) provides, putrescine or ornithine production process comprising the step of separating the putrescine or ornithine from the medium or the microorganism cultured in the step (i).
[34]
One embodiment of the invention provides that the microorganism of the genus Corynebacterium Corynebacterium glutamicum which, putrescine or production method of ornithine.
[35]
[36]
Hereinafter, the present invention will be described in detail.
[37]
One aspect of the present invention i metabolism transcription regulators (transcriptional regulator of sugar metabolism, SugR) per) activity or weak compared to the endogenous activity, ii) citrate synthase (citrate synthase, GltA) enhanced activity compared to the endogenous activity or, or iii) the metabolism transcription regulators activity is weakened compared to the endogenous activity per citrate synthase activity in the genus Corynebacterium microorganism having a mutation to be reinforced, putrescine or ornithine-producing ability compared with the endogenous activity It is about. Specifically, the sugar metabolism transcription regulators activity is weakened compared to the endogenous activity citrate synthase activity is directed to the genus Corynebacterium microorganism having a mutation to be reinforced, putrescine or ornithine-producing ability compared with the endogenous activity .
[38]
The term "metabolism transcription per character (transcriptional regulator of sugar metabolism, SugR)" used in the present invention per variety of sugar and the like inlet (sugar uptake) and phospho-transferase system, the glycolytic (glycolysis), and lactate dehydrogenase-related fermentation a wide range of enzymes that the inhibitor functions for genes involved in metabolism. The metabolism transcription control per the invention comprises all of the inherent stiffness within four proteins or foreign proteins tumefaciens in the microorganism may be specifically the genus Corynebacterium microbial SugR.
[39]
Metabolism transcription control per the invention The SEQ ID NO: 1 or a protein comprising the amino acid sequence of SEQ ID NO: 3, or the sequence that is 70% or more, for example 80% or more, more specifically, more specifically more than 90%, and at least 95%, even more specifically more than 98%, and most particularly if the protein having substantially the metabolic activity's transcription as per the amino acid sequence showing a homology of 99% or more may be included without limitation.
[40]
Further, since depending on the species or strain of microorganism that if a difference exists in the amino acid sequence of a protein showing the activity, but are not limited to the origin The metabolism transcription control per the invention, for example, Corynebacterium spp derived, it may be particularly Corynebacterium glutamicum origin. If the amino acid sequence that has a substantially SEQ ID NO: 1 or SEQ ID NO: 3 of the biological activity the same as or correspond to the protein as a sequence having homology with said sequence, also if some sequence having a deletion, modified, substituted or added in the amino acid sequence also included in the scope of the present invention is apparent.
[41]
Polynucleotides encoding those metabolism transcription control per the invention is one, SEQ ID NO: 1 or SEQ ID NO: 3 the amino acid sequence or a sequence with at least 70% having a similar activity and metabolism transcription modulator protein the sugar, specifically, 80% or more, it can be more specifically comprises a polynucleotide encoding a protein showing a 90% or greater, still more specifically at least 95%, even more specifically more than 98%, most specifically at least 99% homology. Polynucleotides encoding cut the sugar metabolism transcription is in consideration of the codon-preferred organisms and expressing those due, or the control by the degeneracy (degeneracy) of the codon-party, it does not change the amino acid sequence of the protein expressed from the coding region various modifications may be made in a coding region within a range, and specifically, it is not possible to include the polynucleotide sequence of SEQ ID nO: 2 or SEQ ID nO: 4, but limited.
[42]
[43]
As used herein, the term "citrate synthase (citrate synthase, GltA)" is an enzyme involved in the production of the purine nucleic acid reduction and produced in a variety of cellular biosynthetic intermediates. It is known to mediate the hydrolysis condensation reaction of acetyl -CoA and oxaloacetic acetate which acts to produce a citrate. And citrate synthase in the present invention include all of the protein within the intrinsic or foreign proteins in Corynebacterium microorganism, specifically, may be derived from a microorganism of Corynebacterium genus GltA.
[44]
In the present invention, citrate synthase is a protein comprising the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7, or the sequence that is at least 70%, specifically at least 80%, more specifically more than 90% or more, specifically is 95% or more, even more specifically more than 98%, most specifically at substantially acetyl -CoA and oxaloacetic hydrolysis condensation activity of the reaction medium produced a citrate acetate as the amino acid sequence showing a homology of 99% or more If you are having it may include without limitation proteins.
[45]
In addition, although, since depending on the species or strain of microorganism that if a difference exists in the amino acid sequence of a protein showing the activity, citrate synthase in the present invention is not limited to the origin, for example, Corynebacterium spp derived, specifically, it may be a Corynebacterium glutamicum origin. If the amino acid sequence that has a substantially SEQ ID NO: 5 or SEQ ID NO: 7 biological activity the same as or correspond to a protein of a sequence having homology with said sequence, also if some sequence having a deletion, modified, substituted or added in the amino acid sequence also included in the scope of the present invention is apparent.
[46]
Polynucleotides encoding citrate synthase of the present invention is the citrate synthase which has a similar activity as protein, SEQ ID NO: 5 or SEQ ID NO: 7 the amino acid sequence or a sequence with at least 70%, specifically at least 80% , more specifically, more specifically more than 90%, is over 95%, even more specifically, may be a 98% or more, and most specifically includes a polynucleotide encoding a protein showing a homology of 99% or more. A polynucleotide coding for the citrate synthase by considering the codon-preferred organisms and expressing those due, or the control by the degeneracy (degeneracy) of the codon-party, does not change the amino acid sequence of the protein expressed from the coding region various modifications may be made in a coding region within a range, and specifically, it is not possible to include the polynucleotide sequence of SEQ ID nO: 6 or SEQ ID nO: 8, but limited.
[47]
[48]
The term "homology" in the above refers to the degree of matching the given amino acid sequence or polynucleotide sequence, and can be expressed as a percentage. In this specification, it is represented by its sequence homology to the "% homology" has the same or similar activity with a given amino acid sequence or polynucleotide sequence. For example, the sequence by Southern hybridization experiment under the score (score), identities (identity) and similarity (similarity) standard software, stringent conditions specifically used, define the BLAST 2.0 calculating a parameter (parameter), such as appropriate hybridization conditions is to check, by comparing the definition is within the skill of a method well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989;. FM Ausubel et al, may be determined in Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[49]
In addition, the metabolism transcription regulators and polynucleotides encoding citrate synthase per the present invention as a probe (probe) derived from each of SEQ ID NO: 2 or 4 and SEQ ID NO: 6 or 8. A polynucleotide sequence or a polynucleotide sequence of can be hybridized under stringent conditions (stringent conditions), it may be of variations that normally function encoding a metabolic transfer Adjuster and citrate synthase sugar. And in said it means a condition that allows for specific hybridization between the terms "stringent conditions" is a polynucleotide. For example, such stringent conditions are described in detail in the literature (e.g., J. Sambrook et al., Above).
[50]
[51]
In the present invention, putrescine or ornithine to tin weaken the metabolism transcription regulators SugR activity of the sugar to the genus Corynebacterium microorganism having a production capability, or enhance the citrate synthase GltA activity of, or the SugR active weakening and GltA it applied the enhanced activity at the same time, as a result, it was confirmed that all variations are putrescine, or ornithine to improve production strains.
[52]
[53]
On the other hand, if the microorganism of the present invention can produce ornithine to putrescine, or may include all of the wild-type or mutant microbes. Examples of Escherichia genus ( Escherichia sp.), Shigella genus ( Shigella sp.), In bakteo a sheet ( Citrobacter sp.), Salmonella in ( Salmonella sp.), Enterococcus bakteo in ( Enterobacter sp.) Yeosi California in ( Yersinia SP.), keurep when Ella in ( Klebsiella SP.), air Winiah in ( Erwinia SP.), the genus Corynebacterium ( of Corynebacterium SP.), Brevibacterium genus ( Brevibacterium SP.), Lactobacillus genus ( Lactobacillus sp.), celecoxib eggplant grandma in ( Selenomanas sp.), in Vibrio ( Vibrio sp.), Pseudomonas species ( Pseudomonas sp.), Streptomyces in cis ( Streptomycessp.), Oh bacteria in Kano ( Arcanobacterium sp.), Zen in alkaline ( Alcaligenes may be a microorganism belonging to such sp). Specifically, the microorganism of the present invention Corey four may be a microorganism belonging to the genus tumefaciens, more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium to thermoelectric amino Ness ( Corynebacterium thermoaminogenes ), Brevibacterium Plastic boom ( Brevibacterium flavum ), and Brevibacterium lactofermentum ( Brevibacterium lactofermentum can be selected from the group consisting of a), and even more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum may be a), and the like.
[54]
[55]
In particular, the terms of this invention "putrescine or with ornithine-producing ability" is putrescine or ornithine ability production of tin or naturally, putrescine or ornithine to the parent strain without capability of production of tin putrescine or ornithine means the microbial production of tin given ability.
[56]
In addition, the putrescine or ornithine producing microorganism having a capability is ornithine ornithine acid that in tin involved in arginine synthesis carbamoyl transferase dehydratase (ornithine carbamoyltransfrase, ArgF) and / or protein, glutamate x involved in the glutamate discharge the activity of Potter (NCgl1221) may be mutated so as to weaken compared to the endogenous activity.
[57]
In addition, proteins of the putrescine microorganism having a new producing ability is putrescine and mutation to put it weakens the acetyl crystallized protein activity of the acetyltransferase (NCgl1469) compared to the endogenous activity and / or switch the ornithine to putrescine of ornithine it may be modified to introduce the activity of the decarboxylase (ornithine decarboxylase, ODC).
[58]
[59]
On the other hand, mutation, such as the introduction of the active or in the present invention is the enhanced activity or weakening the activity can take place through a process known as transformation. The term "transgenic" in the present invention to a protein wherein the polynucleotide is encoding in a host cell by introducing a vector comprising such a polynucleotide or active coding for a specific protein strong or weak promoter sequence in a host cell expression help or means to induce mutations in the chromosomes of the host cells.
[60]
In addition, the polynucleotides include DNA and RNA encoding the target protein. The polynucleotide is introduced into the host cell as long as it can induce expression or mutation, it does not matter whether it is to be introduced in any form. For example, the polynucleotide may be introduced into a host cell in the form of there is expressed by itself in an expression cassette (cassette expression) gene construct containing all the elements required. The expression cassette may include a promoter that is normally operably linked to the polynucleotide (promoter), a transcription termination signal, ribosome binding site and translation termination signal. The expression cassette may be an expression vector form a self-replicable. In addition, the polynucleotide is introduced into a host cell in the form of itself, and may be, which is possibly connected with the operation sequence necessary for the expression in a host cell, and the like.
[61]
In addition, it means that the promoter sequence and the gene sequence to initiate and mediate the transcription of a polynucleotide encoding a specific protein of the invention in the above expectation, the term "operably linked" is functionally connected.
[62]
The term "vector" as used in the present invention means a DNA preparation containing the polynucleotide sequence encoding the desired protein operably linked to suitable control sequences so as to express the desired protein in a suitable host. The control sequences include any operator sequence, sequences that control the termination of the sequence, and a transcription and translation encoding a suitable mRNA ribosome-binding site for regulating the promoter, such that transcription can initiate transcription. Vector may then be transformed into a suitable host cell, replicate independently of the host genome, or functions, may be integrated into the genome itself.
[63]
Vector for use in the invention as long as it can replicate in a host cell is not particularly limited, it is possible to use any vector known in the art. Examples of the normal vector to be used may be a naturally occurring or recombinant plasmid of the state, cosmid, virus and bacteriophage. For example, the phage vector or course as mid vector may be used. PWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, etc. Charon4A, and Charon21A, pBR series, pUC system, pBluescriptII system as plasmid vector It may be used based pGEM, pTZ-based, such as pCL and pET-based system. Available vectors in the present invention is not particularly limited and may be a known expression vector. Specifically, it may be used pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector or the like.
[64]
Thus, it is possible to replace the polynucleotide encoding the target protein in the chromosome via a bacterial vector for insertion within the chromosome in a mutant polynucleotide. Insertion into the chromosome of the above polynucleotides is any method known in the art, for example, but may be made by homologous recombination, but is not limited to this. Vectors of the invention may further comprise a selectable marker (selection marker) to determine the chromosomal insertion causes homologous recombination can be inserted into the chromosome. Selectable marker is designed to determine the transfection screening the transformed cells with a vector, that is, whether the insertion of the target polynucleotide, drug resistance, nutritional requirement, given the selectable phenotype such as expression of the resistance or the surface protein on cytotoxic agent markers that can be used. Since the selective agent in a process environment (selective agent) survive only cells expressing a selectable marker, or reflect a different phenotype, it may be selected for transformed cells.
[65]
[66]
It is the term of the present invention, "activity-enhanced" not only includes deriving the effect over the original function is increased introduced new of the protein itself, the active or, implicitly gene amplification from the increase in the intrinsic gene activity, internal or external factors, and the It includes that the activity increased by increasing the number deletions, gene copies of the inhibitory regulator of gene expression, gene introduction from the outside, deformation of the expression control sequences, in particular promoter replacement or modification and gene increased the enzyme activity by the in mutation do.
[67]
Specifically, enhanced activity or increased in the invention,
[68]
1) increasing the copy number of the polynucleotide encoding the enzyme,
[69]
2) transformation of the expression control sequences to increase the expression of the polynucleotide,
[70]
3) modification of the polynucleotide sequence on the chromosome so that the activity is enhanced in the enzyme, or
[71]
4) but it can be carried out by such method that modified to enhanced by the combination thereof, but is not limited thereto.
[72]
Wherein 1) increasing the copy number of the polynucleotide is not particularly limited, be performed as operably linked to a vector form, it can be carried out by being inserted into the chromosome in the host cell. Specifically, either a vector capable of polynucleotide is operably linked, and independent of replication and host the ability to encrypt the enzyme of the present invention can be carried out by being introduced into the host cell, the polynucleotide is operably linked to, a host a vector capable of inserting the polynucleotide into the chromosome is introduced into a host cell in the cell by being can be carried out in a way to increase the copy number of the polynucleotide within the chromosome of the host cell.
[73]
Next, 2) a poly modification of expression control sequences so as to express the increase of the nucleotides is especially useful for but not limited to, the polynucleotide sequence so as to further enhance the activity of the expression control sequence deletion, insertion, Vivo wholly or conservative substitution or a combination of the two performed by inducing a mutation on the sequence, or may be performed by replacing as a polynucleotide sequence has a stronger activity. The expression control sequence may comprise a particularly useful for but not limited to promoters, operator sequences, such as sequences that control the termination of the sequence, the transcription and translation coding for a ribosome binding site.
[74]
There is a strong heterologous promoters rather than the original promoter the upper portion of the polynucleotide expression units can be connected, examples of the strong promoter and the like CJ7 promoter, lysCP1 promoter, EF-Tu promoter, groEL promoters, aceA or aceB promoter, more specifically as is lysCP1 promoter of Corynebacterium-derived promoter (WO2009 / 096689) or the CJ7 promoter (Republic of Korea Patent No. 0,620,092 No. and WO2006 / 065095) and work is possible to connect to enhance the expression of the polynucleotide encoding the enzyme However, it not limited to this.
[75]
In addition, 3) modification of the polynucleotide sequence on the chromosome is especially useful for but not limited to, expression control polynucleotide sequence so as to further enhance the activity of the polynucleotide sequence by deletion, insertion, Vivo wholly or conservative substitution or a combination thereof performed by inducing a mutation on the sequence, or may be performed by replacing as in the polynucleotide sequence improved so as to have a stronger activity.
[76]
[77]
Terms of this invention "weakening the activity" is, some or all of the deletion of the polynucleotide encoding a protein that weakens the activity and Now, deformation of the expression control so as to express the reduced sequence of said polynucleotide, of weakening the activity of the protein such can be accomplished by a method selected from the deformation of the polynucleotide sequence on the chromosome, and combinations thereof.
[78]
[79]
Specifically, the activity of weakening in the present invention,
[80]
1) Some or all of the deletion of the polynucleotide encoding the protein,
[81]
2) transformation of the expression control sequence to reduce the expression of the polynucleotide,
[82]
3) modification of the polynucleotide sequence on the chromosome so that the activity of the protein of weakening, and
[83]
4) it can be also achieved by a method selected from a combination thereof, and the like.
[84]
Specifically, a method for deleting a part or all of the polynucleotide encoding the protein, a polynucleotide coding for my intrinsic target protein chromosome through a bacterial vector For chromosomal insertion, some polynucleotide sequence deleted polynucleotides or marker gene as it may be done by substitution. The "part" is different according to the kind of a polynucleotide but, specifically to 1300, in particular from 1 to 100, and more specifically, from 1 to 50 atoms.
[85]
Further, the method of modifying the expression control sequence is performed by inducing a mutation on the controlled expression of the polynucleotide sequence to further weaken the activity of the expression control sequence by deletion, insertion, Vivo wholly or conservative substitution or a combination of these sequences or, a polynucleotide sequence having a weaker activity may be carried out by replacing. And the expression control sequence includes a sequence for controlling the sequence, and termination of transcription and decryption encoding a promoter, operator sequence, a ribosome binding site.
[86]
In addition, the method of modifying the polynucleotide sequence on the chromosome is carried out by inducing a sequence variation on the polynucleotide sequence so as to further weaken the activity of the enzyme by deletion, insertion, Vivo wholly or conservative substitution or a combination thereof, or, more weak It can be carried out by changing to a polynucleotide sequence so as to have the improved activity.
[87]
In addition, the method for deleting a regulator for suppressing the expression of the polynucleotides of the enzyme may be performed by replacing the polynucleotide of the expression inhibitor with some polynucleotides polynucleotide or a marker gene sequence is deleted. The "part" is different according to the kind of a polynucleotide but, specifically to 1300, in particular from 1 to 100, and more specifically, from 1 to 50 atoms.
[88]
[89]
The term "intrinsic activity" used in the present invention is, not that originally contains the status, for example, microorganisms are unmodified means the active state of the enzyme have in natural state, and the "enhanced compared to the endogenous activity", Gene represents the active the introduction or the art increase in copy number of a gene, transformation of the deletion or expression control sequence of the inhibitory regulatory elements of the gene expression, for example, operate as compared to having the microbe prior to being this procedure such as the use of an improved promoter made active It means a microorganism that has the activity of increasing the state after having made.
[90]
[91]
The genus Corynebacterium microorganism of the present invention may be further dicarboxylic ornithine decarboxylase (ornithine decarboxylase, ODC) Corynebacterium spp with a, putrescine-producing ability will be the introduction of active.
[92]
"Dicarboxylic ornithine decarboxylase" in the present invention mediate the dicarboxylic misfire (decarboxylation) of ornithine by means of the enzyme to produce putrescine. Corynebacterium spp include putrescine biosynthesis is not ornithine from the outside tin decarboxylase The introduction of (ornithine decarboxylase, ODC) putrescine is discharged outside the cell gods as putrescine god synthesis. Ornithine above in the present invention tin dicarboxylate cyclase is SEQ ID NO: 17 may be one consisting of the amino acid sequence, or the sequence that is 70% or more, for example 80% or more, more specifically, more specifically more than 90%, and at least 95%, even more specifically, if the protein of more than 98%, most specifically at substantially the activity of ornithine decarboxylase tin dicarboxylic an amino acid sequence showing a homology of 99% or more may be included without limitation.
[93]
Further, since depending on the species or strain of microorganism that if a difference exists in the amino acid sequence of a protein showing the activity, ornithine in the present invention, tin dicarboxylate cyclase is not limited to the origin, in particular derived from E. coli ornithine dicarboxylate LA is the best you can. If the amino acid sequence having a biological activity substantially the same as or correspond to the protein of SEQ ID NO: 17, a sequence having homology with said sequence, if some sequence having a deletion, modified, substituted or added in the amino acid sequence also of the present invention included in the category are self-evident.
[94]
Polynucleotide encoding an Ornithine dicarboxylic decarboxylase of the present invention is the ornithine dicarboxylic decarboxylase one having a similar activity and protein, SEQ ID NO: 17 for the amino acid sequence or a sequence with at least 70%, specifically 80%, more specifically, more specifically more than 90%, is over 95%, even more specifically, may be a 98% or more, and most specifically includes a polynucleotide encoding a protein showing a homology of 99% or more. A polynucleotide coding for the ornithine dicarboxylic decarboxylase, considering the codon-preferred organisms and expressing those due, or the control by the degeneracy (degeneracy) of the codon Now, not change the amino acid sequence of the protein expressed from the coding region within the range that various modifications may be made to the coding region.
[95]
[96]
The genus Corynebacterium microorganism of the present invention is additionally i) ornithine carbamoyl transferase dehydratase (ArgF), ii) glutamate X Porter (NCgl1221) or iii) ornithine carbamoyl transferase dehydratase and glutamate X porter activity of this may be a weakness compared to the endogenous activity, putrescine or ornithine Corynebacterium spp with a production capacity.
[97]
Ornithine in the present invention, tin-carbamoyl transferase kinase is SEQ ID NO: 9 or a protein consisting of the amino acid sequence of SEQ ID NO: 11, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, more more specifically, at least 95%, even more specifically 98% or greater, and most specifically, if the protein has substantially the ornithine carbamoyl transferase dehydratase activity as the amino acid sequence shown by at least 99% homology may be included, without limitation, have.
[98]
In addition, proteins consisting of glutamate Expo emitter SEQ ID NO: 13 or 15 amino acid sequence of the invention, or the sequence that is 70% or more, for example 80% or more, more specifically, more specifically more than 90%, 95% If more than, and even more specifically, the protein of more than 98%, most specifically at substantially glutamate X porter activity of the amino acid sequence shown as at least 99% homology can be included without limitation.
[99]
[100]
In addition, the genus Corynebacterium microorganism of the present invention additionally acetyl gamma glutamyl phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine tin amino least one activity selected from the group consisting of azetidine transferase (ArgD) this may be a microorganism of the genus Corynebacterium having the, putrescine or ornithine-producing ability compared to their intrinsic activity.
[101]
Acetyl-gamma-glutamyl-phosphate reductase kinase in the present invention SEQ ID NO: 19 or SEQ ID NO: protein consisting of the amino acid sequence of 21, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, more more specifically, at least 95%, even more specifically 98% or greater, and most specifically, if a substantially protein of acetyl-gamma-glutamyl-phosphate Li activity of the reductase kinase as the amino acid sequence shown by at least 99% homology may be included, without limitation, have.
[102]
In the present invention acetyl glutamate synthase or ornithine acetyl transferase dehydratase is a protein consisting of the amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 25, or the sequence that is at least 70%, specifically 80% or more, more specifically at least 90%, still more specifically at least 95%, even more specifically 98% or greater, and most specifically, the substantially-acetyl glutamate synthase or ornithine acetyl transferase activity of a kinase as an amino acid sequence showing at least 99% homologous If the protein has may include, without limitation.
[103]
Acetyl glutamate kinase in the present invention SEQ ID NO: 27 or SEQ ID NO: protein consisting of the amino acid sequence of 29, or the sequence that is at least 70%, specifically 80% or more, more specifically 90% or more, more specifically 95 than If% or more, even more specifically, the protein of more than 98%, most specifically at substantially the activity of acetyl glutamate kinase with an amino acid sequence showing a homology of 99% or more may be included without limitation.
[104]
In addition, La-acetyl ornithine amino transferase in the present invention dehydratase is a protein consisting of the amino acid sequence of SEQ ID NO: 31 or SEQ ID NO: 33, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, still more specifically at least 95%, even more specifically 98% or greater, and most specifically, if a substantially protein of acetyl ornithine aminotransferase activity as the amino acid sequence shown by at least 99% homology may be included, without limitation, have.
[105]
[106]
In addition, the genus Corynebacterium, microorganisms of the present invention may be further acetyl transferase azepin genus Corynebacterium microorganism having the, putrescine-producing ability of weakening the activity of the (NCgl1469) than the endogenous activity.
[107]
La acetyltransferase in the present invention dehydratase may include, without limitation, it is a protein that serves to transfer the acetyl group to putrescine. Wherein the acetyltransferase is SEQ ID NO: 35 or SEQ ID NO: protein consisting of the amino acid sequence of 37, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, still more specifically at least 95% , even more specifically, if a substantially protein having the activity of an acetyltransferase la dehydratase as the amino acid sequence shown by more than 98%, most specifically at least 99% homology can be included without limitation.
[108]
[109]
Finally, the genus Corynebacterium microorganism of the present invention is the addition NCgl2522 activity may be a microorganism of the genus Corynebacterium having the, putrescine-producing ability intensified endogenous activity.
[110]
In the present invention NCgl2522 is a protein that functions to discharge putrescine, SEQ ID NO: 39 or a protein consisting of the amino acid sequence of SEQ ID NO: 41, or the sequence that is at least 70%, specifically 80% or more, more specifically 90 If% or more, and still more specifically, the protein of 95% or more, even more specifically more than 98%, most specifically at substantially the same activity as the amino acid sequence showing a homology of 99% or more may be included without limitation.
[111]
[112]
In yet one aspect, the present invention
[113]
(I) culturing in a medium a microorganism of the genus Corynebacterium having the putrescine-producing ability or ornithine; And
[114]
(Ii) provides, putrescine or ornithine production process comprising the step of separating the putrescine or ornithine from the medium or the microorganism cultured in the step (i).
[115]
The genus Corynebacterium microorganism in the present invention may be Corynebacterium kumil.
[116]
Putrescine or genus Corynebacterium microorganism having an ornithine-producing ability of the present invention is as described above.
[117]
In the method, the method comprising culturing the microorganism, and may be particularly, but not limited thereto, carried out by the known batch culture method, the continuous culture method, a fed-batch culture method. At this time, the culture conditions, particularly for but not limited to, a basic compound to an appropriate pH using: (phosphoric acid or sulfuric acid for example) (for example, pH 5 to 9, in particular (for example, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound It is pH 6 to 8, most specifically, and to adjust the pH 6.8), oxygen or oxygen-introducing the gas containing the mixture to the culture and maintain the aerobic conditions, the culture temperature is 20 to 45 ℃, specifically 25 can be maintained to a 40 ℃, it can be cultured for about 10 to 160 hours. The cost of production by the culture putrescine or ornithine residues can be secreted into the culture medium or into the cell.
[118]
In addition, in a culture medium for culture it is used and the carbohydrate sugar is as a carbon source (e.g. glucose, sucrose trehalose, lactose, fructose, maltose, know three, starch and cellulose), maintenance, and fat (such as soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (for example, glycerol and ethanol) and organic acids (e.g. acetic acid) can be used by using individually or mixed, such as, but this is not limited. The nitrogen source may include nitrogen-containing organic compounds (e.g., peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean bakbun and urea), or inorganic compounds (e.g., ammonium ammonium ammonium sulfate, chloride, phosphate, ammonium carbonate and ammonium nitrate) may be used individually or by using or mixing and the like, but is not limited thereto. A source of phosphate, but this can be used either individually or in combination or used as a potassium phosphate, potassium susoyi, such as the corresponding sodium-containing salts, but is not limited to this. In addition, other metal salts (such as magnesium sulfate or iron sulfate), essential amino acids, and growth, such as vitamins can include a promoting material.
[119]
The method for recovering a putrescine or ornithine produced in the incubation step of the invention the culture process, such as object from a batch, continuous or fed-batch culture in the art using a suitable method known in the art according to the culture method a material that can be collected.
[120]
Mode for the Invention
[121]
And in more details below the present invention through the embodiments. However, these examples are intended to illustrate the invention by way of example, it is not the scope of the present invention is limited to these Examples.
[122]
[123]
Example 1: Production of sugR weakened strain putrescine-producing strain
[124]
[125]
The inventors have confirmed the effect of weakening the sugR gene encoding a sugar metabolism transcription regulators (transcriptional regulator of sugar metabolism) on putrescine production in the putrescine-producing strain.
[126]
[127]
1-1. ATCC13032 -based putrescine producing strains sugR production of genetically attenuated strains
[128]
[129]
In order to ensure that the Corynebacterium glutamicum ATCC13032-based putrescine-producing strain of KCCM11240P (Republic of Korea Patent Publication No. 10-2013-0082478), the Ambassador to the weakening of the party gene transcription putrescine production per associate in neunge , sugR prepare a weakened strain. Specifically, weakening sugR gene strain changes the start codon of sugR gene, and a promoter to B6 weak promoter (Patek M (2005) Regulation of gene expression In:. Eggeling L, Bott M (eds) Handbook of Corynebacterium glutamicum CRC, It was prepared by the method of replacing a BocaRaton).
[130]
[131]
First, a vector was prepared for a change in the sugR initiation codon. Obtaining a rear homologous recombination fragment of the polynucleotide sequence SEQ ID NO: 43 and a primer pair and sugR initiation codon of the 44 for obtaining the anterior homologous recombination fragment of sugR initiation codon intended for near described in SEQ ID NO: 2 of the gene encoding the SugR the primer pair SEQ ID NO: 45 or 46 and 47 was prepared for. The primers used in the start codon changes are summarized in Table 1 below.
[132]
TABLE 1
primer SEQ ID NO: 5 '-> 3'
sugR F1_SalI (SEQ ID NO: 43) CTTGCATGCCTGCAGGTCGACAGGATTCATCTGGCATCTGGC
sugR-R1 (SEQ ID NO: 44) GTCACTCCTTAAAGCAAAAAGCC
sugR-F2_GTG (SEQ ID NO: 45) TTTTTGCTTTAAGGAGTGACGTGTACGCAGAGGAGCGCCGTC
sugR -F2_TTG (SEQ ID NO: 46) TTTTTGCTTTAAGGAGTGACTTGTACGCAGAGGAGCGCCGTC
sugR-R2_BamHI (SEQ ID NO: 47) CGAGCTCGGTACCCGGGGATCCGCGAGAGTACGAAGCGCAGT
[133]
[134]
After Corynebacterium as glutamicum ATCC13032 genomic DNA template of, performing PCR using primers each of the second pair to amplify the front and the PCR fragment of the rear portion of the sugR gene start codon, respectively, to this electrophoresis purposes the fragment was obtained. At this time, PCR reaction is a 30 second denaturation, 55 ℃ 30 seconds elongation process in 30 seconds annealing and 72 ℃ in 95 ℃ was repeated 30 times. After the fragments obtained therefrom by electrophoresis in 0.8% agarose gel and purified by eluting the band of the desired size.
[135]
pDZ vector (Republic of Korea Patent No. 10-0924065 No.) was cloned into the BamHI and SalI and treated fusion PCR product of the ATCC13032 strain. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). In this process, a plasmid was prepared pDZ-1'sugR (GTG) and pDZ-1'sugR (TTG).
[136]
For a vector for the replacement of a weaker promoter, B6, to the vector SEQ ID NO: 48 for the production it was prepared as shown in Table 2.
[137]
TABLE 2
primer SEQ ID NO: 5 '-> 3'
sugR F3 (SEQ ID NO: 48) TTTTTGCTTTAAGGAGTGACGAAGGCAACCATGAACTCTAATGTACGCAGAGGAGCGCCGTC
[138]
[139]
A pair of primers of the polynucleotide SEQ ID NO: 43 and 44 for the destination near the sequence to obtain the front homologous recombination fragment of sugR start codon is described in SEQ ID NO: 2 of the gene encoding the SugR and the rear homologous recombination fragment of sugR initiation codon after performing PCR using the primer pair SEQ ID NO: 48 and 47 to obtain and amplify a PCR fragment of the front and rear parts of the sugR gene start codon, respectively, to give the fragment of interest by this electrophoresis. After the fragments obtained therefrom by electrophoresis in 0.8% agarose gel and purified by eluting the band of the desired size. pDZ vector was cloned into the BamHI and SalI and treated fusion PCR product of the ATCC13032 strain. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). In this process, a plasmid was prepared pDZ-1'sugR (B6).
[140]
[141]
The plasmid pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) a putrescine production Corynebacterium spp KCCM11240P (Republic of Korea Patent Publication No. 10-2013-0082478 No.) electroporation (electroporation) to obtain a transformant by introducing into, and kanamycin to the transformant (25 ㎍ / ㎖) and the X-gal (5-bromo-4-chloro-3-indolin - D -galactoside) is to contain the BHIS spread on plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) to form colonies by culturing. Among colonies formed therefrom by selecting colonies of blue color was the starting plasmid pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR of (B6) is introduced strain.
[142]
[143]
Wherein the selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), were respectively formed and then diluted sequentially with plated and cultured on a solid medium containing X-gal colonies from 10-4 to 10-10.
[144]
By selecting the white colonies that appears at a relatively low rate, from the formed colony she was selected for the final strain and the promoter is replaced by the strain B6 are the initiation codon of sugR changed to GTG or TTG by a secondary cross (crossover). Intended for the final selection of strains using the primer pair SEQ ID NO: 43 and 47 perform a PCR to the start codon of sugR confirmed that the change to the GTG or TTG, or switch to B6 weakened promoter, wherein the Corynebacterium glutamicum the mutant was named as KCCM11240P sugR (GTG), KCCM11240P sugR (TTG), KCCM11240P sugR (B6).
[145]
[146]
1-2. ATCC13869 -based putrescine producing strains sugR production of genetically attenuated strains
[147]
[148]
Corynebacterium glutamicum ATCC13869 based putrescine-producing strain of DAB12-a ΔNCgl1469 and (Republic of Korea Patent Publication No. 10-2014-0115244 call) the named as DAB12-b, producing sugR weakened strain on the basis of the strain It was.
[149]
Specifically, Corynebacterium glutamicum ATCC13869 To confirm the gene and the protein sequence expressed therefrom encoding the derived SugR, Corynebacterium glutamicum ATCC13869 genomic DNA as the template of the SEQ ID NO: 43 and SEQ ID NO: 49 of PCR was performed using the primer pair.
[150]
TABLE 3
primer SEQ ID NO: 5 '-> 3'
sugR R (SEQ ID NO: 49) GGACTTGCAGTGACTGTAAGAA
[151]
[152]
At this time, PCR reaction was repeated for 1 minute 30 seconds 30 times in the process of elongation 95 ℃ for 30 seconds denaturation, annealing, and 72 seconds at 30 ℃ in 55 ℃.
[153]
After separation of the PCR products obtained therefrom by gel electrophoresis results of the sequence analysis, confirmed that the gene encoding the Corynebacterium glutamicum SugR the ATCC13869-derived comprises a polynucleotide sequence represented by SEQ ID NO: 4 It was. This sequence from the amino acid sequence of four Corey tumefaciens glutamicum ATCC13032 SugR the origin of the protein encoded (SEQ ID NO: 1) Comparison of the, sequence homology is a name was found in 99%.
[154]
[155]
Table 1 and 2, Corynebacterium glutamicum ATCC13869-derived sugR for initiation codon changes and weakened B6 promoter replaced and the Corynebacterium glutamicum ATCC13869 genomic DNA templates, as in Example 1-1, by performing PCR using primers set forth in after each PCR fragment amplified between the front and the back parts of the sugR gene start codon, to give the desired fragment them by electrophoresis. At this time, PCR reaction is a 30 second denaturation, 55 ℃ 30 seconds elongation process in 30 seconds annealing and 72 ℃ in 95 ℃ was repeated 30 times. After the fragments obtained therefrom by electrophoresis in 0.8% agarose gel and purified by eluting the band of the desired size.
[156]
pDZ vector was cloned into the BamHI and SalI and treated fusion PCR product of the ATCC13032 strain. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). In this process, a plasmid was prepared pDZ-2'sugR (GTG), pDZ -2'sugR (TTG) and pDZ-2'sugR (B6).
[157]
[158]
Carried the plasmid pDZ-2'sugR (GTG), pDZ-2'sugR (TTG) and pDZ-2'sugR (B6) in the same manner as in Example 1-1, the transformed Corynebacterium glutamicum DAB12-b conversion by changing sugR initiation codon was selected, and or a strain converted to B6 weakened promoter. Which was named from the selection of Corynebacterium glutamicum mutant with DAB12-b sugR (GTG), DAB12-b sugR (TTG) and DAB12-b sugR (B6).
[159]
[160]
Example 2: Preparation of gltA enhanced strain in the putrescine-producing strain
[161]
[162]
To determine the putrescine influence from Shin-producing strain is a citrate synthase (citrate synthase) of gltA active reinforcement on putrescine production, the mutant strain to introduce the gltA gene into the inside transposon gene chromosome of the putrescine-producing strain It was prepared. A Corynebacterium vector for transformation that enables the chromosomal genes introduced by using a transposon gene region of Solarium spp pDZTn (WO 2009/125992) were used.
[163]
[164]
2-1. ATCC13032 -based putrescine production strains gltA production of reinforcement strains
[165]
[166]
Using a Corynebacterium glutamicum ATCC13032 SEQ ID NO: genomic DNA as a template, primers 50 and 51 was amplified the gltA gene fragment (Table 4). At this time, PCR reactions were repeated 30 second denaturation, 55 ℃ 30 seconds or 1 minute and 30 seconds elongation at 30 seconds, annealing process, and 72 ℃ in 95 ℃ 30 times. After the PCR products by electrophoresis on a 0.8% agarose gel and purified by eluting the band of the desired size.
[167]
pDZTn vector was cloned fusion of each PCR product was treated with speI and obtained in the above. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). The resulting plasmid was named pDZTn1'-gltA obtained with.
[168]
TABLE 4
primer SEQ ID NO: 5 '-> 3'
gltA F_speI (SEQ ID NO: 50) GAAGGAATGAGTTCCTCGAGACTAGTACTCGGCACCCATCCTTGTC
gltA R_speI (SEQ ID NO: 51) GTTATTAGATGTCGGGCCCACTAGTGTGCTGTACATGCTCCTTGAAAATC
[169]
[170]
The introduction of the prepared plasmid by electroporation (electroporation) to KCCM11240P to give a transformant, and the transformant CM medium (glucose 10 g / ℓ, polypeptone 10 g / ℓ, yeast extract 5 g / ℓ, beef extract 5 g / ℓ, NaCl 2.5 g / ℓ, urea 2 g / ℓ, pH 6.8) in a shaking culture (30 ℃, 8 hours), and each was diluted by one from 10-4 to 10-10 X- to spread on gal-containing solid medium, and cultured to form colonies.
[171]
By selecting the white colonies indicated by a relatively low rate from the formed colonies it was finally selected for the strain introduced gene encoding the gltA by a secondary cross (crossover). Confirming that the end intended for selecting the strains SEQ ID NO: to perform PCR using a primer pair 50 and 51 Gene encoding the gltA, and the Corynebacterium glutamicum gltA :: Tn mutants was named KCCM11240P.
[172]
[173]
2-2. ATCC13869 -based putrescine production strains gltA production of reinforcement strains
[174]
[175]
Carried out to prepare a gltA enhanced strain intended for DAB12-b used in Example 1-2.
[176]
Specifically, Corynebacterium glutamicum ATCC13869 gene encoding the derived gltA, and therefrom to determine the protein sequence to be expressed, Corynebacterium glutamicum ATCC13869 genomic DNA as the template of the SEQ ID NO: 50 and 51 primers using a pair of PCR were performed.
[177]
At this time, PCR reaction was repeated for 1 minute 30 seconds 30 times in the process of elongation 95 ℃ for 30 seconds denaturation, annealing, and 72 seconds at 30 ℃ in 55 ℃. After separation of the PCR products obtained therefrom by gel electrophoresis results of the sequence analysis, confirmed that the gene encoding the Corynebacterium glutamicum gltA the ATCC13869-derived comprises a polynucleotide sequence represented by SEQ ID NO: 8 It was. This sequence from the Corynebacterium glutamicum ATCC13032-derived amino acid sequence of the gltA of the protein encoded (SEQ ID NO: 5) were compared to, sequence homology is a name was found in 99%.
[178]
Using a Corynebacterium glutamicum ATCC13869 Corynebacterium glutamicum ATCC13869 SEQ ID NO: of the genomic DNA as a template, primers 50 and 51 as in the above Examples 2-1 to the resulting reinforced gltA gene fragment was amplified . At this time, PCR reactions were repeated 30 second denaturation, 55 ℃ 30 seconds or 1 minute and 30 seconds elongation at 30 seconds, annealing process, and 72 ℃ in 95 ℃ 30 times. After the PCR products by electrophoresis on a 0.8% agarose gel and purified by eluting the band of the desired size.
[179]
pDZTn vector was cloned fusion of each PCR product was treated with speI and obtained in the above. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). The resulting plasmid was named pDZTn2'-gltA obtained with. Transformed with the plasmid in the same manner as the four corridor pDZTn2'-gltA Examples 2-1 tumefaciens glutamicum DAB12-b and were selected for the strain gltA is enhanced. The Corynebacterium glutamicum mutant selection from which DAB12-b Tn: was named gltA.
[180]
[181]
Example 3: putrescine produced sugR weakening and gltA production and its putrescine produced verify performance of the enhanced integrated strains
[182]
[183]
To determine the putrescine-producing ability improved by the insertion in the chromosome of the gltA gene in the above Example 1-1 and a sugR the attenuated strain prepared in 1-2, we were introduced gltA gene in a transposon. The vector was used to conduct a pDZTn1'-gltA and pDZTn2'-gltA produced in Example 2-1 and 2-2.
[184]
[185]
Specifically, the gltA enhanced by transforming the plasmid pDZTn1'-gltA the Examples 2-1 and Corynebacterium glutamicum in the same manner KCCM11240P sugR (GTG), KCCM11240P sugR (TTG) and KCCM11240P sugR (B6) the strain was produced. The manufacturing cost of Corynebacterium glutamicum mutant KCCM11240P sugR (GTG) :: Tn gltA, KCCM11240P sugR (TTG) :: Tn gltA and KCCM11240P sugR (B6) named :: Tn gltA, and of which KCCM11240P sugR ( TTG) :: gltA Tn ( of Corynebacterium glutamicum CC01-1147) were deposited with the International 28 November 2014 KCCM11615P the Korea Culture Center of microorganisms.
[186]
[187]
In addition, the transformed Corynebacterium glutamicum DAB12-b sugR (GTG), DAB12-b sugR (TTG) and DAB12-b sugR (B6) carried the plasmid pDZTn2'-gltA in the same manner as in Example 2-2 conversion to manufacture a strain of gltA is enhanced. The above prepared Corynebacterium glutamicum mutant strain was named DAB12-b sugR (GTG) Tn :: gltA, DAB12-b sugR (TTG) Tn :: gltA and DAB12-b sugR (B6) :: Tn gltA .
[188]
[189]
Example 4: putrescine produced sugR weakening and gltA strengthen integrated strain putrescine production sanneung rating
[190]
[191]
To putrescine is sugR weakening and gltA enhanced in the new production strains to confirm the effect of putrescine produced, intended for a Corynebacterium glutamicum mutant produced in Example 1, Example 2 and Example 3 putrescine were compared with new production capacity.
[192]
[193]
Specifically, the six kinds of Corynebacterium glutamicum mutant (KCCM11240P sugR (GTG) Tn :: gltA / KCCM11240P sugR (TTG) Tn :: gltA / KCCM11240P sugR (B6) Tn :: gltA / DAB12-b sugR ( GTG) :: Tn gltA / DAB12-b sugR (TTG) :: Tn gltA and DAB12-b sugR (B6) Tn :: gltA)) as the parental strain of two (KCCM11240P, DAB12 a-b) respectively, 1 mM arginine smear containing CM plate medium (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 l standard) the cells were cultured at 30 ℃ for 24 hours.
[194]
Titer medium of 25 ml of each strain cultured therefrom (Glucose 8%, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 and 7H 2 O pantothenate 3 mg, nicotinamide 3 mg, CaCO - 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium 3 to 5% 1 L standard) after a platinum inoculation extent to 200 rpm them at 30 ℃ shaken and incubated for 50 hours.
[195]
A 1 mM arginine in the culture medium during all of the strains were added. Measured after the culture produced from each of the culture putrescine concentrations and the results are shown in Table 5 below.
[196]
Table 5
Strain 퓨 트레 신 (g / L) Productivity (g / L / h) fold (%)
KCCM11240P 5.8 0.116 100
KCCM11240P sugR (TTG) 6.3 0.126 109
KCCM11240P sugR(GTG) 6.3 0.126 109
KCCM11240P sugR(B6) 6.0 0.120 103
KCCM11240P Tn::gltA 6.2 0.124 107
KCCM11240P sugR(TTG) Tn::gltA 6.8 0.136 117
KCCM11240P sugR(GTG) Tn::gltA 6.5 0.130 112
KCCM11240P sugR(B6) Tn::gltA 6.3 0.126 109
DAB12-b 6.5 0.129 100
DAB12-b sugR (TTG) 6.9 0.138 107
DAB12-b sugR(GTG) 6.8 0.136 105
DAB12-b sugR(B6) 6.7 0.134 104
DAB12-b Tn::gltA 7.0 0.140 109
DAB12-b sugR(TTG) Tn::gltA 7.3 0.146 113
DAB12-b sugR(GTG) Tn::gltA 7.1 0.142 110
DAB12-b sugR(B6) Tn::gltA 7.1 0.142 110
[197]
[198]
As shown in Table 5, the ratio compared to a modified strain KCCM11240P, sugR is weakened or if the Corynebacterium glutamicum mutant of gltA is enhanced putrescine and productivity is increased from 3 to 9%, and, sugR the weakening as soon at the same time the case of the mutant gltA is enhanced, putrescine productivity was further increased from 9 to 17%.
[199]
In the case of a non-modified strain DAB12-b, sugR is weakened or if the Corynebacterium glutamicum mutant of gltA is enhanced putrescine and productivity is increased from 4 to 9%, and, as soon sugR weaken at the same time the gltA for enhanced mutant, it was confirmed that the putrescine productivity of 10 to 13% further increased.
[200]
[201]
Example 5: putrescine discharge capability increases the putrescine -producing strain based sugR weakening and making thereof and putrescine check Shin-producing ability of the gltA enhanced integrated strain
[202]
[203]
5-1. Putrescine discharge capability increased strain based sugR weakening and gltA production of enhanced integrated strains
[204]
[205]
A, mutant strain to determine whether putrescine emissions increased KCCM11401P (Republic of Korea Patent Publication No. 10-2014-0115244), putrescine production improves performance by enhancing sugR based gene activity weakened gltA gene activity and the ability strain It was produced.
[206]
Specifically, the first, in Example 1-1 a pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR same way the (B6) as in Example 1-1 Production in It is converted into Corynebacterium glutamicum KCCM 11401P by transforming the sugR the TTG start codon was selected strains sugR weakened. Which it was named from the selection of Corynebacterium glutamicum mutant with KCCM11401P sugR (GTG), KCCM11401P sugR (TTG) and KCCM11401P sugR (B6).
[207]
[208]
Next, in order to ensure that the gltA gene improves performance putrescine produced by the enhanced activity, was introduced into the gltA gene in a transposon gene of the above prepared sugR gene is attenuated strain. At this time it was used as a vector pDZTn1'-gltA prepared in Example 2-1.
[209]
Specifically, the Example 2-1 carried a plasmid pDZTn1'-gltA produced in the same manner as in Example 2-1, the Corynebacterium glutamicum mutant KCCM11401P sugR (GTG), KCCM11401P sugR (TTG) and KCCM11401P sugR ( transformed to B6) and was selected a strain of gltA is enhanced. Which was named the starter from the Corynebacterium glutamicum mutant strain with the mutant KCCM11401P sugR (GTG) Tn :: gltA, KCCM11401P sugR (TTG) Tn :: gltA and KCCM11401P sugR (B6) Tn :: gltA.
[210]
[211]
5-2. Putrescine discharge capability increases the putrescine -producing strain based sugR weakening and gltA putrescine production capacity rating of strengthening integrated strains
[212]
[213]
To putrescine is sugR weakening and gltA enhanced in the new production strains to confirm the effect of putrescine produced, the putrescine-producing ability to target a mutant strain of Corynebacterium glutamicum prepared in Example 5-1 It was compared.
[214]
Specifically, Corynebacterium glutamicum mutant (KCCM11401P sugR (GTG) of seven Corey, KCCM11401P sugR (TTG), KCCM11401P sugR (B6), KCCM11401P :: Tn gltA, KCCM11401P sugR (GTG) :: Tn gltA, KCCM11401P sugR (TTG) :: Tn gltA and KCCM11401P sugR (B6) :: Tn gltA) and one for the parental strain (KCCM11401P) each containing 1 mM arginine CM plate medium (glucose 1% of the species, polypeptone 1%, yeast extract 0.5% , and plated on beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours.
[215]
Titer medium of 25 ml of each strain cultured therefrom (Glucose 8%, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 and 7H 2 O pantothenate 3 mg, nicotinamide 3 mg, CaCO - 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium 3 to 5% 1 L standard) after a platinum inoculation extent to 200 rpm them at 30 ℃ shaken and incubated for 50 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measured after the culture produced from each of the culture putrescine concentrations and the results are shown in Table 6 below.
[216]
TABLE 6
Strain 퓨 트레 신 (g / L) Productivity (g / l / h) fold(%)
KCCM11401P 5.3 0.106 100
KCCM11401P sugR (TTG) 5.6 0.112 106
KCCM11401P sugR(GTG) 5.5 0.110 104
KCCM11401P sugR(B6) 5.4 0.108 102
KCCM11401P Tn::gltA 5.6 0.112 106
KCCM11401P sugR(TTG) Tn::gltA 6.1 0.122 115
KCCM11401P sugR(GTG) Tn::gltA 5.9 0.118 111
KCCM11401P sugR(B6) Tn::gltA 5.8 0.116 109
[217]
[218]
As it is shown in Table 6, compared with the unmodified strain KCCM11401P, and sugR is weakened or gltA the Corynebacterium increase putrescine productivity, 2 to 6% in glutamicum mutant enhanced, as soon sugR weaken at the same time for the mutant gltA is enhanced, it was confirmed that the putrescine productivity is 9 to 15% further increased. This product was confirmed to be consistent with the interpretation of results Table 5
[219]
[220]
Example 6. Preparation of sugR weakened strain ornithine producing strain
[221]
[222]
Corynebacterium glutamicum ATCC13032 was prepared using the mutant vector produced in Example 1-1 to determine the affects neunge ornithine production derived sugR weakened.
[223]
[224]
Plasmid pDZ-1'sugR (GTG) prepared in the above Example 1-1, with the pDZ-1'sugR (TTG) and pDZ-1'sugR (B6) a Corynebacterium glutamicum ATCC13032 as a parent strain by introducing the electroporation (electroporation) to manufacture a KCCM11137P (Republic of Korea Patent No. 10-1372635 call) to obtain a transformant and the transformant kanamycin (25 ㎍ / ㎖) and X-gal (5-bromo -4-chloro-3-indolin - by culturing in D-galactoside) containing the BHIS spread on plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) to form a colony. Among colonies formed therefrom by selecting colonies of blue color was the starting plasmid pDZ-1'sugR (GTG), pDZ-1'sugR (TTG) and pDZ-1'sugR of (B6) is introduced strain.
[225]
Wherein the selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), were respectively formed and then diluted sequentially with plated and cultured on a solid medium containing X-gal colonies from 10-4 to 10-10. By selecting the white colonies that appears at a relatively low rate, from the formed colony she was selected for the final strain and the promoter is replaced by the strain B6 are the initiation codon of sugR changed to GTG or TTG by a secondary cross (crossover).
[226]
End intended for starter strain SEQ ID NO: with the primer pair 43 and 47 perform a PCR to a Corynebacterium glutamicum mutants obtained by checking whether the initiation codon is changed to GTG or TTG of sugR each KCCM11137P sugR ( It was named GTG), KCCM11137P sugR (TTG) and KCCM11137P sugR (B6).
[227]
[228]
Example 7. Preparation of the strain in the reinforced gltA ornithine producing strain
[229]
[230]
In order to confirm the effect of the gltA gene activity enhance ornithine on neunge tin produced in ornithine producing strain, produce a strain mutated by inserting the gltA gene in the embodiment 2-1, a chromosome of ornithine producing strain by using a vector produced in It was.
[231]
[232]
Specifically, ornithine producing strain of KCCM11137P (Republic of Korea Patent No. 10-1372635 No.) Example 2-1 was introduced into the vector electroporation (electroporation) produced in the obtained transformants, and the transformants conversion to shaking culture the body in CM medium (glucose 10 g / ℓ, polypeptone 10 g / ℓ, yeast extract 5 g / ℓ, beef extract 5 g / ℓ, NaCl 2.5 g / ℓ, urea 2 g / ℓ, pH 6.8) ( 30 ℃, 8 hours), and each was diluted from 10-4 to 10-10 in order to form a colony to smear and culture in solid medium containing X-gal.
[233]
By selecting the white colonies indicated by a relatively low rate from the formed colonies it was finally selected for the strain introduced gene encoding the gltA by a secondary cross (crossover). It was confirmed that the end intended for selecting the strains SEQ ID NO: to perform PCR using a primer pair 50 and 51 Gene encoding the gltA, thus obtained a mutant strain of Corynebacterium glutamicum gltA the KCCM11137P :: Tn termed It was.
[234]
[235]
Example 8. sugR weakening and gltA production of ornithine and its enhanced integrated strains produced verify performance
[236]
[237]
8-1. ATCC13032 -based production of ornithine sugR weakening and gltA production of enhanced integrated strains
[238]
[239]
To verify the exemplary ornithine-producing ability improved by the insertion in the chromosome of the gltA gene in Example 6. The one sugR produced by weakening KCCM11137P sugR (GTG), KCCM11137P sugR (TTG) and KCCM11137P sugR (B6), the transposon gene the gltA It was introduced into. At this time it was used as a vector pDZTn1'-gltA prepared in Example 2-1.
[240]
[241]
Transformed into Corynebacterium glutamicum KCCM11137P sugR (TTG) carried the plasmid pDZTn1'-gltA in the same manner as in Example 2-1 was selected a strain of gltA is enhanced. Which was named the starter from the Corynebacterium glutamicum mutant with KCCM11137P sugR (GTG) Tn :: gltA, KCCM11137P sugR (TTG) Tn :: gltA and KCCM11137P sugR (B6) Tn :: gltA.
[242]
[243]
8-2. sugR weakening and gltA ornithine strengthen integrated strain production capacity evaluation
[244]
[245]
In order to confirm the effect of ornithine sugR weakening and the tin producing ornithine gltA enhanced in the producing strain, ornithine intended for the Corynebacterium glutamicum mutant strain prepared in Example 8-1 it was compared to tin-producing ability .
[246]
Specifically, Corynebacterium glutamicum mutant strain of seven Corey ((KCCM11137P sugR (GTG), KCCM11137P sugR (TTG), KCCM11137P sugR (B6), KCCM11137P Tn :: gltA, KCCM11137P sugR (GTG) Tn :: gltA, KCCM11137P sugR (TTG) :: Tn gltA and KCCM11137P sugR (B6) :: Tn gltA) and containing a parent strain (KCCM11137P) one kind of each of 1 mM arginine CM plate medium (glucose 1%, polypeptone 1%, yeast extract 0.5 %, and plated on beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 l, agar 2%, pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours.
[247]
Titer medium of 25 ml of each strain cultured therefrom (Glucose 8%, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 and 7H 2 O pantothenate 3 mg, nicotinamide 3 mg, CaCO - 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium 3 to 5% 1 L standard) after a platinum inoculation extent to 200 rpm them at 30 ℃ shaken and incubated for 50 hours. A 1 mM arginine in the culture medium during all of the strains were added. After culturing to the putrescine concentration and measuring the new result from the production of each culture it is shown in Table 7.
[248]
Table 7
Strain 오르니 틴 (g / L) Productivity (g / l / h) fold(%)
KCCM11137P 11.5 0.230 100
KCCM11137P sugR (TTG) 12.5 0.250 109
KCCM11137P sugR(GTG) 12.3 0.246 107
KCCM11137P sugR(B6) 12.5 0.250 109
KCCM11137P Tn::gltA 12.4 0.248 108
KCCM11137P sugR(TTG) Tn::gltA 13.5 0.270 117
KCCM11137P sugR(GTG) Tn::gltA 13 0.260 113
KCCM11137P sugR(B6) Tn::gltA 12.9 0.258 112
[249]
[250]
As shown in Table 7, the ratio compared to a modified strain KCCM11137P, sugR is weakened or if the Corynebacterium glutamicum mutant of gltA is enhanced putrescine and productivity is increased by 7 to 10%, also, sugR the weakening as soon at the same time it was confirmed that the case of the mutant gltA is enhanced, ornithine productivity is 12 to 17% further increased.
[251]
[252]
It was confirmed that Taken together the above, putrescine or ornithine in the Corynebacterium strain producing tin, it weakened, or the production of putrescine God ornithine increase over to enhance the gltA the sugR, weaken sugR At the same time, if strengthening the gltA, putrescine God and it was confirmed that further increase the production of ornithine.
[253]
[254]
From the above description, those skilled in the art will appreciate that may be embodied in other specific forms of the present invention without changing the technical spirit or essential characteristics. The embodiments described above In this regard, the examples should be understood as illustrative and not be limiting in all aspects. The scope of the invention should be construed as the meaning and scope, and all such modifications as derived from the equivalent concepts of the claims to be described later, rather than the description above within the scope of the invention.
[255]
Claims
[Claim 1]Metabolic transfer per Adjuster (transcriptional regulator of sugar metabolism, SugR) activity is weakened compared to the endogenous activity citrate synthase (citrate synthase, GltA) activity is produced, putrescine or ornithine mutations that enhanced compared to the endogenous activity Corynebacterium spp with the performance.
[Claim 2]
The method of claim 1, wherein the metabolism transcription The SEQ ID NO: 1 or SEQ ID NO: 3 genus Corynebacterium microorganism having putrescine or ornithine-producing ability, comprising of the amino acid sequence of the sugar.
[Claim 3]
The method of claim 1, wherein the citrate synthase is the genus Corynebacterium microorganism having putrescine or ornithine-producing ability, comprising of the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 7.
[Claim 4]
The method of claim 1, wherein the genus Corynebacterium microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ) , Brevibacterium Plastic boom ( Brevibacterium flavum ), and Brevibacterium lactofermentum ( Brevibacterium lactofermentum ) in the genus Corynebacterium microorganism having putrescine or ornithine-producing ability, which is selected from the group consisting of.
[Claim 5]
The method of claim 1, wherein the microorganism of the genus Corynebacterium is further dicarboxylic ornithine decarboxylase (ornithine decarboxylase, ODC) the genus Corynebacterium microorganism having a mutation, the putrescine-producing ability so that the introduction of the active.
[Claim 6]
The method of claim 5, wherein the dicarboxylic ornithine decarboxylase is the genus Corynebacterium microorganism having the putrescine-producing ability, comprising of the amino acid sequence of SEQ ID NO: 17.
[Claim 7]
The method of claim 1, wherein the genus Corynebacterium microorganism is additionally i) ornithine carbamoyl transferase dehydratase (ArgF), ii) glutamate X Porter or iii) ornithine carbamoyl transferase dehydratase and glutamate X Porter It mutated so that the activity is weak compared to the endogenous activity, putrescine or ornithine Corynebacterium spp with a production capacity.
[Claim 8]
The method of claim 7, wherein the ornithine carbamoyl transferase kinase is SEQ ID NO: 9 or SEQ ID NO: consists of the amino acid sequence of 11, wherein the glutamate Expo emitter SEQ ID NO: 13 or 15 of the amino acid sequence, putrescine or consisting of Corynebacterium spp with ornithine-producing ability.
[Claim 9]
The method of claim 1, wherein the genus Corynebacterium microorganism further acetyl gamma glutamyl phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine aminotransferase (ArgD) the at least one active selected from the group consisting of a mutation to be enhanced compared to the endogenous activity, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 10]
10. The method of claim 9, wherein the acetyl-gamma-glutamyl-phosphate reductase dehydratase is composed of the amino acid sequence of SEQ ID NO: 19 or SEQ ID NO: 21, acetyl glutamate synthase or ornithine acetyl transferase kinase is SEQ ID NO: 23 or SEQ ID NO: 25 consists of the amino acid sequence, acetyl glutamate kinase is composed of the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 29, acetyl ornithine aminotransferase is SEQ ID NO: 31 or SEQ ID NO: 33 for the amino acid sequence, putrescine consisting or Corynebacterium spp with ornithine-producing ability.
[Claim 11]
The method of claim 1, wherein the microorganism of the genus Corynebacterium is additionally acetyl transferase activity of the kinase mutated so weakened than the endogenous activity, putrescine genus Corynebacterium microorganism having a production capability.
[Claim 12]
12. The method of claim 11, wherein the acetyl transferase is azepin SEQ ID NO: 35 or SEQ ID NO: 37 the genus Corynebacterium microorganism having the putrescine-producing ability, comprising of the amino acid sequence of.
[Claim 13]
The method of claim 1, wherein the genus Corynebacterium microorganism further SEQ ID NO: 39 or SEQ ID NO: 41, the activity of the protein consisting of the amino acid sequence mutated to enhance than endogenous activity, putrescine or with ornithine-producing ability of Corynebacterium spp.
[Claim 14]
(I) comprising the steps of: 1 to claim 13, wherein the culture of any one of putrescine or ornithine genus Corynebacterium microorganism having a producing ability in a medium; And (ii), putrescine or ornithine production method comprising the step of separating the putrescine or ornithine from the medium or the microorganism cultured in the step (i).
[Claim 15]
15. The method of claim 14 wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum of, putrescine or ornithine production method.
| Section | Controller | Decision Date |
|---|---|---|
| # | Name | Date |
|---|---|---|
| 1 | 201817002367-STATEMENT OF UNDERTAKING (FORM 3) [19-01-2018(online)].pdf | 2018-01-19 |
| 2 | 201817002367-SEQUENCE LISTING(PDF) [19-01-2018(online)].pdf | 2018-01-19 |
| 3 | 201817002367-SEQUENCE LISTING [19-01-2018(online)].jpg | 2018-01-19 |
| 4 | 201817002367-REQUEST FOR EXAMINATION (FORM-18) [19-01-2018(online)].pdf | 2018-01-19 |
| 5 | 201817002367-POWER OF AUTHORITY [19-01-2018(online)].pdf | 2018-01-19 |
| 6 | 201817002367-FORM 18 [19-01-2018(online)].pdf | 2018-01-19 |
| 7 | 201817002367-FORM 1 [19-01-2018(online)].pdf | 2018-01-19 |
| 8 | 201817002367-DECLARATION OF INVENTORSHIP (FORM 5) [19-01-2018(online)].pdf | 2018-01-19 |
| 9 | 201817002367-COMPLETE SPECIFICATION [19-01-2018(online)].pdf | 2018-01-19 |
| 10 | 201817002367-Correspondence-220118.pdf | 2018-01-25 |
| 11 | 201817002367-Proof of Right (MANDATORY) [02-02-2018(online)].pdf | 2018-02-02 |
| 12 | 201817002367-OTHERS-050218.pdf | 2018-02-08 |
| 13 | 201817002367-Correspondence-050218.pdf | 2018-02-08 |
| 14 | 201817002367-Power of Attorney-220118.pdf | 2018-02-13 |
| 15 | 201817002367-Correspondence-220118 -.pdf | 2018-02-13 |
| 16 | 201817002367.pdf | 2018-03-24 |
| 17 | 201817002367-FORM 3 [10-07-2018(online)].pdf | 2018-07-10 |
| 18 | 201817002367-certified copy of translation [14-09-2020(online)].pdf | 2020-09-14 |
| 19 | 201817002367-OTHERS [20-11-2020(online)].pdf | 2020-11-20 |
| 20 | 201817002367-Information under section 8(2) [20-11-2020(online)].pdf | 2020-11-20 |
| 21 | 201817002367-FORM 3 [20-11-2020(online)].pdf | 2020-11-20 |
| 22 | 201817002367-FER_SER_REPLY [20-11-2020(online)].pdf | 2020-11-20 |
| 23 | 201817002367-COMPLETE SPECIFICATION [20-11-2020(online)].pdf | 2020-11-20 |
| 24 | 201817002367-CLAIMS [20-11-2020(online)].pdf | 2020-11-20 |
| 25 | 201817002367-ABSTRACT [20-11-2020(online)].pdf | 2020-11-20 |
| 26 | 201817002367-PETITION UNDER RULE 137 [23-11-2020(online)].pdf | 2020-11-23 |
| 27 | 201817002367-FER.pdf | 2021-10-18 |
| 28 | 201817002367-US(14)-HearingNotice-(HearingDate-05-08-2022).pdf | 2022-06-29 |
| 29 | 201817002367-PETITION UNDER RULE 138 [17-08-2022(online)].pdf | 2022-08-17 |
| 30 | 201817002367-Written submissions and relevant documents [15-09-2022(online)].pdf | 2022-09-15 |
| 31 | 201817002367-FORM 3 [15-09-2022(online)].pdf | 2022-09-15 |
| 32 | 201817002367-Annexure [15-09-2022(online)].pdf | 2022-09-15 |
| 33 | 201817002367-PatentCertificate30-01-2023.pdf | 2023-01-30 |
| 34 | 201817002367-IntimationOfGrant30-01-2023.pdf | 2023-01-30 |
| 1 | strategy_2367E_11-06-2020.pdf |