The present invention relates to a recombinant microorganism for producing putrescine
and a method of producing putrescine using the same.
Background Art
Biogenic amines (BAs) are nitrogen compounds mainly produced by decarboxylation of
amino acids, amination of aldehyde and ketone, and transamination. Such biogenic amines are
low molecular weight compounds, which are synthesized during metabolism of microorganisms,
plants, and animals, and thus are known as components easily found in cells thereof. Especially,
polyamine such as spermidine, spermine, putrescine (or 1,4-butanediamine), cadaverine, etc., are
substances present in most living cells.
Among them, putrescine is an important raw material which synthesizes polyamine
nylon-4,6 by reacting with adipic acid, and is produced mainly by chemical synthesis through
acrylonitrile and succinonitrile from propylene.
In addition, a method for producing putrescine at high concentration by transformation
of E. coli and genus Corynebacterium has been disclosed (International Publication No.
WO06/005603; International Publication No. WO09/125924; Qian ZD et al., Biotechnol. Bioeng.
104(4): 651-662, 2009; Schneider et al., Appl. Microbiol. Biotechnol. 88(4): 859-868, 2010; and
Schneider et al., Appl. Microbiol. Biotechnol. 95: 169-178., 2012). Further, research on
putrescine transporter regarding E. coli, yeast, plant and animal cells has been actively conducted
WO 2015/163718 PCT/KR2015/004087
3
(K Igarashi, Plant Physiol. Biochem. 48: 506-512, 2010).
Meanwhile, the present inventors demonstrated that membrane proteins encoding
NCgl2522 function as a putrescine exporter in a microorganism of genus Corynebacterium ,
which includes a putrescine synthesis pathway, and confirmed that putrescine may be produced
at a high yield by enhancing NCgl2522 activity from to the endogenous activity thereof (KR
Patent Application No. 10-2013-0030020)
In addition, NCgl2523 gene is a multidrug-resistance-related transcription factor which
belongs to TetR family, and is known to act as an NCgl2522 expression inhibitor (Hirochi et. al.
J Biol. Chem. 280:46, 38711-38719. 2005).
In this regard, the present inventors have continuously conducted research and
confirmed enhanced putrescine production by depletion of NCgl2523 which constitutes
NCgl2522 operon, in the manner similar to the effects of enhancing NCgl2522 activity, thereby
completing the present invention.
Disclosure
Technical Problem
An objective of the present invention is to provide a recombinant microorganism capable
of producing putrescine at high yield.
Another objective of the present invention is to provide a method of producing
putrescine at high yield using the microorganism.
Technical Solution
In one aspect to achieve the above objectives, the present invention provides a
WO 2015/163718 PCT/KR2015/004087
4
microorganism of genus Corynebacterium having putrescine productivity, in which a protein
having an amino acid sequence represented by SEQ ID NO: 2 is inactivated
In one exemplary embodiment, the present invention provides a microorganism of genus
Corynebacterium having putrescine productivity, wherein an activity of ornithine decarboxylase
(ODC) is further introduced into the microorganism.
In another exemplary embodiment, the present invention provides a microorganism of
genus Corynebacterium having putrescine productivity, in which the ODC has an amino acid
sequence represented by SEQ ID NO: 10.
In still another exemplary embodiment, the present invention provides a microorganism
of genus Corynebacterium having putrescine productivity, wherein acetyltransferase activity is
further inactivated in the microorganism.
In still another embodiment, the present invention provides a microorganism of genus
Corynebacterium having putrescine productivity, wherein the acetyltransferase comprises an
amino acid represented by SEQ ID NO: 15 or 16.
In still another embodiment, the present invention provides a microorganism of genus
Corynebacterium having putrescine productivity, in which the microorganism is
Corynebacterium glutamicum.
In another aspect, the present invention provides a method of producing putrescine
including:
i) culturing a microorganism of genus Corynebacterium having putrescine productivity
wherein a protein having an amino acid sequence represented by SEQ ID NO: 2 is inactivated in
a culture medium; and
ii) separating putrescine from a cultured microorganism or the culture medium obtained
WO 2015/163718 PCT/KR2015/004087
5
from the above step.
In an exemplary embodiment, the present invention provides a method of producing
putrescine, in which the microorganism of genus Corynebacterium is Corynebacterium
glutamicum.
Hereinafter, the present invention will be described in detail.
In one aspect, the present invention relates to a microorganism of genus
Corynebacterium having putrescine productivity, wherein a protein having an amino acid
sequence represented by SEQ ID NO: 2, thus NCgl2523, is inactivated
As used herein, the term "NCgl2523" refers to a multidrug-resistance-related
transcription factor which belongs to TetR family, and is known to act as an Ncgl2522
expression inhibitor (Hirochi et. al., J Biol. Chem. 280(46): 38711-38719, 2005).
In the present invention, NCgl2523 is a protein having an amino acid of SEQ ID NO: 2
or an amino acid sequence having 70% or more, more specifically 80% or more, even more
specifically 90% or more, much more specifically 98% or more, and most specifically 99% or
more homology to the sequence, and is not limited thereto as long as it is a protein having the
activity of an NCgl2522 expression inhibitor.
Further, because amino acid sequences of proteins showing the activity may differ
depending on species or strain of microorganisms, it is not limited thereto. It is obvious that a
protein having an amino acid sequence in which the sequence is partially deleted, modified,
substituted, or inserted is included in the scope of the present invention, as long as a sequence
having homology to the sequence shows biological activity practically equivalent or
corresponding to a protein of SEQ ID NO: 2.
WO 2015/163718 PCT/KR2015/004087
6
As used herein, the term "homology" refers to similarity between given amino acid
sequences or nucleotide sequences and may be represented in percentage. Herein, the
homology sequence which have identical or similar activity with a given amino acid sequence or
nucleotide sequence is indicated by "% homology". For example, homology may be examined
by using conventional software calculating mediated parameters such as score, identity,
similarity, etc., and more specifically using BLAST 2.0, or by comparing sequences via Southern
hybridization under defined stringent conditions. Appropriate hybridization conditions may be
defined by the scope of the art, and may be determined by one of ordinary skill in the art using
known methods (i.e., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition,
Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
As long as it has an activity similar to those of NCgl2523 proteins, a polynucleotide
encoding NCgl2523 of the present invention may include an amino acid sequence of SEQ ID NO:
2, or a polynucleotide encoding a protein having 70% or more, specifically 80% or more, more
specifically 90% or more, much more specifically 95% or more homology thereto, much more
specifically 98% or more, and most specifically 99% or more homology to the sequence, and
may especially include a nucleotide sequence of SEQ ID NO: 1 or 3.
Further, a polynucleotide encoding NCgl2523 of the present invention may be
hybridized in stringent conditions with a probe of a nucleotide sequence represented by SEQ ID
NO: 1 or 3, or a probe derived from the nucleotide sequence, and may be a variant encoding
functionally normal NCgl2523. As used herein, the term "stringent conditions" refers to
conditions which enable a specific hybridization between polynucleotides. For example, such
stringent conditions are described in detail in literature (i.e., J. Sambrook et al., Molecular
WO 2015/163718 PCT/KR2015/004087
7
Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring
Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John
Wiley & Sons, Inc., New York).
In the present invention, it was confirmed that when NCgl2523, which constitutes an
NCgl2522 operon, was deleted in a microorganism of genus Corynebacterium having putrescine
productivity, putrescine production increased, similarly to when NCgl2522 activity was
enhanced. In this regard, the present invention may provide a recombinant microorganism
showing putrescine production at a high yield by inhibiting NCgl2522 expression resulting from
inactivating NCgl2523 activity. Therefore, as disclosed in the embodiment of the present
invention, by inactivating the corresponding NCgl2523 and genes encoding amino acids similar
thereto, putrescine productivity may be enhanced in a microorganism having amino acids having
sequences similar to that of NCgl2523, in which such amino acids consist of NCgl2522 and an
operon, or a microorganism in which NCgl2523 acts similarly as an NCgl2522 expression
modulator.
As used herein, the term "inactivation" refers to not expressing a gene encoding a
corresponding polypeptide, showing a certain reduction in gene expression, not producing a
corresponding functional polypeptide, even when expressed.
In addition, inactivation refers not only to completely inactivating a gene encoding a
corresponding polypeptide, but also to a weakened or significantly reduced expression compared
to the wild-type, thereby practically not expressing the gene. Therefore, gene inactivation may
be complete (knockout) or partial (for example, a hypomorph which shows gene expression
below the normal level, or a product of a mutant gene which shows partial reduction in activity
in effect of a hymorph).
WO 2015/163718 PCT/KR2015/004087
8
In particular, in the present invention, inactivation of NCgl2523 may be induced by:
1) a partial or complete deletion of a polynucleotide encoding the protein;
2) modification of a regulatory sequence to decrease an expression of the
polynucleotide;
3) modification of the polynucleotide sequence on chromosome in order to weaken the
protein activity; and
4) a combination thereof,
without being particularly limited thereto.
1) a partial or complete deletion of a polynucleotide encoding the protein may be
performed by replacing a polynucleotide encoding endogenous target proteins or chromosomes
with a partially removed polynucleotide or a marker gene using a vector for chromosomal
insertion into a microorganism. The "partial" may vary depending on the type of
polynucleotides, but specifically refers to 1 to 300, more specifically to 1 to 100, and even more
specifically 1 to 50.
As used herein, the term “vector" refers to a DNA construct including a nucleotide
sequence encoding a desired protein, which is operably linked to an appropriate expression
regulatory sequence to express the desired protein in a suitable host cell. The regulatory
sequence includes a promoter that can initiate transcription, an optional operator sequence for
regulating the transcription, a sequence encoding a suitable mRNA ribosome-binding site, and a
sequence regulating the termination of transcription and translation. After the vector is
transformed into a suitable host cell, it can replicate or function independently of the host
genome, and can be integrated into the genome itself.
The vector used in the present invention is not particularly limited, as long as it is able to
WO 2015/163718 PCT/KR2015/004087
9
replicate in host cells, and any vector known in the art may be used. Examples of conventional
vectors may include a natural or recombinant plasmid, cosmid, virus, and bacteriophage. For
example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc.,
may be used as a phage vector or cosmid vector, and pBR types, pUC types, pBluescriptII types,
pGEM types, pTZ types, pCL types, pET types, etc., may be used as a plasmid vector. A vector
usable in the present invention is not particularly limited, and any known expression vector may
be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322,
pMW118, or pCC1BAC vector may be used.
Further, the polynucleotide encoding a desired protein in chromosomes may be replaced
by a mutated polynucleotide using a vector for chromosomal insertion. The insertion of the
polynucleotide into the chromosome may be performed by any method known in the art such as
homologous recombination, without being particularly limited thereto.
As used herein, the term “transformation” refers to introduction of vectors including a
polynucleotide encoding target proteins into host cells so that proteins encoded by the
polynucleotide are expressed in host cells. As long as the transformed polynucleotide can be
expressed in a host cell, it includes all whether it is integrated into chromosomes of host cells or
exists extrachromosomally. Further, the polynucleotide includes DNA and RNA encoding
target proteins. The polynucleotide may be introduced in any form, as long as it can be
introduced into host cells and expressed therein. For example, the polynucleotide may be
introduced into host cells in the form of an expression cassette which is a gene construct
including all elements required for its autonomous expression. Typically, the expression
cassette includes a promoter operably linked to the polynucleotide, transcriptional termination
signals, ribosome-binding sites, or translation termination signals. The expression cassette may
WO 2015/163718 PCT/KR2015/004087
10
be in the form of a self-replicable expression vector. Also, the polynucleotide may be
introduced into host cells as it is and operably linked to sequences required for expression in host
cells, without being limited thereto.
Further, the term "operably linked" refers to a functional linkage between a
polynucleotide sequence encoding desired proteins and a promoter sequence which initiates and
mediates transcription of the polynucleotide sequence.
Next, 2) modification of a regulatory sequence to decrease an expression of the
polynucleotide may be performed by inducing modification in a regulatory sequence by deletion,
insertion, non-conservative or conservative substitution, or a combination thereof in a nucleotide
sequence or replacing with a nucleotide with a weaker activity, in order to weaken the activity of
the regulatory sequence, without being particularly limited thereto. The regulatory sequence
may include a promoter, an operator sequence, a sequence encoding ribosome-binding site, and a
sequence regulating termination of transcription and translation, without being limited thereto.
Further, 3) modification of the polynucleotide sequence on chromosome may be
performed by inducing modification in a regulatory sequence deletion, insertion,
non-conservative or conservative substitution, or a combination thereof in a nucleotide sequence,
or replacing with a nucleotide with a weaker activity, in order to weaken the protein activity,
without being limited thereto,
As used herein, the term "a microorganism having putrescine productivity " or "a
microorganism producing putrescine" refers to a microorganism naturally having putrescine
productivity or a microorganism, in which putrescine productivity is incorporated into a parent
strain having no putrescine productivity.
The microorganism producing putrescine may be, without being particularly limited
WO 2015/163718 PCT/KR2015/004087
11
thereto, a microorganism having improved productivity of ornithine to be used as a raw material
for putrescine biosynthesis, in which the microorganism is modified to have higher activities of
acetylglutamate synthase converting glutamate to acetylglutamate (N-acetylglutamate) or
ornithine acetyltransferase (ArgJ) converting acetyl ornithine to ornithine, acetylglutamate kinase
(ArgB) converting acetyl glutamate to acetylglutamyl phosphate (N-acetylglutamyl phosphate),
acetyl-gamma-glutamyl phosphate reductase (ArgC) converting acetyl glutamyl phosphate to
acetyl glutamate semialdehyde (N-acetyl glutamate semialdehyde), or acetylornithine
aminotransferase (ArgD) converting acetyl glutamate semialdehyde to acetylornithine
(N-acetylornithine), compared to the endogenous activity, in order to enhance the biosynthesis
pathway from glutamate to ornithine glutamate.
Further, the microorganism is modified to inactivate endogenous activity of ornithine
carbamoyltransfrase (ArgF) involved in arginine synthesis from ornithine, glutamate exporter
(NCgl1221), and/or acetyltransferase which acetylizes putrescine and/or is modified to introduce
activity of ornithine decarboxylase (ODC).
Here, the ornithine carbamoyltransfrase(ArgF), glutamate exporter (NCgl1221),
ornithine decarboxylase(ODC), acetyl-gamma-glutamyl-phosphate reductase (ArgC), acetyl
glutamate synthase or ornithineacetyltransferase (ArgJ), acetylglutamate kinase (ArgB), and
acetylornithine aminotransferase (ArgD), may include specifically an amino acid sequence each
represented by SEQ ID NO: 8, 9, 10, 11, 12, 13, and 14 or an amino acid sequence having 70%
or more, more specifically 80% or more, even more specifically 90% or more homology to the
sequence, without being particularly limited thereto.
Further, an acetyltransferase, which acetylizes putrescine, may include specifically an
amino acid sequence represented by SEQ ID NO: 15 or 16 or an amino acid sequence having 70%
WO 2015/163718 PCT/KR2015/004087
12
or more, more specifically 80% or more, even more specifically 90% or more homology to the
sequence, without being particularly limited thereto.
In particular, an increase in activity in the present invention may be carried out by:
1) an increase in the copy number of polynucleotides encoding the enzyme;
2) modification of a regulatory sequence to increase the polynucleotide expression;
3) modification of a polynucleotide sequence on chromosome to enhance activity of the
enzyme; or
4) modification to enhance by a combination thereof,
without being limited thereto.
1) an increase in the copy number of polynucleotides may be performed in the form
operably liked to a vector, or by chromosomal insertion into host cells, without being particularly
limited thereto. In particular, it may be performed by introducing a vector, to which a
polynucleotide encoding an enzyme of the present invention enzyme operably linked and which
may be copied and function independently of host cells into host cells, or by introducing a vector
to which the polynucleotide is operably linked and which is able to insert the polynucleotide into
choromosomes in host cells into host cells, thereby increasing the copy number of
polynucleotides in chromosomes of the host cells.
Next, 2) modification of a regulatory sequence to increase the polynucleotide expression
may be performed by inducing modification in a sequence by deletion, insertion,
non-conservative or conservative substitution or a combination thereof, or replacing with a
nucleotide sequence with enhanced activity, in order to enhance the activity the regulatory
sequence, without being particularly limited thereto. The regulatory sequence may include a
promoter, an operator sequence, a sequence encoding a ribosome-binding site, a sequence
WO 2015/163718 PCT/KR2015/004087
13
regulating termination of transcription and translation, etc., without being particularly limited
thereto.
In the upstream of the polynucleotide expression unit, a strong heterologous promoter
may be linked instead of the original promoter. Examples of the strong promoter are CJ7
promoter, lysCP1 promoter, EF-Tu promoter, groEL promoter, aceA or aceB promoter, etc., and
more specifically, may be operably linked to a Corynebacterium-originated promoter, lysCP1
promoter (WO2009/096689), or CJ7 promoter (KR Patent No. 0620092 and WO2006/065095)
and increase an expression of a polynucleotide encoding the enzyme, but are not limited thereto.
Furthermore, 3) modification of a polynucleotide sequence on chromosome may be
performed by inducing modification in a regulatory sequence by deletion, insertion,
non-conservative or conservative substitution or a combination there of in a nucleotide sequence,
or by replacing with a polynucleotide sequence which is modified to have enhanced activity, in
order to enhance activity of the polynucleotide sequence, without being particularly limited
thereto.
Further, inactivation of ornithine carbamoyltransfrase (ArgF), glutamate exporter, and
acetyl transferase may be performed by methods of inactivating NCgl2523 as previously
mentioned:
1) a partial or complete deletion of a polynucleotide encoding the protein;
2) modification of a regulatory sequence to decrease an expression of the
polynucleotide;
3) modification of the polynucleotide sequence on chromosome in order to weaken the
protein activity; and
4) a combination thereof,
WO 2015/163718 PCT/KR2015/004087
14
without being particularly limited thereto.
Meanwhile, a microorganism of the present invention is a microorganism having
putrescine productivity and includes prokaryotic microorganisms expressing proteins including
an amino acid represented by SEQ ID NO: 2. Examples of such are Escherichia sp., Shigella
sp., Citrobacter sp., Salmonella sp., Enterobacter sp., Yersinia sp., Klebsiella sp., Erwinia sp.,
Corynebacterium sp., Brevibacterium sp., Lactobacillus sp., Selenomanas sp., Vibrio sp.,
Pseudomonas sp., Streptomyces sp., Arcanobacterium sp., Alcaligenes sp. microorganisms, etc.
In particular, a microorganism of the present invention may be a microorganism of genus
Corynebacterium, and more specifically Corynebacterium glutamicum, but is not limited thereto.
In one exemplary embodiment, the present invention uses strains having
high-concentration putrescine productivity due to an enhanced putrescine biosynthesis pathway
from glutamate, which are microorganisms of genus Corynebacterium deposited under
Accession Nos. KCCM11138P (KR Patent No. 2012-0064046) and KCCM11240P (KR Patent
No. 2012-0003634).
In another exemplary embodiment, the present invention uses KCCM11138P and
KCCM11240P, which are putrescine-producing strains derived from Corynebacterium
glutamicum ATCC13032, and DAB12-a (KR Patent No. 2013-0082478) and DAB12-b (KR No.
2013-0082478; DAB12-a △NCgl1469), which are putrescine-producing strains derived from
Corynebacterium glutamicum ATCC13869, each having identical genotypes. ATCC13869
strain may be obtained from American Type Culture Collection (ATCC).
In particular, the present inventors named a microorganism of genus Corynebacterium
having enhanced putrescine productivity due to inactivation of NCgl2523 activity in
WO 2015/163718 PCT/KR2015/004087
15
Corynebacterium glutamicum KCCM11240P, which is a putrescine-producing strain, as
Corynebacterium glutamicum CC01-0844, and deposited it to Korean Culture Center of
Microorganisms (KCCM) under Budapest Treaty as Accession No. KCCM11520P on February
25, 2014.
In another aspect, the present invention provides a method of producing putrescine
including:
i) culturing a microorganism of genus Corynebacterium having enhanced putrescine
productivity wherein a protein having an amino acid sequence represented by SEQ ID NO: 2 is
inactivated in a culture medium; and
ii) separating putrescine from the cultured microorganism or the culture medium
obtained from the above step.
In the method, culturing the microorganism may be performed by known batch culturing
methods, continuous culturing methods, fed-batch culturing methods, etc., without being
particularly limited thereto. Here, culture conditions may be maintained at optimal pH (e.g., pH
5 to 9, specifically pH 6 to 8, and most specifically pH 6.8) using basic compounds (e.g., sodium
hydroxide, potassium hydroxide, or ammonia) or acidic compounds (e.g., phosphoric acid or
sulfuric acid), and at an aerobic condition by oxygen or oxygen-containing gas mixture to a cell
culture, without being particularly limited thereto. The culture temperature may be maintained
at 20°C to 45°C and specifically at 25°C to 40°C, and cultured for about 10 to 160 hours.
Putrescine produced by the cultivation may be exported to the culture medium or remain in cells.
Further, the used culture medium may include sugar and carbohydrate (e.g., glucose,
sucrose, lactose, fructose, maltose, molasse, starch, and cellulose), oil and fat (e.g., soybean oil,
sunflower seed oil, peanut oil, and coconut oil), fatty acid (e.g., palmitic acid, stearic acid, and
WO 2015/163718 PCT/KR2015/004087
16
linoleic acid), alcohol (e.g., glycerol and ethanol), and organic acid (e.g., acetic acid)
individually or in combination as a carbon source; nitrogen-containing organic compounds (e.g.,
peptone, yeast extract, meat juice, malt extract, corn solution, soybean meal powder, and urea),
or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate,
ammonium carbonate, and ammonium nitrate) individually or in combination as a nitrogen
source; potassium dihydrogen phosphate, dipotassium phosphate, or sodium-containing salt
corresponding thereto individually or in combination as a phosphorus source; and other essential
growth-stimulating substances including metal salts (e.g., magnesium sulfate or iron sulfate),
amino acids, and vitamins, without being limited thereto.
Separating putrescine produced in the culturing step of the present invention may be
performed using a suitable method known in the art depending on culturing methods such as
batch, continuous or fed-batch culturing methods, etc., thereby collecting desired amino acids
from the culture.
Advantageous Effects
A microorganism of genus Corynebacterium having enhanced putrescine productivity of
the present invention is modified to inactivate activity of a protein including an amino acid
sequence of SEQ ID NO: 2, thereby inducing enhanced activity of a protein which is expected to
be a putrescine exporter, specifically NCgl2522, and increasing putrescine export to the outside
of cells, and thus may effectively produce putrescine.
WO 2015/163718 PCT/KR2015/004087
17
Description of Drawings
Fig. 1 is a schematic diagram showing combined structures of NCgl2523 and the
adjacent. In particular, Fig. 1 is a schematic diagram showing a combined structure of
NCgl2522-NCgl2523-NCgl2524 which is a combined structure of adjacent genes of a
microorganism including NCgl2523 (Type 1); a structure of combined NCgl2522-NCgl2523 and
individual NCgl2524 (Type 2); or a combined structure of NCgl2522-NCgl2523 (Type 3).
Mode for Invention
Hereinafter, the present invention will be described in more detail with reference to
Examples. However, the Examples are for illustrative purposes only, and thus the scope of the
present invention is not intended to be limited by the Examples.
Example 1: Preparation of NCgl2523-deleted strains and verification of its putrescine
productivity
<1-1> Preparation of NCgl2523-deleted strains in ATCC13032-derived
putrescine-producing strains
In order to verify whether deletion of NCgl2523 derived from Corynebacterium
glutamicum ATCC13032 has an effect in putrescine productivity, vectors for deletion of a gene
encoding NCgl2523 were prepared.
In particular, based on the nucleotide sequence of a gene encoding NCgl2523
represented by SEQ ID NO: 1, a pair of primers of SEQ ID NOs: 4 and 5 for obtaining
homologous recombination fragments at the N-terminal region of NCgl2523, and a pair of
primers of SEQ ID NOs: 6 and 7 for obtaining homologous recombination fragments at the
WO 2015/163718 PCT/KR2015/004087
18
C-terminal region of NCgl2523 were constructed as shown in Table 1.
【Table 1】
NCgl2523-del-F1_BamHI
(SEQ ID NO: 4)
CGGGATCCATGACTACCTCGCAGCGTTTC
NCgl2523-del-R1_SalI
(SEQ ID NO: 5)
ACGCGTCGACCTAGTGCGCATTATTGGCTCC
NCgl2523-del-F2_SalI
(SEQ ID NO: 6)
ACGCGTCGACAGCCATGCTGGAAACAATTCTCG
NCgl2523-del-R2_XbaI
(SEQ ID NO: 7)
CTAGTCTAGAGAGAGCTGCGCATAGTACTG
PCR was performed using the genomic DNA of Corynebacterium glutamicum
ATCC13032 as a template and two pairs of primers, thereby amplifying PCR fragments at the
N-terminal and C-terminal regions of NCgl2523 gene. Desired fragments were obtained via
electrophoresis of the PCR fragments. Here, PCR reaction was repeated for 30 cycles including
30 seconds of denaturation at 95°C, 30 seconds of annealing at 55°C, and 30 seconds of
extension at 72°C. The thus obtained fragments of the N-terminal and C-terminal regions were
treated with restriction enzymes BamHI and SalI, and restriction enzymes SalI and XbaI,
respectively. The treated fragments were cloned into pDZ vectors treated with restriction
enzymes BamHI and XbaI, thereby constructing pDZ-1'NCgl2523(K/O)plasmids.
The pDZ-1'NCgl2523 (K/O) plasmids were each transformed into KCCM11138P (KR
WO 2015/163718 PCT/KR2015/004087
19
Patent No. 10-1348461) and KCCM11240P (KR Patent No. 2013-0082478) by electroporation
to obtain transformants. For colony formation, the transformants were plated and cultured on
BHIS plate media (Braine heart infusion (37 g/L), sorbitol (91 g/L), and agar (2%)) containing
kanamycin (25 μg/mL) and X-gal(5-bromo-4-chloro-3-indolin--D-galactoside). From the formed
colonies, blue colonies were selected as strains introduced with pDZ-1'NCgl2523(K/O)
plasmids.
The selected strains is cultured in a CM medium (glucose 10 g/L, polypeptone (10 g/L),
yeast extract (5 g/L), beef extract (5 g/L), NaCl (2.5 g/L), urea (2 g/L), and pH 6.8) at 30°C for 8
hours. After serial dilution of each cell culture from 10-4 to 10-10, the diluted samples were
plated and cultured in an X-gal-containing solid medium to form colonies. From the formed
colonies, white colonies, which appeared at a relatively low frequency, were finally selected as
strains with deletion of a gene encoding NCgl2523 by a secondary crossover.
PCR was performed using a pair of primers of SEQ ID NOs: 4 and 7 to confirm deletion
of a gene encoding NCgl2523 in the finally selected strains. The Corynebacterium glutamicum
mutants were each named as KCCM11138P △NCgl2523 and KCCM11240P △NCgl2523.
<1-2> Preparation of NCgl2523-deleted strains in ATCC13869-derived
putrescine-producing strains
NCgl2523-deleted strains were constructed from DAB12-a (KR Patent No.
2013-0082478) and DAB12-b (KR Patent No. 2013-0082478; DAB12-a △NCgl1469), which are
putrescine-producing strains derived from Corynebacterium glutamicum ATCC13869.
In particular, in order to verify a sequence of NCgl2523 gene and the expressed protein
therefrom derived from Corynebacterium glutamicum ATCC13869, PCR was performed using
WO 2015/163718 PCT/KR2015/004087
20
genomic DNA of Corynebacterium glutamicum ATCC13869 as a template and a pair of primers
of SEQ ID NOs: 4 and 7. Here, PCR reaction was repeated for 30 cycles including 30 seconds
of denaturation at 95°C, 30 seconds of annealing at 55°C, and 1 minute 30 seconds of extension
at 72°C
By separating the thus obtained PCR products via electrophoresis and analyzing by
sequencing, a gene encoding NCgl2523 derived from Corynebacterium glutamicum
ATCC13869 was found to include a nucleotide sequence represented by SEQ ID NO: 3.
Further, an amino acid sequence of proteins encoded by the gene was compared to an amino acid
sequence of NCgl2523 (SEQ ID NO: 2) derived from Corynebacterium glutamicum
ATCC13032, and the result showed 100% homology.
In order to delete a gene encoding NCgl2523 derived from Corynebacterium
glutamicum ATCC13869, PCR was performed using genomic DNA of Corynebacterium
glutamicum ATCC13869 as a template and two pairs of primers described in Table 1 as in
Example <1-1>, and PCR fragments of the N-terminal C-terminal regions of NCgl2523 gene
were amplified, thereby obtaining desired fragments via electrophoresis. Here, PCR reaction
was repeated for 30 cycles including 30 seconds of denaturation at 95°C, 30 seconds of
annealing at 55°C, and 30 seconds of extension at 72°C. The obtained fragments of the
N-terminal and C-terminal regions were treated with restriction enzymes BamHI and SalI, and
restriction enzymes SalI and XbaI, respectively. The treated fragments were cloned into pDZ
vectors treated with restriction enzymes BamHI and XbaI, thereby constructing
pDZ-2'NCgl2523(K/O) plasmids.
By transforming pDZ-2'NCgl2523 (K/O) into each of Corynebacterium glutamicum
DAB12-a and DAB12-b in the same manner as described in Example <1-1>, strains with
WO 2015/163718 PCT/KR2015/004087
21
deletion of a gene encoding NCgl2523 were selected. The selected Corynebacterium
glutamicum mutants were named as DAB12-a △NCgl2523 and DAB12-b △NCgl2523.
<1-3> Evaluation of putrescine productivity of NCgl2523-deleted strains
In order to verify the effects of NCgl2523 deletion on putrescine production in
putrescine-producing strains, Corynebacterium glutamicum mutants constructed in Example
<1-1> and <1-2> were compared for putrescine productivity.
In particular, 4 different types of Corynebacterium glutamicum mutants (KCCM11138P
△NCgl2523, KCCM11240P △NCgl2523, DAB12-a △NCgl2523, and DAB12-b △NCgl2523) and
4 different types of parent strains (KCCM11138P, KCCM11240P, DAB12-a, and DAB12-b)
were each plated on 1 mM arginine-containing CM plate media (1% glucose, 1% polypeptone,
0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2% urea, 100 μL of 50% NaOH, and 2%
agar, at pH 6.8, base on 1 L) and cultured at 30°C for 24 hours. After inoculating each of the
cultured stains using a platinum loop in 25 mL of titer media (8% Glucose, 0.25% soybean
proteins, 0.50% corn steep solids, 4% (NH4)2SO4, 0.1% KH2PO4, 0.05% MgSO4ㆍ7H2O, 0.15%
urea, 100 g of biotin, 3 mg of thiamine hydrochloride, 3 mg of calcium-pantothenic acid, 3 mg of
nicotinamide, and 5% of CaCO3, based on 1 L), shake culturing was carried out at 30°C and 200
rpm for 98 hours. 1 mM arginine was added to the media for culturing all strains. The
concentration of putrescine produced from each culture was measured, and results are shown in
Table 2.
【Table 2】
Strain Putrescine (g/L)
KCCM11138P 9.8
WO 2015/163718 PCT/KR2015/004087
22
KCCM11138P △NCgl2523 11.8
KCCM11240P (-) 12.4
KCCM11240P △NCgl2523 14.9
DAB12-a 10.2
DAB12-a △NCgl2523 12.2
DAB12-b 13.1
DAB12-b △NCgl2523 15.2
As shown in Table 2, putrescine production was increased in 4 kinds of
NCgl2523-deleted Corynebacterium glutamicum mutants.
Example 2: Measurement of intercellular putrescine concentrations in
NCgl2523-deleted strains
To examine changes in intercellular putrescine concentration in Corynebacterium
glutamicum mutants having inactivated NCgl2523 activity, intercellular putrescine
concentrations were measured in Corynebacterium glutamicum mutant KCCM11240P
△NCgl2523 and parent strain KCCM11240P by extraction using an organic solvent.
Intracellular metabolite analysis was carried out in accordance with a method described in
literature (Nakamura J et al., Appl. Environ. Microbiol., 73(14): 4491-4498, 2007).
First, after inoculating each of Corynebacterium glutamicum mutant KCCM11240P
△NCgl2523 and parent strain KCCM11240P in 25ml of 1 mM arginine-containing CM liquid
media (1% glucose, 1% polypeptone, 0.5% yeast extract, 0.5% beef extract, 0.25% NaCl, 0.2%
urea, and 100 μL of 50% NaOH, at pH 6.8, based on 1 L), shake culturing was carried out at
WO 2015/163718 PCT/KR2015/004087
23
30°C and 200 rpm. When cell growth reached the exponential phase during cultivation, cells
were isolated from the culture media by rapid vacuum filtration (Durapore HV, 0.45 m;
Millipore, Billerica, MA). The cell-adsorbed filter was washed twice with 10 ml of cooled
water and emerged in methanol-containing 5 M morpholine ethanesulfonic acid and 5 M
methionine sulfone for 10 minutes. The extraction liquid obtained therefrom was mixed well
with an equal volume of chloroform and 0.4-fold volume of water. Only the aqueous phase was
applied to a spin column to remove protein contaminants. The filtered extraction liquid was
analyzed by capillary electrophoresis mass spectrometry, and the results are shown in Table 3.
【Table 3】
Strain Putrescine (mM)
KCCM11240P 7
KCCM11240P △NCgl2523 1
As shown in Table 3, the intercellular putrescine concentration was significantly reduced
in Corynebacterium glutamicum mutants having inactivated NCgl2523 activity compared to that
of parent strain KCCM11240P.
It is suggested that when NCgl2523 is deleted in Corynebacterium glutamicum mutant
KCCM11240P, inhibition of NCgl2522 expression is withdrawn and NCgl2522 activity is
enhanced, thereby enhancing putrescine-exporting ability and subsequently exporting putrescine
produced inside the cell to the outside of cells efficiently.
Example 3: Ortholog search of NCgl2523 gene and gene context analysis
Ortholog search was conducted for NCgl2523, which is derived from Corynebacterium
WO 2015/163718 PCT/KR2015/004087
24
glutamicum ATCC13032, using KEGG, MetaCyc Database and NCBI blastP. Via gene cluster,
a combined structure of NCgl2523, and NCgl2522 and NCgl2524, which constitute an operon in
the genome of each microorganism was examined.
The gene name of NCgl2522 is cgmA, which is a major facilitator superfamily permease
belonging to DHA2 family, and the gene name of NCgl2523 is cgmR, which is TetR-family
transcriptional regulator. NCgl2524 has not been attributed with a function, but is a major
facilitator superfamily permease belonging to UMF1 family.
According to the analysis results, while NCgl2522 and NCgl2523 mostly constitute the
same operon, NCgl2524 may be present in the same operons (Type 1), present in a different
position in the genome (Type 2), or not present in the genome (Type 3), depending on
microorganisms.
In this regard, each of analyzed microorganisms was classified into 3 types according to
a combined structure of genes adjacent to NCgl2523. In particular, microorganisms which are
expected to have NCgl2523 were classified into a combined structure of
NCgl2522-NCgl2523-NCgl2524 (Type 1); a structure of combined NCgl2522-NCgl2523 and
individual NCgl2524 (Type 2); or a combined structure of NCgl2522-NCgl2523 (Type 3) (Fig.
1). The classification results are shown in Table 4.
Table 4
Type Combined
structure
Corresponding microorganisms
Microorganism
having
Acidovorax avenae, Actinobaculum sp., Actinomyces sp.,
Actinomyces vaccimaxillae, Actinoplanes missouriensis,
WO 2015/163718 PCT/KR2015/004087
25
NCgl2523 Actinosynnema mirum, Agrobacterium tumefaciens, alpha
proteobacterium, Amycolatopsis mediterranei, Amycolatopsis
orientalis, Arcanobacterium haemolyticum, Arthrobacter
aurescens, Arthrobacter sp., Bdellovibrio bacteriovorus,
Beutenbergia cavernae, Bordetella bronchiseptica, Bordetella
pertussis, Bordetella parapertussis, Brachybacterium
paraconglomeratum, Clavibacter michiganensis subsp.,
Corynebacterium atypicum, Corynebacterium callunae,
Corynebacterium casei, Corynebacterium diphtheriae,
Corynebacterium glutamicum, Corynebacterium glutamicum
AR1, Corynebacterium glutamicum ATCC 13032,
Corynebacterium glutamicum ATCC 13869, Corynebacterium
glutamicum ATCC 14067, Corynebacterium glutamicum ATCC
21831, Corynebacterium glutamicum K051, Corynebacterium
glutamicum MB001, Corynebacterium glutamicum R,
Corynebacterium glutamicum SCgG1, Corynebacterium
glutamicum SCgG2, Corynebacterium glycinophilum,
Corynebacterium maris, Corynebacterium pseudotuberculosis,
Corynebacterium sp. ATCC 6931, Corynebacterium
terpenotabidum, Corynebacterium ulcerans, Corynebacterium
urealyticum, Corynebacterium variabile, Corynebacterium
vitaeruminis, Dermabacter sp. HFH0086, Enterobacter cloacae
EcWSU1, Enterobacter sp. R4-368, Gammaproteobacteria,
WO 2015/163718 PCT/KR2015/004087
26
Granulicoccus phenolivorans, Hafnia alvei, Ilumatobacter
coccineus, Isoptericola variabilis, Janthinobacterium
agaricidamnosum, Ketogulonicigenium vulgare, Microbacterium
sp., Microbacterium testaceum, Micrococcus luteus,
Micromonospora aurantiaca, Micromonospora sp.,
Mycobacterium gilvum, Nakamurella multipartita, Nesterenkonia
alba, Nesterenkonia sp., Nocardia brasiliensis, Nocardia
cyriacigeorgica, Nocardia farcinica, Nocardiopsis dassonvillei,
Nocardiopsis , kunsanensis, Nocardiopsis sp., Nocardiopsis
valliformis, Nocardiopsis xinjiangensis, Ochrobactrum anthropi,
Ochrobactrum intermedium, Paracoccus aminophilus,
Paracoccus sp. 5503, Pectobacterium carotovorum subsp.
carotovorum PCC21, Promicromonospora sukumoe,
Propionibacterium acidipropionici, Propionibacterium
freudenreichii, Proteobacteria, Providencia stuartii ATCC 33672,
Pseudomonas aeruginosa, Pseudomonas cremoricolorata,
Pseudomonas geniculata, Pseudomonas stutzeri, pseudonocardia
dioxanivorans, Renibacterium salmoninarum, Rhodococcus equi,
Rhodococcus erythropolis, Rhodococcus jostii, Rhodococcus
opacus B4, Rhodococcus opacus PD630, Rhodococcus
pyridinivorans, Saccharomonospora viridis, Saccharopolyspora
erythraea, Salinispora, Salinispora arenicola, Salinispora
pacifica, Salinispora tropica, Sanguibacter keddieii, Serratia
WO 2015/163718 PCT/KR2015/004087
27
liquefaciens, Serratia marcescens, Serratia plymuthica, Serratia
proteamaculans, Serratia sp., Sodalis sp. HS1, Sphingobium
chinhatense, Stenotrophomonas maltophilia, Stenotrophomonas
sp., Streptococcus anginosus, Streptomyces, Streptomyces
alboviridis, Streptomyces albus, Streptomyces atroolivaceus,
Streptomyces baarnensis, Streptomyces cyaneofuscatus,
Streptomyces fulvissimus, Streptomyces globisporus,
Streptomyces griseus, Streptomyces mediolani, Streptomyces
scopuliridis, Streptomyces sp., Xanthomonas citri pv. citri,
Xenorhabdus nematophila, Yaniella halotolerans, Yersinia
enterocolitica
1 Combined
structure of
NCgl2522-NCgl
2523-NCgl2524
Corynebacterium callunae, Corynebacterium casei,
Corynebacterium glutamicum AR1, Corynebacterium glutamicum
ATCC 13032, Corynebacterium glutamicum ATCC 13869,
Corynebacterium glutamicum ATCC 14067, Corynebacterium
glutamicum ATCC 21831, Corynebacterium glutamicum K051,
Corynebacterium glutamicum MB001, Corynebacterium
glutamicum R, Corynebacterium glutamicum SCgG1,
Corynebacterium glutamicum SCgG2, Corynebacterium
vitaeruminis
2 Structure of
combined
Actinoplanes missouriensis, Actinosynnema mirum,
Amycolatopsis mediterranei, Amycolatopsis mediterranei,
WO 2015/163718 PCT/KR2015/004087
28
NCgl2522-NCgl
2523; individual
NCgl2524
Amycolatopsis orientalis, Arcanobacterium haemolyticum,
Arthrobacter aurescens, Arthrobacter sp., Bordetella
bronchiseptica, Bordetella parapertussis, Bordetella pertussis,
Clavibacter michiganensis, Corynebacterium glycinophilum,
Corynebacterium maris, Corynebacterium terpenotabidum,
Corynebacterium variabile, Isoptericola variabilis,
Microbacterium testaceum, Micromonospora aurantiaca,
Micromonospora sp. L5, Mycobacterium gilvum, Nakamurella
multipartita, Nocardia brasiliensis, Nocardia cyriacigeorgica,
Nocardia cyriacigeorgica, Nocardia farcinica, Nocardiopsis
dassonvillei, Nocardiopsis dassonvillei, Ochrobactrum anthropi,
Paracoccus aminophilus, Propionibacterium acidipropionici,
Pseudonocardia dioxanivorans, Renibacterium salmoninarum,
Rhodococcus equi, Rhodococcus pyridinivorans,
Saccharomonospora viridis, Saccharopolyspora erythraea,
Salinispora tropica, Streptomyces albus, Streptomyces
fulvissimus, Streptomyces griseus
3 Combined
structure of
NCgl2522-NCgl
2523
Acidovorax avenae, Bdellovibrio bacteriovorus, Beutenbergia
cavernae, Corynebacterium atypicum, Corynebacterium
diphtheriae, Corynebacterium pseudotuberculosis,
Corynebacterium ulcerans, Corynebacterium urealyticum,
Enterobacter cloacae, Enterobacter sp., Hafnia alvei,
Ilumatobacter coccineus, Janthinobacterium agaricidamnosum,
WO 2015/163718 PCT/KR2015/004087
29
Ketogulonicigenium vulgare, Pectobacterium carotovorum subsp.
carotovorum PCC21, Providencia stuartii, Pseudomonas
aeruginosa, Pseudomonas cremoricolorata, Pseudomonas
stutzeri, Sanguibacter keddieii, Serratia liquefaciens, Serratia
marcescens, Serratia plymuthica, Serratia proteamaculans,
Serratia sp., Sodalis sp. HS1, Stenotrophomonas maltophilia,
Xenorhabdus nematophila, Yersinia enterocolitica
From these results, it is expected that putrescine productivity may be enhanced as in the
present invention by inactivating genes encoding NCgl2523 and an amino acid sequence similar
thereto, for microorganisms having an amino acid including a sequence similar to NCgl2523 and
consisting of an operon with a protein expected to be a putrescine exporter, such as NCgl2522, as
in the classification.
Based on the above description, it should be understood by one of ordinary skill in the art
that other specific embodiments may be employed in practicing the invention without departing
from the technical idea or essential features of the present invention. In this regard, the
above-described examples are for illustrative purposes only, and the invention is not intended to
be limited by these examples. The scope of the present invention should be understood to include
all of the modifications or modified form derived from the meaning and scope of the following
claims or its equivalent concepts, rather than the above detailed description.
Deposit Designation
Depository Authority: Korea Culture Center of Microorganisms

CLAIM:
1. An isolated microorganism of genus Corynebacterium having putrescine productivity,
wherein a protein having an amino acid sequence represented by SEQ ID NO: 2 is inactivated.
2. The microorganism of genus Corynebacterium having putrescine productivity according
to claim 1, wherein an activity of ornithine decarboxylase (ODC) is further introduced into the
microorganism.
3. The microorganism of genus Corynebacterium having putrescine productivity according
to claim 2, wherein the ODC has an amino acid sequence represented by SEQ ID NO: 10.
4. The microorganism of genus Corynebacterium having putrescine productivity according
to claim 1, wherein acetyltransferase activity is further inactivated in the microorganism.
5. The microorganism of genus Corynebacterium having putrescine productivity according
to claim 4, wherein the acetyltransferase comprises an amino acid represented by SEQ ID NO:
15 or 16.
6. The microorganism of genus Corynebacterium having putrescine productivity according
to claim 1, wherein the microorganism is Corynebacterium glutamicum.
7. A method of producing putrescine, comprising:
WO 2015/163718 PCT/KR2015/004087
31
culturing a microorganism of genus Corynebacterium having putrescine productivity
wherein a protein having an amino acid sequence represented by SEQ ID NO: 2 is inactivated, in
a culture medium; and
separating putrescine from the cultured microorganism or the culture medium obtained
from the above step.
8. The method of producing putrescine according to claim 7, wherein the microorganism of
genus Corynebacterium is Corynebacterium glutamicum.