Abstract: This invention relates generally to quinoline-based modulators of Liver X receptors (LXRs) and related methods.
Ouinoline Compounds
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of United States Provisional Application No.:
60/852,588, filed on October 18, 2006, which is incorporated herein by reference in its
entirety.
TECHNICAL FIELD
This invention relates generally to quinoline-based modulators of Liver X receptors
(LXRs) and related methods.
BACKGROUND
Atherosclerosis is among the leading causes of death in developed countries. Some
of the independent risk factors associated with atherosclerosis include the presence of
relatively high levels of serum LDL cholesterol and relatively low levels of serum HDL
cholesterol in affected patients. As such, some anti-atherosclerotic therapy regimens include
the administration of agents (e.g., statins) to reduce elevated serum LDL cholesterol levels.
Agents that increase patient HDL cholesterol levels can also be useful in anti-
atherosclerotic therapy regimens. HDL cholesterol is believed to play a major role in the
transport of cholesterol from peripheral tissues to the liver for metabolism and excretion (this
process is sometimes referred to as "reverse cholesterol transport"). ABCA1 is a transporter
gene involved in HDL production and reverse cholesterol transport. Upregulation of ABCA1
can therefore result in increased reverse cholesterol transport as well as inhibition of
cholesterol absorption in the gut. In addition, HDL is also believed to inhibit the oxidation of
LDL cholesterol, reduce the inflammatory response of endothelial cells, inhibit the
coagulation pathway, and promote the availability of nitric oxide.
Liver X receptors (LXRs), originally identified in the liver as orphan receptors, are
members of the nuclear hormone receptor super family and are believed to be involved in the
regulation of cholesterol and lipid metabolism. LXRs are ligand-activated transcription
factors and bind to DNA as obligate heterodimers with retinoid X receptors. While LXRα is
generally found in tissues such as liver, kidney, adipose tissue, intestine and macrophages,
LXRβ displays a ubiquitous tissue distribution pattern. Activation of LXRs by oxysterols
(endogenous ligands) in macrophages results in the expression of several genes involved in
lipid metabolism and reverse cholesterol transport including the aforementioned ABCA1;
ABCG1;and ApoE.
Studies have been conducted in LXRα knock-out (k/o), LXRβ k/o and double k/o
mice to determine the physiological role of LXRs in lipid homeostasis and atherosclerosis.
The data from these studies suggested that in double k/o mice on normal chow diet, increased
cholesterol accumulation was observed in macrophages (foam cells) of the spleen, lung and
arterial wall. The increased cholesterol accumulation was believed to be associated with the
presence of reduced serum HDL cholesterol and increased LDL cholesterol, even though the
total cholesterol levels in the mice were about normal. While LXRα k/o mice did not appear
to show significant changes in hepatic gene expression, LXRβ k/o mice showed 58%
decrease in hepatic ABCA1 expression and 208% increase in SREBP1c expression
suggesting that LXRβ may be involved in the regulation of liver SREBP1c expression.
Data obtained from studies employing two different atherosclerotic mouse models
(ApoE k/o and LDLR k/o) suggest that agonists of LXRα or β can be relatively effective in
upregulating ABCA1 expression in macrophages. For example, inhibition of atherosclerotic
lesions could be observed when ApoE k/o and LDLR k/o mice were treated with LXRα or β
agonists for 12 weeks. The tested agonists were observed to have variable effects on serum
cholesterol and lipoprotein levels and appeared to cause a relatively significant increase in
serum HDL cholesterol and triglyceride levels. These in vivo data were found to be
consistent with in vitro data obtained for the same agonists in macrophages.
In addition to the lipid and triglyceride effects described above, it is also believed that
activation of LXRs results in the inhibition of inflammation and proinflammatory gene
expression. This hypothesis is based on data obtained from studies employing three different
models of inflammation (LPS-induced sepsis, acute contact dermatitis of the ear and chronic
atherosclerotic inflammation of the artery wall). These data suggest that LXR modulators can
mediate both the removal of cholesterol from the macrophages and the inhibition of vascular
inflammation.
SUMMARY
This invention relates generally to quinoline-based modulators of LXRs and related
methods and compositions.
In one aspect, this invention features a compound having formula (I):
wherein:
R1 hydrogen, C1-C6 alkyl, NH2, NH(C1-C6 alkyl), orN(C1-C6 alkyl)2;
R2is:
(i) hydrogen, cyano, or halo; or
(ii) C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally substituted with from
1-5 Ra; or
(iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally
substituted with from 1-10 Rb; or
(iv) C2-C12 alkcnyl or C2-C12 alkynyl, each of which is optionally substituted with
from 1-10 Rc;
(v) C3-C10 cycloalkyl, heterocyclyl including 3-10 atoms, or heterocycloalkenyl
including 3-10 atoms, each of which is optionally substituted with from 1-5 Rb; or
(vi) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd; or
(vii) -XR8, wherein:
X is -C(O)-; -O-; -S(O),-, wherein t is 0-2; -NR9-; -C(O)NR9-; -C(NH)NR9; -C(O)O-;
-CH2O-; -NR9SO2-; or -SO2NR9-, wherein R9 is hydrogen or C1-C6 alkyl; and
R8is:
(i) hydrogen; or
(ii) C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally substituted with from
1-5 Ra; or
(iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally
substituted with from 1-10 Rb; or
(iv) C2-C12 alkenyl or C2-C12 alkynyl, each of which is optionally substituted with
from 1-10 Rc;
(v) C3-C10 cycloalkyl or heterocyclyl including 3-10 atoms, each of which is
optionally substituted with from l-5Rfc; or
(vi) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1 -10 Rd;
R3 is C6-C18 (e.g., C6-C14) aryl or heteroaryl including 5-16 (e.g., 5-14) atoms, each of
which is:
(i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) R10, and
(ii) optionally substituted with from 1-4 Rc; wherein:
R10 is WA, wherein:
W at each occurrence is, independently, a bond; -O-; -S(O)t-, wherein t is 0-2;
-NR9-; -C(O)NR9-; C1-6 alkylene; or C2-6 alkynylene; -W1(C1-6 alkylene)-; or -(C1-6
alkylene)W1-;
W1 at each occurrence is, independently, -O-; -S(O)t-, wherein t is 0-2;
-NR9-; -C(O)NR9-; or C2-6 alkynylene; and
A at each occurrence is, independently:
(i) C6-C10 aryl, which is:
(a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) Rt; and
(b) optionally substituted with from 1-4 Re;
or
(ii) heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) Rf or includes
a substituted ring atom selected from the group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1 -4 Rc;
provided that the heteroaryl including 5-10 atoms is not [1,2,4]-oxadiazolyl;
or
(iii) arylazacyclyl including 8-12 atoms, each of which is:
(a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, or 1, e.g., 1-2) Rf, and
(b) optionally substituted with from 1-4 Re;
or
(iv) arylsulfinylcyclyl, heteroarylsulfinylcyclyl, arylsulfonylcyclyl or
heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with
from 1-4 Rc;
or
(v) [1,2,4]-oxadiazolyl, optionally substituted with from 1 Rc;
each of R4, R5, R6, and R7 is, independently:
(i) hydrogen; or
(ii) Rc; or
(iii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted v/ith
from 1-10 Ra; or
(iv) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(v) C7-C20 aralkyl or hcteroaralkyl, each of which is optionally substituted with from
1-10 Rb;
Rd at each occurrence is, independently:
(i) NRgRh; nitro; azido; hydroxy; oxo; thioxo; =NR'; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20
cycloalkcnyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including
3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20
thioalkoxy; C1-C20 thiohaloalkoxy; C6-C18 thioaryloxy or thioheteroaryloxy including 5-16
atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy.
thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy
including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -
NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORg)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms,
heterocycloalkenyl including 3-20 atoms, arylheterocyclyl including 8-20 atoms, or
heteroarylheterocyclyl including 8-20 atoms, each of which is optionally substituted with
from 1-10 Rh;
Ra at each occurrence is, independently, NR8Rh; nitro; azido; hydroxy; oxo; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -
NRkC(O)Rj; -C(NR;)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; -P(O)(ORg)(ORh); C3-C20 cycloalkyl, C3-C20 cycloalkenyl,
heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms;
Rb at each occurrence is, independently:
(i) halo; NRgRb; nitro; azido; hydroxy; oxo; thioxo; =NRi; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20
cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including
3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20
thioalkoxy; C1-C20 thiohaloalkoxy; C6-C18 thioaryloxy or thioheteroaryloxy including 5-16
atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy,
thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy
including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgR1; -
NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORg)(ORh); or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1 -10 Rd; or
(v) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-
10 Rb';
Rb at each occurrence is, independently, Ra; halo; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10
Ra; C2-C20 alkenyl; C2-C20 alkynyl; or C6-C18 aryl or heteroaryl including 5-16 atoms, each of
which is optionally substituted with from 1-10 Rd;
Rc at each occurrence is, independently:
(i) halo; NRgRh; nitro; azido; hydroxy; oxo; thioxo; —NR1; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20
cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including
3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20
thioalkoxy; C1-C20 thiohaloalkoxy; C6-C18 thioaryloxy or thioheteroaryloxy including 5-16
atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy,
thiohcteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy
including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -
NRkC(O)Rj; -C(NRj)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORi; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORg)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-
10Rb;or
(iii) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd;
Rd at each occurrence is, independently:
(i) halo; NRgRh; nitro; azido; hydroxy; C1-C20 alkoxy or C1-C20 haloalkoxy, each of
which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or heteroaryloxy including
5-16 atoms, each of which is optionally substituted with from 1-10 Rd ; C7-C20 aralkoxy,
heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20 cycloalkenyloxy,
heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each
of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20 thioalkoxy; C1-C20
thiohaloalkoxy; C6-C18 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which
is optionally substituted with from 1-10 Rd ; C7-C20 thioaralkoxy, thiohetcroaralkoxy
including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20 thiocycloalkenyloxy,
thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20
atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -C(O)Rj, -C(O)ORj;
-OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -NRkC(O)Rj; -C(NR)Rj; -
OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm;
or -P(O)(ORg)(ORh);
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C7-C20 aralkyl, heteroaralkyl including 6-20 atoms, C3-C20 cycloalkyl, C3-C20
cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms,
each of which is optionally substituted with from 1-10 R°; or
(v) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd;
Rd at each occurrence is, independently, halo; NRgRh; nitro; azido; hydroxy; C1-C20
alkyl, C1-C20 haloalkyl, C2-C20 alkenyl; C2-C20 alkynyl; C3-C20 cycloalkyl; C3-C20
cycloalkenyl, heterocyclyl including 3-20 atoms; heterocycloalkenyl including 3-20 atoms;
C7-C20 aralkyl; heteroaralkyl including 6-20 atoms; C1-C20 alkoxy; C1-C20 haloalkoxy; C6-C18
aryloxy; heteroaryloxy; C7-C20 aralkoxy; heteroaralkoxy including 6-20 atoms; C3-C16
cycloalkoxy; C3-C20 cycloalkenyloxy; heterocyclyloxy including 3-20 atoms;
heterocycloalkenyloxy including 3-20 atoms; mercapto; C1-C20 thioalkoxy; C1-C20
thiohaloalkoxy; C6-C18 thioaryloxy; thioheteroaryloxy including 5-16 atoms; C7-C20
thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thiohctcrocycloalkcnyloxy
including 3-20 atoms; cyano; -C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -
SC(S)Rj; -C(O)NRgRh; -NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -
NRkC(O)ORj; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh);
Re at each occurrence is, independently, C1-C6 alkyl, optionally substituted with from
1-3 Ra; C1-C6 haloalkyl; phenyl; 4-fluorophenyl; halo; hydroxyl; NRgRh; nitro; C2-C6 alkenyl;
C2-C6 alkynyl; C1-C6 alkoxy; C1-C6 haloalkoxy; cyano; or -C(O)Rj;
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 0, 1, or 2 (e.g., 1 or 2); or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or-OC(O)ORj; or
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1-3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or 1H-benzoimidazolyl, each of which
is optionally substituted with from 1-3 Rc; or
(v) -YRf, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-;
Rf at each occurrence is, independently:
(i) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1 -3 Rc; or
(ii) heterocycloalkenyl including 5-10 atoms or 1H-benzoimidazolyl, each of which is
optionally substituted with from 1 -3 R11;
each of Rg, Rh, R, and Rk, at each occurrence is, independently:
(i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20
atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-C18 aryl or hctcroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd; or
(vi) -ORj, -C(O)Rj, -C(O)ORj; -C(O)NRgRh; or -S(O)nRm;
RJ at each occurrence is, independently:
(i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20
atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-C18 aryl or hetcroaryl including 5-16 atoms, each of which is optionally
substituted with from 1 -10 Rd; or
Rm at each occurrence is, independently, Rj, OR, or NRgRh;
Rn at each occurrence is, independently, Rj or NRgRh;
or an N-oxide and/or a pharmaceutically acceptable salt thereof.
In one aspect, this invention features a compound of formula (I), in which:
R1 is hydrogen or C1-C6 alkyl;
X is -C(O)-; -O-; -S(O),-, wherein t is 0-2; -NR9-; -C(O)NR9-; -C(O)O-; -CH2O-; or
-SO2NR9-, wherein R9 is hydrogen or C1-C6 alkyl;
each of Rg, Rh, Ri, and Rk, at each occurrence is, independently:
(i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20
atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-C18 aryl or hetcroaryl including 5-16 atoms, each of which is optionally
substituted with from 1 -10 Rd; or
(vi) -ORj, -C(O)Rj, -C(O)ORj; -C(O)NRgRh; or -S(O)nRm, wherein n is 1 or 2;
n is 1 or 2; and
R2, R3, R4, R5, R6, R7, R8, R9, R10, Y, W, W1, A, Ra, Ra', Rb, Rb', Rc, Rd, Rd', Rc, Rf, Rf,
Rj, Rm, Rn, and t can be as defined above; or an N-oxide and/or a pharmaceutically acceptable
salt thereof.
In another aspect, this invention features any of the specific quinoline compounds
delineated herein (e.g., as shown in the Examples). In some embodiments, the compound
compound can be selected from the group consisting of the title compounds of Examples 43-
190, 192-198, 201, 202, 204-210, 212-217, 220-223, 226, 229-257, 259-267, 269-272, 274-
365, 367-370, 372, 374-391, 394-396, 400, 402-593, and 595-597, and each of the title
compounds in Examples 397-399, 401, and 598-600. As used herein, the term "title
compound" refers to (i) the compound name heading a particular example or (ii) each of the
compound names delineated in Examples 397, 399, 401, and 598-600. For purposes of
clarification, when the Example sets forth a multi-step synthesis, the title compound is the
final product of that multi-step synthesis. For example, the title compound of Example 43 is
"4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline," and one of
the title compounds of Example 397 is "4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-3-
methyl-8-(trifluoromethyl)quinoline."
In one aspect, this invention features a pharmaceutical composition, which includes a
compound of formula (I) (including any subgenera or specific compounds thereof) or a salt
(e.g., a pharmaceutically acceptable salt) or a prodrug thereof and a pharmaceutically
acceptable adjuvant, carrier or diluent. In some embodiments, the composition can include an
effective amount of the compound or the salt thereof. In some embodiments, the composition
can further include an additional therapeutic agent.
The invention also relates generally to modulating (e.g., activating) LXRs with the
quinoline compounds described herein. In some embodiments, the methods can include, e.g.,
contacting an LXR in a sample (e.g., a tissue, a cell free assay medium, a cell-based assay
medium) with a compound of formula (I) (including any subgenera or specific compounds
thereof). In other embodiments, the methods can include administering a compound of
formula (I) (including any subgenera or specific compounds thereof) to a subject (e.g.. a
mammal, e.g., a human, e.g., a human having or at risk of having one or more of the diseases
or disorders described herein).
In one aspect, this invention also relates generally to methods of preventing or
treating (e.g., controlling, ameliorating, alleviating, slowing the progression of, delaying the
onset of, or reducing the risk of developing) one or more LXR-mediated diseases or disorders
in a subject (e.g., a subject in need thereof). The methods include administering to the subject
an effective amount of a compound of formula (I) (including any subgenera or specific
compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof. LXR-mediated
diseases or disorders can include, e.g., cardiovascular diseases (e.g., acute coronary
syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type 1 diabetes, type II
diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia,
hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders
(e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis,
rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-
induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the
artery wall), celiac, thyroiditis, skin aging or connective tissue diseases.
In another aspect, this invention relates to methods of modulating (e.g., increasing)
serum HDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes
administering to the subject an effective amount of a compound of formula (I) (including any
subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug
thereof.
In another aspect, this invention relates to methods of modulating (e.g., decreasing)
serum LDL cholesterol levels in a subject (e.g., a subject in need thereof), which includes
administering to the subject an effective amount of a compound of formula (I) (including any
subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug
thereof.
In another aspect, this invention relates to methods of modulating (e.g., increasing)
reverse cholesterol transport in a subject (e.g., a subject in need thereof), which includes
administering to the subject an effective amount of a compound of formula (I) (including any
subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug
thereof.
In another aspect, this invention relates to methods of modulating (e.g., decreasing or
inhibiting) cholesterol absorption in a subject (e.g., a subject in need thereof), which includes
administering to the subject an effective amount of a compound of formula (I) (including any
subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug
thereof.
In a further aspect, this invention relates to methods of preventing or treating a
cardiovascular disease (e.g., acute coronary syndrome, restenosis), which includes
administering to a subject in need thereof an effective amount of a compound of formula (I)
(including any subgenera or specific compounds thereof) or a pharmaceutically acceptable
salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating
atherosclerosis and/or atherosclerotic lesions, which includes administering to a subject in
need thereof an effective amount of a compound of formula (1) (including any subgenera or
specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating diabetes
(e.g., type 1 diabetes or type II diabetes), which includes administering to a subject in need
thereof an effective amount of a compound of formula (I) (including any subgenera or
specific compounds thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating
Syndrome X, which includes administering to a subject in need thereof an effective amount of
a compound of formula (I) (including any subgenera or specific compounds thereof) or a
pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of preventing or treating obesity,
which includes administering to a subject in need thereof an effective amount of a compound
of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically
acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating a lipid
disorder (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low
HDL and/or high LDL), which includes administering to a subject in need thereof an infective
amount of a compound of formula (I) (including any subgenera or specific compounds
thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating a
cognitive disorder (e.g., Alzheimer's disease or dementia), which includes administering to a
subject in need thereof an effective amount of a compound of formula (I) (including any
subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug
thereof.
In one aspect, this invention relates to methods of preventing or treating dementia,
which includes administering to a subject in need thereof an effective amount of a compound
of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically
acceptable salt or prodrug thereof.
In another aspect, this invention relates to methods of preventing or treating
Alzheimer's disease, which includes administering to a subject in need thereof an effective
amount of a compound of formula (I) (including any subgenera or specific compounds
thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating an
inflammatory disease (e.g., multiple sclerosis, rheumatoid arthritis, inflammatory bowel
disease, Crohn's disease, endometriosis, LPS-induced sepsis, acute contact dermatitis of the
ear, chronic atherosclerotic inflammation of the artery wall), which includes administering to
a subject in need thereof an effective amount of a compound of formula (I) (including any
subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or prodrug
thereof.
In another aspect, this invention relates to methods of preventing or treating
rheumatoid arthritis, which includes administering to a subject in need thereof an effective
amount of a compound of formula (I) (including any subgenera or specific compounds
thereof) or a pharmaceutically acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating celiac,
which includes administering to a subject in need thereof an effective amount of a compound
of formula (I) (including any subgenera or specific compounds thereof) or a pharmaceutically
acceptable salt or prodrug thereof.
In a further aspect, this invention relates to methods of preventing or treating
thyroiditis, which includes administering to a subject in need thereof an effective amount of a
compound of formula (I) (including any subgenera or specific compounds thereof) or a
pharmaceutically acceptable salt or prodrug thereof.
In one aspect, this invention relates to methods of treating a connective tissue disease
(e.g., osteoarthritis or tendonitis), which includes administering to a subject (e.g., a mammal,
e.g., a human) in need thereof an effective amount of a compound of formula (I) (including
any subgenera or specific compounds thereof) or a pharmaceutically acceptable salt or
prodrug thereof. In embodiments, the compound of formula (I) inhibits (e.g., reduces or
otherwise diminishes) cartilage degradation. In embodiments, the compound of formula (I)
induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments, the
compound of formula (1) inhibits (e.g., reduces or otherwise diminishes) cartilage degradation
and induces (e.g., increases or otherwise agments) cartilage regeneration. In embodiments,
the compound of formula (I) inhibits (e.g., reduces or otherwise diminishes) aggrecanase
activity. In embodiments, the compound of formula (I) inhibits (e.g., reduces or otherwise
diminishes) elaboration of pro-inflammatory cytokines in osteoarthritic lesions.
In another aspect, this invention relates to methods of treating or preventing skin
aging, the method comprising administering (e.g., topically administering) to a subject (e.g., a
mammal, e.g., a human) in need thereof an effective amount of a compound of formula (I)
(including any subgenera or specific compounds thereof) or a pharmaceutically acceptable
salt or prodrug thereof. In embodiments, the skin aging can be derived from chronological
aging, photoaging, steroid-induced skin thinning, or a combination thereof.
The term "skin aging" includes conditions derived from intrinsic chronological aging
(for example, deepened expression lines, reduction of skin thickness, inelasticity, and/or
unblemished smooth surface), those derived from photoaging (for example, deep wrinkles,
yellow and leathery surface, hardening of the skin, elastosis, roughness, dyspigmentations
(age spots) and/or blotchy skin), and those derived from steroid-induced skin thinning.
Accordingly, another aspect is a method of counteracting UV photodamage, which includes
contacting a skin cell exposed to UV light with an effective amount of a compound of
formula (I).
In some embodiments, the compound of formula (I) (including any subgenera or
specific compounds thereof) does not substantially increase serum and/or hepatic triglyceride
levels of the subject.
In some embodiments, the administered compound of formula (I) (including any
subgenera or specific compounds thereof) can be an LXR agonist (e.g., an LXRα agonist or
an LXRβ agonist, e.g., an LXRβ agonist).
m some embodiments, the subject can be a subject in need thereof (e.g., a subject
identified as being in need of such treatment). Identifying a subject in need of such treatment
can be in the judgment of a subject or a health care professional and can be subjective (e.g.
opinion) or objective (e.g. measurable by a test or diagnostic method). In some embodiments,
the subject can be a mammal. In certain embodiments, the subject is a human.
In a further aspect, this invention also relates to methods of making compounds
described herein. Alternatively, the method includes taking any one of the intermediate
compounds described herein and reacting it with one or more chemical reagents in one or
more steps to produce a compound described herein.
In one aspect, this invention relates to a packaged product. The packaged product
includes a container, one of the aforementioned compounds in the container, and a legend
(e.g., a label or an insert) associated with the container and indicating administration of the
compound for treatment and control of the diseases or disorders described herein.
Embodiments can include one or more of the following features.
The substituent attached to the 4-position of the quinoline ring in formula (I) can be
defined as follows:
(I)
R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally
substituted with from 1 -4 Re; and
A at each occurrence is, independently, C6-C10 aryl, which is: (a) substituted with
from 1-2 Rf; and (b) optionally substituted with from 1-4 Rc; and
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 0, 1, or 2 (e.g., 1 or 2); or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)ORj; or
(II)
R3 is heteroaryl including 5-14 atoms, which is: (i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, C6-C10 aryl, which is: (a) substituted with
from 1-2 Rf; and (b) optionally substituted with from 1-4 Re; and
R at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or-OC(O)ORj; or
(III)
R1 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally
substituted with from 1 -4 Re; and
A at each occurrence is, independently, heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1-2 Rf or includes a substituted ring atom selected from the
group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1-4 Rc;
provided that the heteroaryl including 5-10 atoms is not optionally substituted [1,2,4]-
oxadiazolyl; and
R1 at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)ORj; or
(IV)
R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally
substituted with from 1-4 Re; and
A at each occurrence is, independently, C6-C10 aryl, which is: (a) substituted with
from 1-2 Rf; and (b) optionally substituted with from 1-4 Re; and
R1 at each occurrence is, independently:
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1-3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or 1H-benzoimidazolyl, each of which
is optionally substituted with from 1-3 Re; or
(v) -YRf, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-; or
(V)
R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally
substituted with from 1-4R; and
A at each occurrence is, independently, arylazacyclyl including 8-12 atoms, each of
which is: (a) substituted with from 1-2 Rf, and (b) optionally substituted with from 1-4 Rc;
and
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH:)u6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh -NRkC(O)ORj, -OC(O)NRgRh or-OC(O)OR-; or
(VI)
R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally
substituted with from 1 -4 Rc; and
A at each occurrence is, independently, arylsulfinylcyclyl, heteroarylsulfinylcyclyl,
arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is
optionally substituted with from 1-4 Re; or
(VII)
R3 is C6-C14 aryl, which is: (i) substituted with from 1-2 R10, and (ii) optionally
substituted with from 1-4 Re; and
A at each occurrence is, independently, [1,2,4]-oxadiazolyl, optionally substituted
with from 1-2 Re.
R1 can be hydrogen.
R2 can be hydrogen.
R2 can be: (ii) C1-C6 alkyl that is optionally substituted with from 1-2 Ra; or (iii) C--
C10 aralkyl that is optionally substituted with from 1-3 Rb; or (vii) -XR8.
R2 can be C1-C6 alkyl, optionally substituted with from 1-2 Ra (e.g., R2 can be CH3; or
CH2CH3 or CH(CH3)2). Ra can be NRgRh or hydroxyl. For example, R2 can be CH2NRgRh.
R2 can be C7-C10 aralkyl, optionally substituted with from 1 -3 Rb (e.g., R2 can be
benzyl). R2 can be cyano. R: can be XR8 (e.g., -SO2CH3, C(O)NH2, C(O)OH, or C(O)OEt).
R3 can be C6-C10 aryl, which is (a) substituted with from 1-2 (e.g., 1) R10; and (b)
optionally substituted with from 1-2 Re. R3 can be phenyl, which is (a) substituted with 1 R ;
and (b) optionally substituted with from 1 -2 Re. R3 can be phenyl, which is substituted with 1
R10.
R3 can have formula A as described herein in which W and A can be as defined
anywhere herein (generically, subgenerically, or specifically):
R3 can have formula (A-4):
in which W and A can be as defined anywhere herein, and R32 can be hydrogen or Re
as defined anywhere herein (e.g., halo, e.g., chloro or fluoro).
R3 can be heteroaryl including 5-10 atoms, which is (i) substituted with 1 R10, and (ii)
optionally substituted with from 1-2 Re. For example, R3 can be pyridyl, thienyl, thiazolyl, or
pyrazolyl, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Re.
W can be-O-. W can be a bond. W can be C1-C3 alkylene (e.g., -CH2-). W can be
C2-C4 alkynylene (e.g., -C≡C-). W can be -O(CrC3 alkylene)- or -(C1-C3 alkylene)O- (e.g., -
OCH2- or -CH2O-). W can be -O-, a bond, -O(C1-C3 alkylene)-, and -(C1-C3 alkylcne)O-.
A can be: (i) phenyl, which is (a) substituted with 1 Rf, and (b) optionally substituted
with from 1-2 Re; or (ii) heteroaryl including 5-8 atoms, which is (a) substituted with I Rf,
and (b) optionally substituted with from 1-3 Re, provided that the heteroaryl including 5-8
atoms is not [1,2,4]-oxadiazolyl; or (iii) tetrahydroquinolyl or tetrahydroisoquinolyl, which is
(a) substituted with from 1 R1, and (b) optionally substituted with from 1-2 Re.
Rf can be -S(O)nRn (e.g., Rf can be -SO2Rn).
Rn can be C1-C10 alkyl, optionally substituted with from 1-2 Ra. Rn can be
unsubstituted C1-C3 alkyl (e.g., Rn can be CH3). Rn can be C2-C8 alkyl or C3-C8 alkyl
substituted with 1-2 (e.g., 1) Ra. Ra can be hydroxyl; C1-C3 alkoxy; NRgRh; aryl heterocyclyl
including 8-10 atoms optionally substituted with from 1-3 Rb (e.g., oxo); or C(O)ORj; or Ra
can be hydroxyl; C1-C3 alkoxy; NR8Rh; halo; arylheterocyclyl including 8-10 atoms,
optionally substituted with from 1-3 Rb; cyano; or C(O)ORj.
Rn can beNRgRh. In some embodiments, Rg and Rh can each be, independently,
hydrogen; C1-C10 alkyl, optionally substituted with from 1-2 Ra; C7-C10 aralkyl, optionally
substituted with from 1-3 Rb; or -C(O)R'. In certain embodiments, Rg and Rh are each,
independently, hydrogen; C1-C6 unsubstituted alkyl; C2-C8 alkyl substituted with hydroxyl or
C1-C3 alkoxy; benzyl; or -C(O)CH3.
Rn can be heterocyclyl including 5-10 atoms, optionally substituted with from 1-5 Rb.
For example, Rn can be morpholin-4-yl, 1-piperidyl, piperazin-1-yl, or pyrrolidin-1-yl, each of
which is optionally substituted with from 1-3 Rb.
Rn can be C7-C10 aralkyl or C3-C8 cycloalkyl, each of which is optionally substituted
with from 1-5 Rb. Rn can be C2-C10 alkenyl, optionally substituted with from 1-2 Rc. Rn can
be C6-C10 aryl, optionally substituted with from 1-2 Rd.
Rf can be -NRkC(O)NRgRk -NRkC(O)ORj; or -NRkS(O)nRn. Rk can be hydrogen. R8,
Rh, and Rj can each be, independently, hydrogen; C1-C6 alkyl, optionally substituted with
from 1-2 Ra; or C6-C10 aryl, optionally substituted with from 1-2 Rd. Rn can be C1-C6 alkyl,
optionally substituted with from 1-2 Ra; or C6-C10 aryl, optionally substituted with from 1-2
Rd.
R1 can be heterocyclyl including 5-7 atoms that is substituted with 1 oxo and
optionally substituted with from 1 -2 Re.
R1 can be heterocycloalkenyl including 5-7 atoms or 1H-benzoimidazolyl, each of
which is optionally substituted with from 1-2 Re.
Rf can be 4,5-dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-dihydro-1H-imidazolyl,
1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-[1,3]oxazinyl, or 2-oxo-oxazolidinyl.
R1 can be 1H-benzoimidazolyl.
Rc at each occurrence can be, independently, halo, C1-C3 alkyl, C1-C3 haloalkyl, C1-
C3 alkoxy, NRgRh, phenyl, or 4-fluorophcnyl.
R3 can have formula D:
wherein:
W is a bond; -O-; C1-3 alkylene; C2-4 alkynylene; -O(C1-3 alkylene)-; or -(C1-3
alkylene)O-;
one of Rf1, Rf2, Rf3, Rf4, and Rf5 is:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn; wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)ORj; or
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1-3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or 1H-benzoimidazolyl, each of which
is optionally substituted with from 1-3 Re; or
(v) -YRf, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-; and the others are each, independently, hydrogen or Re.
One of Rf1, Rf2, Rf3, Rf4, and Rf5 can be: (i) -S(O)nRn or -NRkS(O)nRn; or (ii) -
NRkC(O)NRgRh or -NRkC(O)ORj; or (iii) heterocyclyl including 5-7 atoms that is substituted
with from 1 oxo and optionally substituted with from 1-2 Rc; or (iv) heterocycloalkenyl
including 5-7 atoms or 1 H-benzoimidazolyl, each of which is optionally substituted with from
1-2 Re; and the other four can each be, independently, hydrogen, halo, C1-C3 alkyl, C1-C3
haloalkyl, C1-C5 alkoxy, or NR8Rh.
Four of Rfl, Rf2, Rf3, Rf4, and Rf5 can be hydrogen.
Rf2 can be: (i) -S(O)nRn or -NRkS(O)nRn; or (ii) -NRkC(O)NRgRh or -NRkC(O)ORj; or
(iii) heterocyclyl including 5-7 atoms that is substituted with from 1 oxo and optionally
substituted with from 1-2 Re; or (iv) heterocycloalkenyl including 5-7 atoms or 1H-
benzoimidazolyl, each of which is optionally substituted with from 1-2 Rc; and R11, Rf3, Rf4,
and Rf5 can each be, independently, hydrogen, halo, C1-C3 alkyl, C1-C3 haloalkyl, C1-C3
alkoxy, or NRgRh. Each of Rfl, Rf3, Rf4, and Rf5 can be hydrogen. Rf2 can be -SO2Rn.
Rc can be: (i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and
optionally substituted with from 1-2 Rc; or (ii) heterocycloalkenyl including 5-7 atoms or,
each of which is optionally substituted with from 1-2 Re. For example, Rf2 can be 4,5-
dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-dihydro-1H-imidazolyl, 1,2,5,6-tetrahydro-
pyrimidinyl, 5,6-dihydro-2H-[1,3]oxazinyl, or 2-oxo-oxazolidinyl. As another example, R2f
can be 1H-benzoimidazolyl.
R3 can have formula D-1:
in which:
R3i can be hydrogen or Re (e.g., halo, e.g., fluoro, or chloro);
W can be as defined anywhere herein (e.g., -O- or a bond);
each of RA22 and R23 is, independently, hydrogen or Re; and
one of RA24 and RA25 is Rf (e.g., -SO2Rn), and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Re.
R3 can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1
R10, and (ii) optionally substituted with from 1 -2 Re; and
W can be a bond; and
A can have formula (B-9):
in which:
each of RA22 and RA23 is, independently, hydrogen or Rc; and
one of RA24 and RA25 is Rf (e.g., -SO2Rn), and the other is hydrogen or Re;
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Rc.
R3 can have formula (A-4); and
W can be a bond; and
A can be hetcroaryl including 5-8 atoms, which is (a) substituted with 1 Rf (e.g., -
SO2Rn), and (b) optionally substituted with from 1 -3 Re, provided that the heteroaryl
including 5-8 atoms is not [1,2,4]-oxadiazolyl.
R3 can have formula (A-4); and
W can be a bond; and
A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with 1
R1 (e.g., -SO2Rn), and (b) optionally substituted with from 1-2 Rc.
R3 can have formula (A-4); and
W can be a bond; and
A can be benzo[b]thienyl-1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-1,1-
dioxide, or 2,3-dihydrobenzo[b]thienyl-1,1 -dioxide, each of which is optionally substituted
with from 1-3 Re.
R3 can have formula D-1; R32 can be hydrogen or Re (e.g., halo, e.g., fluoro, or
chloro); and
W can be as defined anywhere herein (e.g., -O- or a bond); each of RA22 and RA23 is,
independently, hydrogen or Re; and
one of RA24 and RA25 is Rf, e.g.;
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally
substituted with from 1-2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or 1H-benzoimidazolyl, each of which is
optionally substituted with from 1 -2 Rc; and the other is hydrogen or Rc.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Rc.
R3 can have formula (E) or (F) as defined anywhere herein.
R32 can be hydrogen. R32 can be halo (e.g., chloro or fluoro).
A can be benzo[b]thienyl-l,l-dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-1,1-
dioxide, or 2,3-dihydrobenzo[b]thienyl-1,1 -dioxide, each of which is optionally substituted
with from 1-3 Re. Re at each occurrence can be, independently, halo; C1-C3 alkyl, optionally
substituted with from 1-2 R3; C1-C3 haioalkyl; C1-C3 alkoxy; hydroxyl; nitro; cyano; NR8Rh:
phenyl; or 4-fluorophenyl.
Each of R4, R5 and R6 can be hydrogen or fluoro. Each of R4, R5 and R6 can be
hydrogen. Each of R4, R5 and R6 can be hydrogen, and R7 can be other than hydrogen.
R7 can be chloro, cyano, C1-C6 alkyl, C1-C3 haioalkyl, C1-C6 alkoxy, C(O)ORj,
C(O)NRgRh, or SO2Rm
R7 can be C1-C6 (e.g., C1-C3) haioalkyl (e.g., CF,). R1 tan be halo (e.g., chloro or
bromo, preferably chloro). R7 can be SO2Rm. Rm can be CH3. R7 can be hydrogen or cyano.
In some embodiments, it is provided that when Rf is SO2Rn and Rn is C1-C6 alkyl, then R7 is
other than fluoro.
The compounds can have formula (III) or (V) as defined anywhere herein.
The term "mammal" includes organisms, which include mice, rats, cows, sheep, pigs.
rabbits, goats, horses, monkeys, dogs, cats, and humans.
"An effective amount" refers to an amount of a compound that confers a therapeutic
effect (e.g., treats, controls, ameliorates, prevents, delays the onset of, or reduces the risk of
developing a disease, disorder, or condition or symptoms thereof) on the treated subject. The
therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective
(i.e., subject gives an indication of or feels an effect). An effective amount of the compound
described above may range from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about
0.1 mg/Kg to about 100 mg/Kg, from about 1 mg/Kg to about 100 mg/Kg). Effective doses
wilt also vary depending on route of administration, as well as the possibility of co-usage with
other agents.
The term "halo" or "halogen" refers to any radical of fluorine, chlorine, bromine or
iodine.
In general, and unless otherwise indicated, substituent (radical) prefix names are
derived from the parent hydride by either (i) replacing the "ane" in the parent hydride with the
suffixes "yl," "diyl," "triyl," "tetrayl," etc.; or (ii) replacing the "e" in the parent hydride with
the suffixes "yl," "diyl," "triyl," "tetrayl," etc. (here the atom(s) with the free valence, when
specified, is (are) given numbers as low as is consistent with any established numbering of the
parent hydride). Accepted contracted names, e.g., adamantyl, naphthyl, anthryl, phenanthryl,
furyl, pyridyl, isoquinolyl,6 quinolyl, and piperidyl, and trivial names, e.g., vinyl, allyl, phenyl,
and thienyl are also used herein throughout. Conventional numbering/lettering systems are
also adhered to for substituent numbering and the nomenclature of fused, bicyclic, tricyclic,
polycyclic rings.
The term "alkyl" refers to a saturated hydrocarbon chain that may be a straight chain
or branched chain, containing the indicated number of carbon atoms (e.g., C1-C20, C1-C10)
For example, C1-C20 alkyl indicates that the group may have from 1 to 20 (inclusive) carbon
atoms in it. Any atom can be substituted. Examples of alkyl groups include without
limitation methyl, ethyl, n-propyl, isopropyl, and tert-butyl.
The term "cycloalkyl" refers to saturated monocyclic, bicyclic, tricyclic, or other
polycyclic hydrocarbon groups (e.g., C3-C20, C3-C10, C3-C6). Any atom can be substituted,
e.g., by one or more substituents. A ring carbon serves as the point of attachment of a
cycloalkyl group to another moiety. Cycloalkyl groups can contain fused rings. Fused rings
arc rings that share a common carbon atom. Cycloalkyl moieties can include, e.g.,
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, adamantyl, andnorbornyl
(bicycle[2.2.1]heptyl).
The terms "alkylene," "alkcnylene," and "alkynylene," refer to divalent alkyl (e.g.,
C1-C6, e.g., -CH2-), alkenyl (e.g., C2-C6, e.g., -CH=CH-), and alkynyl (e.g., C2-C6, e.g., -C≡C-
) moieties, respectively.
The term "haloalkyl" refers to an alkyl group (e.g., C1-C20, e.g., C1-C10), in which at
least one hydrogen atom is replaced by halo. In some embodiments, more than one hydrogen
atom (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,etc.
hydrogen atoms) on a alkyl group can be replaced by more than one halogen (e.g., 2, 3, 4, 5,
6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, etc. halogen atoms).
In these embodiments, the hydrogen atoms can each be replaced by the same halogen (e.g.,
fluoro) or the hydrogen atoms can be replaced by a combination of different halogens (e.g.,
fluoro and chloro). "Haloalkyl" also includes alkyl moieties in which all hydrogens have
been replaced by halo (e.g., perhaloalkyl, e.g., perfluoroalkyl, such as trifluoromethyl).
The term "aralkyl" (e.g., C7-C20, C7-C12, C7-C10) refers to an alkyl moiety in which an
alkyl hydrogen atom is replaced by an aryl group. One of the carbons of the alkyl moiety
serves as the point of attachment of the aralkyl group to another moiety. Aralkyl includes
groups in which more than one hydrogen atom on an alkyl moiety has been replaced by an
aryl group. Any ring or chain atom can be substituted e.g., by one or more substituents. Non-
limiting examples of "aralkyl" include benzyl, 2-phenylethyl, 3-phenylpropyl, benzhydryl
(diphenylmethyl), and trityl (triphenylmethyl) groups.
The term "heteroaralkyl" (e.g., 5-16 atoms, 5-14 atoms, 5-10 atoms, 5-6 atoms) refers
to an alkyl moiety in which an alkyl hydrogen atom is replaced by a heteroaryl group. One of
the carbons of the alky I moiety serves as the point of attachment of the aralkyl group to
another moiety. Heteroaralkyl includes groups in which more than one hydrogen atom on an
alkyl moiety has been replaced by a hetcroaryl group. Any ring or chain atom can be
substituted e.g., by one or more substitucnts. Heteroaralkyl can include, for example, 2-
pyridylethyl.
The term "alkenyl" refers to a straight or branched hydrocarbon chain containing 2-20
(e.g., 2-12, 2-10, 2-6, 2-4) carbon atoms and having one or more double bonds. Any atom
can be substituted, e.g., by one or more substituents. Alkenyl groups can include internal or
terminal double bond containing, e.g., allyl, 1-butenyl, 2-hexenyl and 3-octenyl groups. One
of the double bond carbons can optionally be the point of attachment of the alkenyl
substituent. The term "alkynyl" refers to a straight or branched hydrocarbon chain containing
2-20 (e.g., 2-12, 2-10, 2-6, 2-4) carbon atoms and having one or more triple bonds. Any atom
can be substituted, e.g., by one or more substituents. Alkynyl groups can include internal or
terminal triple bond containing moieties, e.g., ethynyl, propargyl, and 3-hexynyl. One of the
triple bond carbons can optionally be the point of attachment of the alkynyl substituent.
The term "alkoxy" refers to an -O-alkyl radical. The term "mercapto" refers to an SH
radical. The term "thioalkoxy" refers to an -S-alkyl radical. The terms "aryloxy" and
"heteroaryloxy" refer to an -O-aryl radical and -O-heteroaryl radical, respectively. The terms
"thioaryloxy" and "thioheteroaryloxy" refer to an -S-aryl radical and -S-heteroaryl radical,
respectively.
The terms "aralkoxy" and "heteroaralkoxy" refer to an -O-aralkyl radical and -O-
heteroaralkyl radical, respectively. The terms "thioaralkoxy" and "thioheteroaralkoxy" refer
to an -S-aralkyl radical and -S-heteroaralkyl radical, respectively. The term "cycloalkoxy"
refers to an -O-cycloalkyl radical. The terms "cycloalkenyloxy" and "heterocycloalkenyloxy"
refer to an -O-cycloalkenyl radical and -O-heterocycloatkenyl radical, respectively. The term
"heterocyclyloxy" refers to an -O-hetcrocyclyl radical. The term "thiocycloalkoxy" refers to
an -S-cycloalkyl radical. The terms "thiocycloalkenyloxy" and "thioheterocycloalkenyloxy"
refer to an -S-cycloalkenyl radical and -S-heterocycloalkenyl radical, respectively. The term
"thioheterocyclyloxy" refers to an -S-hcterocyclyl radical.
The term "heterocyclyl" (e.g., 5-16 ring atoms, 5-14 ring atoms, 5-10 ring atoms, 5-6
ring atoms) refers to a saturated monocyclic, bicyclic, tricyclic or other polycyclic ring system
having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if bicyclic, or 1-10 heteroatoms if
tricyclic, said heteroatoms selected from O, N, or S (and mono and dioxides thereof, e.g.,
N→O-, S(O), SO2). Thus, a heterocyclyl ring includes carbon atoms and 1-4, 1-8, or 1-10
heteroatoms selected from N, O, or S if monocyclic, bicyclic, or tricyclic, respectively. A
ring heteroatom or ring carbon is the point of attachment of the heterocyclyl substituent to
another moiety. Any atom can be substituted, e.g., by one or more substituents. The
heterocyclyl groups can contain fused rings. Fused rings are rings that share a common
carbon or nitrogen atom. Heterocyclyl groups can include, e.g., tetrahydrofuryl,
tetrahydropyranyl, piperidyl (piperidino), piperazinyl, morpholinyl (morpholino), pyrrolinyl,
and pyrrolidinyl.
The term "cycloalkenyl" refers to partially unsaturated monocyclic, bicyclic, tricyclic,
or other polycyclic hydrocarbon groups (e.g., C3-C20, C3-C10, C3-C6). A ring carbon (e.g.,
saturated or unsaturated) is the point of attachment of the cycloalkenyl substituent. Any atom
can be substituted e.g., by one or more substituents. The cycloalkenyl groups can contain
fused rings. Fused rings are rings that share a common carbon atom. Cycloalkenyl moieties
can include, e.g., cyclohexenyl, cyclohexadienyl, or norbornenyl.
The term "heterocycloalkenyl" (e.g., 5-16 ring atoms, 5-14 ring atoms, 5-10 ring
atoms, 5-6 ring atoms) refers to partially unsaturated monocyclic, bicyclic, tricyclic, or other
polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if
bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (and
mono and dioxides thereof, e.g., N→O-, S(O), SO2) (e.g., carbon atoms and 1-4, 1-8, or 1-10
heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively). A ring carbon
(e.g., saturated or unsaturated) or heteroatom is the point of attachment of the
heterocycloalkenyl substituent. Any atom can be substituted, e.g., by one or more
substituents. The heterocycloalkenyl groups can contain fused rings. Fused rings are rings
that share a common carbon or nitrogen atom. Heterocycloalkenyl groups can include, e.g.,
tetrahydropyridyl, dihydropyranyl, 4,5-dihydrooxazolyl, 4,5-dihydro-1H-imidazolyl, 1,2,5,6-
tetrahydro-pyrimidinyl, and 5,6-dihydro-2H-[1,3]oxazinyl.
The term "aryl" refers to a fully unsaturated, aromatic monocyclic, bicyclic, or
tricyclic, hydrocarbon ring system (e.g., C6-C18, C6-C14, C6-C10), wherein any ring atom can
be substituted, e.g., by one or more substituents. Aryl groups can contain fused rings. Fused
rings are rings that share a common carbon atom. Aryl moieties can include, e.g., phenyl,
naphthyl, anthracenyl, and pyrenyl.
The term "heteroaryl" (e.g., e.g., 5-16 ring atoms, 5-14 ring atoms, 5-10 ring atoms.
5-6 ring atoms) refers to a fully unsaturated, aromatic monocyclic, bicyclic, tricyclic, or other
polycyclic hydrocarbon groups having 1-4 heteroatoms if monocyclic, 1-8 heteroatoms if
bicyclic, or 1-10 heteroatoms if tricyclic, said heteroatoms independently selected from O, N,
or S (and mono and dioxides thereof, e.g., N→O-, S(O), SO2) (e.g., carbon atoms and 1-4, 1 -
8, or 1-10 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively). Any
atom can be substituted, e.g., by one or more substituents. Heteroaryl groups can contain
fused rings. Fused rings are rings that share a common carbon or nitrogen atom. Heteroaryl
groups can include, e.g., pyridyl, thienyl, furyl (furanyl), imidazolyl, indolyl, isoquinolyl,
quinolyl and pyrrolyl.
The terms "arylheterocyclyl" and "heteroarylheterocyclyl" (e.g., 8-20 ring atoms, 8-
12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems
that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that
includes from 1 -3 hetcroatoms independently selected from O, N, or S (and mono and
dioxides thereof, e.g., N→O-, S(O), SO2,). The remaining ring atoms of the heterocyclyl ring
are carbon. Any atom can be substituted, e.g., by one or more substituents. A ring atom on
either the aryl portion or the heterocyclyl portion can serve as the point of attachment of the
arylheterocyclyl to another moiety. Examples can include without limitation the ring systems
delineated below under the definitions of arylazacyclyl, arylsulfinylcyclyl,
heteroarylsulfmylcyclyl, arylsulfonylcyclyl, and heteroarylsulfonylcyclyl.
The term "arylazacyclyl" (e.g., 8-20 ring atoms, 8-12 ring atoms, 8-10 ring atoms)
refers to bicyclic, tricyclic, or other polycyclic ring systems that include an aryl ring fused to
a heterocyclyl ring that includes one nitrogen ring atom (the remaining ring atoms of the
heterocyclyl ring are carbon). Any atom can be substituted, e.g., by one or more substituents.
A ring atom on either the aryl portion or the heterocyclyl portion can serve as the point of
attachment of the arylazacyclyl to another moiety. For example, arylazacyclyl can include
1,2,3,4-tetrahydroquinolyl, 1,2,3,4-tetrahydroisoquinolyl, and isoindolinyl-l,3-dione
(phthalimido).
The terms "arylsulfinylcyclyl" and "heteroarylsulfinylcyclyl" (e.g., 8-20 ring atoms,
8-12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring systems
that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl ring that
includes one -S(O)- (sulfinyl) ring atom (i.e., the sulfur atom of which forms part of the ring
system, and the remaining ring atoms of the heterocyclyl ring arc carbon. Any atom can be
substituted, e.g., by one or more substituents. A carbon ring atom on either the
aryl/heteroaryl portion or the heterocyclyl portion can serve as the point of attachment of the
arylsulfinylcyclyl and heteroarylsulfinylcyclyl to another moiety. For example, such ring
systems can include:
The terms "arylsulfonylcyclyl" and "heteroarylsulfonylcyclyl" (e.g., e.g., 8-20 ring
atoms, 8-12 ring atoms, 8-10 ring atoms) refer to bicyclic, tricyclic, or other polycyclic ring
systems that include an aryl or heteroaryl ring, respectively, that is fused to a heterocyclyl
ring that includes one -SO2- (sulfonyl) ring atom (i.e., the sulfur atom of which forms part of
the ring system, and the remaining ring atoms of the heterocyclyl ring are carbon,). Any atom
can be substituted, e.g., by one or more substituents. A carbon ring atom on either the
aryl/heteroaryl portion or the heterocyclyl portion can serve as the point of attachment of the
arylsulfonylcyclyl and heteroarylsulfonylcyclyl to another moiety. For example, such ring
systems can include:
The term "oxo" refers to an oxygen atom, which forms a carbonyl (C=O) when
attached to carbon, or which forms part of a sulfinyl or sulfonyl group when attached to a
sulfur atom, or which forms part of an N-oxide when attached to a nitrogen. The term
"thioxo" refers to an oxygen atom, which forms a thiocarbonyl (C=S) when attached to
carbon. Descriptors such as C(O), C(S), and C(NR') refer to carbon atoms that arc doubly
bonded to an oxygen, sulfur, and nitrogen atom, respectively.
The term "substituent" refers to a group "substituted" on, e.g., an alkyl, haloalkyl,
cycloalkyl, alkenyl, alkynyl, aralkyl, heteroaralkyl, heterocyclyl, heterocycloalkenyl,
cycloalkenyl, aryl, or heteroaryl group at any atom of that group. In one aspect, the
substituent(s) (e.g., Rd) on a group are independently any one single, or any combination of
two or more of the permissible atoms or groups of atoms delineated for that substituent. In
another aspect, a substituent may itself be substituted with any one of the above substituents
(e.g., Rd').
In general, when a definition for a particular variable includes both hydrogen and
non-hydrogen (halo, alkyl, aryl, etc.) possibilities, the term "substituent(s) other than
hydrogen" refers collectively to the non-hydrogen possibilities for that particular variable.
In some embodiments, the compounds have agonist activity for genes involved with
HDL production and cholesterol efflux (e.g., ABCA1) and antagonist activity for genes
involved with triglyceride synthesis (e.g., SREBP-1c).
The details of one or more embodiments of the invention are set forth in the
description below. Other features and advantages of the invention will be apparent from the
description and from the claims.
DETAILED DESCRIPTION
This invention relates generally to quinoline-based modulators of LXRs and related
methods and compositions.
The quinoline-based LXR modulators have the general formula (1):
in which R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, X, Y, W, W1, A, Ra, Ra', Rb, Rb', Rc, Rd, Rd',
Re, Rf, Rf', Rg, Rh, Ri Rj, Rk, Rm, Rn, n, and t can be as defined anywhere herein.
For ease of exposition, it is understood that any recitation of ranges (e.g., C1-C12, 1-5)
or subranges of a particular range (e.g., C1-C4, C2-C6, 1-2) for any of R1, R2, R3, R4, R5, R6,
R7, R8, R9, R10, X, Y, W, W1, A, Ra, Ra' Rb, Rb', Rc, Rd, Rd', Re, Rf, Rf', Rg, Rh, Ri, Rj, Rk, Rm,
Rn, n, and t expressly includes each of the individual values that fall within the recited range,
including the upper and lower limits of the recited range. For example, the range C1-C4 alkyl
is understood to mean Q, C2, C3, C4, C1-C4, C1-C3, C1-C3, C2-C4, C2-C3, or C3-C4 alkyl and
the range 1-3 Ra is understood to mean 1, 2, 3, 1-3, 1-2, or 2-3 Ra.
For ease of exposition, it is also understood that where in this specification (including
the claims), a group is defined by "as defined anywhere herein" (or the like), the definitions
for that particular group include the first occurring and broadest generic definition as well as
any sub-generic and specific definitions delineated anywhere in this specification.
Variable R1
In some embodiments, R1 can be hydrogen.
Variable R2
In some embodiments, R2 can be:
(i) hydrogen, cyano, or halo; or
(ii) C1-Cl2 (e.g., C1-C6 or C1-C4) alkyl or C1-C12 (e.g., C1-C6 or C1-C4) haloalkyl, each
of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra; or
(iii) C7-C20 (e.g., C7-C16, C7-C12, C7-C10) aralkyl or hetcroaralkyl including 6-20 (e.g.,
6-14, 6-12, 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4,
1-3, 1-2, l)Rb;or
(v) C3-C10 (e.g., C3-C7) cycloalkyl, optionally substituted with from 1-5 (e.g., 1-4, 1-
3, 1-2, l)Rb;or
(vi) C6-C18 (e.g., C6-C14, C6-C10, phenyl) aryl or heteroaryl including 5-16 (e.g., 5-14,
5-10, 5-6) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4, 1-3, 1-
2, 1)Rd;or
(vii) -XR8.
In some embodiments, R2 can be:
(i) hydrogen or cyano; or
(ii) C1-C12 (e.g., C1-C6 or C1-C4) alkyl or C1-C12 (e.g., C1-C6 or C1-C4) haloalkyl, each
of which is optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) Ra; or
(iii) C7-C20 (e.g., C7-C16, C7-C12, C7-C10) aralkyl or heteroaralkyl including 6-20 (e.g.,
6-14, 6-12, 6-10) atoms, each of which is optionally substituted with from 1-10 (e.g., 1-5, 1-4,
1-3, 1-2, l)Rb.
In some embodiments, R2 can be: (ii) C1-C6 alkyl that is optionally substituted with
from 1-2 Ra; or (iii) C7-C20 aralkyl that is optionally substituted with from 1-3 Rb; or (vii) -
XR8.
In certain embodiments, R2 can be hydrogen.
In certain embodiments, R2 can be C1-C6 (e.g., C1-C4) alkyl, which is optionally
substituted with 1 or 2 Ra (e.g., NRgRh, hydroxy, cyano, or -C(O)ORj).
For example, R2 can be CH3 (methyl), ethyl, n-propyl, or iso-propyl. An exemplary
R2 substituent is CH3.
In certain embodiments, R2 can be C1-C6 (e.g., C1 or C2) alkyl substituted with one R3.
In embodiments, Ra can be hydroxy or NR8Rh. For example, R2 can be CH2NRgRh.
In embodiments, Rg and Rh can be both hydrogen. In certain embodiments, one of Rg
and Rh can be hydrogen, and the other can be d-do (e.g., C1-C10, C1-C6, C1-C3) haloalkyl
(e.g., fluoromethyl, trifluoromethyl, or fluoroethyl); or C1-C20 alkyl (e.g. methyl, ethyl, or
isopropyl), which is optionally substituted with C1-C20 alkoxy (e.g., C1-C10, C1-C6, C1-C3, e.g.,
methoxy), cyano, C2-C20 (e.g., C2-C10, C2-C6, C2-C3) alkenyl (e.g., allyl), or C3-C20 cycloalkyl
(e.g., cyclopropyl or cyclopentyl).
In certain embodiments, R2 can be C7-C10 aralkyl, which is optionally substituted with
from 1-3 (e.g., 1-2, 1) Rb (e.g., C1-C3 alkyl; d-d haloalkyl, e.g., C1-C3 perfluoroalkyl;
halogen; or CN). An exemplary R2 aralkyl substituent is benzyl.
In certain embodiments, R2 can be cyano.
In certain embodiments, R: can be halo.
In certain embodiments, R: can be C1-C4 haloalkyl, (e.g., C1-C4 perhaloalkyl, e.g.,
CF3).
In certain embodiments, R2 can be C6-C10 aryl that is optionally substituted with from
1-3 (e.g., 1-2, 1) Rd (e.g., C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl; halogen; or
CN). For example, R2 can be phenyl optionally substituted with from 1 -3 Rd.
In certain embodiments, R2 can be heteroaryl including 5-10atoms that is optionally
substituted with from 1-3 (e.g., 1-2, 1) Rd (e.g., C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3
perfluoroalkyl; halogen; CN; NRsRh; or C1-C3 alkoxy). For example, R2 can be pyridyl,
pyrimidinyl, thienyl, benzisoxazolyl, benzothienyl, oxadiazolyl, pyrrolyl, pyrazolyl,
imidazolyl, tetrazolyl, or furyl, each of which can be optionally substituted with from 1 -3 Rd.
An exemplary R2 heteroaryl substituent is tetrazolyl.
In certain embodiments, R2 can be C3-C7 cycloalkyl or heterocyclyl including 3-7
atoms, each of which can be optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R5. In
embodiments, when Rb is present, Rb can be attached to the same carbon atom that connects
the cycloalkyl or heterocyclyl ring to the 3-position of the quinoline core.
In certain embodiments, R2 can be -XR8.
For example, X can be -C(O)O-, thereby forming an ester moiety of the formula -
C(O)OR8. In certain embodiments, R8 can be hydrogen or C1-C6 (e.g., C1-C4) alkyl (e.g.,
methyl or ethyl).
As another example, X can be -C(O)NR9-, thereby forming an amide moiety of the
formula -C(O)NR9R8. In these embodiments, R8 and R9 can each be, independently,
hydrogen or C1-C6 (e.g., C1-C4) alkyl. In certain embodiments, R8 and R9 can both be
hydrogen; or one of R8 and R9 can be hydrogen, and the other can be C1-C6 (e.g., C1-C4) alkyl
(e.g., CH3 or ethyl).
As one example, X can be -S(O)t-, thereby forming a sulfone moiety of the formula -
S(O),R8. In certain embodiments, R8 can be hydrogen or C1-C6 (e.g., C1-C4) alkyl (e.g.,
ethyl), and t can be 0, 1, or 2 (e.g., 2).
As a further example, X can be -NR9-, thereby forming an amino moiety of the
formula -NR8R9. In certain embodiments, R9 can be hydrogen or C1-C6 (e.g., C1-C4) alkyl,
and R8 can be as defined anywhere herein. In certain embodiment, R8 and R9 can both be
hydrogen.
Variable R3
In some embodiments, R3 can be C6-C18 (e.g., C6-C14, C6-C10, phenyl) aryl, which is
(i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally substituted with
from 1-4 (e.g., 1-3, 1-2, 1) Rc. In embodiments, when R3 is substituted with Re, each Re can
be independently of one another: C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl;
halogen; or CN.
In some embodiments, R3 can be C6-C10 aryl, which is (i) substituted with from 1-5
(e.g., 1-4, 1-3, 1-2, 1)R10 and (ii) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1)Re.
In some embodiments, R3 can be C6-C10 aryl, which is (i) substituted with 1 or 2 R10
and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R3 can be naphthyl, which is (i) substituted with 1 or 2 R10 and
(ii) optionally substituted with 1 or 2 Rc.
In some embodiments, R3 can be phenyl, which is (i) substituted with 1 or 2 R10 and
(ii) optionally substituted with 1 or 2 Re (e.g., 1 Re, which can be, e.g., halo, e.g., fluoro or
chloro).
In some embodiments, R3 can be C6-C10 aryl, which is (i) substituted with 1 R10 and
(ii) optionally substituted with 1 or 2 Re.
In certain embodiments, R3 can be phenyl, which is (i) substituted with 1 R10 and (ii)
optionally substituted with 1 or 2 Re (e.g., halo). In these embodiments, R3 can have formula
(A), in which R10 (i.e., the moiety -WA) can be attached to a ring carbon that is ortho, meta,
or para (preferably meta) with respect to the ring carbon that connects the phenyl ring to the
4-position of the quinoline ring, and Rc, when present can be connected to ring carbons that
are not occupied by WA. For example, R3 can have formula (A-1) or (A-1'), in which R10
(WA) is attached to the ring carbon that is meta with respect to the ring carbon that connects
the phenyl ring to the 4-position of the quinoline ring in formula (I).
In certain embodiments, R3 can be phenyl that is substituted with 1 R10, and R3 can
have formula (A-2), e.g., formula (A-3):
In still other embodiments, R3 can have formula (A-4):
in which W and A can be as defined anywhere herein; and R32 can be hydrogen; or Rc (e.g.,
halo, e.g., chloro or fluoro).
In some embodiments, R3 can be heteroaryl including 5-16 (e.g., 5-14, 5-10, 5-6)
atoms, which is (i) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally
substituted with from 1-4 (e.g., 1-3, 1-2, 1) Re. In embodiments, when R3 is substituted with
Re, each Re can be independently of one another: C1-C3 alkyl; C1-C3 haloalkyl, e.g., C1-C3
perfluoroalkyl; halogen; or CN.
In some embodiments, R3 can be heteroaryl including 5-10 atoms, which is (i)
substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1) R10 and (ii) optionally substituted with from
1-4 (e.g., 1-3, 1-2, l)Re.
In some embodiments, R3 can be heteroaryl including 5-10 atoms, which is (i)
substituted with from 1-4 (e.g., 1-3, 1-2, 1) R10 and (ii) optionally substituted with 1 or 2 Re.
In some embodiments, R3 can be heteroaryl including 5-6 atoms, which is (i)
substituted with from 1-4 (e.g., 1-3, 1-2, 1) R10 and (ii) optionally substituted with 1 or 2 Re
(e.g., C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl, e.g., C1-C2 perfluoroalkyl; or halogen).
In certain embodiments, R3 can be pyridyl, pyrimidinyl, thienyl, or furyl (e.g., pyridyl
or pyrimidinyl), which is (i) substituted with from 1-4 (e.g., 1-3, 1-2, 1) R10 and (ii) optionally
substituted with 1 or 2 Rc (e.g., C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl, e.g., C1-C2
perfluoroalkyl; or halogen).
In some embodiments, R3 can be heteroaryl including 5-10 (e.g., 5-6) atoms, which is
(i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Rc.
In certain embodiments, R3 can be pyridyl, pyrimidinyl, thienyl, thiazolyl, pyrazoly,
or furyl (e.g., pyridyl, thienyl, thiazolyl, or pyrazoly), which is (i) substituted with from I R10
and (ii) optionally substituted with 1 or 2 Re (e.g., C1-C3 haloalkyl, e.g., C1-C3 perfluoroalkyl,
e.g., C1-C3 perfluoroalkyl; or halogen).
In certain embodiments, R3 can be pyridyl, thienyl, pyrazoly, or thiazolyl (e.g.,
thienyl or thiazolyl).
Variable W
In some embodiments, W can be -O-.
In some embodiments, W can be a bond.
In some embodiments, W can be C1-C3 alkylene (e.g., CH2).
In some embodiments, W can be C2-C4 alkynylene (e.g., -C≡C-).
In some embodiments, W can be -Wl(C1-C3 alkylene)- or -(C1-C3 alkylene) W1- (e.g.,
-O(C1-C3 alkylene)- or -(C1-C3 alkylene)O-, e.g., -OCH2- or -CH2O-); or W can be -O-, a
bond, -O(C1-C3 alkylene)-, and -(C1-C3 alkylene)O-.
Variable A
In some embodiments, A can be a cyclic group that is (a) substituted with one or more
Rf; and (b) optionally substituted with from 1-4 Rc.
In some embodiments, A can be:
(i-A) C6-C10 (e.g., phenyl) aryl, which is (a) substituted with from 1-5 (e.g., 1-4, 1-3,
1-2, 1, e.g., 1) Rf: and (b) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-2) Rc;
and/or
(ii-A) heteroaryl including 5-10 (e.g., 5-8) atoms, which is (a) substituted with from
1-5 (e.g., 1-4, 1-3, 1-2, l,e.g., 1) Rf; and (b) is optionally substituted with from 1-4 (e.g., 1-3,
1-2, 1, e.g., 1-3) Rc; provided that the heteroaryl including 5-10 atoms is not [1,2,4]-
oxadiazolyl;
and/or
(iii-A) arylazacyclyl including 8-12 atoms (e.g., tetrahydroquinolyl or
tetrahydroisoquinolyl), which is (a) substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) Rf,
and (b) optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-2) Rc.
In embodiments, any one of the following combinations can apply for defining A:
• (i-A), (ii-A), or (iii-A); or
• (i-A) and (ii-A), or (i-A) and (iii-A), or (ii-A) and (iii-A); or
• (i-A), (ii-A), and (iii-A).
In some embodiments, A can be C6-C10 aryl, which is (i) substituted with from 1-3
(e.g., 1-2, 1) Rf and(ii) optionally substituted with 1 or 2 Rc.
In some embodiments, A can be naphthyl, which is (i) substituted with from 1-3 (e.g.,
1-2, 1) Rf and (ii) optionally substituted with 1 or 2 Rc.
In some embodiments, A can be phenyl, which is (i) substituted with from 1-3 (e.g.,
1-2, 1) Rf and (ii) optionally substituted with 1 or 2 Rc.
In certain embodiments, A can be phenyl, which is (i) substituted with 1 Rf and (ii)
optionally substituted with 1 or 2 Rc.
For example, A can have formula (B-1), (B-2), or (B-3), in which Rf can be attached
to a ring carbon that is ortho, meta, or para, respectively (preferably meta) with respect to the
ring carbon that is attached to W:
As another example, A can have formula (B-4), (B-5), (B-6), or (B-7) in which the
phenyl ring is substituted with (a) 1 Rf and (b) 1 Rc:
As another example, A can have formula (B-8), in which the phenyl ring is
substituted with (a) 1 Rf and (b) 2 Rc:
As a further example, A can have formula (B-9):
in which:
each of RA22 and RA23 can be, independently, hydrogen or Rc; and
one of RA24 and RA25 can be Rf (e.g., -SO2Rn), and the other is hydrogen or Rc.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Rc.
In certain embodiments, RA25 can be Rf (e.g., -SO2Rn), and each of RA22, RA23, and
RA24 can be hydrogen. In certain embodiments, RA25 can be Rf (e.g., -SO2Rn), one of RA22,
RA23, and RA24 (e.g., RA23) can be Re, and the other two can each be hydrogen.
In other embodiments, RA24 can be Rf (e.g., -SO2Rn), and each of RA22, RA23, and RA25
can be hydrogen. In certain embodiments, RA24 can be R1 (e.g., -SO2Rn), one of RA22, RA23,
and RA25 (e.g., R22) can be Re, and the other two can each be hydrogen.
In other embodiments, A can be heteroaryl including 5-10 atoms, which is (a)
substituted with from 1 -3 (e.g., 1 -2, 1,) R1; and (b) is optionally substituted with from 1-3
(e.g., 1-2, 1) Rc; provided that the heteroaryl including 5-10 atoms is not [1,2,4]-oxadiazolyl.
In some embodiments, A can be heteroaryl including 5-10 atoms, which is (a)
substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Re; provided
that the heteroaryl including 5-10 atoms is not [1,2,4]-oxadiazolyl.
In some embodiments, A can be heteroaryl including 5-8 atoms, which is (a)
substituted with 1 R1; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Rc; provided
that the heteroaryl including 5-10 atoms is not [l,2,4]-oxadiazolyl.
In certain embodiments, A can be pyrrolyl, pyridyl, pyridyl-N-oxide, pyrimidinyl,
pyrazolyl, thienyl, furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, isoxazolyl, or indolyl, each
of which is (a) substituted with 1 Rf; and (b) is optionally substituted with from 1-3 (e.g., 1-2,
1)Rc.
In certain embodiments, A can be pyrrolyl, pyridyl, pyrimidinyl, pyrazolyl, thienyl,
furyl, quinolyl, oxazolyl, thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted
with 1 R1; and (b) is optionally substituted with from 1-3 (e.g., 1-2, 1) Rc.
In certain embodiments, A can be pyridyl, pyrimidinyl, thienyl, furyl, oxazolyl,
thiazolyl, imidazolyl, or isoxazolyl, each of which is (a) substituted with 1 Rf; and (b) is
optionally substituted with from 1-3 (e.g., 1-2, 1) Rc.
In certain embodiments, A can be pyridyl in which W is attached to the 2- or 3-
position of the pyridiyl ring.
In embodiments, A can be pyridyl in which W is attached to the 2-position of the
pyridyl ring, and Rf is attached to the 4- or the 6-position of the pyridyl ring. Such rings can
be further substituted with 1, 2 or 3 Rc (e.g., halo, e.g., chloro; or NRgRh, e.g., NH2). For
example, A can be pyridyl in which W is attached to the 2-position of the pyridyl ring, Rf is
attached to the 6-position of the pyridyl ring, and 1 Rc is attached to the 4-position of the
pyridyl ring. As another example, A can be pyridyl in which W is attached to the 2-position
of the pyridyl ring, Rf is attached to the 6-position of the pyridyl ring, and an Rc substituent is
attached to the 3-, 4-, and 5-positions of the pyridyl ring.
In other embodiments, A can be pyridyl in which W is attached to the 3-position of
the pyridyl ring, and Rf is attached to the 5-position of the pyridyl ring. Such a ring can be
further substituted with 1, 2 or 3 Rc (e.g., halo, e.g., chloro; or NRgRh, e.g., NH2).
In certain embodiments, A can be thienyl in which W is attached to the 2-position of
the thienyl ring, and Rf is attached to the 5-position of the thienyl ring. Such a ring can be
further substituted with 1, 2 or 3 Rc (e.g., halo, e.g., chloro; or NRgRh, e.g., NH2).
In some embodiments, A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is
(a) substituted with from 1-3 (e.g., 1-2, 1) Rf; and (b) is optionally substituted with from 1-3
(e.g., 1-2, 1)Rc.
In some embodiments, A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is
(a) substituted with 1 R1; and (b) is optionally substituted with 1 or 2 Rc.
In some embodiments, A can be tetrahydroquinolyl or tetrahydroisoquinolyl, which is
substituted with 1 Rf. In certain embodiments, W can be attached to the aromatic ring portion
of the tetrahydroquinolyl or tetrahydroisoquinolyl ring (e.g., the 5-position). In certain
embodiments, Rf can be attached to the tetrahydroquinolyl or tetrahydroisoquinolyl nitrogen
ring atom (e.g., when Rf is SO2Rn). In certain embodiments, W can be attached to the 5-
position of the tetrahydroquinolyl or tetrahydroisoquinolyl ring, R1 is SO2Rn, and the SO2Rn
group is attached to the tetrahydroquinolyl or tetrahydroisoquinolyl nitrogen ring atom.
In some embodiments, when A is (a) substituted with one or more R1; and (b)
substituted with from 1-4 Rc, then Rc at each occurrence can be, independently, halo (e.g.,
fluoro or chloro), C1-C3 alkyl (e.g., CH3), C1-C3 haloalkyl (e.g., CF3), C1-C3 alkoxy (e.g.,
OCH3), NRgRh (e.g., NH2), phenyl, or 4-fiuorophenyl. In certain embodiments, Rc at each
occurrence can be, independently, halo (e.g., fluoro or chloro), C1-C3 alkyl (e.g., CH3), C1-C3
haloalkyl (e.g., CF3), C1-C3, alkoxy (e.g., OCH3), NRgRh (e.g., NH2).
In some embodiments, A can be a cyclic group that (a) includes a substituted ring
atom selected from the group consisting of S(O) and SO2, e.g., SO2; and (b) is optionally
substituted with from 1 -4 Rc.
In some embodiments, A can be heteroaryl including 5-10 (e.g., 5-8) atoms that (a)
includes a substituted ring atom selected from the group consisting of S(O) and SO2; and (b)
is optionally substituted with from 1-4 (b) is optionally substituted with from 1-4 (e.g., 1-3, 1-
2, l,c.g., 1-3) Rc.
In certain embodiments, A can be heteroaryl including 5-10 (e.g., 5-8) atoms that (a)
includes a substituted ring atom selected from the group consisting of S(O) and SO2, e.g.,
SO2. For example, A can be benzo[b]thicnyl 1,1-dioxide (e.g., in which W is attached to the
phenyl ring portion of the benzo[b]thienyl ring system, e.g., the 4-position thereof; or W is
attached to the thienyl ring portion of the benzo[b]thienyl ring system, e.g., the 3-position
thereof).
In some embodiments, A can be arylsulfonylcyclyl or heteroarylsulfonylcyclyl, each
of which includes 8-10 atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1,
e.g., 1-3)RC.
In certain embodiments, A can be heteroarylsulfonylcyclyl, which includes 8-10
atoms and is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-3)Rc. For example,
A can be 3,4-dihydro-2H- thiopyrano[2,3-b]pyridyl 1,1-dioxide (e.g., in which W is attached
to the pyridyl ring portion of the thiopyrano[2,3-b]pyridyl ring system, e.g., the 2- or 4-
position thereof).
In certain embodiments, A can be arylsulfonylcyclyl, which includes 8-10 atoms and
is optionally substituted with from 1-4 (e.g., 1-3, 1-2, 1, e.g., 1-3)Rc. For example, A can be
2,3-dihydro-benzo[b]thienyl 1,1-dioxide (e.g., in which W is attached to the phenyl ring
portion of the benzo[b]thienyl ring system, e.g., the 4-position thereof).
In some embodiments, when A is a cyclic group that (a) includes a substituted ring
atom selected from the group consisting of S(O) and SO2, e.g., SO2; and (b) is substituted
with from 1-4 Rc, then Rc at each occurrence can be, independently, halo; C1-C3 alkyl,
optionally substituted with from 1-2 Ra; C1-C3 haloalkyl; C1-C3 alkoxy; hydroxyl; cyano;
nitro; NRgRh; phenyl; or 4-fluorophenyl. In certain embodiments, Rc at each occurrence can
be, independently, halo; C1-C3 alkyl, optionally substituted with from 1 -2 Ra (e.g., Ra can be
C(O)NRgRh); hydroxyl; cyano; or nitro.
In some embodiments, A can be[1,2,4]-oxadiazolyl, optionally substituted with from
1 Rc. In certain embodiments, A can have formula (C):
in which Rc can be hydrogen; halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra; C1-
C3 haloalkyl; C1-C3 alkoxy; hydroxyl; cyano; nitro; NRgRh; phenyl; or 4-fluorophenyl. In
certain embodiments, Rc can be hydrogen; halo; C1-C6 alkyl, optionally substituted with from
1-2 Ra (e.g., Ra can be C(O)NRgRh); C1-C3 haloalkyl; C1-C3 alkoxy; NRgRh; phenyl; or 4-
fluorophenyl. In certain embodiments, Rc can be hydrogen; halo; C1-C3 alkyl, optionally
substituted with from 1-2 Ra (e.g., Ra can be C(O)NRgRh); hydroxyl; cyano; or nitro.
Variable Rf
In some embodiments, Rf at each occurrence can be:
(i-F) -S(O)nRn or -NRkS(O)nRn, in which n is 0, 1 or 2 (e.g., 1 or 2);
and/or
(ii-F) -NRkC(O)NRgRh or -NRkC(O)ORj;
and/or
(iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1
oxo and optionally substituted with from 1-3 (e.g., 1-2, 1) Rc;
and/or
(iv-F) heterocycloalkenyl including 5-10 (e.g., 5-7) atoms or 1H-benzoimidazolyl,
each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Rc.
In some embodiments, any one of the following combinations can apply for defining
Rf:
• (i-F), (ii-F), (iii-F) or (iv-F); or
• (i-F) and (ii-F), or (i-F) and (iii-F), or (i-F) and (iv-F) or (iii-F) and (iv-F); or
• (i-F), (iii-F), and (iii-F); or
• (i-F), (ii-F), (iii-F) and (iv-F).
In some embodiments, R1 can be -S(O)nRn (e.g., -SO2Rn). In embodiments, when Rn
is Rj, then Rj is other than hydrogen. In embodiments, n can be 0; or n can be 1 or 2.
In some embodiments, Rn can be C1-C10 (e.g., C1-C5 or C2-C8 or C3-C8) alkyl or C1-
C10 (e.g., C1-C5 or C1-C3) haloalkyl, optionally substituted with from 1-2 Ra.
In certain embodiments, Rn can be C1-C10 (e.g., C1-C3 or C2-C8 or C3-C8) alkyl,
optionally substituted with from 1-2 (e.g., 1) Ra.
In certain embodiments, Rn can be unsubsrituted branched or unbranched C1-C10 (e.g.,
C1-C5, C1-C3, C2-C8, or C3-C8) alkyl. In embodiments, Rn can be unsubstituted C1-C3 alkyl.
For example, Rn can be methyl (CH3). As another example, Rn can be ethyl (CH2CH3). As a
further example, Rn can be isopropyl (CH(CH3)2). In still another example, Rn can be
CH2CH2CH3, CH(CH3)2, or CH(CH3)CH2CH3.
In certain embodiments, Rn can be C1-C10 (e.g., C1-C5 or C1-C3) haloalkyl. For
example, Rn can be CF3 or CH2CH2CH2Cl.
In certain embodiments, Rn can be C2-C8 alkyl or C3-C8 alkyl substituted with 1 -2
(e.g., 1) Ra, Ra can be hydroxyl; C1-C3 alkoxy; NRgRh; aryl heterocyclyl including 8-10 atoms
optionally substituted with from 1 -3 Rh (e.g., oxo); or C(O)ORj; or Ra can be hydroxyl; C1-C3
alkoxy; NRgRh; halo; arylhctcrocyclyl including 8-10 atoms, optionally substituted with from
1-3 Rb; cyano; or C(O)ORj. For example, example, Rn can be branched or unbranched C3-C8
alkyl, which is substituted with 1-2 (e.g., 1) Ra. In certain embodiments, Ra can be:
(i) hydroxyl; or
(ii) C1-C3 alkoxy (e.g., OCH3); or
(iii) NRgRh (e.g., Rg and Rh can be, independently of one another, hydrogen; C1-C6
alkyl, optionally substituted with from 1-2 Ra; C7-C10 aralkyl, optionally substituted with from
1-2 Ra; -C(O)Rj; or -S(O)nRm; e.g., Ra can be NH2, NHCH3, NH(Et), or NH(i-propyl)); or
(iv) cyano; or
(v) arylheterocyclyl including 8-20, e.g., 8-10, atoms optionally substituted with from
1-4, e.g., 1-2 Rb (e.g., oxo, e.g., Ra can be can be phthalimido); or
(vi) C(O)ORj (e.g., C(O)OCH3 or C(O)OH).
In certain embodiments, Ra can be attached to a secondary or tertiary carbon atom of
the alkyl group.
In some embodiments, Rn can be branched or unbranched C1-C8 (e.g., C1, C2, or C3)
alkyl, which is substituted with 1 Ra. In certain embodiments, Ra can be:
(i) hydroxyl; or
(iii) NRgRh; or
(iv) cyano; or
(v) arylheterocyclyl including 8-20, e.g., 8-10, atoms optionally substituted with from
1-4, e.g., 1-2 Rb (e.g., oxo, e.g., Ra can be can be phthalimido).
In certain embodiments, when Rn is alkyl substituted with one or more Ra, and Ra is
NRgRh, then Rg and Rh can each be, independently,
(i) hydrogen; or
(ii) C1-C8 alkyl (e.g., CH3, CH2CH3, or CH(CH3)CH2CH3) or haloalkyl (e.g.,
CH2CH2F or CH2CH2Cl), each of which is optionally substituted with cyano; or
(iii) C2-C10 alkenyl or C2-C20 alkynyl (e.g., C3 alkenyl or alkynyl); or
(iv) C7-C20 aralkyl (e.g., benzyl), which is optionally substituted with halo (e.g.,
fluoro or chloro); or
(v) C(O)Rj (e.g., Rj can be CH3 or phenyl substituted with -COOH) or SO2Rm (e.g.,
Rm can be CH3).
For example, one of Rg and Rh can be hydrogen or C1-C3 alkyl; and the other can be:
(ii) C1-C8 (e.g., C1-C5) alkyl (e.g., CH3, CH2CH3, or CH(CH3)CH2CH3) or haloalkyl
(e.g., CH2CH2F or CH2CH2Cl), each of which is optionally substituted with cyano; or
(iii) C2-C10 (e.g., C2-C6) alkenyl or C2-C10 (e.g., C2-C6) alkynyl (e.g., C3 alkenyl or
alkynyl); or
(iv) C7-C20 (e.g., C7-C10) aralkyl (e.g., benzyl), which is optionally substituted with
halo (e.g., fluoro or chloro); or
(v) C(O)Rj (e.g., Rj can be CH3 or phenyl substituted with -COOH) or SO2Rm (e.g.,
Rm can be CH3).
In some embodiments, Rn can be -NRgRh.
In certain embodiments, Rg and Rh can each be, independently of one another:
(i) hydrogen; or
(ii) -Cio (e.g., CrC7, C1-C6, C1-C6, Ci, C2-C8, C2, C3-C8) alkyl (branched or
unbranched as appropriate), optionally substituted with from 1-2 (e.g., 1) Rd; or
(iii) C6-C10 aryl (e.g., phenyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rd
(e.g., C1 to C3 alkyl, optionally substituted with 1-2 Ra; halogen, -CN or -CO2Rj);
(iv) C7-C10 aralkyl (e.g. benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb
(e.g., C1 to C3 alkyl, optionally substituted with 1-2 Ra; halogen, -CN or -CO2Rj); or
(v) C7-C10 cycloalkyl, optionally substituted with from 1-3 (e.g., 1-2, 1) Rh; or
(vi) -C(O)Rj.
In certain embodiments, Rg and Rh can each be, independently of one another,
hydrogen; C1-C10 alkyl, optionally substituted with from 1-2 (e.g., 1) Ra; C7-C10 aralkyl,
optionally substituted with from 1-3 (e.g., 1-2, 1) Rb; or -C(O)Rj.
In certain embodiments, Rg and Rh can each be, independently of one another,
hydrogen; C1-C6 unsubstituted alkyl; C2-C8 alkyl substituted with hydroxyl or C1-C3 alkoxy;
benzyl; or -C(O)CH3.
In certain embodiments, one of RBand Rh can be hydrogen or C1-C3 alkyl; and the
other can be:
(ii) C1-C10 (e.g., C1-C7, C1-C6, C1-C3, C1, C2-C8, C2, C3-C8) alkyl or haloalkyl (e.g.,
alkyl, e.g., branched or unbranched), each of which is optionally substituted with from 1-3
(e.g., 1) Ra; or
(iii) C6-C10 aryl (e.g., phenyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rd;
or
(iv) C7-C10 aralkyl (e.g. benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb;
or
(v) C7-C10 cycloalkyl, optionally substituted with from 1-3 (e.g., 1-2, 1) Rb; or
(vi) -C(O)Rj.
In certain embodiments, Rg and Rh can both be:
(i) hydrogen; or
(iv) C7-C10 aralkyl (e.g. benzyl), optionally substituted with from 1-3 (e.g., 1-2, 1) Rb.
In embodiments, Rb can be C1-C20 (e.g., C1-C10, C1-C6, C1-C3) alkoxy (e.g., OCH3).
In certain embodiments, Rn can be -N(H)(Rh), -N(CH3)(Rh), or -N(CH2CH3)(Rh).
In certain embodiments, Rh can be C1-C6 unsubstituted alkyl (e.g., CH3, CH2CH3,
branched or unbranched C3-C6 alkyl); C2-C8 (e.g., C3-C8 branched or unbranched alkyl),
which is substituted with substituted with 1 Ra. In certain embodiments, Ra can be hydroxyl,
C1-C3 alkoxy (e.g., OCH3), NRgRh (e.g., NH2), or cyano, preferably hydroxyl.
In certain embodiments, Rh can be C7-C10 aralkyl (e.g. benzyl), optionally substituted
with 1 Rb (e.g., halo, e.g., fluoro; or C1-C6 alkoxy, e.g., OCH3).
In certain embodiments, Rh can be -C(O)Rj (e.g., -C(O)CH3).
In some embodiments, Rn can be heterocyclyl including 5-10 (e.g., 5-8, 5-6) atoms,
optionally substituted with from 1-5 (e.g., 1-4, 1-3, 1-2, 1, e.g., 1) Rb.
In certain embodiments, Rn can be morpholin-4-yl, 1-piperidyl, 4-piperidyl,
pipcrazin-1-yl, or pyrrolidin-1-yl, each of which is optionally substituted with from 1-3 (e.g.,
1-2, 1) Rb. In certain embodiments, Rb can be C1-C3 alkyl or -C(O)ORj (e.g., Rj can be C1-C4
alkyl, e.g., tert-butyl, or Rj can be C1-C4 alkyl, C7-C20 (e.g., C7-C10) aralkyl, e.g., benzyl).
In some embodiments, Rn can be C7-C10 aralkyl (e.g., benzyl), optionally substituted
with from 1-3 (e.g., 1-2, 1) Rb. In certain embodiments, Rb can be C1-C3 alkyl, which is
optionally substituted with from 1-2 (e.g., 1) Ra; halo; cyano; or C(O)ORj. In certain
embodiments, Rb can be C1-C3 alkyl (e.g., CH3), which is optionally substituted with 1 Ra
(e.g., C(O)ORj, e.g., C(O)OCH3); or halo (e.g., fluoro).
In some embodiments, Rn can be C3-C8 cycloalkyl (e.g., cyclopentyl), optionally
substituted with from 1-3 (e.g., 1-2, 1) Rb.
In some embodiments, Rn can be C2-C6 alkenyl (e.g., allyl, 1-propenyl), optionally
substituted with from 1 -2 Rc.
In some embodiments, Rn is C6-C10 aryl, optionally substituted with from 1-2 Rd. In
certain embodiments, Rd can be C1-C3 alkyl, which is optionally substituted with 1-2 (e.g., 1)
Ra; halo; cyano; or C(O)ORj.
In some embodiments, R1 can be -NRkS(C))nRn. In certain embodiments, Rk can be
hydrogen. In certain embodiments, Rn can be Ci-C6 alkyl (CH3, CH2CH3), optionally
substituted with from 1-2 Ra; or C6-C10 (e.g., phenyl) aryl, optionally substituted with from 1-
2 Rd (e.g., CH3).
In some embodiments, Rf can be -NRkC(O)ORj or -NRkC(O)NRgRh. In certain
embodiments, Rk can be hydrogen. In certain embodiments, Rg, Rh, and Rj can each be,
independently of one another, hydrogen; C1-C6 alkyl, optionally substituted with from 1-2 Ra
(e.g., chloro) or C6-C10 aryl, optionally substituted with from 1-2 Rd (e.g., CH3). In certain
embodiments, R' can be C1-C10 alkyl, optionally substituted with from 1-2 Ra (e.g., chloro). In
certain embodiments, one of Rg and Rh can be hydrogen.
In some embodiments, Rf can be:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally
substituted with from 1 -2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or 1H-benzoimidazolyl, each of which is
optionally substituted with from 1 -2 Re.
In certain embodiments, R1 can be 4,5-dihydrooxazolyl, 2-oxo-imidazolidinyl, 4,5-
dihydro-1H-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-[1,3]oxazinyl, or 2-
oxo-oxazolidinyl, each of which is optionally substituted with from 1 -2 Re.
In certain embodiments, Rf can be 1H-benzoimidazolyl.
In certain embodiments, Re at each occurrence can be, independently, C1 to C3 alkyl
(e.g., CH3) or haloalkyl, each of which is optionally substituted with from 1-2 Ra (e.g.,
C(O)ORj, e.g., C(O)OH); or phenyl.
Variables R4, R5, R6, and R7
In some embodiments, each of R4, R5 and R6 can be, independently of one another,
hydrogen or halo (e.g., fluoro). In certain embodiments, each of R4, R3 and R6 can be
hydrogen. In certain embodiments, each of R4, R5 and R6 can be hydrogen, and R7 can be
other than hydrogen (e.g., C1-C3 haloalkyl, e.g., CF3).
In some embodiments, R7 can be hydrogen, halo, cyano, C1-C10 (e.g., C1-C6 or C1-C3)
alkyl, or C1-C10 (e.g., C1-C6 or C1-C3) haloalkyl, C1-C20 alkoxy (e.g., methoxy), C(O)ORj,
C(O)NRgRh, or SO2Rm.
In some embodiments, R7 can be hydrogen, halo, cyano, C1-C10 (e.g., C1-C6, C1-C3)
alkyl, or C1-C10 (e.g., C1-C6, C1-C3) haloalkyl, or SO2Rm.
In some embodiments, R7 can be hydrogen, fluoro, chloro, cyano, C1-C10 (e.g., C1-C6
or C1-C3) alkyl, or C1-C10 (e.g., C1-C6 or C1-C3) haloalkyl, C1-C20 alkoxy (e.g., methoxy),
C(O)ORj, C(O)NRgRh, or SO2Rm
In some embodiments, R7 can be hydrogen; chloro or bromo (e.g., chloro), cyano, C1-
C10 (e.g., C1-C6, C1-C3) alkyl, or C1-C10 (e.g., C1-C6, C1-C3) haloalkyl, or SO2Rm.
In some embodiments, R7 can be halo, cyano, C1-C10 (e.g., C1-C6 or C1-C3) alkyl, or
C1-C10 (e.g., C1-C6 or C1-C3) haloalkyl, C1-C20 alkoxy (methoxy), C(O)ORj, C(O)NRgRh, or
SO2Rm
In some embodiments, R7 can be halo, cyano, C1-C10 (e.g., C1-C6, C1-C3) alkyl, or C1-
C10 (e.g., C1-C6, C1-C3) haloalkyl, or SO2Rm
In some embodiments, R7 can be fluoro, chloro, cyano, C1-C10 (e.g., C1-C6 or C1-C3)
alkyl, or C1-C10 (e.g., C1-C6 or C1-C3) haloalkyl, C1-C20 alkoxy (e.g., methoxy), C(O)ORj,
C(O)NR8Rh, or SO2Rm.
In some embodiments, R7 can be chloro or bromo (e.g., chloro); cyano, C1-C10 (e.g.,
C1-C6, C1-C3) alkyl, or C1-C10 (e.g., C1-C6, C1-C3) haloalkyl, or SO2Rm.
In some embodiments, R7 can be chloro, cyano, G-G alkyl, C1-C3 haloalkyl, C1-C6
alkoxy, C(O)ORj, C(O)NRgRh or SO2Rm
In some embodiments, R7 can be halo, C1-C10 (e.g., C1-C6 or C1-C3) alkyl, or C1-C10
(e.g., C1-C6 or C1-C3 haloalkyl, G-Go alkoxy (e.g., methoxy), C(O)ORj, C(O)NRgRh, or
SO2Rm.
In some embodiments, R7 can be halo, C1-C10 (e.g., C1-C6, C1-C3) alkyl, or C1-C10
(e.g., C1-C6, C1-C3) haloalkyl, or SO2Rm.
In some embodiments, R7 can be fluoro, chloro, C1-C10 (e.g., C1-C6 or C1-C3) alkyl, or
C1-C10 (e.g., C1-C6 or C1-C3) haloalkyl, C1-C20 alkoxy (e.g., methoxy), C(O)ORj, C(O)NRgRh,
or SO2Rm
Tn some embodiments, R7 can be chloro or bromo (e.g., chloro); C1-C10 (e.g., G-G,
C1-C3) alkyl, or C1-C10 (e.g., C1-C6, C1-C3) haloalkyl, or SO2Rm.
In some embodiments, R7 can be fluoro, C(O)ORj, or C(O)NRgRh.
In some embodiments, R7 can be C(O)ORj or C(O)NRgRh.
In certain embodiments, R7 can be hydrogen; fluoro, chloro; cyano; CH3; CF3; or
SO2CH3. In certain embodiments, R' can be fluoro; chloro; cyano; CH3; CF3; SO2CH3;
SO2CH2CH3; or SO2CH(CH3)2. In certain embodiments, R7 can be other than fluoro, e.g., R7
can be chloro; CH3; CF3; or SO2CH3.
In certain embodiments, R7 can be C1-C6 (e.g., C1-C3) haloalkyl (e.g., CF3).
In certain embodiments, R7 can be halo (e.g., fluoro or chloro, e.g., chloro).
In certain embodiments, R7 can be SO2Rm (e.g., Rm can be CH3, CH2CH3, or
CH(CH3)2).
In certain embodiments, R7 can be hydrogen or cyano.
In certain embodiments, R7 can be C1-C20 alkoxy (e.g., OCH3).In certain
embodiments, R7 can be C(O)ORj (e.g., C(O)OH or C(O)OCH3) or C(O)NRgRh (e.g.,
C(O)NH2).
In some embodiments, when Rf is SO2Rn and Rn is C1-C6 alkyl (e.g., CH3), then R7 is
other than fluoro.
In some embodiments, R7 in the definitions above is other than halo (e.g., fluoro).
A subset of compounds includes those in which R3 has formula (D):
wherein:
W can be a bond; -O-; C1-3 alkylene (e.g., -CH2-); C2-4 alkynylene (e.g., -C≡C-); -
O(C1-3 alkylene)- (e.g., -OCH2-); or -(C1-3 alkylene)O- (e.g., -CH2O-);
one of Rf1, Rf2, Rf3, Rf4, and Rf5 (e.g., Rf1, Rf2, or Rf3; e.g., Rf2 or Rf3; e.g., Rf2) can be:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn or -OS(O)nRn; wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or-OC(O)ORj; or
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkcnyl including 5-10 atoms or 1H-benzoimidazolyl, each of which
is optionally substituted with from 1-3 Re; or
(v) -YRf, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-; and the others are each, independently, hydrogen or Re, in which Rn, n, Rk, Rf, Rg, Rh,
Rj, and Re at each occurrence can be, independently of one another, as defined anywhere
herein.
In some embodiments, one of Rf1, Rf2, Rf3, Rf4, and Rf5 (e.g., Rf1, Rf2, or Rf3; e.g., Rf2
or Rf3; e.g., Rf2) can be:
(i-F) -S(O)nRn or -NRkS(O)nRn, in which n is 1 or 2; or
(ii-F) -NRkC(O)NRgRh or -NRkC(O)ORj; or
(iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1
oxo and optionally substituted with from 1-3 (e.g., 1-2, 1) Rc; or
(iv-F) heterocycloalkcnyl including 5-10 (e.g., 5-7) atoms or 1H-bcnzoimidazolyl,
each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In certain embodiments, four of Rfl, Rf2, Rf3, Rf4, and Rf5 can be hydrogen.
In certain embodiments, three of Rf1, Rf2, Rf3, Rf4, and Rf5 can be hydrogen, and one
of Rf1, Rf2, Rf3, Rf4, and Rf5 can Re (e.g., as shown in formula (B-4), (B-5), (B-6), or (B-7)).
In certain embodiments, one of Rfl, Rf2, Rf3, Rf4, and Rf5 (e.g., Rfl, Rf2, or Rf3; e.g., Rf2
or Rf3; e.g., Rf2) can be -S(O)nRn (e.g., n can be 2; e.g., Rn can be C1-C10 alkyl, optionally
substituted with from 1 -2 Ra; or NRgRh).
Other embodiments can include one of more other features described herein.
Another subset of compounds includes those in which R3 has formula D-1:
wherein:
R3i can be hydrogen; or R32 can be Rc as defined anywhere herein (e.g., halo, e.g.,
fluoro, or chloro);
W can be as defined anywhere herein (e.g., -O- or a bond);
each of RA22 and RA23 is, independently, hydrogen or Rc; and
one of RA24 and RA25 is R1 (e.g., -SO2Rn), and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23 ,RA24, and RA25 is
Re, RA22, RA23, RA24, and RA25 can be as defined anywhere herein. Other embodiments can
include one of more other features described herein.
Another subset of compounds includes those in which:
R3 is heteroaryl including 5-10 (e.g., 5-6) atoms, which is (i) substituted with 1 R10,
and (ii) optionally substituted with from 1 -2 Re; and
W is a bond; and
A has formula (B-9):
wherein:
each of RA22 and RA23 is, independently, hydrogen or Re; and
one of RA24 and RA25 is R1 (e.g., -SO2Rn), and the other is hydrogen or Re;
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Re. RA22, RA23, RA24, and RA25 can be as defined anywhere herein. Other embodiments can
include one of more other features described herein.
Another subset of compounds includes those in which:
R3 has formula (A-4); and
W is a bond; and
A is heteroaryl including 5-8 atoms, which is (a) substituted with 1 R1 (e.g., -SO2Rn),
and (b) optionally substituted with from 1-3 Re, provided that the heteroaryl including 5-8
atoms is not [1,2,4]-oxadiazolyl. Other embodiments can include one of more other features
described herein.
Another subset of compounds includes those in which:
R3 has formula (A-4); and
W is a bond; and
A is tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with 1 Rf
(e.g., -SO2Rn), and (b) optionally substituted with from 1-2 Re. Other embodiments can
include one of more other features described herein.
Another subset of compounds includes those in which:
R3 has formula (A-4); and
W is a bond; and
A is benzo[b]thicnyl-1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-1,1-
dioxide, or 2,3-dihydrobenzo[b]thienyl-1,1-dioxide, each of which is optionally substituted
with from 1-3 Re. Other embodiments can include one of more other features described
herein.
Another subset of compounds includes those in which:
R3 has formula D-1; R32 can be hydrogen or Re (e.g., halo, e.g., fluoro, or chloro); W
can be as defined anywhere herein (e.g., -O- or a bond); each of RA22 and RA23 is,
independently, hydrogen or Re; and
one of RA24 and RA25 is Rf, e.g.:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally
substituted with from 1-2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or 1H-benzoimidazolyl, each of which is
optionally substituted with from 1 -2 Re; and the other is hydrogen or Re.
In certain embodiments, it is provided that only one of RA22, RA23, RA24, and RA25 is
Re. RA22, RA23, RA24, and RA25 can be as defined anywhere herein. Other embodiments can
include one of more other features described herein.
In these embodiments, R32 can be hydrogen; or R32 can be halo (e.g., chloro or
fluoro).
Another subset of compounds includes those in which R3 has formula (E):
in which:
W can be a bond; -O-; C1-3 alkylene (e.g., -CH2-); C2-4 alkynylene (e.g., -C≡C-); -
O(C1-3 alkylene)- (e.g., -OCH2-); or -(C1-3 alkylene)O- (e.g., -CH2O-);
Rfcan be:
(i) -S(O)nRn, -(CH:)1-6S(O)nRa, -NRkS(O)nRn, or -OS(O)nRn; or
(ii) -NRkC(O)NRgRn, -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)ORj; or
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or 1H-benzoimidazolyl, each of which
is optionally substituted with from 1 -3 Re; or
(v) -YRr, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-; and the others are each, independently, hydrogen or Re; and
Re at each occurrence is, independently, halo; C1-C6 alkyl, optionally substituted with
from 1-2 Ra; C1-C3 haloalkyl; C1-C3 alkoxy; NRgRh; phenyl; or 4-fluorophenyl; in which Rn,
n, Rk, Rf, Rg, Rh, Rj, and Re at each occurrence can be, independently of one another, as
defined anywhere herein.
In some embodiments, Rf can be:
(i-F) -S(O)nR11 or -NRkS(O)nRn, in which n is 1 or 2; or
(ii-F) -NRkC(O)NRgRh or -NRkC(O)ORj; or
(iii-F) heterocyclyl including 5-10 (e.g., 5-7) atoms that is substituted with from 1
oxo and optionally substituted with from 1-3 (e.g., 1-2, 1) Re; or
(iv-F) heterocycloalkenyl including 5-10 (e.g., 5-7) atoms or 1H-benzoimidazolyl,
each of which is optionally substituted with from 1-3 (e.g., 1-2, 1) Re.
In certain embodiments, Rf can be -S(O)BRn (e.g., n can be 2; e.g., Rn can be C1-C10
alkyl, optionally substituted with from 1-2 Ra; orNRgRh).
Re can be present or absent (i.e., the positions not occupied by W and R1 can all be
attached to hydrogen or Rc; or a combination thereof).
In certain embodiments, W can be attached to the 2-position of the pyridyl ring, and
Rf can be attached to the 4- or the 6-position of the pyridyl ring. Such rings can be further
substituted with 1, 2 or 3 Rc (e.g., halo, e.g., chloro; or NRgRh e.g., NH2). For example, W
can be attached to the 2-position of the pyridyl ring, Rf can be attached to the 6-position of the
pyridyl ring, and 1 Re can be attached to the 4-position of the pyridyl ring. As another
example, W can be attached to the 2-position of the pyridyl ring, R1 can be attached to the 6-
position of the pyridyl ring, and an Re substituent can be attached to the 3-, 4-, and 5-positions
of the pyridyl ring.
In other embodiments, W can be attached to the 3-position of the pyridyl ring, and R1
can be attached to the 5-position of the pyridyl ring. Such a ring can be further substituted
with 1, 2 or 3 Re (e.g., halo, e.g., chloro; orNRgRh, e.g., NH2).
Other embodiments can include one of more other features described herein.
A further subset of compounds includes those in which R3 has formula F:
in which Rc can be hydrogen; halo; C1-C3 alkyl, optionally substituted with from 1-2 Ra; C1-
C3 haloalkyl; C1-C3 alkoxy; hydroxyl; cyano; nitro; NRgRh; phenyl; or 4-fluorophenyl. In
certain embodiments, Rc can be hydrogen; halo; C1-C6 alkyl, optionally substituted with from
1-2 Ra (e.g., Ra can be C(O)NRsRh); C1-C3 haloalkyl; C1-C3 alkoxy; NRgRh; phenyl; or 4-
fluorophenyl. In certain embodiments, Re can be hydrogen; halo; C1-C3 alkyl, optionally
substituted with from 1-2 Ra (e.g., Ra can be C(O)NRsRh); hydroxyl; cyano; or nitro.
Other embodiments can include one of more other features described herein.
In some embodiments, the compounds can have formula (II):
in which R2, R3, R4, R5, R6, and R7 can be as defined anywhere herein (generically,
subgenerically, or specifically).
In some embodiments, the compounds can have formula (III):
in which R2, R3, and R7 can be as defined herein (generically, subgenerically, or specifically).
In some embodiments, the compounds can have formula (IV) or (IV-1):
in which R2, W, A, R4, R5, R6, R7, and R32 can be as defined herein (generically,
subgenerically, or specifically).
In some embodiments, the compounds can have formula (V):
in which R2, W, A, R , and R32 can be as defined herein (generically, subgenerically., or
specifically).
Other embodiments of the compounds of formulas (II), (III), (IV), (IV-1), (V), and
(V-l) can include any one or more of the features described herein.
It is understood that the actual electronic structure of some chemical entities cannot
be adequately represented by only one canonical form (i.e. Lewis structure). While not
wishing to be bound by theory, the actual structure can instead be some hybrid or weighted
average of two or more canonical forms, known collectively as resonance forms or structures.
Resonance structures are not discrete chemical entities and exist only on paper. They differ
from one another only in the placement or "localization" of the bonding and nonbonding
electrons for a particular chemical entity. It can be possible for one resonance structure to
contribute to a greater extent to the hybrid than the others. Thus, the written and graphical
descriptions of the embodiments of the present invention are made in terms of what the art
recognizes as the predominant resonance form for a particular species.
The compounds described herein can be synthesized according to methods described
herein and/or conventional, organic chemical synthesis methods from commercially available
starting materials and reagents. The compounds described herein can be separated from a
reaction mixture and further purified by a method such as column chromatography, high-
pressure liquid chromatography, or recrystallization. As can be appreciated by the skilled
artisan, further methods of synthesizing the compounds of the formulae herein will be evident
to those of ordinary skill in the art. Additionally, the various synthetic steps may be
performed in an alternate sequence or order to give the desired compounds. Synthetic
chemistry transformations and protecting group methodologies (protection and deprotection)
useful in synthesizing the compounds described herein are known in the art and include, for
example, those such as described in R. Larock, Comprehensive Organic Transformations,
VCH Publishers (1989); T.W. Greene and P.G.M. Wuts. Protective Groups in Organic
Synthesis, 2d. Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's
Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed.,
Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and
subsequent editions thereof.
Synthesis of Halogenated Aryl Sulfones
Halogenated arylsulfones can be prepared using a variety of conventional synthetic
approaches.
In some embodiments, the synthesis can include the partial reduction of a commercial
halogenated arylsulfonyl chloride using sodium sulfite and sodium bicarbonate in water,
typically at 95- 100°C for 0.5 to 1 h to provide the sodium arylsulfinate. The reaction is
cooled, treated with an alkylating agent such as an alkylating agent R-LG in which LC is a
leaving group such as a bromide, iodine, or tosylate. Such alkylating agents can include
without limitation ethyl iodide, 3-bromopropan-1-ol, and the like. A phase transfer catalyst,
typically tetrabutylammonium bromide, is added and the two-phase mixture is heated at 40-
100 °C for several hours to provide the halogenated arylsulfones (Scheme 2).
In other embodiments, halogenated thiophenols can be alkylated with an alkylating
agent in the presence of a base, typically potassium carbonate, in an appropriate solvent such
as acetone. The reaction is typically heated at 40 to 65°C for 1-4 h, cooled, and treated with
aqueous sodium bicarbonate and Oxone. After 18-48 h, the desired halogenated arylsulfones
is isolated (Scheme 3).
In still other embodiments, aryl bromides and iodides can be converted to
halogenated arylsulfones, in particular methylsulfones, using a copper-catalyzed coupling
reaction employing sodium methylsulfinate (Scheme 4).
Scheme 4
Synthesis of Quinoline-Biarylether-sulfones and sulfonamides
In general, compounds in which W is oxygen (O) can be prepared as shown in
Scheme 1 below.
Quinoline-phenols (a nonlimiting example of which is compound 100 is shown at the
top of Scheme 1) can be prepared, for example, as described in Collini et al., US
2005/0131014, which is incorporated by reference herein, and reacted with a halogenatcd
arylsulfone (e.g., 102) or a halogenated arylsulfonamide (e.g., 101). When the halogen is a
fluorine or chlorine, an aromatic displacement is typically performed, usually in a polar,
aprotic solvent such as DMF, DSMO, and the like in the presence of a base, e.g., potassium
carbonate or cesium carbonate, at elevated temperatures, typically from about 100-150°C for
several hours to several days. When the halogen on the halogenated arylsulfone or
halogenated arylsulfonamide is a bromine or iodine, a coupling procedure using a copper salt,
e.g., Cul, can be used in the presence of a ligand such as N,N-dimethylglycine or L-proline, in
a solvent such as 1,4-dioxanc. Such coupling reactions can be performed using conventional
methods known in the art. Examples of the preparation of the halogenated arylsulfones and
halogenated arylsulfonamides as well as the procedures for forming the biarylethers where W
= oxygen are described below are described elsewhere.
Synthesis of Halogenated Aryl Sulfonamides
In general, halogenated arylsulfonamides can be prepared by reaction of halogenated
arylsulfonyl chlorides with amines (Scheme 5).
Preparation of Biarylether sulfones by phenol to aryihalide displacement
In some embodiments, biarylethers can be prepared by displacement reactions
between 4-(3-hydroxyphenyl)-quinolines and halogenated arylsulfones in which the halogen
is preferably fluorine or chlorine. The reactions are typically heated at 100 to 150 °C in a
polar solvent such as DMF, DMSO, and N-methylpyrrolidine for several hours to several days
(Scheme 6).
Preparation of Biarylether sulfones by phenol to aryihalide coupling
In some embodiments, biarylethers can be synthesized by a coupling reaction
between 4-(3-hydroxyphenyl)-quinolines and halogenated arylsulfones where the halogen is
preferably bromine or iodine. The reactions are typically heated at 100 to 150 °C in a polar
solvent such as DMSO, for several hours to several days, with a copper solubilizing reagent
such as L-proline (Scheme 7).
Preparation of Biarylether sulfones by alkylation of methylsulfones
In some embodiments, the quinoline-biarylether-methylsulfones described herein can
be further elaborated by forming the anion of the methylsulfone, typically using a strong base
such as n-butyl lithium of sec-butyl lithium in a solvent such as ether or THF, typically at 0°C
to ambient temperatures, followed by addition of an epoxide to form the 3-
hydroxypropylsulfone as shown in Scheme 8 below.
Preparation of Biaryiether sulfonamides by phenol to arylhalide displacement
In some embodiments, biarylethers with sulfonamide groups can be prepared by
displacement reactions between 4-(3-hydroxyphenyl)-quinolines and halogenated
arylsulfonamides where the halogen is preferably fluorine. The reactions are typically heated
at 100 to 150°C in a polar solvent such as DMF, DMSO, or N-methylpyrrolidine for 2 hours
to 2 days (Scheme 9).
Preparation of Biaryiether sulfonamides by phenol to arylhalide coupling
In other embodiments, biarylethers with sulfonamide substituents can be synthesized
by a coupling reaction between 4-(3-hydroxyphenyl)-quinolines and halogenated
arylsulfonamides where the halogen is preferably bromine or iodine. The reactions are
typically heated at 100 to 150°C in a solvent such as 1,4-dioxane, for several hours to several
days, with a copper solubilizing reagent such as L-proline or N,N-dimethylglycine and a base
such as cesium carbonate (Scheme 10).
Preparation of Ar-OCH2-Ar' compounds
Via phenol alkylation
In some embodiments, alkylation of 4-(3-hydroxyphenyl)-quinolincs with
arylalkylhalides (aralkyl halides) in a solvent such as acetonitrile or DMF in the presence of a
base, typically cesium carbonate or potassium carbonate, generally with heating at reflux for 6
to 24 hours, can provide the benzylsulfone substitution as shown in Scheme 11.
Preparation of Quinoline-Ar-CH2O-Ar' compounds
Via Quinoline-Ar-CH:Br reaction with Ar 'OH
Preparation of quinoline-aryl-CH2O-arylsulfones or quinoline-aryl-CH2O-
arylsulfonamides can be accomplished by conversion of a 4-(3-hydroxymethylphenyl)
quinoline into the corresponding bromide by conventional methods, e.g., reaction with a
brominating agent such as phosphorous tribromide in a solvent such as dichloromethane or
the like. A phenol (or heterophenol) can be alkylated with the benyzlic bromide under typical
alkylation conditions as described in Scheme 11 above or using other conditions such as
sodium hydride or other base in the presence of a solvent such as DMF or THF (Scheme 12).
Preparation of Biarylmethylenes
Via arylborolane to benzylic halide coupling
In some embodiments, biarylmethylenes can be prepared via the use of 4-(3-
[(HO)2B]-phenyl-quinoline by coupling methods using pinacolatoborane and an appropriate
catalyst, e.g., a palladium catalyst, e.g., palladium tetrakistriphenylphosphine (Pd(PPh)3)4
with a base, typically a carbonate of cesium, sodium, or potassium. The borolane formed
undergoes reaction with a benzylic halide, typically a benzylic bromide, to form the quinoline
biarylmethylene (Scheme 13).
Via quinoline-arylhenzylic halide to arylborolane coupling
In other embodiments, biarylmethylenes can be prepared by employing the
benzylhalide as described in Scheme 12, and using an arylboronic acid or heteroarylboronic
acid and similar conditions to those described for Scheme 13 (Scheme 14).
Via quinoline-arylbenzylic halide to arylborolane coupling (e.g., Biaryl-methylenes
with sulfonamide substitution)
In some embodiments, biarylmethylenes with sulfonamide substitution can be
prepared by coupling a borolane with a benzylic bromide as in Scheme 13 using analogous
conditions. The benzylic bromide contains a sulfonic acid ester with a leaving group such as
pentafluorophenol which can be displaced by an amine (HNRgRh) by heating in a solvent such
as THF and the like in the presence of a tertiary amine base such as DBU and the like. This
provides the quinoline-biarylmethylenesulfonamide (Scheme 15).
Preparation of Biaryls
Via Suzuki Coupling with boronic acids
In some embodiments, biaryl or aryl-heteroaryl compounds can be prepared by
coupling of a bromide, iodide, or triflate on the 4-phenylquinoline with a boronic acid with
suitable substitution using typical Suzuki conditions including a palladium catalyst such as
Pd(PPh3)4 and the like along with a base, typically at elevated temperatures (50 - 110 oC).
(Scheme 16)
Scheme 16
Via Suzuki Coupling with borolanes
In other embodiments, biaryl or aryl-heteroaryl compounds can be prepared by
coupling of a borolane containing 4-phenylquinoline with an arylbromide or aryliodide or
with a heteroarylbromidc or heteroaryliodide with suitable substitution. Typical Suzuki
conditions are used, e.g., as in Scheme 16, such as a palladium catalyst, e.g., Pd(PPh3)4, with a
base, typically at elevated temperatures (50 - 110°C). (Scheme 17)
Preparation of Quinoline-Ar-alkvne-Ar" and Quinoline-Ar-CH2CH2-Ar'
Coupling an appropriate aryl bromide in the presence of a palladium catalyst with
trimethyl-tributylstannanylethynyl-silane followed by desilation can provide the aryl-
acetylene. The acetylene can be coupled with an appropriate aryl-halide (bromo or iodo) in
the presence of a palladium catalyst to provide the diphenyl substituted acetylene.
Modification of the acetylene linker can be conveniently carried out using hydrogenation with
heterogeneous catalysis (Scheme 18).
Scheme 18
Preparation of Pyridine-Sulfones
In embodiments where the biarylethersulfones contain a heteroaryl group such as a
pyridine, 4-(3-hydroxyphenyl)quinoline can be reacted with 2,6-difluoropyridine in a polar
solvent such as DMF, in the presence of a base, e.g., potassium carbonate, to afford a 2-
fluoropyridine intermediate which can be reacted with sodium alkylsulfinate in a polar
solvent such as DMF to give the target pyridine-sulfone (Scheme 19).
In other embodiments, pyridine sulfone can be prepared by reaction of 2-chloro-4-
fluoropyridine with a sodium salt of a thiol in a polar solvent such as DMF to afford a 4-
alkylthio-2-chloropyridine which in turn is reacted with a 4-(3-hydroxyphenyl)quinolme
under similar conditions to those above and the resulting sulfide can, if desired, be oxidized
up to the corresponding sulfone using OXONE® (brand name for 2HKO5S.HKO4S.K2O4S) or
other oxidants (Scheme 20).
In other embodiments, pyridine-sulfone can be prepared by the copper-induced
coupling of 3-bromo-5-(methylsulfonyl)pyridine with a 4-(3-hydroxyphenyl)quinoline.
typically using Cul in the presence of N,N-dimethylglycine hydrochloride in the presence of a
base such as cesium carbonate in 1,4-dioxane at elevated temperature, typically at reflux
(Scheme 21).
In other embodiments, pyridine sulfone can be prepared by coupling a 4-bromo-2-
alkylthio-pyridine with a 4-(3-hydroxyphenyl)quinoline under similar coupling conditions as
in Scheme 21 followed by oxidation with OXONE® to the sulfone as in Scheme 20 (Scheme
22).
In some embodiments, substituted pyridylsulfones can be prepared as outlined in
Scheme 23 using a trichloropyridine.
Scheme 23
In some embodiments, bicyclic pyridylsulfones (constrained) can be prepared from
known intermediates as shown in Scheme 25.
Preparation of quinoline-biarylethers with small heterocycle substitutents
In some embodiments, quinolines containing biarylmethylencs with small
heterocycles, such as 2-imidazolinones and 2-oxazolidinones, can be prepared by coupling of
imidazolinones or oxazolidinones to an bromobenzyl alcohol or iodobenzyl alcohol using
copper-induced coupling to afford the benzyl alcohols substituted with 2-imidazolinones or 2-
oxazolidinones. The alcohols can be converted to the bromides, typically using PBr3, as
described in Scheme 12. These are coupled to quinoline containing a borolane under
conditions like those in Scheme 13. (Scheme 26).
Preparation of quinoline-biarylethers with NHSO2Rn. NHC(Q)ORj, and
NHC(O)NHRh
Quinoline biarylethcrs containing substitutents NHSO2Rn, NHC(O)ORj, and
NHC(O)NHRh can be prepared by reacting a fluoronitrobenzene with a quinoline-phenol in a
polar solvent such as DMF or DMA in the presence of a base, typically potassium carbonate
at elevated temperatures, typically 80 - 150°C, for typically 4 to 24 hours. The nitro group is
reduced in the product, typically with tin metal in hydrochloric acid with a cosolvent such as
methanol or ethanol, or by hydrogenation with a palladium catalyst where applicable. The
resulting amine can be reacted with isocyanates to afford ureas, with alkyl chloroformates to
afford carbamates, and with alkylsulfonyl chlorides or arylsulfonyl chlorides to afford
sulfonamides, as in Scheme 27. Several products can be elaborated further by cyclization to
2-imidazolinones (from the ureas) and 2-oxazolidinones (from the carbamates), as also
indicated in Scheme 27:
In some embodiments, amide substitution in which the amide is secondary and
contains a hydroxyl propyl or hydoxyethyl can be cyclized using triflic anhydride to afford
the analogous oxazolines as in Scheme 28.
In some embodiments, oxadiazoles can be prepared by the reaction of an ester with an
amino-oxime as in Scheme 29.
In some embodiments, imidazolines can be prepared by reaction of an ester with a
diamine as in Scheme 30.
Preparation of quinolines with 8-H or 8-SO2R
In some embodiments, compounds in which R7 is hydrogen or SO2Rn can be prepared
according to Scheme 31.
The compounds of this invention may contain one or more asymmetric centers and
thus occur as racemates and racemic mixtures, single enantiomers, individual diastereomers
and diastereomeric mixtures. All such isomeric forms of these compounds are expressly
included in the present invention. The compounds of this invention may also contain linkages
(e.g., carbon-carbon bonds, carbon-nitrogen bonds such as amide bonds) wherein bond
rotation is restricted about that particular linkage, e.g. restriction resulting from the presence
of a ring or double bond. Accordingly, all cis/trans and E/Z isomers and rotational isomers
are expressly included in the present invention. The compounds of this invention may also be
represented in multiple tautomeric forms, in such instances, the invention expressly includes
all tautomeric forms of the compounds described herein, even though only a single tautomeric
form may be represented (e.g., alkylation of a ring system may result in alkylation at multiple
sites, the invention expressly includes all such reaction products). All such isomeric forms of
such compounds are expressly included in the present invention. All crystal forms of the
compounds described herein are expressly included in the present invention.
The compounds of this invention include the compounds themselves, as well as their
salts and their prodrugs, if applicable. A salt, for example, can be formed between an anion
and a positively charged substituent (e.g., amino) on a compound described herein. Suitable
anions include chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, methanesulfonate,
trifluoroacetate, and acetate. Likewise, a salt can also be formed between a cation and a
negatively charged substituent (e.g., carboxylate) on a compound described herein. Suitable
cations include sodium ion, potassium ion, magnesium ion, calcium ion, and an ammonium
cation such as tetramethylammonium ion. Examples of prodrugs include esters and other
pharmaceutically acceptable derivatives, which, upon administration to a subject, are capable
of providing active compounds.
Pharmaceutically acceptable salts of the compounds of this invention include those
derived from pharmaceutically acceptable inorganic and organic acids and bases. Examples of
suitable acid salts include acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate,
bisulfate, butyrate, citrate, camphorate, camphorsulfonate, digluconate, dodecylsulfate,
ethanesulfonate, formate, fumarate, glucoheptanoate, glycolate, hemisulfate, heptanoate,
hexanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate,
malcate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, palmoate,
pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, salicylate,
succinate, sulfate, tartrate, thiocyanate, tosylate and undecanoate. Other acids, such as oxalic,
while not in themselves pharmaceutically acceptable, may be employed in the preparation of
salts useful as intermediates in obtaining the compounds of the invention and their
pharmaceutically acceptable acid addition salts. Salts derived from appropriate bases include
alkali metal (e.g., sodium), alkaline earth metal (e.g., magnesium), ammonium and N-(alkyl)4
salts. This invention also envisions the quatemization of any basic nitrogen-containing
groups of the compounds disclosed herein. Water or oil-soluble or dispersible products may
be obtained by such quatemization. Salt forms of the compounds of any of the formulae
herein can be amino acid salts of carboxy groups (e.g. L-arginine, -lysine, -histidine salts).
The term "pharmaceutically acceptable carrier or adjuvant" refers to a carrier or
adjuvant that may be administered to a subject (e.g., a patient), together with a compound of
this invention, and which does not destroy the pharmacological activity thereof and is
nontoxic when administered in doses sufficient to deliver a therapeutic amount of the
compound.
Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the
compositions of this invention include, but are not limited to, ion exchangers, alumina,
aluminum stearate, lecithin, self-emulsifying drug delivery systems (SEDDS) such as d-α-
tocopherol polyethyleneglycol 1000 succinate, surfactants used in pharmaceutical dosage
forms such as Tweens or other similar polymeric delivery matrices, serum proteins, such as
human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium
sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or
electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen
phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl
pyrrolidone, cellulose-based substances, polyethylene glycol, sodium
carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block
polymers, polyethylene glycol and wool fat. Cyclodextrins such as α-, β-, and γ-cyclodextrin,
or chemically modified derivatives such as hydroxyalkylcyclodextrins, including 2- and 3-
hydroxypropyl-β-cyclodcxtrins, or other solubilized derivatives may also be advantageously
used to enhance delivery of compounds of the formulae described herein.
In general, the compounds described herein can be used for treating (e.g., controlling,
ameliorating, preventing, delaying the onset of, or reducing the risk of developing) one or
more diseases, disorders, conditions or symptoms mediated by LXRs (e.g., cardiovascular
diseases (e.g., acute coronary syndrome, restenosis), atherosclerosis, atherosclerotic lesions,
type I diabetes, type II diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia,
hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL),
cognitive disorders (e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g.,
multiple sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease,
endometriosis, LPS-induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic
inflammation of the artery wall), celiac, or thyroiditis)).
A disorder or physiological condition that is mediated by LXR refers to a disorder or
condition wherein LXR can trigger the onset of the condition, or where inhibition of a
particular LXR can affect signaling in such a way so as to treat, control, ameliorate, prevent,
delay the onset of, or reduce the risk of developing the disorder or condition. Examples of
such disorders include, but are not limited to cardiovascular diseases (e.g., acute coronary
syndrome, restenosis), atherosclerosis, atherosclerotic lesions, type I diabetes, type II
diabetes, Syndrome X, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia,
hypertriglyceridemia, hypercholesterolemia, low HDL and high LDL), cognitive disorders
(e.g., Alzheimer's disease, dementia), inflammatory diseases (e.g., multiple sclerosis,
rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis, LPS-
induced sepsis, acute contact dermatitis of the ear, chronic atherosclerotic inflammation of the
artery wall), celiac, or thyroiditis).
While not wishing to be bound by theory, it is believed that LXR modulators that
activate cholesterol efflux (e.g., upregulate ABCA1), but do not substantially increase
SREBP-1c expression and triglyceride synthesis in liver, can both reduce atherosclerotic risk
and minimize the likelihood of concommitantly increasing serum and hepatic triglyceride
levels. Candidate compounds having differential activity for regulating ABCA1 (ABCG1) vs.
SREBP-1c can be can be evaluated using conventional pharmacological test procedures,
which measure the affinity of a candidate compound to bind to LXR and to upregulate the
gene ABCA1.
In some embodiments, LXR ligands can be identified initially in cell-free LXR beta
and LXR alpha competition binding assays. LXR ligands can be further characterized by
gene expression profiling for tissue selective gene regulation.
In some embodiments, the compounds described herein have agonist activity for
ABCA1 transactivation but do not substantially affect (e.g., inhibit) SREBP-lc gene
expression in differentiated THP-1 macrophages. Gene expression analysis in an antagonist
mode can be used to further delineate differential regulation of ABCA1 and SREBP-lc gene
expression. In certain embodiments, the compounds described herein preferentially
antagonize SREBP-1c activation (a marker for genes involved in cholesterol and fatty acid
homeostasis) but do not substantially affect (e.g., have relatively minimal or additive effects)
on ABCA1 gene expression or genes known to enhance HDL biogenesis (based on a
competition assay with known potent synthetic LXR agonists). Cell type or tissue specificity
may be further evaluated in additional cell lines, intestinal, CaCo2 or liver, HepG2 and Huh-7
cells where ABCA1 activity is believed to influence net cholesterol absorption and reverse
cholesterol transport. The test procedures performed, and results obtained therefrom arc
described in the Examples section.
In some embodiments, the compounds described herein have agonist activity for
ABCA1 and antagonist activity for SREBP-1c (e.g., as determined by gene specific
modulation in cell based assays). In certain embodiments, the compounds described herein
(in the agonist mode) have at least about 20% efficacy for ABCA1 activation by LXR and do
not substantially agonize SREBP-lc (at most about 25% efficacy relative to a reference
compound N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-1 -hydroxy-1 -trifluoromethyl-ethyl)-
phenyl]-benzenesulfonamidc (Schultz, Joshua R., Genes & Development (2000), 14(22),
2831-2838)). In certain embodiments, the compounds described herein (in the antagonist
mode) do not substantially antagonize ABCA1 gene expression. While not wishing to be
bound by theory, it is believed that there may be an additive effect on ABCA1 gene
expression relative to the reference compound at their EC50 concentration. In certain
embodiments, the compounds described herein (in the antagonist mode) inhibited agonist-
mediated SREBP-1c gene expression in a dose dependent fashion.
In some embodiments, to study the effect of the compounds of formula (1) on skin
aging, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed
for the levels of expression of TIMP1, ABCA12, decorin, TNFa, MMP1, MMP3, and/or 1L-8.
The levels of gene expression (i.e., a gene expression pattern) can be quantified, for example,
by Northern blot analysis or RT-PCR, by measuring the amount of protein produced, or by
measuring the levels of activity of TIMP1, ABCA12, decorin, TNFα, MMP1, MMP3, and/or
IL-8, all by methods known to those of ordinary skill in the art. In this way, the gene
expression pattern can serve as a marker, indicative of the physiological response of the cells
to the compounds of formula (1). Accordingly, this response state may be determined before,
and at various points during, treatment of the individual with the compounds of formula (I).
In one embodiment, expression levels of cytokines and metalloproteases described
herein can be used to facilitate design and/or identification of compounds that treat skin aging
through an LXR-based mechanism. Accordingly, the invention provides methods (also
referred to herein as "screening assays") for identifying modulators, i.e., LXR modulators,
that have a stimulatory or inhibitory effect on, for example, TIMP1, ABCA12, decorin,
TNFa, MMP1, MMP3, and/or IL-8 expression.
An exemplary screening assay is a cell-based assay in which a cell that expresses
LXR is contacted with a test compound, and the ability of the test compound to modulate
TIMP1, ABCA12, decorin, TNFa, MMP1, MMP3, and/or IL-8 expression through an LXR-
based mechanism. Determining the ability of the test compound to modulate TIMP1,
ABCA12, decorin, TNFa, MMP1, MMP3, and/or IL-8 expression can be accomplished by
monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of
activity of TIMP 1, ABCA12, decorin, TNFa, MMP1, MMP3, and/or IL-8, all by methods
known to those of ordinary skill in the art. The cell, for example, can be of mammalian
origin, e.g., human.
In some embodiments, to study the effect of the compounds of formula (1) on
osteoarthritis, for example, in a clinical trial, cells can be isolated and RNA prepared and
analyzed for the levels of expression of ApoD and other genes implicated in osteoarthritis (for
example, TNFa). The levels of gene expression (i.e., a gene expression pattern) can be
quantified by Northern blot analysis or RT-PCR, by measuring the amount of protein
produced, or by measuring the levels of activity of ApoD or other genes, all by methods
known to those of ordinary skill in the art. In this way, the gene expression pattern can serve
as a marker, indicative of the physiological response of the cells to the LXR modulator.
Accordingly, this response state may be determined before, and at various points during,
treatment of the individual with the LXR modulator.
An exemplary screening assay is a cell-based assay in which a cell that expresses
LXR is contacted with a test compound, and the ability of the test compound to modulate
ApoD expression and/or aggrecanase activity and/or cytokine elaboration through an LXR-
based mechanism. Determining the ability of the test compound to modulate ApoD
expression and/or aggrecanase activity and/or cytokine elaboration can be accomplished by
monitoring, for example, DNA, mRNA, or protein levels, or by measuring the levels of
activity of ApoD, aggrecanase, and/or TNFα, all by methods known to those of ordinary skill
in the art. The cell, for example, can be of mammalian origin, e.g., human.
In some embodiments, the compounds described herein can be coadministered with
one or more other threapeutic agents. In certain embodiments, the additional agents may be
administered separately, as part of a multiple dose regimen, from the compounds of this
invention (e.g., sequentially, e.g., on different overlapping schedules with the administration
of one or more compounds of formula (I) (including any subgenera or specific compounds
thereof)). Alternatively, these agents may be part of a single dosage form, mixed together
with the compounds of this invention in a single composition. In still another embodiment,
these agents can be given as a separate dose that is administered at about the same time that
one or more compounds of formula (I) (including any subgenera or specific compounds
thereof) are administered (e.g., simultaneously with the administration of one or more
compounds of formula (I) (including any subgenera or specific compounds thereof)). When
the compositions of this invention include a combination of a compound of the formulae
described herein and one or more additional therapeutic or prophylactic agents, both the
compound and the additional agent can be present at dosage levels of between about 1 to
100%, and more preferably between about 5 to 95% of the dosage normally administered in a
monotherapy regimen.
The compounds and compositions described herein can, for example, be administered
orally, parenterally (e.g., subcutaneously, intracutaneously, intravenously, intramuscularly,
intraarticularly, intraarterially, intrasynovially, intrasternally, intrathecally, intralesionally and
by intracranial injection or infusion techniques), by inhalation spray, topically, rectally,
nasally, buccally, vaginally, via an implanted reservoir, by injection, subdermally,
intraperitoneally, transmucosally, or in an ophthalmic preparation, with a dosage ranging
from about 0.01 mg/Kg to about 1000 mg/Kg, (e.g., from about 0.01 to about 100 mg/'kg,
from about 0.1 to about 100 mg/Kg, from about 1 to about 100 mg/Kg, from about 1 to about
10 mg/kg) every 4 to 120 hours, or according to the requirements of the particular drug. The
interrelationship of dosages for animals and humans (based on milligrams per meter squared
of body surface) is described by Freireich et al, Cancer Chemother. Rep. 50,219 (1966).
Body surface area may be approximately determined from height and weight of the patient.
See, e.g.. Scientific Tables, Geigy Pharmaceuticals, Ardsley, New York, 537 (1970). In
certain embodiments, the compositions are administered by oral administration or
administration by injection. The methods herein contemplate administration of an effective
amount of compound or compound composition to achieve the desired or stated effect.
Typically, the pharmaceutical compositions of this invention will be administered from about
1 to about 6 times per day or alternatively, as a continuous infusion. Such administration can
be used as a chronic or acute therapy. The amount of active ingredient that may be combined
with the carrier materials to produce a single dosage form will vary depending upon the host
treated and the particular mode of administration. A typical preparation will contain from
about 5% to about 95% active compound (w/w). Alternatively, such preparations contain
from about 20% to about 80% active compound.
Lower or higher doses than those recited above may be required. Specific dosage and
treatment regimens for any particular patient will depend upon a variety of factors, including
the activity of the specific compound employed, the age, body weight, general health status,
sex, diet, time of administration, rate of excretion, drug combination, the severity and course
of the disease, condition or symptoms, the patient's disposition to the disease, condition or
symptoms, and the judgment of the treating physician.
Upon improvement of a patient's condition, a maintenance dose of a compound,
composition or combination of this invention may be administered, if necessary.
Subsequently, the dosage or frequency of administration, or both, may be reduced, as a
function of the symptoms, to a level at which the improved condition is retained when the
symptoms have been alleviated to the desired level. Patients may, however, require
intermittent treatment on a long-term basis upon any recurrence of disease symptoms.
The compositions of this invention may contain any conventional non-toxic
pharmaccutically-acceptable carriers, adjuvants or vehicles. In some cases, the pH of the
formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to
enhance the stability of the formulated compound or its delivery form.
The compositions may be in the form of a sterile injectable preparation, for example,
as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated
according to techniques known in the art using suitable dispersing or wetting agents (such as,
for example, Tween 80) and suspending agents. The sterile injectable preparation may also be
a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or
solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and
solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium
chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For this purpose, any bland fixed oil may be employed including
synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyecride derivatives
are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils,
such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil
solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, or
carboxymethyl cellulose or similar dispersing agents which are commonly used in the
formulation of pharmaceutically acceptable dosage forms such as emulsions and or
suspensions. Other commonly used surfactants such as Tweens or Spans and/or other similar
emulsifying agents or bioavailability enhancers which are commonly used in the manufacture
of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the
purposes of formulation.
The compositions of this invention may be orally administered in any orally
acceptable dosage form including, but not limited to, capsules, tablets, emulsions and aqueous
suspensions, dispersions and solutions. In the case of tablets for oral use, carriers which are
commonly used include lactose and corn starch. Lubricating agents, such as magnesium
stearate, are also typically added. For oral administration in a capsule form, useful diluents
include lactose and dried corn starch. When aqueous suspensions and/or emulsions are
administered orally, the active ingredient may be suspended or dissolved in an oily phase is
combined with emulsifying and/or suspending agents. If desired, certain sweetening and/or
flavoring and/or coloring agents may be added.
The compositions of this invention may also be administered in the form of
suppositories for rectal administration. These compositions can be prepared by mixing a
compound of this invention with a suitable non-irritating excipient which is solid at room
temperature but liquid at the rectal temperature and therefore will melt in the rectum to
release the active components. Such materials include, but are not limited to, cocoa butter,
beeswax and polyethylene glycols.
Topical administration of the compositions of this invention is useful when the
desired treatment involves areas or organs readily accessible by topical application. For
application topically to the skin, the composition should be formulated with a suitable
ointment containing the active components suspended or dissolved in a carrier. Carriers for
topical administration of the compounds of this invention include, but are not limited to,
mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene
polyoxypropylene compound, emulsifying wax and water. Alternatively, the composition can
be formulated with a suitable lotion or cream containing the active compound suspended or
dissolved in a carrier with suitable emulsifying agents. Suitable carriers include, but are not
limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl
alcohol, 2-octyldodecanol, benzyl alcohol and water. The compositions of this invention may
also be topically applied to the lower intestinal tract by rectal suppository formulation or in a
suitable enema formulation.
Topically-transdermal patches are also included in this invention. Also within the
invention is a patch to deliver active chemotherapeutic combinations herein. A patch includes
a material layer (e.g., polymeric, cloth, gauze, bandage) and the compound of the formulae
herein as delineated herein. One side of the material layer can have a protective layer adhered
to it to resist passage of the compounds or compositions. The patch can additionally include
an adhesive to hold the patch in place on a subject. An adhesive is a composition, including
those of either natural or synthetic origin, that when contacted with the skin of a subject,
temporarily adheres to the skin. It can be water resistant. The adhesive can be placed on the
patch to hold it in contact with the skin of the subject for an extended period of time. The
adhesive can be made of a tackiness, or adhesive strength, such that it holds the device in
place subject to incidental contact, however, upon an affirmative act (e.g., ripping, peeling, or
other intentional removal) the adhesive gives way to the external pressure placed on the
device or the adhesive itself, and allows for breaking of the adhesion contact. The adhesive
can be pressure sensitive, that is, it can allow for positioning of the adhesive (and the device
to be adhered to the skin) against the skin by the application of pressure (e.g., pushing,
rubbing,) on the adhesive or device.
The compositions of this invention may be administered by nasal aerosol or
inhalation. Such compositions are prepared according to techniques well-known in the art of
pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl
alcohol or other suitable preservatives, absorption promoters to enhance bioavailability,
fluorocarbons, and/or other solubilizing or dispersing agents known in the art.
A composition having the compound of the formulae herein and an additional agent
(e.g., a therapeutic agent) can be administered using any of the routes of administration
described herein. In some embodiments, a composition having the compound of the formulae
herein and an additional agent (e.g., a therapeutic agent) can be administered using an
implantable device. Implantable devices and related technology are known in the art and are
useful as delivery systems where a continuous, or timed-release delivery of compounds or
compositions delineated herein is desired. Additionally, the implantable device delivery
system is useful for targeting specific points of compound or composition delivery (e.g.,
localized sites, organs). Negrin et al., Biomaterials, 22(6):563 (2001). Timed-release
technology involving alternate delivery methods can also be used in this invention. For
example, timed-release formulations based on polymer technologies, sustained-release
techniques and encapsulation techniques (e.g., polymeric, liposomal) can also be used for
delivery of the compounds and compositions delineated herein.
The invention will be further described in the following examples. It should be
understood that these examples are for illustrative purposes only and are not to be construed
as limiting this invention in any manner.
EXAMPLES
Example 1
1-(ethylsulfonyl)-3-fluorobenzene
A stirred mixture of 3-fluorobenzenesulfonyl chloride (0.973 g, 5.00 mmol), sodium
bicarbonate (0.84 g, 10.0 mmol), and sodium sulfite (1.16 g, mmol) was heated in water (7
mL) at 95-100 °C for 1 h under nitrogen. The reaction was cooled to -50 °C, treated with
(nBu)4NBr (100 mg) and ethyl iodide (2.5 mL) and heated at 70 °C for 18 h. The reaction
was cooled, treated with water (10 mL) and extracted with dichloromethane (3x15 mL).
The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on silica
gel eluting with an ethyl acetate/hexane gradient of 10/90 to 40/60 afforded the title
compound as a colorless oil (878 mg).
In a similar manner to that described for Example 1 above, the following compounds
were prepared using the corresponding halogenated arylsulfonylchloride and alkylating agent,
and eluting with an appropriate eluent.
Example 2
3-[(2-fluorophenyl)sulfonyl]propan-1-ol
The title compound was prepared using 2-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 3-bromo-1-propanol as the alkylating agent.
MS (ES)m/z 219.0;
HRMS: calcd for C9H11FO3S + H+, 219.04857; found (ESI, [M+H]+), 219.0489.
Example 3
1-fluoro-3-(methylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and iodomethane as the alkylating agent.
MS(ES)m/z 175.0.
Example 4
3-[(3-fluorophenyl)sulfonyl]-2,2-dimethylpropan-1-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 4-bromo-2-methylbutan-2-ol as the alkylating agent.
MS (ES) m/z 246.9.
Example 5
5-[(3-fluorophenyl)sulfonyl]pentan-1-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 5-bromo-1-pentanol as the alkylating agent.
MS (ES) m/z 246.9.
Example 6
1,3-difluoro-5-(mothylsulfonyl)benzene
The title compound was prepared using 3,5-difluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and iodomethane as the alkylating agent.
MS (EI) m/z 192.
Example 7
4-fluoro-1-methyl-2-(methylsulfonyl)benzene
The title compound was prepared using 5-fluoro-2-methylbcnzene-1-sulfonyl
chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent,
mp 77 °C; MS (ES) m/z 188.9.
Example 8
4-bromo-1-methyl-2-(methylsulfonyl)benzene
The title compound was prepared using 5-bromo-2-methylbenzene-1-sulfonyl
chloride as the arylsulfonyl chloride and iodomethane as the alkylating agent,
mp 121 °C.
Example 9
4-bromo-2-(ethylsulfonyl)-1-methylbenzene
The title compound was prepared using 5-bromo-2-methylbenzene-1-sulfonyl
chloride as the arylsulfonyl chloride and iodoethane as the alkylating agent,
mp 49 °C; MS (ES) m/z 262.7.
Example 10
1-fluoro-3-[(3-methylbutyl)sulfonyl]benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent.
MS(ES)m/z 231.0.
Example 11
1-fluoro-3-(isobutylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1 -bromo-2-methylpropane as the alkylating agent.
MS (ES)m/r 217.0.
Example 12
1-fluoro-3-(propylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1-iodopropane as the alkylating agent.
MS (ES) m/z 203.0.
Example 13
3-[(3-fluorophenyl)sulfonyl]propan-1-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 3-bromo-1-propanol as the alkylating agent.
MS (ES) m/z 218.9; HRMS: calcd for C9H11FO3S + H+, 219.04857; found (ESI,
[M+H]+), 219.0475.
Example 14
1-fluoro-3-(isopropylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 2-iodopropane as the alkylating agent.
MS (ES) m/z 203.0.
Example 15
1-(benzylsulfonyl)-3-fluorobenzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and benzylbromide as the alkylating agent.
mp 134-135 °C; HRMS: calcd for C13H11FO2S, 250.04638; found (El, M+.),
250.0469.
Example 16
1,3-dichloro-5-(propylsulfonyl) benzene
The title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1 -iodopropanc as the alkylating agent.
mp 59-61 °C; MS (ES) m/z 252.9; HRMS: calcd for C9H10Cl2O2S, 251.97785; found
(EI, M+.), 251.9776.
Example 17
3-[(3,5-dichlorophenyl)sulfonyl]propan-1-ol
The title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 3-bromo-1-propanol as the alkylating agent,
mp 80-82 °C; MS (ES) m/z 268.9.
Example 18
1-fluoro-3-[(3-methoxypropyl)sulfonyl] benzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and l-bromo-3-methoxypropane as the alkylating agent.
MS (ES) m/z 233.0; HRMS: calcd for C10H13FO3S + H+, 233.06422; found (ESI,
[M+H]-), 233.0643.
Example 19
1,3-dichloro-5-[(3-methylbutyl)sulfonyl] benzene
The title compound was prepared using 3,5-dichlorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1-bromo-3-methylbutane as the alkylating agent.
mp 64-65 °C; MS (ESI) m/z 280; HRMS: calcd for C11H14C12O2S, 280.00915; found
(EI, M+.), 280.0078.
Example 20
1-(cyclopentylsulfonyl)-3-fluorobenzene
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and cyclopenyliodide as the alkylating agent.
MS (ES) m/z 229.0.
Example 21
4-[(3-fluorophenyl)sulfonyl]-2-methylbutan-2-ol
The title compound was prepared using 3-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 4-bromo-2-methylbutan-2-ol as the alkylating agent.
MS (ES) m/z 229.1 [M+H-H20]+1
Example 22
1,4-dibromo-2-(methylsulfonyl)benzene
The title compound was prepared using 2,5-dibromobenzencsulfonyl chloride as the
arylsulfonyl chloride and methyliodode as the alkylating agent.
MS (ES) m/z 312.6.
Example 23
4-bromo-1-methoxy-2-(methylsulfonyl)benzene
The title compound was prepared using 5-bromo-1-methoxy-benzenesulfonyl
chloride as the arylsulfonyl chloride and methyliodode as the alkylating agent.
MS (ES) m/z 264.8.
Example 24
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and iodopropane as the alkylating agent.
1-fluoro-4-(propylsulfonyl)benzene
MS (ES)m/z 203.1.
Example 25
1-(allylsulfonyl)-4-fluorobenzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and allylbromide as the alkylating agent.
MS(ES)w/z 201.0.
Example 26
1-chloro-3-{[(4-fluorophenyl)sulfonyl]methyl}benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1-(bromomethyl)-3-chlorobenzene as the alkylating agent.
MS (ES) m/z 282.9.
Example 27
1-fluoro-4-(isobutylsulfonyl)benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and l-bromo-3-methylbutane as the alkylating agent.
MS (ES) m/z 217.0.
Example 28
ethyl (4-{[(4-fluorophenyl)sulfonyl]methyl}phenyl)acetate
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and ethyl 2-(4-(bromomethyl)phenyl)acetate as the alkylating agent.
MS (ES) m/z 337.0.
Example 29
1-fluoro-4-1(3-methylbutyl)sulfonyl]benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1-bromo-3-methylbutane as the alkylating agent.
MS (ES) m/z 231.0.
Example 30
1-(cyclopentylsulfonyl)-4-fluorobenzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and iodocyclopentane as the alkylating agent.
MS (ES) m/z 229.0.
Example 31
3-[(4-fluorophenyl)sulfonyl)propan-1-ol
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 3-bromo-1-propanol as the alkylating agent.
MS (ES) m/z 219.0; HRMS: calcd for C9H11FO3S + H+, 219.04857; found (ESI,
[M+H]-), 219.048.
Example 32
1-(butylsulfonyl)-4-fluoro benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and iodobutane as the alkylating agent.
MS(ES)m/z217.0.
Example 33
1-fluoro-2-{[(4-iluorophenyl)sulfonyl]methyl}benzene
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 1-(bromomethyl)-2-fluorobenzene as the alkylating agent.
MS (EI) m/z 268.
Example 34
2,5-dimethylbenzyl-4-fluorophenyl sulfone
The title compound was prepared using 4-fluorobenzenesulfonyl chloride as the
arylsulfonyl chloride and 2-(bromomethyl)-l,4-dimethylbenzene as the alkylating agent.
MS(ESI) m/z 278.
Example 35
1-fluoro-3-(isopropylsulfonyl)benzene
A stirred mixture of 3-fluorobcnzenethiol (3.38 mL, 40.0 mmol), potassium carbonate
(11.04 g, 80.0 mmol), and 2-iodopropane (6.00 mL, 60.0 mmol) was heated in acetone (120
mL) at 65-70 °C for 2.5 h under nitrogen. The reaction was cooled, treated with 0.3 M
sodium bicarbonate in water (240 mL) and then, in portions, OXONE® (61.6 g) and stirred at
ambient temperature for 18 h. The reaction was treated with water (100 mL) and extracted
with dichloromethane (2 x 150 mL). The extracts were dried with MgSO4 and concentrated
in vacuo. Chromatography on silica gel eluting with ethyl acetate/hexane gradient of 25/75 to
50/50 afforded the title compound as a slightly orange liquid (6.21 g). HRMS: calcd for
C9H11FO2S, 202.04638; found (EI, M+.), 202.0469.
In a similar manner to that described for Example 35 above, the following
compounds were prepared using the corresponding halogenated thiophenol and alkylating
agent R-LG, and eluting with an appropriate eluent.
Example 36
1-fluoro-3-(methylsulfonyl)benzene
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol
and iodomethane as the alkylating agent.
MS (ES) m/z 175.1
Example 37
1-(ethylsulfonyl)-3-fluoro benzene
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol
and iodoethane as the alkylating agent.
MS (ES) m/z 189.0
Example 38
3-[(3-fluorophenyl)sulfonyl]propan-1-ol
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol
and 3-bromo-1-propanol as the alkylating agent.
MS (ES) m/z 218.9
Example 39
4-[(3-fluorophenyl)sulfonyl]-2-methylbutan-2-ol
The title compound was prepared using 3-fluorobenzenethiol as the as the thiophenol
and 3-hydroxy-3-methylbutyl 4-methylbenzenesulfonate as the alkylating agent.
MS (ES) m/z 229.1 [M+H-H2O]+1
Example 40
1-fluoro-3-(methylsulfonyl)benzene
A stirred mixture of l-bromo-3-fluorobenzene (10.0 g, 57.1 mmol), sodium
methanesulfinate (7.00 g, 68.6 mmol), Cul (1.08 g, 5.71 mmol), L-proline (1.31 g, 11.4
mmol) and sodium hydroxide (0.456 g, 11.4 mmol) was heated in DMSO (135 mL) at 95 °C
overnight (-18 h). The reaction was cooled, diluted with water, and then extracted with ethyl
acetate (2 x 150 mL). The extracts were dried with MgSO4 and concentrated in vacuo.
Chromatography on silica gel eluting with 25/75 ethyl acetate/hexane afforded the title
compound as a colorless solid (6.21 g). MS (ES) m/z 175.1.
In a similar manner to that described for Example 40 above, the following
compounds were prepared using the appropriate arylbromide and eluting with an appropriate
elucnt.
Example 41
1-chloro-3-fluoro-5-(methylsulfonyl)benzene
The title compound was prepared using l-bromo-3-chloro-5-fluorobenzene as the
arylbromide.
MS (EI) m/z 208
Example 42
1,3-difluoro-5-(methylsurfonyl) benzene
The title compound was prepared using 1-bromo-3,5-difluorobenzene as the
arylbromide.
MS (El) m/z 192.
Example 43
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline
A stirred mixture of 3-(3-methyl-8-(trifluoromethyl)quinolin-4-yl)phenol (91 mg,
0.30 mmol), 1-(ethylsulfonyl)-3-fluorobenzene (85 mg, 0.45 mmol), and potassium carbonate
(58 mg, 0.60 mmol) was heated in DMF (1.5 mL) at 150 °C for 18 h under nitrogen. The
reaction was cooled, treated with water (5 mL), and extracted with dichloromethane (3x5
mL). The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on
silica gel eluting with ethyl acetate/hexane gradient of 10/90 to 40/60, affordedthe title
compound as an off-white solid (136 mg). MS (ES) m/z 471.8. HRMS: calcd for
C25H20F3NO3S + H+, 472.11887; found (ESI, [M+H]+), 472.1194.
In a similar manner to that described for Example 43 above, the following
compounds were prepared using the corresponding halogenated arylsulfone and quinoline
phenol, and eluting with an appropriate eluent. When normal phase purification on silica gel
did not provide pure compounds, additional purification using reverse phase chromatography
was used to further purify the compounds. In some instances, ethyl acetate was used in place
of methylene chloride in the extraction step.
Example 44
3-methyl-4-{3-[3-(propylsulfonyl)phenoxylphenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 485.8; HRMS: calcd for C26H22F3NO3S + H+, 486.13452; found (ESI,
[M+H]+), 486.1326.
Example 45
4-{3-l3-(isopropylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 485.8; HRMS: calcd for C26H22F3NO3S + H+, 486.13452; found (ESI,
[M+H]+), 486.1349.
Example 46
4-{3-[3-(benzylsulfonyl)phenoxylphenyl}-3-methyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 533.8; HRMS: calcd for C30H22F3NO3S + H+, 534.13452; found (ESI,
[M+H]+), 534.1346.
Example 47
3-methyl-4-{3-[2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluorornethyl)quinoline
mp 203-205 °C; MS (ES) m/z 457.8; HRMS: calcd for C24H18F3NO3S + H+.
458.10322; found (ESI, [M+H]+), 458.1016.
Example 48
4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 499.8; HRMS: calcd for C27H24F3NO3S + H+, 500.15017; found (ESI,
[M+H]+), 500.1494.
Example 49
3-methyl-4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 513.8; HRMS: calcd for C28H26F3NO3S + H+, 514.16582; found (ESI,
[M+H]+), 514.1642.
Example 50
3-[(2-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
mp 73-75 °C (not very sharp); MS (ES) m/z 501.8; HRMS: calcd for C26H22F3NO4S +
H+, 502.12944; found (ESI, [M+H]+), 502.1281.
Example 51
4-{3-[3-chloro-5-(propylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 519.7; HRMS: calcd for C26H21ClF3NO3S + H+, 520.09555; found
(ESI, [M+H]+), 520.0947.
Example 52
3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 501.8; HRMS: calcd for C26H22F3N04S + H+, 502.12944; found (ESI,
[M+H]+), 502.1304.
Example 53
4-(3-{3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 515.9; HRMS: calcd for C27H24F3NO4S + H+, 516.14509; found (ESI,
[M+H]+), 516.1458.
Example 54
4-(3-{3-chloro-5-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 548.0; HRMS: calcd for C28H25ClF3NO3S + H+, 548.12685; found
(ESI, [M+H]+), 548.1264.
Example 55
3-[(4-{3-[3-methyl-8-(trifluoromethyl)quinoIin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 502.0; HRMS: calcd for C26H22F3NO4S + H+, 502.12944; found (ESI,
[M+H]+), 502.1301.
Example 56
3-methyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 458.0; HRMS: calcd for C24H18F3NO3S + H+, 458.10322; found (ESI,
[M+H]+), 458.1037.
Example 57
2-methyl-4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]butan-2-ol
MS (ES) m/z 529.8; HRMS: calcd for C28H26F3NO4S + H+, 530.16074; found (ESI,
[M+H]+), 530.159.
Example 58
3-benzyl-8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 499.9; HRMS: calcd for C29H22ClNO3S + H+, 500.10817; found (ESI,
[M+H]+), 500.1083.
Example 59
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 457.8; HRMS: calcd for C24H18F3NO3S + H+, 458.10322; found (ESI,
[M+H]+), 458.1017.
Example 60
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 475.8.
Example 61
8-chIoro-3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 424.1; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI,
[M+H]+), 424.0781.
Example 62
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 491.7.
Example 63
2,2-dimethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 529.9.
Example 64
4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]butan-1-ol
MS (ES) m/z 515.9; HRMS: calcd for C27H24F3NO4S + H+, 516.14509; found (ESI,
[M+H]+), 516.1459;
Example 65
5-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]pentan-1-ol
MS (ES) m/z 529.9; HRMS: calcd for C28H26F3NO4S + H+, 530.16074; found (ESI,
[M+H]+), 530.1598;
Example 66
3-benzyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 533.8.
Example 67
3-benzyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 533.8.
Example 68
3-benzyl-4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 575.8.
Example 69
3-benzyl-4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 589.8.
Example 70
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
mp 147-148 °C; MS (ES) m/z 443.9.
Example 71
3-[(3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 577.8.
Example 72
3-benzyl-4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 548.0.
Example 73
3-benzyl-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 562.0.
Example 74
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 458.0.
Example 75
4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 474.0.
Example 76
4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 472.0.
Example 77
4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 486.0.
Example 78
4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline
MS (ES) m/z 500.0.
Example 79
4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline
MS (ES) m/z 537.9.
Example 80
3-[(4-{3-[8-(trifluoromcthyI)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 488.0.
Example 81
4-{3-[4-(butylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 486.0.
Example 82
2-[(4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]ethanol
MS (ES) m/z 472.0.
Example 83
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 470.2.
Example 84
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
mp 147 °C; MS (ES) m/z 457.9; HRMS: calcd for C24H18F3NO3S + H+, 458.10322;
found (ESI, [M+H]+), 458.1019.
Example 85
4-{3-[3-(propylsulfonyl)phenoxy)phenyl}-8-(trifluoromethyl)quinoline
mp 133 °C; MS (ESI) m/z 472.1199; HRMS: calcd for C25H20F3NO3S + H+,
472.11887; found (ESI, [M+H]+), 472.1199.
Example 86
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 472.0.
Example 87
4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 486.0.
Example 88
4-(3-{3-[(3-methylbutyl)sulfonyllphenoxy}phenyl)-8-(trifluoromethyl)quinoline
MS (ES) m/z 500.0.
Example 89
4-{3-[3-(cyclopentylsulfonyl)phenoxy]pheny]}-8-(trifluoromethyl)quinoline
MS (ES) m/z 497.9.
Example 90
4-{3-[3-(benzylsulfonyl)phenoxylphenyl}-8-(trifluoromethyl)qulnoline
MS (ES) m/z 519.9.
Example 91
3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 488.0.
Example 92
ethyl (4-{[(4-{3-[8-(trifluoromethyl)quinolin-4-
yl] phenoxy} phenyl)sulfonyl] methyl} phenyl)acetate
MS (ES) m/z 606.0.
Example 93
4-(3-{4-[(2,5-dimethylbenzyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
mp 94-96 °C; MS (ES) m/z 548.0.
Example 94
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
mp 88-90 °C; MS (ES) m/z 444.0.
Example 95
3-benzyl-4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 64-66 °C; MS (ES) m/z 562.0.
Example 96
3-benzyl-4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
mp 77-79 °C; MS (ES) m/z 576.1.
Example 97
3-benzyl-4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 590.0.
Example 98
3-benzyl-4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
mp 99-101 °C; MS (ES) m/z 628.0.
Example 99
3-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl] phenoxy}phenyl)sulfonyl]propan-1-ol
MS (ES) m/z 578.0.
Example 100
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-3-benzyl-8-(trifluoromethyl)quinolline
MS (ES) m/z 560.2.
Example 101
3-benzyl-4-{3-[4-(butylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 576.0.
Example 102
3-benzyl-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 548.0.
Example 103
3-benzyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 562.0.
Example 104
3-benzyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 562.0.
Example 105
3-benzyl-4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 610.0.
Example 106
3-benzyl-4-(3-{3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 592.0.
Example 107
3-benzyl-4-{3-[3-(cyclopentylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 588.0.
Example 108
4-[(3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]-2-
methylbutan-2-ol
MS (ES) m/z 606.0.
Example 109
4-{3-[4-methyl-2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
mp 83-84 °C; MS (ES) m/z 457.9.
Example 110
4-{3-[4-methyl-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
mp 147-149 °C; MS (ES) m/z 457.8.
Example 111
4-{3-[2-fluoro-5-(methylsulfonyl)phenoxy)phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 461.8.
Example 112
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carbonitrile
MS (ES) m/z 486.8.
Examnle 113
4-(3-{3-[(3-hydroxy-3-methy]butyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 540.8.
Example 114
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile
MS (ES) m/z 496.8.
Example 115
4-{3-13-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile
MS (ES) m/z 482.8.
Example 116
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile
MS (ES) m/z 468.7.
Example 117
4-{3-[3-(methylsulfonyl)phenoxylphenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile
MS (ESI) m/z 469.
Example 118
[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]acetic
acid
MS (ES) m/z 577.9; HRMS: calcd for C31H22F3NO5S + H+, 578.12435; found (ESI,
[M+HD, 578.1264.
Example 119
N-{2-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]ethyl}propan-2-amine
MS (ES) m/z 605.0; HRMS: calcd for C34H31F3N2O3S + H+, 605.20802; found (ESI,
[M+H]+), 605.2053.
Example 120
4-[3-(4-{[2-(isopropylamino)ethyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 540.0.
Example 121
ethyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxylate
MS (ES) m/z 515.8.
Example 122
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxylic acid
MS (ES) m/z 487.7.
Example 123
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carbonitrile
MS (ES) m/z 486.9.
Example 124
4-{3-[4-methoxy-3-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
The general procedure is essentially the same as that described by Dawei Ma and
Qian Cai in Organic Letters 2003, 5, 3799-3802.
A stirred mixture of 3-(3-methyl-8-(trifluoromethyl)quinolin-4-yl)phcnol (151 mg,
0.50 mmol), 4-bromo-1 -methoxy-2-(methylsulfonyl)benzene (199 mg, 0.75 mmol), N,N-
dimethylglycine hydrochloride (28 mg, 0.020 mmol), Cul (20 mg, 0.10 mmol) and Cs2CO3
(326 mg, 1.00 mmol) was heated in 1,4-dioxane (3.0 mL) at 105-110 °C for 44 h under
nitrogen. The reaction was cooled, treated with water, and extracted with dichloromethane.
The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography on silica
gel eluting with ethyl acetate/hexane gradient of 10/90 to 20/80, with further purification on
reverse phase chromatography, afforded the title compound as a white foam-solid (49 mg).
MS (ES) m/z 487.7.
In a similar manner to that described for Example 124 above, or using cesium
carbonate as base, N,N-dimethylglycine in place of L-proline, and 1,4-dioxane as solvent, the
following compounds were prepared using the appropriate halogenated arylsulfone and
quinolinc phenol:
Example 125 is the same compound as Example 110 but using the method described
in Example 124.
4-{3-[4-methyl-3-(methylsulfonyl)phenoxy]phenyl}-8-(tritluoromethyl)quinoline
mp 147-149 °C; MS (ES) m/z 457.8.
Example 126
3-methyl-4-(3-{3-[(methylsulfonyl)methyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
MS(ES)m/z471.8.
Example 127
8-chloro-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-propylquinoline
A stirred mixture of 3-(8-chloro-3-propylquinolin-4-yl)phenol (108 mg, 0.40 mmol),
4-[(fluorophenyl)sulfonyl]morpholine (102 mg, 0.50 mmol), and potassium carbonate (70 mg,
0.50 mmol) was heated in DMF (1.0 mL) at 100 °C for 20 h under nitrogen. The reaction was
cooled, treated with water (4 mL), and extracted with dichloromethane (2x5 mL). The
extracts were dried with MgSCU and concentrated in vacuo. Chromatography on silica gel
eluting with 35/65 ethyl acetate/hexane afforded the title compound as an oil (113 mg). mp
137-138 °C; MS (ES) m/z 523.1; HRMS: calcd for C28H27ClN2O4S + H+, 523.14528; found
(ESI, [M+H]+), 523.1444.
In a similar manner to that described for Example 127 above, the following
compounds were prepared using the corresponding halogenated arylsulfonamide and
quinoline phenol, and eluting with an appropriate eluent, varying temperature based on
substitution. In general, meta-haloarylsulfonamides were subjected to higher temperatures,
typically 150 °C, while ortho- and para-haloarylsulfonamides can react at lower temperatures,
typically 100 °C to 150 °C. In some instances, higher yields were obtained when R is not H.
Example 128
3-benzyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES)m/z 605.2.
Example 129
4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-phenyl-8-
(trifluoromethyl)quinoline
mp 88 °C; MS (ES) m/z 591.2.
Example 130
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
methylbenzenesulfonamide
mp 77-79 °C; MS (ES) m/z 549.1.
Example 131
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
ethylbenzenesulfonamide
MS (ES) m/z 563.1.
Example 132
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N-
dimethylbenzenesulfonamide
MS (ES) m/z 563.1.
Example 133
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-ethyl-N-
methylbenzenesulfonamide
mp 66 °C; MS (ES) m/z 577.2.
Example 134
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N-
diethylbenzenesulfonamide
mp 80°C; MS (ES) m/z 591.2.
Example 135
3-benzyl-4-{3-[4-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 101 °C; MS (ES) m/z 589.2.
Example 136
3-benzyl-4-{3-[4-(piperidin-1-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 603.2.
Example 137
3-benzyl-4-(3-{4-[(4-methylpiperazin-1-yl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
mp 77 °C; MS (ES) m/z 618.2.
Example 138
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
propylbenzenesulfonamide
MS (ES) m/z 577.2.
Example 139
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
isopropylbenzenesulfonamide
MS (ES) m/z 577.2.
Example 140
N-benzyl-4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
mp 98 °C; MS (ES) m/z 625.2.
Example 141
3-benzyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 118 °C; MS (ES) m/z 605.2.
Example 142
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
methylbenzenesulfonamide
MS (ES) m/z 548.8.
Example 143
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N-
dimethylbenzenesulfonamide
MS (ES) m/z 562.1.
Example 144
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-ethyl-A-
methylbenzenesulfonamide
MS (ES) m/z 576.8.
Example 145
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phcnoxy}-N,N-
diethylbenzenesulfonamide
MS (ES) m/z 590.8.
Example 146
3-benzyl-4-{3-[3-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 588.8.
Example 147
3-benzyl-4-{3-[3-(piperidin-1-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 602.8.
Example 148
3-benzyl-4-(3-{3-[(4-methylpiperazin-1-yl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 617.9.
Example 149
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
propylbenzenesulfonamide
MS (ES) m/z 576.8.
Example 150
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
isopropylbenzenesulfonamide
MS (ES) m/z 574.6.
Example 151
N-benzyl-3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
MS (ES) m/z 622.6.
Example 152
3-methyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 86-88 °C; MS (ES) m/z 529.2; HRMS: calcd for C27H23F3N2O4S + H+,
529.14034; found (ESI, [M+H]+), 529.1417.
Example 153
8-chloro-3-methyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 495.1; HRMS: calcd for C26H23ClN2O4S + H+, 495.11398; found (ESI,
[M+H]+), 495.1144.
Example 154
8-chloro-3-isopropyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline
mp 93-95 °C; MS (ES) m/z 523.1; HRMS: calcd for C28H27ClN2O4S + H+,
523.14528; found (ESI, [M+H]+), 523.1434.
Example 155
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-
dimethylbenzenesulfonamide
MS (ES) m/z 453.1; HRMS: calcd for C24HyClN2O3S + H+, 453.10342; found (ESI,
[M+H]+), 453.1022.
Example 156
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethyl-N-
methylbenzenesulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]+), 467.1195.
Example 157
8-chloro-3-methyl-4-{3-[4-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 479.1; HRMS: calcd for C26H23ClN2O3S + H+, 479.11907; found (ESI,
[M+H]+), 479.1171.
Example 158
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbenzenesulfonamide
MS (ES) m/z 437.1; HRMS: calcd for C23H19CIN2O3S + H+, 439.08777; found (ESI,
[M+H]+), 439.086.
Example 159
8-chloro-4-{3-[3-fluoro-5-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-
methylquinoline
HRMS: calcd for C26H22ClFN2O4S + H+, 513.10456; found (ESI, [M+H]+),
513.1044;
Example 160
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzenesulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]+), 467.1181.
Example 161
N-benzyl-4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide
MS (ES) m/z 515.1; HRMS: calcd for C29H23C1N2O3S + H+, 515.11907; found (ESI,
[M+H]+), 515.1211.
Example 162
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbenzenesulfonamide
MS (ES) m/z 439.1; HRMS: calcd for C23H19ClN2O3S + H+, 439.08777; found (ESI,
[M+H]-), 439.0868.
Example 163
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethylbenzenesulfonamide
MS (ES) m/z 453.1; HRMS: calcd for C24H21ClN2O3S + H+, 453.10342; found (ESI,
[M+H]+), 453.1044.
Example 164
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzenesulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]-), 467.1195.
Example 165]
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-isopropylbenzencsulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]+), 467.1173.
Example 166
N-benzyl-3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide
MS (ES) m/z 515.1; HRMS: calcd for C29H23ClN2O3S + H+, 515.11907; found (ESI,
[M+H]+), 515.1171.
Example 167
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-
dimethylbenzenesulfonamide
MS (ES) m/z 453.1; HRMS: calcd for C24H21ClN2O3S + H+, 453.10342; found (ESI,
[M+H]-), 453.1017.
Example 168
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethyl-N-
methylbenzenesulfonamide
MS (ES) m/z 467.1; HRMS: calcd for C25H23ClN2O3S + H+, 467.11907; found (ESI,
[M+H]+), 467.1183.
Example 169
8-chloro-3-methyl-4-{3-[3-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 479.1; HRMS: calcd for C26H23ClN2O3S + H+, 479.11907; found (ESI,
[M+H]-), 479.1186.
Example 170
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-diethylbenzenesulfonamide
MS (ES) m/z 481.1; HRMS: calcd for C26H25ClN2O3S + H+, 481.13472; found (ESI,
[M+H]-), 481.1336.
Example 171
8-chloro-3-methyl-4-{3-[3-(piperidin-1-ylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 493.1; HRMS: calcd for C27H25ClN2O3S + H+, 493.13472; found (ESI,
[M+H]+), 493.1348.
Example 172
8-chloro-3-methyl-4-(3-{3-[(4-methylpiperazin-1-
yl)sulfonyl]phcnoxy}phenyl)quinoline
MS (ES) m/z 508.1; HRMS: calcd for C27H26ClN3O3S + H+, 508.14561; found (ESI,
[M+HD, 508.1456.
Example 173
8-chloro-3-methyl-4-{3-[3-(piperazin-1-ylsutfonyl)phenoxy]phenyl}quinoline
HRMS: calcd for C26H24ClN3O3S + H+, 494.12996; found (ESI, [M+HD, 494.1311.
Example 174
8-chloro-3-methyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline
A stirred mixture of 3-(8-chloro-3-methylquinolin-4-yl)phenol (100 mg, 0.37 mmol),
4-(3-bromophenylsulfonyl)morpholine (170 mg, 0.56 mmol), CuI (11 mg, 0.056 mmol),
Me3NCH2CO2H hydrochloride (23 mg, 0.167 mmol) and cesium carbonate (70 mg, 0.50
mmol) was heated in 1,4-dioxane (3.0 mL) at 100 oC for 18 h under nitrogen. The reaction
was cooled, treated with water, and extracted with ethyl acetate. The extracts were dried with
MgSO4 and concentrated in vacuo. Chromatography on silica gel eluting with 30/70 ethyl
acetate/hexane afforded the title compound as a tan solid (120 mg).
HRMS: calcd for C26H23ClN2O4S + H+, 495.11398; found (ESI, [M+H]+), 495.1146.
In a similar manner to that described for Example 174 above, the following
compounds were prepared using the corresponding brominated arylsulfonamide and quinoline
phenol, and eluting with an appropriate eluent.
Example 175
8-chloro-3-methyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline
HRMS: calcd for C26H23ClN2O4S + H+, 495.11398; found (ESI, [M+H]-), 495.1146.
Example 176
tert-butyl 4-({3-[3-(8-chloro-3-methylquinolin-4-
yl)phenoxy]phenyl}sulfonyl)piperazine-1-carboxylate
HRMS: calcd for C31H32ClN3O5S + H+, 594.18240; found (ESI, [M+H]), 594.1791.
Example 177
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-(2-
hydroxyethyl)benzenesulfonamide
HRMS: calcd for C24H21ClN2O4S + H+, 469.09833; found (ESI, [M+H]-), 469.0962.
Example 178
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-(2-hydroxyethyl)-N-
methylbenzenesulfonamide
HRMS: calcd for C25H23ClN2O4S + H+, 483.11398; found (ESI, [M+H]+), 483.1148.
Example 179
3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
propylbenzenesulfonamide
HRMS: calcd for C26H23F3N2O3S + H+, 501.14542; found (EST, [M+H]+), 501.1465.
Example 180
N-ethyl-methyl-3-{3-methyl-8-(trifluoromethy)quinolin-4-
yl]phenoxy}benzenesulfonamide
HRMS: calcd for C26H23F3N2O3S + H+, 501.14542; found (ESI, [M+H]+), 501.144.
Example 181
N-(2-hydroxyethyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
MS (ES) m/z 516.8; HRMS: calcd for C26H23F3N2O4S + H+, 517.14034; found (ESI,
[M+H]-), 517.141.
Example 182
N-(2-hydroxyethyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
HRMS: calcd for C25H21F3N2 + H+, 503.12469; found (ESI, [M+H]-), 503.1231.
Example 183
N-(2-hydroxypropyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide
HRMS: calcd for C26H23F3N2O4S+ H+, 517.14034: found (ESI, [M+H]+), 517.1384.
Example 184
N-(2-hydroxy-1-methylpropyl)-3-{3-[3-methyl-8-(trinuoromethyl)quinolin-4-
yl] phenoxy} benzenesulfonamide
HRMS: calcd for C27H25F3N2O4S + H+, 531.15599; found (ESI, [M+H]+), 531.1558.
Example 185
N-(2-hydroxy-2-methylpropyl)-N-methyl-3-{3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl] phenoxy} benzenesulfonamide
MS (ES) m/z 544.9; HRMS: calcd for C28H27F3N2O4S + H+, 545.17164; found (ESI,
[M+H]+), 545.1719.
Example 186
N-(2-methoxy-2-methylpropyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl] phenoxy} benzenesulfonamide
MS (ES) m/z 542.8; HRMS: calcd for C28H27F3N2O4S + H+, 545.17164; found (ESI,
[M+H]+), 545.1698.
Example 187
N-(2-methoxy-2-methylpropyl)-N-methyl-3-{3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl] phenoxy} benzenesulfonamide
MS (ES) m/z 558.9; HRMS: calcd for C29H29F3N2O4S + H+, 559.18729; found (ESI,
[M+H]-), 559.1882.
Example 188
N-(2-hydroxy-1,1-dimethylethyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl] phenoxy} benzenesulfonamide
MS (ES) m/z 528.8; HRMS: calcd for C27H25F3N2O4S + H+, 531.15599; found (ESI,
[M+H]+), 531.1541.
Example 189
4-[3-(6-Fluoro-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-quinoline
3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (0.200 g, 0.658 mmol), 2,6-
difluoropyridine (0.098 g, 0.856 mmol) and K2CO3 (0.181 g, 1.32 mmol) were taken into
DMF (5 mL) and heated at 60 °C overnight under nitrogen atmosphere. The reaction was
cooled, diluted with water and extracted with ethyl acetate. The combined organics were
washed with a solution of half-saturated brine and then dried over MgSO4. The ethyl acetate
was removed and the resulting material was purified via column chromatography to afford the
title compound as an oil (0.242 g, 92%).
Example 190
3-methyl-4-(3-{[6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
4-[3-(6-Fluoro-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-quinolinc (0.236
g, 0.59 mmol) and NaSO2Me (90 mg, 0.89 mmol) in DMF (5 mL) was heated at 60 °C for 3
h. Additional NaSO2Me was added and the reaction was heated at 150 °C overnight.
Additional NaSO2Me was added and heating was continued overnight. The reaction was
cooled, diluted with water, and extracted with ethyl acetate. The combined organics were
washed with a solution of half-saturated brine and then dried over MgSO4. The ethyl acetate
was removed and the resulting material was chromatographed to afford the title compound as
a white solid (0.199 g, 74%). HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI,
[M+H]+), 459.0972.
Example 191
2-chloro-4-(methylthio)pyridine
2-Chloro-4-fluoropyridine (1.00 g, 7.60 mmol) and MeSNa (0.639 g, 9.12 mmol) in
DMF (8 mL) were stirred overnight at ambient temperature. The reaction was treated with
water and extracted with ethyl acetate. The combined organics were washed with a solution
of half-saturated brine, dried over MgSO4, and concentrated in vacuo. Chromatography
afforded the title compound as a colorless oil (0.976 g, 81%).
Example 192
3-Methyl-4-[3-(4-methylsulfanyl-pyridin-2-yloxy)-phenyl]-8-trifluoromethyl-
quinoline
2-Chloro-4-(methylthio)pyridine (0.170 g, 1.07 mmol), 3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl]phenol (0.250 g, 0.822 mmol) and K2CO3 (0.227 g, 1.64
mmol) in DMF (5 mL) were heated at 80 °C overnight. TLC indicated no reaction.
Additional pyridine compound and K2CO3 were added and the reaction was heated at 150 oC
overnight. The reaction was cooled, diluted with water, and extracted with ethyl acetate. The
combined organics were washed with a solution of half-saturated brine, dried over MgSO4,
and concentrated in vacuo. The residue was purifed by chromatography to give the title
compound contaminated with some of the phenol (0.310 g). This material was carried
forward without further purification.
Example 193
3-methyl-4-(3-{[4-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
3-methyl-4-[3-(4-methylsulfanyl-pyridin-2-yloxy)-phenyl]-8-trifluoromethyl-
quinoline in acetone/water (20 mL of 1:1 mixture) was stirred with NaHCO3 (0.207 g, 2.46
mmol) and Oxone (1.26 g, 2.06 mmol) overnight at room temperature. The acetone was
removed under vacuum and the resulting solution was extracted with ethyl acetate. The
combined organics were washed with brine, dried over MgSO4, and concentrated in vacuo.
The residue was purified by chromatography to afford the title compound as a white foam
(231 mg). MS (ES) m/z 458.8; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found
(ESI, [M+H]-), 459.0988.
Examples 194 to 195
In a manner similar to Example 190 to Example 193 above, but starting with 2,6-
difluoropyridine in place of 2-chloro-4-fluoropyridme in the first step, the following 2,6-
pyridine compounds were prepared using the appropriate sodium thiolate.
Example 194
2-methyl-4-[(6-{3-l3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}pyridin-2-
yl)sulfonyl] butan-2-ol
HRMS: calcd for C27H25F3N2O4S + H+, 531.15599; found (ESI, [M+H-], 531.1547.
Example 195
4-[3-({6-[(3-methoxy-3-methylbutyl)sulfonyl]pyridin-2-yl}oxy)phenyl]-3-methyl-
8-(trifluoromethyl)quinolinc
HRMS: calcd for C28H27F3N2O4S + H+, 545.17164; found (ESI, [M+H]+), 545.1656.
Example 196
3-methyl-4-(3-{[5-(methylsulfonyl)pyridin-3-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
3-Bromo-5-(mcthanesulfonyl)pyridine (233 mg, 0.989 mmol, see, e.g., WO
2002/060438 for a description of the synthesis) was added to a mixture of 3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl]phenol (150 mg, 0.494 mmol), Cul (9 mg, 0.0494 mmol), N-
N-dimethylglycine hydrochloride (25 mg, 0.185 mmol), Cs2CO3 (482 mg, 1.47 mmol) in 1,4-
dioxanc (5 mL). The reaction was heated at reflux overnight, then cooled and treated with
water. The mixture was extracted with ethyl acetate and the combined organics dried over
MgSO4 and concentrated in vacuo. The residue was chromatographed to yield the title
compound (140 mg, 62%) as a white solid. MS (ESI) m/z 459; HRMS: calcd for
C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]-), 459.1004.
Example 197
3- Methyl-4-[3-(2-methylsulfanyl-pyridin-4-yloxy)-phenyl]-8-trifluoromethyl-
quinoline
4-Bromo-2-(methylthio)pyridine (201 mg, 0.989 mmol) was added to a mixture of 3-
[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (200 mg, 0.659 mmol), Cul (13 mg, 0.066
mmol), N-N-dimethylglycinc hydrochloride (35 mg, 0.24 mmol), Cs2C03 (644 mg, 1.98
mmol) in 1,4-dioxane (5 mL). After heating at reflux overnight, the reaction was cooled,
treated with water, and extracted with ethyl acetate. The combined extracts were dried over
MgSCu and concentrated in vacuo. The residue was chromatographed to afford the title
compound as a white, tacky solid (279 mg). MS (ES+): 458.9.
Example 198
3-methyl-4-(3-{[2-(methylsulfonyl)pyridin-4-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
3-Methyl-4-[3-(2-methylsulfanyl-pyridin-4-yloxy)-phenyl]-8-trifluoromethyl-
quinoline (226 mg, 0.529 mmol) in a 1:1 mixture of acetone/water (10 mL) was treated with
NaHCO3 (132 mg, 1.58 mmol) and Oxone (325 mg, 1.32 mmol) and stirred overnight at
ambient temperature. The acetone was removed in vacuo and the resulting aqueous mixture
was extracted with ethyl acetate. The combined extracts were dried over MgSO4,
concentrated in vacuo, and the residue purified via column chromatography to afford the title
compound as a white solid (169 mg). MS (ES) m/z 427.0.
Example 199
3,4-Dihydro-2H-thiopyrano[2,3-b]pyridine 1,1,8-trioxidc
30% H2O2 (40.0 mL, 352 mmol) was added slowly to trifluoroacetic acid (225 mL) at
0 °C. The ice bath was removed and the bicyclic pyridyl-sulfide (6.10 g, 40.4 mmol, for
preparation see, e.g., Taylor and Macor, J. Org. Chem. 1987, 52,4280-4287) was added and
the reaction was heated at 45 °C overnight. The reaction was concentrated and the residue
triturated with hot MeOH. The mixture was cooled and filtered to afford the title compound
as a white solid (7.00 g, 87%). MS (ESI) m/z 200.
Example 200
7-Bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (A) and 5-
Bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (B)
3,4-Dihydro-2H-thiopyrano[2,3-b]pyridine 1,1,8-trioxide (1.00 g, 5.02 mmol) and
P(O)Br3 (10.0 g) were heated at 65 °C for 0.5 h. The reaction was cooled and carefully
treated with saturated NaHCO3 with some ethyl acetate to reduce foaming. Solid K2CO3 was
then added until the reaction became basic. The mixture was extracted with ethyl acetate and
the combined extracts were dried over MgSO4 and concentrated in vacuo. The residue was
chromatographed to afford the separated title compounds A (0.245 g) and B (0.156 g) used in
the next step.
Example 201
7-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H-
thiopyrano[2,3-b] pyridine 1,1-dioxide
(3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (172 mg, 0.57 mmol) was
added to a mixture of 7-bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (100
mg, 0.38 mmol), Cul (11 mg, 0.057 mmol), N-N-dimethylglycine HCl (30 mg, 0.213 mmol),
Cs2CO3 (557 mg, 1.71 mmol) in 1,4-dioxane (5 mL) and heated at reflux overnight. The
cooled mixture was extracted with ethyl acetate and the combined extracts were dried over
MgSO4 and concentrated in vacuo. The residue was chromatographed to afford the separated
title compound as a white solid (168 mg). MS (ES) m/z 484.9; HRMS: calcd for
C25H19F3N2O3S + H+, 485.11412; found (ESI, [M+H]+), 485.114.
Example 202
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H-
thiopyrano[2,3-b]pyridine 1,1-dioxide
(3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]phenoI (269 mg, 0.89 mmol) was
added to a solution of 5-bromo-3,4-dihydro-2H-thiopyrano[2,3-b]pyridine 1,1-dioxide (156
mg, 0.595 mmol), Cul (17 mg, 0.089 mmol), N-N-dimethylglycinc HCl (46 mg, 0.333
mmol), CS2CO3 (869 mg, 2.67 mmol) in 1,4-dioxane (5 mL) and heated at reflux overnight.
The cooled mixture was extracted with ethyl acetate and the combined extracts were dried
over MgSO4 and concentrated in vacuo. The residue was chromatographed to afford the
separated title compound as a white solid (127 mg). MS (ES) m/z 485.0; HRMS: calcd for
C25H19F3N2O3S + H+, 485.11412; found (ESI, [M+H]+), 485.1151.
Example 203
2,4,6-Trichloro-pyridine 1-oxide
2,4,6-Trichloropyridinc (4.26 g, 23.4 mmol) was dissolved in trifluoroacetic acid (25
mL) and treated with 30% H2O2 (5.9 mL). The mixture was heated at 100 °C for 4 h, men
cooled and poured into water (150 mL). The mixture was extracted with dichloromethane
and the combined extracts were washed with saturated aqueous NaHCO3, dried over MgSO4
and concentrated in vacuo. The residue was chromatographed to afford the title compound,
which was used without further analysis.
Example 204
4-[3-(4,6-Dichloro-1-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-
quinoline
2,4,6-Trichloro-pyridine 1-oxide (0.244 g, 1.23 mmol), 3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl]phenol (0.250 g, 0.822 mmol) and K2CO3 (0.227 g, 1.64
mmol) were taken into DMF (5 mL) and heated at 80 °C overnight. The reaction was cooled,
diluted with water and extracted with ethyl acetate. The combined organics were washed with
a solution of half-saturated brine, dried over MgSO4, and concentrated in vacuo. The residue
was chromatographed to afford the title compound as a white solid (0.330 g, 86%) used
without further analysis.
Example 205
4-(3-{[4-chloro-6-(methylsulfonyl)-1-oxidopyridin-2-yl]oxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline
4-[3-(4,6-Dichloro-1-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-
quinolinc (330 mg, 0.709 mmol) and sodium methanesulfinate (72 mg, 0.709 mmol) in DMF
(5 mL) were heated at 80 oC overnight. The reaction was cooled, diluted with water and
extracted with ethyl acetate. The combined organics were washed with a solution of half-
saturated brine, dried over MgSO4, and concentrated in vacuo. The residue was
chromatographed to afford the title compound as a white solid (190 mg, 53%). MS (ES) m/z
508.9; HRMS: calcd for C23H16ClF3N2O4S + H+, 509.05442; found (ESI, [M+H]-), 509.0532.
Example 206
4-[3-(4-Chloro-6-methanesulfonyl-pyridin-2-yloxy)-phenyl]-3-methyl-8-
trifluoromethyl-quinoline
4-[3-(4-Chloro-6-methanesulfonyl-1-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-
trifluoromethyl-quinoline (0.122 g, 0.239 mmol) was dissolved in dichloromethane (5 mL)
and treated with PBr3 (0.358 mL of a 1.0M solution in dichloromethane, 0.358 mmol) and
stirred overnight. The reaction was quenched with saturated aqueous NaHCO3, extracted with
ethyl acetate, and the combined extracts dried over MgSO4 and concentrated in vacuo. The
residue was chromatographed to afford the title compound as a white solid (75 mg, 64%).
HRMS: calcd for C23H16ClF3N2O3S + H+, 493.05950; found (ESI, [M+H]"), 493.0591.
Example 207
3,5-dichloro-2-fluoro-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl] phenoxy} pyridin-4-amine
4-Amino-3,5-dichloro-2,6-difluoropyridine (0.850 g, 4.28 mmol) was added to a
solution 3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol (1.00 g, 3.29 mmol). K2CO3
(0.909 g, 6.58 mmol) in acetonitrile (10 mL) and the reaction heated at 50 °C overnight. LC-
MS showed that some of the starting phenol was still present. An additional 0.5 g of the
pyridine was added and heating was continued for 2 h. The cooled reaction was treated with
water and extracted with ethyl acetate. The combined extracts were dried over MgSO4,
concentrated in vacuo, and the residue was purified by chromatography to afford the title
compound as a white foam (1.09 g, 69%). MS (ES) m/z 481.7.
Example 208
3,5-dichloro-2-(methylsulfonyl)-6-{3-(3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}pyridin-4-amine
3,5-Dichloro-2-fluoro-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}pyridin-4-amine (1.068 g, 2.21 mmol) was added to a solution of sodium
methanesulfmate (0.399 g, 3.32 mmol) in DMF (15 mL) and heated at 100 oC for 60 h.
Additional sodium methanesulfmate and DMF were added and the reaction was heated at 120
°C overnight. The cooled reaction was treated with water, extracted with ethyl acetate, and the
combined extracts washed with half-saturated brine. The MgSO4-dried extracts were
concentrated in vacuo and the residue chromatographed to afford the title compound as a
white foam (0.828 g, 70%). MS (ES) m/z 541.7.
Example 209
2-Methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenoxy]-
pyridin-4-ylamine
3,5-Dichloro-2-mcthancsulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-
phenoxy]-pyridin-4-ylaminc (0.692 g, 1.27 mmol) was added to a solution of ammonium
formate (3.50 g, 55.5 mmol) and 10% palladium on carbon (0.139 g) in MeOH (5 mL) and
heated at 60 °C overnight. The reaction was treated with 1.6 g of additional ammonium
formate and another portion of 10% Pd/C and heating continued for several more hours. More
MeOH was added along with 2.5 g of ammonium formate and 0.050 g of 10% Pd/C. The
reaction was heated for another overnight period. The reaction was cooled and filtered
through Celite. The mother liquor was concentrated and the resulting material was purified
via column chromatography to give the title compound, which was carried forward to the next
step (0.400 g, 67%).
Example 210
4-(3-{[4-fluoro-6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline
2-Methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenoxy]-
pyridin-4-ylamine (0.300 g, 0.633 mmol) was added to 70% HF-pyridine (5 mL) in a Teflon
round-bottomed flask and cooled to 0 oC. Sodium nitrite (0.262 g, 3.80 mmol) is added in
portions. The reaction was stirred at 20 °C for 2 h, then at 60 °C for 1 h. The reaction was
cooled to 20 °C and treated with ice followed by neutralization with solid NaHCO3. The
mixture was extracted with ethyl acetate and the combined extracts were washed with water
and dried over MgSO4. The extracts were concentrated in vacuo and the residue
chromatographed to afford the title compound as a white foam (0.159 g, 53%). MS (ES) m/z
477.1.
Example 211
1-(bromomethyl)-4-(methyIsulfonyl)benzene
A stirred mixture of l-methanesulfonyl-4-methyl-benzene (1.30 g, 7.5 mmol), n-
bromosuccinimide (1.30 g, 7.10 mmol), and benzoyl peroxide (70 mg, 0.30 mmol) in CCl4
(70 mL) was heated at reflux for 4 h. The reaction was cooled, fdtcrcd, and concentrated in
vacuo. The combined organic phases were concentrated and the residue chromatographed
eluting with 1:9 ethyl acetate:hexane to afford the title compound as a white solid (0.700 g,
38%). mp 99-101 °C; MS (ES) m/z 248.9.
Example 212
4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline
A mixture of 3-(8-trifluoromethyl-quinolin-4-yl)-phenol (0.100 g, 0.35 mmol), 1-
(bromomethyl)-3-(methylsulfonyl)benzene (0.130g, 0.52 mmol), and cesium carbonate (676
mg, 2.10 mmol) in acetonitrile (5 mL) was stirred at room temperature for 3 h. The reaction
was filtered and concentrated in vacuo and the residue was chromatographed eluting with 1:1
ethyl acetaterhexane to afford the title compound as a white solid foam (0.147 g, 93%). mp
63-65 °C. Calculated mass for C24H18F3NO3S is 457.47; found (ES, [M+H]+), 458.2.
The following compounds were prepared in a similar manner to that described for
Example 212 above substituting the appropriate quinoline-phenol and benzylhalide.
Example 213
4-(3-{[4-(methylsulfonyl)benzylloxy}phenyl)-8-(trifluoromethyl)quinoline
mp 75-77 °C; MS (ES) m/z 458.2.
Example 214
3-benzyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
mp 94-95 °C; MS (ES) m/z 548.0.
Example 215
3-benzyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
mp 77-79 °C; MS (ES) m/z 548.0.
Example 216
3-Methyl-4-{3-[3-(methylsulfony])benzyl]phenyl}-8-(trifluoromethyl)quinoline
3-Methyl-4-[3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifiuoromethyl)quinolinc (0.150 g, 0.363 mmol) was added to a solution of 1 -
(bromomethyl)-3-(methanesulfonyl)benzene (0.181 g, 0.726 mmol), Pd(PPh3)4 (0.021 g,
0.0181 mmol), toluene (5 mL) and EtOH (1 mL) in 2M Na2CO3 (0.55 mL, 1.10 mmol) and
refluxed for 2.5 h. The reaction was cooled, diluted with water, and extracted with ethyl
acetate. The combined organics were washed with water and brine, dried over MgSO4, and
concentrated in vacuo. The residue was chromatographed to afford the title compound as a
yellow solid (0.149 g, 90%). HRMS: calcd for C25H20F3NO2S + H+, 456.12396; found
(HRMS, [M+H]+), 456.1224.
Example 217
3-benzyl-4-{3-[3-(ethylsulfonyl)benzyl)phenyl}-8-(trifluoromethyl)quinoline
To a stirred mixture of 3-benzyl-4-[3-(bromomethyl)phenyl]-8-
(trifluoromethyl)quinoline (182 mg, 0.40 mmol) and 3-ethylsulfonyl-phenylboronic acid (129
mg, 0.60 mmol) in DME (4.0 mL), and 2M aqueous Na2CO3 (0.60 mL, 1.20 mmol) was
added Pd(PPh3)4 (0.023 g, 0.020 mmol). The mixture was heated at 80 °C for 18 h, cooled,
treated with water (15 mL), and extracted with dichloromethane (2x15 mL). The extracts
arc dried (MgSO4) and concentrated in vacuo. The residue was chromatographed on silica gel
eluting with a gradient of 30:70 to 50:50 ethyl acetate:hexanes and the resulting material (R1-
0.5 in the latter solvent system) was further purified on reverse phase using a gradient of
0:100 to 100:0 acetonitrile:water to afford the title compound as a white foam solid (81 mg).
MS (ES) m/z 545.8; HRMS: calcd for C32H26F3NO2S + H+, 546.17091; found (ESI,
[M+H]+), 546.1702.
Example 218
Pentafluorophenyl 3-methylbenzenesulfonate
m-Tolylsulfonyl chloride (2.83 g, 14.8 mmol) was added to a solution of
pentafluorophenol (3.27 g, 17.0 mmol) and triethylamine (3.10 mL, 22.3 mmol) in
dichloromethane (50 mL) and stirred overnight at 20 °C. The reaction was concentrated and
the residue was taken into ethyl acetate and washed sequentially with water, 1N aqueous HCl,
2N aqueous NaOH and brine. The organic layer was dried over MgSO4, concentrated in
vacuo, and chromatographed to afford the title compound as a colorless liquid (4.82 g. 96%).
Example 219
Pentafluorophenyl 3-(bromomethyl)benzenesulfonate
A solution of pentafluorophenyl 3-methylbenzenesulfonate (4.76 g, 14.1 mmol), N-
bromosuccinimide (2.79 g, 15.5 mmol) and AIBN (0.115 g, 0.70 mmol) in CCl4 (75 mL) was
heated at reflux for 2 h. Catalytic benzoyl peroxide was added and heating continued
overnight. The cooled reaction was filtered through Celite and concentrated in vacuo. The
residue was chromatographed to afford the title compound.
Example 220
3-[3-(3-Methyl-8-trifluoromethyl-quinolin-4-yl)-benzyl]-benzenesulfonic acid
pentafluorophenyl ester
3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline (0.575 g, 1.81 mmol) was added to a stirred solution of
pentafluorophenyl 3-(bromomethyl)benzenesulfonate (1.50 g, 3.62 mmol) and Pd(PPh3)4
(0.105 g, 0.091 mmol) in 2M aqueous Na2CO3 (2.7 mL, 5.4 mmol), toluene (15 mL) and
EtOH (3 mL) and heated at reflux for 3 h. The reaction was cooled, diluted with water, and
extracted with ethyl acetate. The combined organics were washed with water and then brine
and dried over MgSO4. The residue from concentration was chromatographed to afford the
title compound sufficiently pure for the next step (0.90 g).
Example 221
3-{3-[3-Methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}-N-
propylbenzenesulfonamide
A solution of 3-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-benzyl]-
benzenesulfonic acid pentafluorophenyl ester (0.150 g, 0.253 mmol), 1-propylamine (0.044 g,
0.759 mmol) and DBU (0.056 mL, 0.38 mmol) in THF was heated at 65 °C for 3 h. The
reaction was cooled and 2N aqueous HC1 is added. The reaction mixture was extracted with
ethyl acetate and dried over MgSO4. The material was chromatographed to afford the title
compound as a white solid (0.154 g). MS (ES) m/z 497.0; HRMS: calcd for C27H25F3N2O2S +
H+, 499.16616; found (ESI, [M+H]+), 499.1689.
The following compounds were prepared in a similar manner to that described above
using the appropriate amine in place of 1-propylamine.
Example 222
N-Ethyl-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl] benzyl} benzenesulfonamide
MS (ES) m/z 499.0; HRMS: calcd for C27H25F3N2O2S + H+, 499.16616; found (ESI,
[M+H]-), 499.1651.
Example 223
N-(2-Hydroxyethyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]benzyl}benzenesulfonamide
MS (ES) m/z 515.0; HRMS: calcd for C27H25F3N2O3S + H+, 515.16107; found (ESI,
[M+H] ), 515.1599.
Example 224
1-(3-Hydroxymethyl-phenyl)-imidazolidin-2-one
3-Iodobenzylalcohol (1.84 g, 7.9 mmol) and 2-imidazolidone (10.15 g, 118 mmol)
are added to a mixture of Cul (0.149 g, 0.79 mmol), K3PO4 (3.33 g, 15.7 mmol), and N,N'-
dimethylethylenediamine (0.17 mL, 1.57 mmol) in DMF (30 mL) and the mixture was heated
at 120 °C overnight. The reaction was cooled, diluted with ethyl acetate, and filtered through
Celite. Water and NaCl were added and the layers separated. The aqueous layer was extracted
several more times and the combined organics were dried over MgSO4 and concentrated. The
resulting material was chromatographed to afford the title compound (0.22 g).
Example 225
1-(3-Bromomethyl-phenyl)-imidazolidin-2-one
1-(3-Hydroxymethyl-phenyl)-imidazolidin-2-onc. (0.220 g, 1.14 mmol) in THF (7
mL) was treated with 1.0 M PBr3 in dichloromethane (2.28 mL, 2.28 mmol). After 1 h, the
reaction was concentrated in vacuo and treated with ethyl acetate and dilute aqueous NaHCO3,
solution. The layers were separated and the organic layer washed with more NaHCO3
solution. The organics were dried over MgSO4, concentrated, and the residue
chromatographed to afford the title compound (0.180 g).
Example 226
1-(3-{3-l3-Methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)imidazolidin-
2-one
3-Methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline (0.150 g, 0.363 mmol) was added to a solution of l-(3-
bromomethyl-phenyl)-imidazolidin-2-one (0.185 g, 0.73 mmol), Pd(PPh3)4 (0.021 g, 0.018
mmol), toluene (5 mL) and EtOH (1 mL) in 2M aqueous Na2CO3 (0.55 mL, 1.09 mmol) and
rcfluxed for 2 h. The reaction was cooled, diluted with water, and extracted with ethyl acetate.
The combined organics were washed with water and brine, then dried over MgSO4. After
concentration, the residue was chromatographed afford the title compound as a white solid
(0.137 g). HRMS: calcd for C27H22F3N3O + H+, 462.17877; found (ESI, [M+H]+), 462.1799.
Example 227
3-(3-Hydroxymethyl-phenyl)-oxazolidin-2-one
3-Bromobenzyl alcohol (1.56 g, 8.34 mmol) and 2-oxazolidone (0.871 g, 10.00
mmol) were added to trans-1,2-diaminocyclohexane (0.10 mL, 0.83 mmol), Cul (0.079 g,
0.417 mmol), and K2CO3 (2.30 g, 16.7 mmol) in dioxane (40 mL) and refluxed overnight.
Additional 2-oxazolidone (1.0 g), Cul and trans-1,2-diaminocyclohexane (0.3 mL) were
added and heating continued 7 h. The reaction mixture was concentrated and the residue
chromatographed to afford the title compound, which was sufficiently pure for the next step
(1.94 g).
Example 228
3-(3-Bromomethyl-phenyl)-oxazolidin-2-one
3-(3-Hydroxymethyl-phenyl)-oxazolidin-2-one (1.61 g, 8.34 mmol, from previous
step) in THF (50 mL) was treated with 1.0 M PBr3 in dichloromethane (16.7 mL, 16.7 mmol)
and stirred for 1 h. The reaction was concentrated to a residue which was treated with ethyl
acetate and dilute aqueous NaHCO3 solution. The layers were separated and the organic layer
was washed with more dilute aqueous NaHCO3. The organic layer was dried over MgSO4 and
concentrated in vacuo. The residue was chromatographed to afford the title compound (1.03
g).
Example 229
3-(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)-l,3-
oxazolidin-2-one
3-methyl-4-[3-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline (0.150 g, 0.363 mmol) was added to 3-(3-bromomethyl-phenyl)-
oxazolidin-2-one (0.185 g, 0.726 mmol) and Pd(PPh3)4 (0.021 g, 0.018 mmol) in toluene (5
mL) and EtOH (1 mL) in 2M aqueous Na2CO3 (0.55 mL, 1.09 mmol) and refluxed for 2 h.
The cooled reaction was diluted with water and extracted with ethyl acetate. The combined
organics were washed with water and brine, and dried over MgSO4. After concentration in
vacuo, the residue was chromatographed to yield afford the title compound as an off-white
solid (0.163 g). MS (ES) m/z 463.1; HRMS: calcd for C27H21F3N2O2 + H-, 463.16279; found
(EST, [M+H]-), 463.1626.
Example 230
8-Chloro-3-methyl-4-[3-(3-nitro-phenoxy)-phenyl]-quinoline
A stirred mixture of 3-(8-chloro-3-methyl-quinolin-4-yl)-phcnol (2.50 g, 9.26 mmol),
l-fluoro-3-nitrobenzene (1.97 mL, 18.5 mmol), and K2CO3 (2.56 g, 18.53 mmol) in DMF (30
mL) was heated at reflux for 4 h. The reaction was cooled, diluted with water, and extracted
with ethyl acetate. The combined organics were washed with a solution of half-saturated brine
and dried over MgSO4. The material was chromatographed eluting with 15:85 ethyl
acetate:hexanc afford the title compound as an off-white solid (2.71 g, 75%). MS (ES) m/z:
391.1
Example 231
3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine
8-Chloro-3-methyl-4-[3-(3-nitro-phenoxy)-phenyl]-quinoline (2.49 g, 6.37 mmol) in
a mixture of concentrated hydrochloric acid (20 mL) and methanol (20 mL) was treated with
tin metal (3.02 g, 25.5 mmol) and heated at 50 °C for 2.5 h. The reaction was cooled and
poured into a large Erlenmeyer flask containing NaHCO3, (50 g), water (100 mL) and some
ethyl acetate. This mixture was stirred for an hour and then extracted with ethyl acetate. The
combined organics were washed with water and brine and dried over MgSO4. The product
was chromatographed eluting with 30:70 ethyl acetate:hexane afford the title compound as a
yellow solid (1.19 g). MS (ES) m/z: 361.1.
Example 232
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxyJphenyl}benzenesulfonamide
A solution of 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phcnoxy]-phenylamine (0.100
g, 0.277 mmol) and tricthylamine (0.080 mL, 0.55 mmol) in THF (3 mL) was treated with
benzenesulfonyl chloride (0.043 mL, 0.33 mmol) and stirred at 20 °C overnight. The reaction
was filtered and concentrated. The residue was purified by reverse phase HPLC (101o 100%
acetonitrile in water) to afford the title compound as a white solid (0.027 g). MS (ES) m/z
499.1; HRMS: calcd for C28H21ClN2O3S + H+, 501.10342; found (ESI, [M+H]+), 501.1042.
The following compounds were prepare in a similar manner to that described above
in Example 232 employing the appropriate quinoline-phenol, fluoronitrobenzene, and RSO2C1
or chloroformate ROC(O)Cl.
Example 233
N-{3-[3-(8-chloro-3-methylquinolin-4-yI)phenoxy]phenyl}methanesulfonamide
Procedure was essentially the same as above except that benzenesulfonyl chloride
was replaced with methancsulfonyl chloride. MS (ES) m/z 437.0; HRMS: calcd for
C23H19ClN2O3S + H+, 439.08777; found (ESI, [M+H]-), 439.0871.
Example 234
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}ethanesulfonamide
Procedure was essentially the same as above except that benzenesulfonyl chloride
was replaced with ethanesulfonyl chloride. MS (ES) m/z 451.0; HRMS: calcd for
C24H21ClN3O3S + H+, 453.10342; found (ESI, [M+H]+), 453.1033.
Example 235
Methyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate
Procedure was essentially the same as above except that benzenesulfonyl chloride
was replaced with methyl chloroformate. MS (ES) m/z 419.1; HRMS: calcd for C24H11ClN2O3
+ H+, 419.11570; found (ESI, [M+H]+), 419.1154.
Example 236
Ethyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate
Procedure was essentially the same as above except that benzenesulfonyl chloride
was replaced with ethyl chloroformate. MS (ES) m/z 431.1; HRMS: calcd for C25H21ClN2O3 +
H+, 433.13135; found (ESI, [M+H]-), 433.1322.
Example 237
Isobutyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate
Procedure was essentially the same as above except that benzenesulfonyl chloride
was replaced with isobutyl chloroformate. MS (ES) m/z 459.1; HRMS: calcd for
C27H25ClN2O3 + H+, 461.16265; found (ESI, [M+H]+), 461.1628.
Example 238
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N'-ethylurea
3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine (0.100 g, 0.277
mmol) in THF (3 mL) was treated with ethyl isocyanate (0.024 mL, 0.31 mmol) and stirred at
20 °C overnight. The reaction was filtered and concentrated. The residue was purified via
reverse phase HPLC (10 to 100% acetonitrile in water) to afford the title compound as a white
solid (0.037 g). MS (ES) m/z 430.1; HRMS: calcd for C25H22ClN3O2 + H+, 432.14733; found
(ESI, [M+H]+), 432.1456.
Examples 239 to 242
The following compounds were prepared in an analogous manner employing the
appropriate quinoline biarylether aniline and isocyanate.
Example 239
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N'-isopropylurea
Procedure was essentially the same as that described above except that ethyl
isocyanate was replaced with isopropyl isocyanate. MS (ES) m/z 444.1; HRMS: calcd for
C26H24ClN3O2 + H+, 446.16298; found (ESI, [M+H]+), 446.1638.
Example 240
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N'-phenylurea
Procedure was essentially the same as that described above except that ethyl
isocyanate was replaced with phenyl isocyanate. MS (ES) m/z 478.1; HRMS: calcd for
C29H22ClN3O2 + H+, 480.14733; found (ESI, [M+H]-), 480.1473.
Example 241
N-(2-Chloroethyl)-N-{3-[3-(8-chloro-3-methylquinolin-4-
yl)phenoxy]phenyl} urea
Prepared in a similar manner to that described above, but adding chloroethyl
isocyanate initially at 0 °C before warming to 20 °C. The title compound was isolated as a
brown foam. HRMS: calcd for C25H21C12N3O2 + H+, 466.10836; found (ESI, [M+H]+),
466.1083.
Example 242
2-Chloroethyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate
3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine (0.265 g, 0.734
mmol) and triethylamine (0.107 mL, 0.77 mmol) in toluene (5 mL) was treated with 2-
chloroethyl chloroformate (0.075 mL, 0.734 mmol) for 1 h. The reaction was quenched with
water and extracted with ethyl acetate. The combined organics were washed with water, dried
over MgSO4 and concentrated. The residue was chromatographed eluting with 30:70 ethyl
acetate:hexanes to afford the title compound as white foam (0.245 g, 72%). HRMS: calcd for
C25H20Cl2N2O3 + H+, 467.09237; found (ESI, [M+H]+), 467.0942.
Example 243
8-Chloro-3-methyl-4-{3-[3-(5-methyl-4,5-dihydro-1,3-oxazol-2-
yl)phenoxy]phenyl}quinoline
A solution of 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(2-hydroxy-
propyl)-benzamide (0.096 g, 0.214 mmol) and DMAP (0.078 g, 0.642 mmol) in
dichloromethane (5 mL) cooled to -40 oC was treated with triflic anhydride (0.054 mL, 0.322
mmol) and the reaction stirred at 20 °C for 1.5 h. Additional triflic anhydride was added and
the reaction stirred overnight. The reaction was passed through a short silica gel plug eluting
with 20:80 methanol:dichloromethane. The solvent was removed and the residue purified via
reverse phase chromatography to afford the title compound as a white solid (17 mg). MS (ES)
m/z 429.1; HRMS: calcd for C26H21ClN2O2 + H+, 429.13643; found (ESI, [M+H]-).
429.1356.
Example 244
1-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-3-methylimidazolidin-
2-one
1-{3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl}-imidazolidin-2-one
(0.100 g, 0.232 mmol) in DMF (3 mL) was stirred with 60% NaH in mineral oil (0.011 g,
0.279 mmol) for 15 min. Iodomcthane (0.017 mL, 0.28 mmol) was added and the reaction
stirred overnight. The reaction was quenched with 1N HCl and the layers were separated. The
aqueous layer was extracted with ethyl acetate. The combined organics were washed with
half-saturated brine and dried over MgSO4. The product was chromatographed to afford the
title compound as a white solid (0.087 g, 85%). HRMS: calcd for C26H22ClN3O2 + H+,
444.14733; found (ESI, [M+H]-), 444.1457.
Example 245
1-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxyJphenyl}-3-ethylimidazolidin-2-
one
The procedure was essentially the same as above (Example 244) except that
iodomethane was replaced with iodoethane. MS (ES) m/z 458.3. HRMS: calcd for
C27H24ClN3O3 + H+, 458.16298; found (ESI, [M+H]+), 458.1599.
Example 246
8-Chloro-4-{3-[3-(4-isopropyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-3-
methylquinoline
3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(1-hydroxymethyl-2-methyl-
propyl)-benzamide (0.059 g, 0.127 mmol) and DAST (0.020 mL, 0.153 mmol) in
dichloromethane (3 mL) was stirred at 20 °C overnight. The reaction was treated with
saturated aqueous NaHCO3 for 0.5 h. The layers were separated and the organic layer was
dried over MgSO4. The crude material was chromatographed to afford the title compound as
yellow oil. HRMS: calcd for C28H25ClN2O2 + H+, 457.16773; found (ESI, [M+H]+),
457.1683.
Example 247
8-Chloro-3-methyl-4-{3-[3-(4-propyl-4,5-dihydro-1,3-oxazol-2-
yl)phenoxy]phenyl}quinoline
The procedure was essentially the same as above (Example 246) except that 3-[3-(8-
chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(l-hydroxymethyl-2-methyl-propyl)-benzamide
was replaced with 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(1-hydroxymethyl-
butyl)-bcnzamide. HRMS: calcd for C28H25ClN2O2 + H+, 457.16773; found (ESI, [M+H]+),
457.1681.
Example 248
8-Chloro-4-{3-[3-(4,4-dimethyl-4,S-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-3-
methylquinoline
The procedure was essentially the same as Example 246 except that 3-[3-(8-chloro-3-
methyl-quinolin-4-yl)-phenoxy]-N-( 1 -hydroxymethyl-2-methyl-propyl)-benzamide was
replaced with 3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-N-(2-hydroxy-1,1 -dimethyl-
ethyl)-benzamide. HRMS: calcd for C27H23ClN2O2 + H+, 443.15208; found (ESI, [M+H]+),
443.1497.
Example 249
3-{3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxyl-phenyl}-2-oxo-imidazolidin-
1-yl)-acetic acid methyl ester
1-{3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl} -imidazolidin-2-one
(0.100 g, 0.232 mmol) in THF (3 mL) was treated with 1.0 M potassium t-butoxide in THF
(0.255 mL, 0.255 mmol) for 15 min. Then methyl bromoacetate (0.044 mL, 0.46 mmol) was
added and the reaction was stirred overnight. The reaction was quenched with 1 N HCl and
extracted with ethyl acetate. The combined extracts were dried over MgSO4 and concentrated.
The residue was chromatographed to afford the title compound as a yellow oil (0.055 g)
carried on to the acid.
Example 250
(3-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-2-oxoimidazolidin-1-
yl)acetic acid
(3-{3-[3-(8-Chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl}-2-oxo-imidazolidin-1-
yl)-acetic acid methyl ester (0.055 g, 0.109 mmol) and 1.0M aqueous LiOH (1 mL) in THF (3
mL) were stirred at 20 °C overnight. The THF was removed in vacuo and the residue was
acidified with 2 N aqueous HCl and extracted with ethyl acetate. The extracts were dried over
MgSO4 and concentrated. The residue was chromatographed to yield afford the title
compound as yellow solid. HRMS: calcd for C27H22ClN3O4 + H+, 488.13716; found (ESI,
[M+H]-), 488.1361.
Example 251
4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyljbutan-2-ol
4-[3-(3-Methanesulfonyl-phenoxy)-phenyl]-3-methyl-8-trifluoromethyl-quinoline
(0.150 g, 0.328 mmol) in ether (2 mL) was treated with 1.4 M s-BuLi in cyclohexane (0.35
mL, 0.49 mmol) and stirred for 15 min. Propylene oxide (0.23 mL, 3.28 mmol) and THF (1
mL) were added and the reaction stirred overnight. The reaction was quenched with saturated
ammonium chloride and extracted with ethyl acetate. The combined organics were dried over
MgSO4 and concentrated. The resulting material was chromatographed to afford the title
compound as tan solid. MS (ES) m/z 515. HRMS: calcd for C27H24F3NO4S + H+, 516.14509;
found (ESI, [M+H]-), 516.1465.
Example 252
1-(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]pentan-3-ol
The procedure was essentially the same as Example 251 above except that propylene
oxide was replaced with 1,2-epoxybutane. MS (ES) m/z 529.8. HRMS: calcd for
C28H26F3NO4S + H+, 530.16074; found (ESI, [M+H]-), 530.1555.
Example 253
1-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl)hexan-3-ol
The procedure was essentially the same as Example 251 except that propylene oxide
was replaced with 1,2-epoxypcntane. MS (ES) m/z 543.8. HRMS: calcd for C29H28F3NO4S +
H+, 544.17639; found (ESI, [M+HD, 544.1757.
Example 254
4-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)butan--2-ol
DMSO (0.073 g, 0.940 mmol) in THF (1.5 mL) was cooled to 0 °C. n-BuLi (0.19 mL,
0.47 mmol, 2.5 M solution in hexanes) was added and stirred 5 min. 8-Chloro-4-[3-(3-
methanesulfonyl-phenoxy)-phenyl]-3-methyl-quinoline (0.100 g, 0.235 mmol) in THF (1 mL)
was added quickly. After stirring for 30 min at 20 °C, propylene oxide (0.050 mL, 0.71 mmol)
was added. After stirring overnight, the reaction was quenched with 1 N aqueous HC1 and
extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated. The
residue was chromatographcd to afford the title compound as an off-white foam-solid (0.048
g). MS (ES) m/z 482.1; HRMS: calcd for C26H24ClNO4S + H+, 482.11873; found (ESI.,
[M+H]-), 482.1169.
Example 255
4-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phcnyl}sulfonyl)-2-
methylbutan-2-ol
The procedure was essentially the same as above except that propylene oxide was
replaced with 1,2-epoxy-2-methylpropane and 1 N HCl was replaced with saturated
ammonium chloride. MS (ES) m/z 495.7; HRMS: calcd for C27H26ClNO4S + H+, 496.13438;
found (EST, [M+HD, 496.1336.
Example 256
4-(3-{3-[3-(tert-Butyl-dimethyl-silanyloxy)-propane-1-sulfonyl]-phenoxy}-
phenyl)-8-chloro-3-methyl-quinoline
The procedure was essentially the same as above except that propylene oxide was
replaced with (2-bromoethoxy)-t-butyldimethylsilane and 1 N HCl was replaced with
saturated ammonium chloride. The compound was carried forward to the next step without
further purification.
Example 257
3-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)propan-1-ol
A solution of 4-(3- {3-[3-(tert-butyl-dimethyl-silanyloxy)-propane-1 -sulfonyl]-
phenoxy}-phenyl)-8-chloro-3-methyl-quinoline in THF (5 mL) was treated with
tetrabutylammonium fluoride (3 equiv) and stirred at 20 °C for 1 h. The reaction was treated
with saturated ammonium chloride and water and extracted with ethyl acetate. The extracts
were washed with brine, dried over MgSO4 and concentrated. The residue was
chromatographed to afford the title compound as a yellow solid. MS (ES) m/z 467.7; HRMS:
calcd for C25H22ClNO4S + H+, 468.10308; found (ESI, [M+H]+), 468.1026.
Example 258
3-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]phenyl trifluoromethanesulfonate
A stirred mixture of 4-(3-hydroxy-phenyl)-8-trifluoromethyl-quinoline-3-carbonitrile
(260 mg, 0.828 mmol) and N-phenylbis(trifluoromethanesulphonimide) (414 mg, 1.16 mmol)
in THF (20 mL) was cooled to 0 °C and treated with potassium tert-butoxide (120 mg, 1.08
mmol) in a lump sum. The resulting orange mixture was stirred at 0 oC for 1 h, then quenched
with water and extracted with ethyl acetate. The organic extracts were dried over MgSO4 and
concentrated in vacuo. The residue was chromatographed eluting with ethyl acetate:hexanc
gradient to afford the title compound as a brown powder (136 mg, 37% yield). MS (ESI) m/z
447.8.
Example 259
N-{3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}methanesulfonamide
A mixture of 3-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]phenyl
trifluoromethanesulfonatc (45 mg, 0.10 mmol), 3-(methanesulfonylamino)phenylboronic acid
(44 mg, 0.20 mmol), K3PO4 (64 mg, 0.30 mmol) and Pd(PPh3)4 (15 mg, 0.13 mmol) in
dioxane (5 mL) was heated at reflux 2 h. The reaction was filtered and the filtrate
concentrated in vacuo. The residue was purified by HPLC to obtain the title compound as a
white solid (25 mg). MS (ES) m/z 467.8; HRMS: calcd for C24H16F3N3O2S + H+, 468.09881;
found (ESI, [M+H]), 468.0981.
The following compounds were prepared in a similar manner to Example 259 above
using the appropriate arylboronic acid and quinoline-aryltriflate.
Example 260
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 452.8; HRMS: calcd for C24H15F3N2O2S + H+, 453.08791; found (ESI,
[M-H]-), 453.0871.
Example 261
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 466.8.
Example 262
N-{3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-
yl} methanesulfonamide
MS (ES) m/z 467.8.
Example 263
N-{3-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}-4-
methylbenzenesulfonamide
MS (ES) m/z 543.9.
Example 264
4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 452.8.
Example 265
4-{3-[1-(phenylsulfonyl)-1H-indol-3-yl]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile
MS (ES) m/z 553.8.
Example 266
3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]-N-methylbiphenyl-3-sulfonamide
MS (ES) m/z 468.
Example 267
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-(1H-tetrazol-5-yl)-8-
(trifluoromethyl)quinoline
A mixture of 4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carbonitrile (30 mg, 0.06 mmol), NaN^ (100 mg, 1.54 mmol), tricthylamine hydrochloride
(200 mg, 1.45 mmol) in DMF (5 mL) was heated at 95 °C overnight. The solid was removed
and the liquid was chromatographed eluting with ethyl acctate:hexane gradient to give the
title compound as a white solid (25 mg, 80%). MS (ES) m/z 512.1.
Example 268
4-(3-bromomethyl-phenyl)-3-methyl-8-trifluoromethyl-quinoline
A stirred mixture of [3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenyl]-methanol
(150 mg, 0.471 mmol) in dry toluene (5 mL) at 0 °C was treated with 1.0 M phosphorous
tribromide in CH2Cl2, (2.9 mL, 2.9 mmol). After 15 min, the reaction was allowed to warm
to 20 °C. After 3 h, the reaction was quenched with water and extracted with ethyl acetate.
The combined organics were dried over MgSO4 and concentrated in vacuo. The residue was
chromatographed eluting with ethyl acetate:hexane to afford the title compound as a light
brown powder (178 mg, 84%). MS (ESI) m/z 380.02.
Example 269
3-methyl-4-[3-({[1-(methylsulfonyl)-1,2,3,4-tetrahydroquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline
1-Methanesulfonyl-1,2,3,4-tetrahydro-quinolin-5-ol (59 mg, 0.26 mmol) in dry DMF
(4 mL) was stirred with 60% sodium hydride in oil (12 mg, 0.31 mmol) for 15 min at 20 °C
and then treated with 4-(3-bromomethyl-phenyl)-3-methyl-8-trifluoromethyl-quinoline (90
mg, 0.237 mmol). After 3 h, the reaction was quenched with water and concentrated in vacuo
to afford a brown powder which was purified by HPLC (watenacetonitrile gradient) to afford
the title compound as an off-white powder (49 mg, 39%). MS (ESI) m/z 526.8.
The following compounds were prepare in a similar manner to Example 269 except
using the appropriate benzylbromide-quinoline and phenol:
Example 270
3-benzy 1-4- [3-({[1 -(methylsulfonyl)-1,2,3,4-tetrahydroquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline
MS (ESI) m/z 602.9.
Example 271
3-benzyl-4-[3-({[2-(methylsulfonyl)-1,2,3,4-tetrahydroisoquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline
MS (ESI) m/z 602.8.
Example 272
3-methyl-4-[3-({[2-(methylsulfonyl)-1,2,3,4-tetrahydroisoquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline
MS (ESI) m/z 526.8
Example 273
3-(2-methoxy-2-oxoethylthio)phenylboronic acid
A mixture of 3-mecraptophenylboronic acid (0.50 g, 3.2 mmol), methyl bromoacetate
(1.5 g, 10 mmol), and potassium carbonate (5.0 g, 37 mmol) in 15 mL of DMF was heated at
45 °C overnight. The reaction was poured into water and extracted with ethyl acetate. The
extracts were dried over MgSO4 and concentrated. The crude material was used for the next
reaction without any further purification.
Example 274
Methyl 2-(3'-(3-cyano-8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylthio)acetate
The title compound was prepared as described in Example 259 using 3-(2-methoxy-2-
oxoethylthio)phenylboronic acid and 3-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]phenyl
trifluoromethanesulfonate.
Example 275
({3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulibnyl)acetic acid
A mixture of methyl 2-(3'-(3-cyano-8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-
ylthio)acetate (25 mg, 0.05 mmol), acetic acid (5 mL), 30% H2O2 was heated at 50 °C for 3 h.
The mixture was poured into water and extracted with n-BuOH. The solvent was removed to
give the title compound as a white solid (10 mg, 37%). MS (ES) m/z 497.0.
Example 276
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide
A mixture of 4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carboxylic acid (100 mg, 0.205 mmol) and N,N-carbonyldiimidazole (85 mg, 0.053 mmol)
in DMF (5 mL) was heated at 60 °C for 1 h. The mixture was cooled and THF (10 mL) and
concentrated NH4OH (15 mL) were added. The reaction was stirred overnight at room
temperature and purified by HPLC to provide the title compound as a white solid (64 mg).
MS (ES) m/z 486.9.
The following compounds were prepared in a similar manner to that described in
Example 276.
Example 277
N-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carboxamide
MS (ES)m/z 501.1.
Example 278
A-ethyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carboxamide
MS (ES)m/z 515.2.
Example 279
3-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
4-(3-Bromo-phenyl)-3-methyl-8-trifluoromethyl-quinoline (0.050 g, 0.14 mmol) in
toluene (3 mL) and ethanol (0.5 mL) was treated with 3-(methancsulfonyl)benzeneboronic
acid (0.30 mmol), 2 M aqueous Na2CO3, (0.25 mL, 0.50 mmol), and Pd(PPh3)4 (9 mg, 0.0075
mmol). The reaction was heated at 90 °C for 8 h. The solvent was removed and the residue
chromatographed using 10:90 ethyl acetate:hexane obtain 0.051 g of the title compound.
MS(ES)w/z 441.8.
The following compounds were prepared in a similar manner to that described in
Example 279 using the appropriate halogenated arylsulfone and quinoline aryl bromide or
borolane, and using an appropriate base chosen from Na2CO3, K2CO3, or CS2CO3 and an
appropriate solvent including toluene:ethanol mixtures and DMF.
Example 280
3-benzyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ESI) m/z 518.
Example 281
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-trifluoromethyl)quinoline
MS (ES) m/z 427.8.
Example 282
3-ethyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 455.8.
Example 283
3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 442.8.
Example 284
4-[3'-(methylsulfonyl)biphenyl-3-yl]-3-propyl-8-(trifluoromethyl)quinoline
Example 285
3-isopropyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Example 286
3-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Example 287
4-[3-(2-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline
MS (ES) m/z 400.0.
Example 288
4-[3-(6-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline
MS (ES) m/z 400.0.
Alternatively, compounds of formula I can be prepared by converting an aryl bromide
into the borolane, followed by coupling with an appropriately halogen substituted aryl or
heteroaryl unit.
3-methyl-4-[3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline
4-(3-Bromophenyl)-3-methyl-8-(trifluoromethyl)quinoline (3.45 g, 9.40 mmol),
bis(pinacoIato)diboron (2.87 g, 11.3 mmol) and potassium acetate (2.9 g (30 mmol) were
stirred in toluene (70 mL) under a nitrogen atmosphere. Pd(PPh3)4 was added and the reaction
heated at 90 °C for 8 h. The reaction mixture was partitioned between ethyl acetate and water.
The organic layer was washed with brine dried and concentrated in vacuo and the residue
chromatographed to provide the title compound as a white solid (2.30 g, 58%). MS (ESI) m/z
414.
Example 290
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxy-2-
methylpropyl)biphenyl-3-sulfonamide
3-Methyl-4-[3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline (0.10 g, 0.20 mmol) was dissolved in DMF (3 mL) and treated
with 3-bromo-N-(2-hydroxy-2-methylpropyl)-benzenesulfonamide (0.25 mmol), Cs2CO3
(0.20 g, 0.60 mmol) and Pd(PPh3)4 (0.012 g, 0.01 mmol). The reaction was heated at 100 oC
for 12 h. The solvent was removed and the Tesidue purified by chromatography eluting with
20:80 ethyl acetate.hexane to afford the title compound as a tan solid (0.017 g). MS (ES) m/z
590.8.
The following compounds were prepared in a similar manner to that described above
using the appropriate halogenated arylsulfone and quinoline aryl boronic acid or boronic
ester.
Example 291
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-hydroxyethyl)biphenyl-3-
sulfonamide
MS (ES) m/z 562.8.
Example 292
3-benzyl-4-[3'-(morpholin-4-ylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 588.8.
Example 293
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxyethyl)-N-
methylbiphenyl-3-sulfonamide
MS (ES) m/z 576.8.
Example 294
3-benzyI-4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 579.9.
Example 295
3-benzyl-4-[3'-chloro-4'-(isopropylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 579.9.
Example 296
3-benzyl-4-[3'-chloro-4'-(isobutylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 593.9.
Example 297
3-benzyl-4-{3'-chloro-4'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 608.0.
Example 298
3-benzyl-4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 565.9.
Example 299
4-[4'-(allylsulfonyl)-3,-chlorobiphenyl-3-yll-3-benzyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 578.0.
Example 300
3-({3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-3-chlorobiphenyl-4-
yl}sulfonyl)propan-1-ol
MS (ES) m/z 595.9.
Example 301
3-benzyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 546.0.
Example 302
3-benzyl-4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 546.0.
Example 303
3-benzyl-4-[3'-(isobutylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 560.1.
Example 304
3-benzyl-4-{3'-l(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 574.1.
Example 305
3-benzyl-4-[3'-(ethylsulfonyl)biphenyl-3-yl])-8-(trifluoromethyl)quinoline
MS (ES) m/z 532.0.
Example 306
4-[3,-(allylsulfonyl)biphenyl-3-yl]-3-benzyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 544.0.
Example 307
3-({3'-[3-benzyl-8-(trifluoromethyl)quinolin-4yl)biphenyl-3-yl}sulfonyl)propan-
1-ol
MS (ES) m/z 562.0.
Example 308
3-benzyl-4-{3-{5-(methylsulfonyl)pyridin-3-yl[phenyl}-8-
(trifluoromethyl)quinoline
MS (ES)m/z 518.9.
Example 309
3-benzyl-4-{4'-(pyrrolidin-1-ylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 572.9.
Example 310
3-benzyl-4-[3'-(pyrrolidin-1-ylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES)m/z 641.0.
Example 311
4-[3'-(allylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-3-benzyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 611.9.
Example 312
3-benzyl-4-[3'-(isobutylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 627.9.
Example 313
3-benzyl-4-[3'-(propylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES)w/z 613.9.
Example 314
3-benzyl-4-[3'-[(3-methylbutyl)sulfonyl]-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 641.9.
Example 315
3-{[3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-5-(trifluoromethyl)biphenyl-3-
yl]sulfonyl}propan-1-ol
MS (ES) m/z 629.9.
Example 316
3-benzyl-4-[3'-(isopropylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 613.9.
Example 317
4-[3'-(ethylsulfony])biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline
MS (ES) m/z 455.8.
Example 318
3-methyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 469.8.
Example 319
3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-
1-ol
MS (ES) m/z 485.8.
Example 320
4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 475.7.
Example 321
4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 489.7.
Example 322
4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 503.7.
Example 323
3-({3-ch]oro-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-
yl}sulfonyl)propan-1-ol
MS (ES) m/z 519.7.
Example 324
3-methyl-4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 442.8.
Example 325
3-methyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 441.8.
Example 326
4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 456.8.
Example 327
4-[4'-(allylsulfonyl)-3'-chlorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 501.7.
Example 328
3-benzyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 517.7.
Example 329
3-benzyl-4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 532.7.
Example 330
3-benzyl-4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-y]]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 551.7.
Example 331
3-methyl-4-{3'-[(1E)-prop-1-en-1-ylsulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 465.7.
Example 332
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 441.7.
Example 333
4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 455.7.
Example 334
4-{3'-[(1E)-prop-1-en-1-ylsulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 453.7.
Example 335
3-({3'-[8-(trifluoromethyl)quinolin-4-yl] biphenyl-3-yl} sulfonyl)propan-1-ol
MS (ES) m/z 471.7.
Example 336
4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES)m/z 461.6.
Example 337
4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 475.6.
Example 338
4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 489.6.
Example 339
4-{3'-chloro-4'-[(1E)-prop-1-en-1-ylsulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 487.6.
Example 340
3-({3-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-yl}sulfonyl)propan-
1-ol
MS (ES) m/z 505.6.
Example 341
4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 428.7.
Example 342
4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 427.7.
Example 343
4-{3-[5-(ethylsulfonyl)-1-oxidopyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline
MS (ESI) m/z 459.
Example 344
4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline
MS (ES) m/z 442.9.
Example 345
N-methyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 456.9.
Example 346
N-ethyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 470.9.
Example 347
3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]-N-propylbiphenyl-3-sulfonamide
MS (ES) m/z 484.9.
Example 348
N-isopropyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
sulfonamide
MS (ES) m/z 484.9.
Example 349
3-methyl-4-[3'-(pyrrolidin-1-ylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 496.8.
Example 350
N-methyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 442.8.
Example 351
N-ethyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 456.8.
Example 352
N-propyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 470.8.
Example 353
N-isopropyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
MS (ES) m/z 470.9.
Example 354
4-[3'-(pyrrolidin-1-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 482.8.
Example 355
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES)m/z 442.1.
Example 356
4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 456.1.
Example 357
4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 496.1.
Example 358
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 510.2.
Example 359
3-methyl-4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 456.1.
Example 360
3-methyl-4-[4'-(methylsulfonyl-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 510.1.
Example 361
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 524.2.
Oxidation of sulfides (Oxone® Method)
Where the quinoline described above has a sulfide, the sulfur can be oxidized to a
sulfone using Oxone® as is described in the literature, and in Example 35 above for the
preparation of halogenated arylsulfones from thiophenols.
Example 362
3-benzyl-4-[3-(1,1-dioxido-1-benzothien-4-yl)phenyl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 528.0.
Example 363
3-methyl-4-{3-[2-(methylsulfonyl)pyrimidin-4-yl]phenyl}-8 (trifluoromethyl)-
quinoline
MS (ES) m/z 444.1.
Example 364
4-[3-(1,1-dioxido-1-benzothien-3-yl)phenyl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 451.8.
Example 365
4-[3-(6-Methanesulfonyl-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-
quinoline
MS (ES) m/z 444.1.
Example 366
3-Benzyl-4-(3-ethynylphenyl)-8-(trifluoromethyl)-quinoline
A solution of 3-benzyl-4-(3-bromo-phenyl)-8-trifluoromethyl-quinoline (1.02 g, 2.3
mmol) and trimethyl-rributylstannanylethynyl-silane (1.30 g, 3.4 mmol) in toluene (25 mL)
was treated with Pd(PPh3)4 (270 mg) and heated at 120 oC for 3 h. The reaction was then
cooled and concentrated in vacuo. The residue was chromatographed with 10:90 ethyl
acetate:hexane to afford 3-benzyl-8-trifluoromethyl-4-(3-trimethylsilanylethynyl-phenyl)-
quinoline as an oil. MS (ESI) m/z 460.0.
A solution of this oil, 3-benzyl-8-trifluoromethyl-4-(3-trimethylsilanylethynyl-
phenyl)-quinoline (730 mg, 1.6 mmol) and potassium carbonate (220 mg, 1.6 mmol) in
methanol (30 mL) was stirred at ambient temperature for 3 h. The reaction mixture was
concentrated to dryness and the residue taken up in ethyl acetate and washed with 30 mL (IN
HCl). The organic layer was dried and concentrated in vacuo to provide after
chromatography the title compound (870 mg, 80%). MS (ESI) m/z 388.
Example 367
3-benzyl-4-(3-{[5-(methylsulfonyl)pyridin-3-yl]ethynyl}phenyl)-8-
(trifluoromethyl)quinoline
A solution of 3-benzyl-4-(3-ethynyl-phenyl)-8-trifluoromethyl-quinoline (80 mg,
0.20 mmol), 3-bromopyridinemethylsulfone 93 mg, 0.40 mmol), piperidine (80 mg, 0.90
mmol) in toluene (2.0 mL) was treated with Pd(Cl)2(PPh3)2 (8.0 mg) and heated at 90 °C for 3
h. The reaction was then cooled and concentrated in vacuo. The residue was taken up in
ethyl acetate and washed with 1N aqueous HCl (10 mL). The organic layer was dried and
concentrated in vacuo to provide after chromatography the title compound (75 mg, 70%). MS
(ES) m/z 542.9.
Examples 368 to 370
The following compounds were prepared in a similar manner to that described in
Examples 366 and 367 using the appropriate halogenated aryl or heteroaryl and quinoline
acetylene.
Example 368
3-benzyl-4-(3-{[4-(pyrrolidin-1-ylsulfonyl)phenyl]ethyny]}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 597.0.
Example 369
3-benzyl-4-(3-{[3-(pyrrolidin-1-ylsulfonyl)phenyl]ethynyl}phenyl)-8-
(trifluoromethyl)quinoline
MS (ES) m/z 597.0.
Example 370
3-benzyl-4-(3-{13-(pyrrolidin-1-ylsulfonyl)-5-
(trifluoromethyl)phenyl]ethynyl}phenyl)-8-(trifluoromethyl)quinoline
MS (ES) m/z 665.0.
Example 371
6-FIuoro-2,3-dihydro-benzo[b]thiophene 1,1-dioxide
A mixture of 1-(bromomethyl)-4-fluoro-2-(methanesulfonyl)benzene(0.250 g, 0.94
mmol) and sodium hydride (0.042 g, 1.1 mmol) in DMF (10 mL) was stirred at 20 °C for 6 h.
The reaction was poured into water and extracted with ethyl acetate. The extracts were dried
with brine and then MgSO4, filtered, and concentrated in vacuo. The combined organic
phases were concentrated and the residue was chromatographed with 1:9 ethyl
acetate:hexanes to afford the title compound as a white solid (0.090 g, 52%). mp 119-121 oC.
Calculated mass for C8H7FO2S is 186.21; found (ES, [M+H]+), 186.9.
Example 372
4-{3-[(1,1-dioxido-2,3-dihydro-1-benzothien-6-yl)oxy]phenyl}-8-
(trifluoromethyl)quinoline
3-[8-(Trifluoromethyl)-quinolin-4-yl]-phenol (0.070 g, 0.244 mmol), 6-fluoro-2,3-
dihydro-benzo[b]thiophcne 1,1-dioxide (0.091 g, 0.488 mmol) and K2CO3 (0.070 g, 0.488
mmol) were combined in DMF (5 mL) and heated at 150 °C for 2 d. The reaction was cooled,
filtered and purified by HPLC to afford the title compound as a white foamy solid (0.040 g,
36%). mp 161-163 °C; calculated mass for C24H16F3NO3S is 455.47; found (ES, [M+H]+),
455.7.
Example 373
3-[3-bcnzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxypropyl)benzamidc
A stirred mixture of 3-(3-benzyl-8-trifluoromethyl-quinolin-4-yl)-benzoic acid (0.102
g, 0.249 mmol), 2-amino-1-propanol (0.093 g, 1.2 mmol), EDCT, (0.238 g, 1.23 mmol), and
4-dimethylaminopyridine (0.083 g, 0.49 mmol) was heated in acetonitrile (70 mL) al reflux
for 3 h. The reaction was cooled, filtered, and concentrated in vacuo. The combined organic
phases were concentrated and the residue chromatographed using 1:8 ethyl acetate:hexane to
afford the title compound as a clear tacky solid (0.021 g, 18%). Calculated mass for
C27H23F3O2N:, is 464.49; found (ES, [M+H]+), 465.2
The following compounds were prepared in a similar manner to that described in
Example 373 using the appropriate aminoalcohol and quinoline.
Example 374
3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxy-2-
phenylethyl)benzamide
mp 95-97; MS (ES) m/z 525.2.
Example 375
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-(3-
hydroxypropyl)benzamide
mp 122-1247; MS (ES) m/z 556.8.
Example 376
3-benzyl-4-{3-[3-(5-methyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
3-(3-Benzyl-8-(trifluoromethyl)quinolin-4-yl)-N-(2-hydroxyethyl)benzamicie (0.100
g, 0.179 mmol) and Burgess Reagent (0.086 g, 0.359 mmol) was taken into THF (5 mL) and
heated at 75 °C for 2 hours. The reaction was cooled, filtered and the solvent is removed in
vacuo. The residue was chromatographed with 1:9 ethyl acetate:hexanes to afford the title
compound as a clear tacky solid (0.070 g, 71%). Calculated mass for C33H27F3N2O3 is 538.56;
found (ES, [M+H]+), 539.2.
The following compounds were prepared in a manner similar to that described in
Example 376 starting from the appropriate quinolines.
Example 377
3-benzyl-4-{3-[3-(4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
tan syrup; MS (ES) m/z 525.2.
Example 378
3-benzyl-4-{3-[3-(5-phenyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 98-100 °C; MS (ES) m/z 601.2.
Example 379
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
trifluoromethyl)quinoline
yellow tacky solid; MS (ES) m/z 539.2.
Example 380
3-benzyl-4-{3-[3-(4,4-dimethyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 65-67 °C; MS (ES) m/z 553.2.
Example 381
3-benzyl-4-{3-[3-(5,6-dihydro-4H-1,3-oxazin-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
tan syrup; MS (ES) m/z 539.
Example 382
3-benzyl-4-{3-[3-(4,5-dihydro-1H-imidazol-2-yl)phenoxy] phenyl}-8-
(trifluoromethyl)quinoline
Methyl 3-(3-(3-benzyl-8-(trifluoromethyl)quinolin-4-yl)phenoxy)benzoate (0.100 g,
0.179 mmol), ethylenediamine (0.060 g, 0.97 mmol), and 2.0 M trimethylaluminum in
toluene (0.49 ml, 0.97 mmol) was taken into toluene (3 mL) and heated at reflux for 1.5 h.
The reaction was cooled, poured into 2 N HCl and extracted with dichloromethane. The
organic layers were washed with brine and dried over MgSO4, filtered and the solvent
removed in vacuo. The residue was purified by chromatography eluting with 1:9 ethyl
acetate:hexanes to afford the title compound as a white solid (0.081 g, 81%). mp 110-112 oC;
calculated mass for C32H24F3N3O is 523.56; found (ES, [M+H]+), 524.2.
Examples 383 to 387
The following compounds were prepared in a similar manner to that described in
Example 382 using the appropriate quinoline and diamine.
Example 383
4-{3-[3-(1H-benzimidazol-2-yl)phenoxy]phenyl}-3-benzyl-8-
(trifluoromethyl)quinoline
mp 65-67 °C; MS (ES) m/z 572.2.
Example 384
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-1H-imidazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
yellow tacky solid; MS (ES) m/z 537.9.
Example 385
3-benzyl-4-{3-[3-(1-methyl-4,5-dihydro-1H-imidazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
creamy colored tacky solid; MS (ES) m/z 537.9.
Example 386
3-benzyl-4-{3-13-(1,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
creamy colored tacky solid; MS (ES) m/z 537.8.
Example 387
3-benzyl-4-{3-[3-(1-methyl-1,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 137-139 oC; MS (ES) m/z 552.
Example 388
3-benzyl-4-[3-(3-methyl-1,2,4-oxadiazol-5-yl)phenyll-8-
(trifluoromethyl)quinoline
3-(3-Benzyl-8-trifluoromethyl-quinolin-4-yl)-benzolc acid methyl ester (0.100 g,
0.237 mmol), N'-hydroxyacetimidamide (0.0090 g, 0.119 mmol), and 60% sodium hydride in
oil (7.0 mg, 0.131 mmol) was taken into THF (3 mL) and heated at reflux overnight. The
reaction was cooled, poured into water and extracted with ethyl acetate. The organic layers
were dried with brine and MgSO4, filtered and the solvent was removed in vacuo. The residue
was loaded onto silica gel diskette and chromatographed with a Biotage Horizon in
hexanes:ethyl acetate (9:1) to afford 0.038 g (71%) of oxadiazole as a tan tacky solid.
Calculated mass for C26184F3N3O is 445.44; found (ES, [M+H]+), 445.8.
The following compounds were prepared in a similar manner to that described in
Example 388 using the appropriate quinoline and amino-oxime.
Example 389
3-benzyl-4-{3-[3-(4-fluorophenyl)-1,2,4-oxadiazol-5-yl]phenyl}-8-
(trifluoromethyl)quinoline
mp 111-113 °C; MS (ES)m/z 525.8.
Example 390
2-(5-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-1,2,4-oxadiazol-3-
yl)acetamide
mp 91-93 °C; MS (ES) m/z 489.
Example 391
3-benzyl-4-[3-(3-phenyl-1,2,4-oxadiazol-5-yl)phenyl]-8-
(trifluoromethyl)quinoline
clear tacky syrup; MS (ES) m/z 508.0.
Example 392
(2-amino-3-bromophenyl)(3-hydroxyphenyl)methanone
To a stirred mixture of 1 M BCl3 in p-xylenes (39.0 mL, 39.0 mmol) in 1 -
chlorobenzene (50 mL) cooled to 0oC under nitrogen was added 2-bromoaniline (10.32 g,
60.0 mmol) in chlorobenzene (50 mL) over 5 min. Additional chlorobenzene (50 mL) was
added and, after 10 min, 3-methoxybenzonitrile (3.66 mL, 30.0 mmol) and AlCl3 (5.21 g, 39.0
mmol) were added and the reaction heated at 90 °C for 3 h, then at 130 °C for 20 h. The
reaction was cooled, ice (50 g) and 2M hydrochloric acid (50 mL) were added and the
reaction was heated at 70-80 °C for 0.5 to 1 h. After cooling, the reaction was diluted with
water (50 mL) and extracted with dichloromethane (100 mL, 50 mL). The combined extracts
were dried over MgSO4, and concentrated in vacuo. The residue was chromatographed using
a 10/90 to 50/50 ethyl acctate/hexane gradient to afford the title compound as a yellow solid
(3.10g).
Example 393
3-(8-bromo-3-methylquinolin-4-yl)phenol
A stirred solution of (2-amino-3-bromophenyl)(3-hydroxyphenyl)methanone (3.06 g,
10.0 mmol) and propionaldehyde diethylacetal (4.90 mL, 30 mmol) in acetic acid (30 mL)
was treated with concentrated H2SO4 (20 pipet drops, about 0.5 mL) and heated at 110 °C for
24 h. The reaction was cooled, concentrated in vacuo to remove most of the acetic acid. The
residue was treated with aqueous saturated NaHCO3 (100 mL) and extracted with
dichloromethane (2 x 100 mL). The extracts were dried over MgSO4 and concentrated, in
vacuo. Chromatography eluting with a gradient of 10:90 to 30:70 ethyl acetate:hexane
afforded the title compound as a yellow solid (1.90 g). MS (ES) m/z 314.0; HRMS: calcd for
C16H12BrNO + H+, 314.01750; found (EST, [M+H]+), 314.0174.
Example 394
8-bromo-3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
This compound was prepared using essentially the same method described in
Example 43 starting with 3-(8-bromo-3-methylquinolin-4-yl)phenol. MS (ES) m/z 468.0;
HRMS: calcd for C23H18BrNO3S + H+, 468.02635; found (ESI, [M+HD, 468.025.
Example 395
3-methyl-8-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
This compound was prepared using essentially the same method described in
Example 43 starting with 8-bromo-3-methyl-4-{3-[3-
(methylsulfonyl)phenoxy]phenyl}quinoline. HRMS: calcd for C24H21NO5S2 + H+,
468.09339; found (ESI, [M+H]-), 468.0928.
Example 396
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
A mixture of 8-bromo-3-methyl-4-(3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
(230 mg, 0.50 mmol), ammonium formate (252 mg, 2.00 mmol), and 10% palladium on
carbon (50 mg) in methanol (10 mL) was heated at 60 °C for 3 h. The reaction was cooled,
filtered, and concentrated in vacuo to a solid. The residue was treated with saturated aqueous
NaHCO3 (10 mL), extracted with dichloromethane (2 x 10 mL), and the extracts concentrated
in vacuo. The residue was chromatographed eluting with a gradient of 50/50 to 100/0 ethyl
acetate/hexane to provide the title compound as a slightly yellow solid (152 mg, 80%).
HRMS: calcd for C23H19NO3S + H+, 390.11584; found (ESJ, [M+H]-), 390.1176.
Example 397
The following compounds were prepared in a manner similar to that described in one
or more of Examples 1-396.
A. 4-[3'-(ethylsulfonyl)-4-methylbiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 470.2;
B. 4-{3-[3-chloro-5-(methylsulfony])phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carbonitrile
MS (ES) m/z 503.1;
C. 8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carbonitrile
MS (ES) m/z 435.1; HRMS: calcd for C23H15CIN2O3S + H+, 435.05647; found (ESI,
[M+H]+), 435.0553;
D1. 4-{3-[3-(methylsu]fonyl)phenoxy]phenyl}quinoline-3-carboxamide
MS (ES) m/z 419.1; HRMS: calcd for C23H18N2O4S + H+, 419.10600; found (ESI,
[M+H]+),419.1044;
D2. 4-[4,-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 506.0;
E. 4-[4,-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 520.0;
F. 4-[2',5'-difluoro-4'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 464.1;
G. 4-[4'-(ethylsulfonyl)-2',5,-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 478.1;
H. 4-[2',4,-dinuoro-5'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 464.1;
I. 4-[5'-(ethylsulfonyl)-2',4'-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 478.1;
J. 2-methyl-4- [(3- {3- [8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]butan-2-ol
mp 77-79 °C; MS (ES) m/z 516.2;
K. 4-{3-[4-(methylsulfonyl)phcnoxy]pheny]}-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES) m/z 487.1;
L. 4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 505.0;
M. 4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
mp 100-102 °C; MS (ES) m/z 478.0; HRMS: calcd for C23H15CIF3NO3S + H-,
478.04860; found (ESI, [M+H]+), 478.0479;
N. 4-[4'-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 533.9;
O. 4-[2',5,-difluoro-4-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 478.0;
P. 4-[4,-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 492.0;
Q. 4-[2,,4,-difluoro-5,-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 478.0;
R. 4-[5'-(ethylsulfonyl)-2,,4,-difluorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 492.0;
S. 4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 505.0;
T. 4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carboxamide
MS (ES) m/z 521.0;
U. 3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
MS (ES) mix 415.1; HRMS: calcd for C24H13N2O3S + H+, 415.11109; found (ESI,
[M+H]+), 415.1110;
V. 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES) m/z 515.1;
W. 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxylic acid
MS (ES) m/z 472.0;
X. Ethyl 4-[3'-(methylsulfonyl)biphenyl-3-yll-8-(trifluoromethyl)quinoline-3-
carboxylate
MS (ES) m/z 500.0;
Y. 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES) m/z. 471.0;
Z. 4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES) m/z 515.0;
AA. 4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 520.0;
AB. 4-(3'-(isopropylsulfonyl)biphenyl-3-ylI-8-(trifluoromethyl)quinoline-3-
carbonitrile
MS (ES) m/z 481.1; HRMS: calcd for C26H19F3N2O2S + H-, 481.1192.1; found (ESI-
FTMS, [M+H]1+), 481.12001;
AC. Ethyl 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-
carboxylate
MS (ES) m/z 466.1; HRMS: calcd for C25H20FNO5S + H+, 466.11190; found (ES1-
FTMS, [M+H]1+), 466.11303;
AD. 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxylphenyl}quinoline-3-carboxamide
MS (ES) m/z 437.0; HRMS: calcd for C23H17FN2O4S + H+, 437.09658; found (ESI-
FTMS, [M+H]1+),437;
AE. 8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
mp 117-119 °C; MS (ES)m/z 410.0;
AF. 4-[4,-methoxy-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
MS (ES) m/z 472.1;
AG. 4-[4'-mcthoxy-3'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline
MS (ES) m/z 458.1;
AH. 3-({4-methyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-ol
MS (ES) m/z 500.2;
AI. 3-({4-methyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-ol
MS (ES) m/z 486.1;
AJ. 8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide
MS (ES) m/z 453.0; HRMS: calcd for C23H17C1N2O4S - H+, 451.05248; found (ES1,
[M-H]-), 451.0526;
AK. 8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic
acid
MS (ES) m/z 454.1; HRMS: calcd for C23H16C1NO5S + H+, 454.05105; found (ESI,
[M+H]+), 454.0517;
AL. 3-({4-chloro-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-ol
MS (ES) m/z 520.1;
AM. 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES)m/z 501.1;
AN. 4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES) m/z 484.9;
AO. 3-({4-bromo-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl} sulfony l)propan-1 -ol
MS (ES) m/z 550.0;
AP. 4-{3'-[(dimethylamino)sulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline-
3-carboxamide
MS (ES) m/z 499.9;
AQ. 8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 423.9; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI,
[M+H]+), 424.0772;
AR. 8-chloro-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 437.9; HRMS: calcd for C24H20ClNO3S + H+, 438.09252; found (ESI,
[M+H]+), 438.0933;
AS. 3-({4-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl} sulfonyl)propan-1-ol
MS (ES) m/z 505.8;
AT. 4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
MS (ES) m/z 455.9;
AU. 8-chloro-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline
MS (ES) m/z 437.9;
HRMS: calcd for C24H20CINO3S + H", 438.09252; found (ESI, [M+HH, 438.0935;
AV. 4-[3'-(aminosulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxamide
MS (ES)m/z 471.9;
AW. 2-methyl-4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)butan-2-ol
MS (ES) m/z 499.9;
AX. 2-methyl-4-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)butan-2-ol
MS (ES)m/z 513.9;
AY. 8-cyano-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide
HRMS: calcd for C24H17N3O4S + H+, 444.10125; found (ESI, [M+H]+), 444.101;
AZ. 4-(3-{3-1(dimethylamino)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline-3-carboxamide
MS (ES)m/z 515.9; and
AAA. 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
MS (ES) m/z 478.0.
Example 398
A. 3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-
1-amine
Step 1: A mixture of 3-fluorothiophenol (1.28 g, 10 mmol), N-(3-
bromopropyl)phthalimide (2.68 g, 10 mmol), and cesium carbonate (6.52 g, 20 mmol) in
DMF (20 mL) was stirred at room temperature for 2 h. The reaction mixture was quenched
with water and extracted with ethyl acetate. The combined organic layers were dried and
concentracted to give 2-{3-[(3-fluorophenyl)thio]propyl[-1H-isoindole-1,3(2H)-dione as a
white solid (3.0 g, 95%). MS (ES) m/z 316.0.
Step 2: H2O2 (30 mL, 50% in water) was added to 2-{3-[(3-
fluorophenyl)thio]propyl}-1H-isoindole-l,3(2H)-dione (2.9 g, 9.2 mmol) in acetic acid (30
mL) at room temperature. The mixture was heated at 60 °C for 2 hours and poured into water.
The solid was collected and dried to give 2-{3-[(3-fluorophenyl)sulfonyl]propyl}-1H-
isoindole-1,3(2H)-dionc (2.5 g, 78 %) as a white solid. MS (ES) m/z 348.0.
Step 3: A mixture of 2-{3-[(3-fluorophenyl)sulfonyl]propyl}-1H-isoindole-1,3(2H)-
dione (0.69 g, 2 mmol), 3-(8-(trifluoromethyl)quinolin-4-yl)phenol (0.29 g, 1 mmol),
potassium carbonate (3.29 g, 23.8 mmol) in 10 mL DMF was heated overnight at 140 °C .
The mixture was poured into water and extracted with ethyl acetate. The combined organic
was purified by silica gel chromatography (ethyl acetate/hexanes) to give 2- {3-[(3- {3-[8-
(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propyl}-1H-isoindole-1,3(2H)-dione
(0.31 g, 50%) as a white solid. MS (ES) m/z 616.9; HRMS: calcd for C33H23F3N2O5S + H+,
617.13525; found (ESI, [M+H]+), 617.1353.
Step 4: 2-{3-[(3-{3-[8-(Trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}-1H-isoindole-1,3(2H)-dione (0.1 g, 0.16 mmol) was
dissolved in ethanol (15 mL) and 2 mL of hydrazine was added. The solution was refluxed
for 2 h and the solvent was removed. The residue was purified via reverse phase HPLC
(AcCN/water) to elute out 25 mg (32%) of the title compound as a gummy solid. MS (ES)
m/z 487.0; HRMS: calcd for C25H21F3N2O3S + H+, 487.12977; found (ESI, [M+H]+),
487.1299.
B. N-methyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propan-1-amine
Step 1: At room temperature under a nitrogen atmosphere methancsulfonyl chloride
(46 mg, 0.399 mmol) was added to a stirred solution of 3-[(3-{3-[8-(trifluoromethyl)quinolin-
4-yl]phenoxy}phenyl)sulfonyl]propan-1-ol (162 mg, 0.333 mmol) and pyridine (34 mg, 0.432
mmol) in CH2Cl2 (2.5 mL). After 30 min the reaction mixture was quenched with water (0.5
ml), extraction, separation and concentration in vacuo to a brown syrup. Purification of this
same syrup was done by RP-HPLC (acetonitrile:water) afforded 3-(3-(3-(8-
(trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propyl methanesulfonate as a light
brown powder (138 mg, 73% yleld). MS (ES) m/z 566.0.
Step 2: To a vial containing a magnetic stir bar was placed 3-(3-(3-(8-
(trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propyl methanesulfonate (55 mg,
0.11 mmol) and methylamine 7N in EtOH (5 ml) and THF (5 ml). The vial was capped and
heated at 45oC for 15 h. The resulting yellow solution was concentrated in vacuo to a yellow
syrup. This same syrup was purified by RP-HPLC resulted in the title compound as a light
brown powder 27.7 mg (47% yleld). MS (ES) m/z 501.0.
Example 399
The following compounds were prepared in a manner similar to that described in
Example 398B
A. 3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 500.9; HRMS: calcd for C26H23F3N2O3S + H+, 501.14542; found (ESI,
[M+H]+), 501.1456;
B. N-methyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyllpropan-1-amine
MS (ES) m/z 514.9; HRMS: calcd for C27H25F3N2O3S + H+, 515.16107; found (ESI,
[M+H]+), 515.1611;
C. N-ethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 528.9: HRMS: calcd for C28H27F3N2O3S + H+, 529.17672; found (ESI,
[M+H]-), 529.1771;
D. N-isopropyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyllpropan-1-amine
MS (ES) m/z 542.9; HRMS: calcd for C29H29F3N2O3S + H+, 543.19237; found (ESI,
[M+H]-), 543.1925;
E. N-ethyl-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 515.1; and
F. N-isopropyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propan-1-amine
MS (ES) m/z 528.9.
Example 400
4-{2-chloro-5-l3-(methylsulfonyl)phenoxylphenyl}-8-(trifluoromethyl)quinoline
Stepl: 4-(2-chloro-5-mcthoxyphenyl)-8-(trifluoromethyl)quinoline
A stream of nitrogen gas was bubbled through a mixture of 4-ehloro-8-
(trifluoromethyl)quinoline (347 mg, i .5 mmol), 2-chloro-5-methoxyphenylboronic acid (355
mg, 1.88 mmol), 2M aqueous Na2CO3 (3 mL, 6 mmol) in dimethoxyethane (6 mL) for 10
min. Terrakis-triphenylphosphine palladium (175 mg, 0.15 mmol) was added and the mixture
was stirred at 85 °C for 3 h. The suspension was cooled and poured into a mixture of ethyl
acetate (60 mL) and aqueous NaHCO3;. The layers were separated and the organic layer was
further washed with aqueous NaHCO3 (10 mL), water (10 mL), and brine (20 mL). The
organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was purified by
SiO: chromatography using a gradient of 0:100 to 20:80 E:H to afford an off-white gummy
solid. HRMS: calcd for Cl7H10ClF3NO + H+ 338.05540; found (ESI, [M+H]+ Obs'd),
338.0562.
Step 2: 4-chIoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
To the 4-(2-chloro-5-methoxyphenyl)-8-(triftuoromethyl)quinolme obtained in step 1
was added pyridine hydrochloride (4 g) and the mixture was heated to 200 °C, during which it
became a homogenous solution. After 1.5 h, the reaction was poured into water (40 mL) and
ethyl acetate (60 mL) and the layers were separated. The organic layer was further washed
with 5% aqueous citric acid (3 x 10 mL), saturated aqueous NaHCO3, (10 mL), and brine (20
mL). The organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was
purified by SiO2 chromatography using a gradient of 0:100 to 30:70 E:H to afford 4-chloro-3-
[8-(trifluoromethyl)quinolin-4-yl]phenol as a white foamy solid. MS (ES) m/z 324.1; HRMS:
calcd for C16H9C1F3NO + H+, 324.03975; found (ESI, [M+H]-), 324.0406.
Step 3: 4-{2-chloro-5-{3-(methylsutfonyl)phenoxy]phenyl}-8
(trifiuoromethyl)quinoline
A mixture of 4-chloro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol (80 mg, 0.25
mmol), K2CO3 (69 mg, 0.5 mmol), and 1-fluoro-3-(methylsulfonyl)benzene (64 mg, 0.37
mmol) in DMF (3 mL) was heated at 150 C for 24 h. The reaction was cooled and diluted
with EtOAc (50 mL) and water (10 mL). The layers were separated and the organic layer was
washed water (4 x 10 mL), and brine (20 rnL). The organic layer was dried with Na2SO4 and
concentrated in vacuo. The residue was purified by SiO2 chromatography during with a
gradient of 0:100 to 25:75 E:H. The residual material was further purified by C18 reverse-
phase chromatography using a gradient of 5:95 to 100:0 acetonitrile:H2O to afford 4- {2-
chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline as a white foamy
solid. MS (ES) m/z 478.0. HRMS: calcd for C23H15ClF3NO3S + H-, 478.04860; found (ESI,
[M+H]+), 478.0488.
Example 401
The following compounds were prepared in a manner similar to that described in
Example 400, step 3.
A. 3-[(3-{4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-[(3-fluorophenyl)sulfonyl]propan-1-ol as the
reactants to afford the title compound as a white solid. MS (ES) m/z 522.0; HRMS: calcd for
C25H19ClF3NO4S + H+, 522.07482; found (ESI, [M+H]-), 522.0748.
B. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-fluoro-1-(isopropylsulfonyl)benzene as the
reactants to afford the title compound as a white foam. MS (ES) m/z 506.0; HRMS: calcd for
C25H19ClF3NO3S + H+, 506.07990; found (ESI, [M+H]-), 506.0802.
C. 4-{2-chloro-5-[3-(ethylsulfonyl)phcnoxy]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and l-(ethylsulfonyl)-3-fluorobcnzene as the reactants
to afford the title compound as a white foam. MS (ES) m/z 492.0; HRMS: calcd for
C24H17ClF3NO3S + H+, 492.06425; found (ESI, [M+H]"), 492.0645.
D. 4-{2-chloro-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-
(trifluoromethyl)quinolin-4-yl]phenol and 4-fluoro-1-(methylsulfonyl)benzene as the
reactants to afford the title compound as a white foam. MS (ES) m/z 478.0; HRMS: calcd for
C23H15ClF3NO3S + H!, 478.04860; found (ESI, [M+H]-), 478.0487.
Example 402
4-{2-chloro-5-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
4-chloro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol (107 mg, 0.33 mmol), Cs2CO3
(215 mg, 0.66 mmol), and 4-(ethylsulfonyl)-1-fluorobenzenc (94 mg, 0.5 mmol) in
dimethylacetamide (3 mL) was heated at 120 C for 16 h. The reaction was cooled and
diluted with EtOAc (50 mL) and water (10 mL). The layers were separated and the organic
layer was washed with water (4x10 mL) and brine (20 mL). The organic layer was dried
with Na2SO4 and concentrated in vacuo. The residue was purified by SiO2 chromatography
eluting with a gradient of 0:100 to 25:75 E:H. The residual material was further purified by
C18 reverse-phase chromatography using a gradient of 5:95 to 100:0 acetonitrile:H2O to
afford the title compound as a white foam. MS (ES) m/z 491.6; HRMS: calcd for
C24H17ClF3NO3S + H+, 492.06425; found (ESI, [M+H]-), 492.0644.
Example 403
4-{2-chloro-5-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and 4-fluoro-1-(isopropylsulfonyl)-benzene as the reactants to afford the title
compound as a white foam. MS (ES) m/z 505.6; HRMS: calcd for C25H19ClF3NO3S + H-,
506.07990; found (ESI, [M+H]+), 506.0797.
Example 404
4-{5-[4-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline
Step 1: 4-(2-fluoro-5-methoxyphenyl)-8-(trifluoromethyl)quinoline
Prepared as in Example 400, step 1, except using 4-chloro-8-
(trifluoromethyl)quinoline and 2-fluoro-5-methoxyphenylboronic acid as the reactants to
afford the title compound as a white foam. MS (ES) m/z 322.6; HRMS: calcd for
C17H11F4NO + H-, 322.08495; found (ESI, [M+H]-), 322.0852.
Step 2: 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
Prepared as in Example 400, step 2, except using 4-(2-fluoro-5-methoxyphenyl)-8-
(trifluoromethyl)quinoline as the reactant to afford the title compound as a white foam.
MS (ES) m/z 308.0; HRMS: calcd for C16H9F4NO + H+, 308.06930; found (ESI, [M+H]-
Obs'd), 308.0696.
Step 3: 4-{5-[4-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and 1-(ethylsulfonyl)-4-fluorobenzene as the reactants to afford the title compound
as a white foam. MS (ES) m/z 475.7; HRMS: calcd for C24H17F4NO3S + H-, 476.09380;
found (ESI, [M+H]-), 476.0938.
Example 405
4-{2-fluoro-5-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example402, except using 4-fIuoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
and 4-fluoro-1-(isopropylsulfonyl)-benzene as the reactants to afford the title compound as a
white foam. MS (ES) m/z 489.7; HRMS: calcd for C25H19F4NO3S + H-, 490.10945; found
(ESI, [M+H]-), 490.1094.
Example 406
4-{2-chloro-5-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and 1,2-difluoro-4-(methylsulfonyl)benzene as the reactants to afford the title
compound as a white foam. MS (ES) m/z 495.6; HRMS: calcd for C21H14ClF4NO3S + H-,
496.03918; found (ESI, [M+H]- Obs'd), 496.0395.
Example 407
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
and 1-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as a white
foam. MS (ES) m/z 475.7; HRMS: calcd for C24H17F4NO3S + H , 476.09380; found (ESI,
[M+H]- Obs'd), 476.0943.
Example 408
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
and 3-fluoro-1-(methylsulfonyl)-bcnzcne as the reactants to afford the title compound as a
white foam. MS (ES) m/z 461.6; HRMS: calcd for C23H15F4NO3S + H-, 462.07815; found
(ESI, [M+H]-), 462.0779.
Example 409
4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
and 1,3-difluoro-5-(methylsulfonyl)benzene as the reactants to afford the title compound as a
white foam. MS (ES) m/z 479.6; HRMS: calcd for C23H14F5NO3S + H+ 480.06873; found
(ESI, [M+H]-), 480.0685.
Example 410
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and l,3-difluoro-5-(methylsulfonyl)benzene as the reactants to afford the title
compound as a white foam. MS (ES) m/z 495.6; HRMS: calcd for C23H14ClF4NO3S + H ,
496.03918; found (ESI, [M+H]-), 496.0389.
Example 411
3-[(4-{4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol
Prepared as in Example 402, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and 3-[(4-fluorophenyl)sulfonyl]propan-1-ol as the reactants to afford the title
compound as a white foam. MS (ES) m/z 521.6; HRMS: calcd for C25H19OF3NO4S + H-,
522.07482; found (ESI, [M+H]-), 522.0748.
Example 412
4-{2-fluoro-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 402, except using 4-fluoro-3-[8-(trifluoromethyl)quinolin-4-yl]phcnol
and 4-fluoro-1-(methylsulfonyl)-benzene as the reactants to afford the title compound as a
white foam. MS (ES) m/z 461.6; HRMS: calcd for C23H15F4NO3S + H1, 462.07815; found
(ESI, [M+H]- Obs'd), 462.0783.
Example 413
4-{2-chloro-5-[2-chloro-4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and 1,2-dichloro-4-(methylsulfonyl)benzene as the reactants in dimethylacetamide
to afford the title compound as a white foam. MS (ES) m/z 511.9; HRMS: calcd for
C23H14Cl2F3NO3S + H+, 512.00963; found (ESI, [M+H]. Obs'd), 512.0099.
Example 414
[(4-{4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]acetonitrile
Prepared as in Example 400, step 3, except using 4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenol and l,2-dichloro-4-(methylsulfonyl)benzene as the reactants in dimethylacetamide
to afford the title compound as a white foam. MS (ES) m/z 503.0; HRMS: calcd for
C24H14ClF3N2O3S + H\ 503.04385; found (ESI, [M+H]- Obs'd), 503.0443.
Example 415
4-{3-[3-tluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Step 1: 2,2-dimethyl-5-[(E)-{[2-(methylsulfonyl)phenyl]imino}methyl]-1,3-
dioxane-4,6-dione
A mixture of 2,2-dimethyl-1 ,3-dioxane-4,6-dione (1.59 g, 11.0 mmol) and trimethyl
orthoformate (10 mL) was heated for 2 h at 105 °C. The mixture was cooled to 90 °C and 2-
(methylsulfonyl)aniline (1.71 g, 10.0 mmol) in DMF (10 mL) was added. The mixture was
heated for 3 h at 125 °C, and then was slowly poured into ice-water (200 mL). The
precipitate was collected, washed with water, and dried under high vacuum, giving the title
compound as an off-white powder. MS (ES) m/z 323.7, HRMS: calcd for C14H15NO6S +
NH4+, 343.09583; found (ESI, [M+NH4]+ Obs'd), 343.0960.
Step 2: 4-chloro-8-(methylsulfonyl)quinoline
2,2-Dimethyl-5-[(E)- {[2-(methylsulfonyl)phenyl]irnino} methyl]-1,3-dioxane-4,6-
dione (1.20 g, 3.7 mmol) was heated in Dowtherm A (5 mL) for 4 h at 260 °C (gas evolution).
The mixture was allowed to cool to ambient temperature resulting in a precipitate. The
reaction was diluted with diethyl ether (50 mL). The brown solid was collected, washed with
ether, and dried under vacuum. The solid was heated in phosphorous oxychloride (5 mL) at
90 °C for 2 h. The mixture was carefully pouring into a stirred mixture of ice-water (100 mL)
and EtOAc (75 mL). The mixture was carefully neutralized with solid potassium carbonate
and the layers were separated. The organic layer was washed with 2M aqueous Na2CO3
water (50 mL), and brine (50 mL). After drylng over Na2SO4 and evaporation of the solvent,
the resulting material was purified by SiO2 chromatography using a 2:98 to 30:70 E:H
gradient, ylelding the title compound as an off-white solid. MS (ES) m/z 241.7; HRMS: calcd
for C10H8ClNO2S + H+ 242.00370; found (ESI, [M+H]- Obs'd), 242.0040.
Step 3: 3-[8-(methylsulfonyl)quinolin-4-yl]phenol
Prepared as in Example 400, step 1, except using 4-chloro-8-
(methylsulfonyl)quinoline and 3-hydroxyphenylboronic acid as the reactants to afford the title
compound as a white foam. MS (ES) m/z 299.9; HRMS: calcd for C15H13NO3S + H-,
300.06889; found (ESI, [M+H]+ Obs'd), 300.0695.
Step 4: 4-{3-[3-fluoro-5-(methylsulfonyl)phenoxylphenyl}-8-
(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol
and l,3-difluoro-5-(rnethylsulfonyl)benzene as the reactants in dimethylacetamide to afford
the title compound as a white foam. MS (ES) m/z 471.6; HRMS: calcd for C23H18FNO5S2 +
H+, 472.06832; found (ESI, [M+H]+ Obs'd), 472.0684.
Example 416
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 1-
(ethylsulfonyl)-3-fluorobenzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 467.9; HRMS: calcd for C24H21NO5S2 + H-,
468.09339; found (ESI, [M+H]+ Obs'd), 468.0938;
Example 417
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 3-
fluoro-1-(isopropylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 481.9; HRMS: calcd for C25H23NO5S2 + H-,
482.10904; found (ESI, [M+H]+ Obs'd), 482.1091.
Example 418
3-[(3-{3-l8-(methylsulfonyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-1-ol
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 3-
[(3-fluorophenyl)sulfonyl]propan-1-ol as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 497.9; HRMS: calcd for C25H23NO6S2 + H ,
498.10396; found (ESI, [M+H]+ Obs'd), 498.1045.
Example 419
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 1-
(cthylsulfonyl)-4-fluorobenzcnc as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 467.9; HRMS: calcd for C24H21NO5S2 + H ,
468.09339; found (ES1, [M+H]+ Obs'd), 468.0933.
Example 420
8-(methylsulfonyl)-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 4-
fluoro-1-(propylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 481.9; HRMS: calcd for C25H23NO5S2 + H-,
482.10904; found (ESI, [M+H]+ Obs'd), 482.1093.
Example 421
4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 4-
fluoro-1 -(isopropylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 481.9; HRMS: calcd for C25H23NO5S2 + H-,
482.10904; found (ESI, [M+H]+ Obs'd), 482.1091.
Example 422
8-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl} quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 3-
fluoro-1 -(methylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 453.6; HRMS: calcd for C23H19NO5S2 + H ,
454.07774; found (ES1, [M+H]-), 454.0781.
Example 423
8-(methylsulfonyl)-4-{3-[4-(methylsulfonyl)phenoxy] phenyl} quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 4-
fluoro-1 -(methylsulfonyl)-benzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z 453.6; FIRMS: calcd for C23H19NO5S2 + H-,
454.07774; found (ESI, [M+H]-), 454.0782.
Example 424
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline
Prepared as in Example 402, except using 3-[8-(methylsulfonyl)quinolin-4-yl]phenol and 1,2-
difluoro-4-(methylsulfonyl)benzene as the reactants in dimethylacetamide to afford the title
compound as a white foam. MS (ES) m/z. 471.6; HRMS: calcd for C23H18FNO5S2 + H1,
472.06832; found (ESI, [M+H]+), 472.0682.
Example 425
3-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Step 1: 4-(3-methoxyphenyl)-3-(methylsulfonyl)-8-(trifluoromethyl)quinoline
A stirred mixture of [2-amino-3-(trifluoromethyl)phenyl](3-methoxyphenyl)methanone (147
mg, 0.50 mmol) and l,l-diethoxy-2-(methylsulfonyl)ethane (98 mg, 0.50 mmol) in glacial
acetic acid (3.0 mL) was treated with one pipette drop of concentrated sulfuric acid and
heated at 110 °C for 20 h. The cooled reaction was treated with NaHCO3 (5 g) in water (20
mL) and extracted with dichloromethane. The extracts were dried with MgSCU and
concentrated in vacuo. The reside was purified by chromatography eluting with a 35:65 to
100:0 E:H gradient to afford the title compound as a white solid (122 mg, Rf ~ 0.15 in initial
solvent system). MS (ES) m/z 382.1; HRMS: calcd for CRHI^NOBS + H+, 382.07192;
found (ESI, [M+H]"), 382.0719.
Step 2: 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4-yl]phenol
A mixture of 4-(3-mcthoxyphenyl)-3-(methylsulfonyl)-8-(trifluoromethyl)quinoline (1.18 g,
3.10 mmol) in pyridine hydrochloride (4.6 g) were heated at 200 °C for 2 h, then poured onto
ice. The ice was allowed to melt and the mixture was extracted with dichloromcthane (30 mL,
20 mL). The extracts were dried with MgSO4 and concentrated in vacuo. Chromatography
eluting with a gradient of 20:80 to 50:50 E:H gave the title compound as a white solid (1.13 g,
Rf ~ 0.35 in 50:50 E:H). MS (ES) m/z 368.1; HRMS: calcd for C17H12F3NO3S + H+,
368.05627; found (ESI, [M+H]-), 368.0567.
Step 3: 3-(rnethylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
A mixture of 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4-yl]phenol (183 mg, 0.50
mmol), 3-MeSO2PhB(OH)2 (150 g, 0.75 mmol), Cu(OAc)2 (91 mg), pyridine (0.12 mL, 1.5
mmol), and powdered 4A molecular sieves (0.50 g) in dichloromethanc (10 mL) were stirred
at ambient temperature, partly open to air, for 64 h. The green reaction was filtered through
Celite, treated with water (15 mL), and extracted with dichloromethane. The extracts were
dried over MgSO4 and concentrated in vacuo. The residue was chromatographed with a
gradient of 50:50 to 100:0 E:H, and further purified by reverse phase chromatography to
afford the title compound as a white solid (188 mg). MS (ES) m/z 521.8; HRMS: calcd for
C24H18F3NO5S2 + H-, 522.06512; found (ESI, [M+H]-), 522.0652.
Examples 426 to 459
The following compounds in Examples 426 to 459 were prepared in a similar manner
to the procedure of Example 43 except using the appropriate corresponding halogenated
arylsulfone and quinoline phenol for the desired substitution pattern.
Example 426
3-(methylsulfonyl)-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-fluoro-1-(propylsulfonyl)-benzene as the
reactants to afford the title compound as an off-white solid. MS (ES+) m/z 549.8 [M+H]+;
HRMS: calcd for C26H22F3NO5S2 + H+, 550.09642; found (ESI, [M+H]+ Obs'd), 550.0955.
Example 427
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4-
yl]phenol and l-(isopropylsulfonyl)-3-fluorobenzene as the reactants to afford the title
compound as a white solid. MS (ES+) m/z 549.8 [M+H]+; HRMS: calcd for C26H22F3NO5S2 +
H+, 550.09642; found (ESI, [M+H]+ Obs'd), 550.0959.
Example 428
4-{3-l3-fluoro-5-(methylsulfonyl)phenoxy)phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-(trifluoromethyl)quinolin-4-
yl]phenol and 3,5-difluoro-1-(methylsulfonyl)benzene as the reactants to afford the title
compound as a white solid. MS (ES+) m/z 539.8 [M+H]+; HRMS: calcd for C24H17F4NO5S2 +
H+, 540.05570; found (ESI, [M+H]+ Obs'd), 540.0552.
Example 429
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-(methylsulfonyl)-8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-chloro-5-fluoro-1-(methylsulfonyl)berizene as
the reactants to afford the title compound as a white solid. MS (ES+) m/z 555.8 [M+H]-r;
HRMS: calcd for C24H17ClF3NO5S3 + H+, 556.02615; found (ESI, [M+H]+ Obs'd), 556.0256.
Example 430
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol
and 3,5-difluoro-1-(cthylsulfonyl)benzene as the reactants to afford the title compound as a
white solid. MS (ES) m/z 489.8; HRMS: calcd for C25H19F4NO3S + H+, 490.10945; found
(ESI, [M+H]+ Obs'd), 490.1094.
Example 431
8-chloro-3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 3-isopropyl-8-chloro-quinolin-4-yl]phenol and 3-
fluoro-1-(methylsulfonyl)benzene as the reactants to afford the title compound as a white
solid. MS (ES) m/z 451.9; HRMS: calcd for C25H22ClNO3S + H+, 452.1082; found (ESI,
[M+H]+Obs'd), 452.1085.
Example 432
3-methyl-8-(trifluoromethyl)-4-(3-{3-[(trifluoromethyl)
sulfonyl]phenoxy}phenyl)quinoline
Step 1: 1-fluoro-3-trifluoromethanesulfonyl-benzene
A mixture of 3-fluorobenzene-1-sulfonyl chloride (5.0 g, 25.7 mmol), 18-crown-6
(0.170 g, 0.642 mmol), and potassium fluoride (7.46 g, 128 mmol) in acetonitrile (51 mL)
was stirred for 4 h. Saturated aqueous NaHCO3 (200 mL) was added and the mixture was
extracted with ethyl acetate. The combined organics were washed with saturated aqueous
NaHCO3 (200 mL), dried over MgSO4, and concentrated to afford the intermediate 3-
fluorobenzenesulfonyl fluoride as a yellow oil (4.20 g, 92%) which was used without further
purification in the next step. 3-Fluorobcnzene-1-sulfonyl fluoride (4.20 g, 23.6 mmol) and
tris(dimethylamino)sulfur(trimethylsilyl)difluoride (0.649 g, 2.36 mmol) in THF (24 mL) was
treated drop wise with (trifluoromethyl)trimethylsilane (7.06 ml, 47.1 mmol) in THF (24 mL)
over 0.25 h, under a N2 atmosphere, and the reaction was stirred overnight at room
temperature. Water was added and the mixture extracted with ethyl acetate. The combined
organic extracts were washed several times with water, then with half-saturated brine, dried
over MgSO4 and concentrated. Purification by chromatography eluting with a gradient of
0:100 to 20:80 E:H afforded the title compound as a yellow liquid (3.32 g, 62%).
Step 2: 3-methyl-8-(trifluoromethyl)-4-(3-{3-
[(trifluoromethyl)sulfonyllphenoxy}phenyl)quinoline
Prepared as in Example 43 except using 3-methyl-8-(trifluoromethyl)qumolin-4-
yl]phenol and 3-fluoro-1-(trifluoromethylsulfonyl)benzene as the reactants, heating at 100 oC,
to afford the title compound as a white solid. MS (ES+) m/z 511.7 [M+H]+; HRMS: calcd for
C24H15F6NO3S + H+, 512.07496; found (ESI, [M+H]+ Obs'd), 512.0750.
Example 433
4-{3-[3-(methylsufonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-amine
Step 1: 2-(4-(3-methoxyphenyl)-8-(trifluoromethyl)quinolin-3-yl)isoindoline-1 ,3-
dione
Prepared as in Example 24, step 1, except using (2-amino-3-
(trifluoromethyl)phenyl)(3-methoxyphenyl)methanone and 2-(2,2-diethoxyethyl)isoindoline-
1,3-dionc as the reactants to afford the title compound as a white solid. MS (ES+) m/z 449.1
[M+H]+.
Step 2: 4-(3-methoxyphenyl)-8-(trifluoromethyl)quinolin-3-amine
Prepared as in Step 4 of Example 398 except using 2-(4-(3-methoxyphenyl)-8-
(trifluoromcthyl)quinolin-3-yl)isoindoline-1,3-dione as the reactant to afford the title
compound as a yellow solid. MS (ES) m/z 319.1.
Step 3: 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
amine
After demethylation of the methoxy group from the above, the title compound was
prepared from 2-(4-(3-hydroxyphenyl)-8-(rrifluoromethyl)quinolin-3-yl)isoindolinc-l,3-dione
in a manner similar to that described in Example 43. MS (ES) m/z 458.7; HRMS: calcd for
C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+), 459.0985.
Example 434
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline
The title compound was prepared in a similar manner to that described for Example
43. MS (ES) m/z 427.6; HRMS: calcd for C22H15ClFNO3S + H+, 428.05179; found (ESl,
[M+H]+Obs'd), 428.0521.
Example 435
4-{2-chloro-5-(3-(methylsulfonyl)phenoxy]phenyl}quinoline
The title compound was prepared in a similar manner to that described for Example
43. MS (ES) m/z 409.7; HRMS: calcd for C22H16ClNO3S + H+, 410.06122; found (ESl,
[M+H]-), 410.0618.
Example 436
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3-
carboxylic acid
The title compound was prepared in a similar manner to that described for Example
43.
MS (ES) m/z 471.6; HRMS: calcd for C23H15ClFNO5S + H+, 472.04163; found (ESI,
[M+H]-), 472.0419.
Example 437
3-methyl-4-{1-[3-(methylsulfonyl)phenyl]-1H-pyrazol-4-yl}-8-
(trifluoromethyl)quinoline
Step 1: 3-methyl-4-(1H-pyrazol-4-yl)-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 277.6; HRMS: calcd for C14H10F3N3 + H+, 278.08996; found (EST,
[M+H]+ Obs'd), 278.0903.
Step 2: 3-methyl-4-{1-[3-(methylsulfonyl)phenyl]-1H-pyrazol-4-yl}-8-
(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
43. MS (ES) m/z 432.0; HRMS: calcd for C21H16F3N3O2S + H+, 432.09881; found (ESI,
[M+H]+ Obs'd), 432.0992.
Example 438
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid
The title compound was prepared in a similar manner to that described for Example
43. MS (ES) m/z 434.1; HRMS: calcd for C24H19NO5S + H+, 434.10567; found (ESI,
[M+H]+Obs'd), 434.1065.
Example 439
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide
Step 1: ethyl 8-chloro-4-(3-hydroxyphenyl)quinoline-3-carboxylate
A well-stirred mixture of ethyl 4-bromo-8-chloroquinoline-3-carboxylatc (5.20 g,
16.6 mmol), 3-hydroxybenzene boronic acid (4.53 g, 33.1 mmol), sodium carbonate (6.85 g,
49.6 mmol), tetrakis(triphenylphosphine)palladium(0) (5.73 g, 4.97 mmol), toluene (160 mL),
H2O (80 mL), and ethanol (40 mL) was heated at reflux for 4 h. The cooled reaction was
treated with water (75 mL) and extracted several times with ethyl acetate. The combined
extracts were washed with brine (25 mL), dried with MgSO4, filtered, and concentrated in
vacuo to a brown syrup. Purification by chromatography afforded the title compound as a
yellow powder (4.19 g, 77%). MS (ES) m/z 328.1; HRMS: calcd for C18H14ClNO3 + H+,
328.07350; found (ESI, [M+H]-), 328.0748.
Step 2: 8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide
The title compound was prepared from ethyl 8-chloro-4-(3-hydroxyphenyl)quinoline-
3-carboxylate and 1-(ethylsulfonyl)-3-fluorobenzene according to the procedure for Example
43. MS (ES) m/z 466.8.
Example 440
8-chloro-4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}quinoline-3-
carboxamide
The title compound was prepared from ethyl 8-chloro-4-(3-hydroxyphenyl)quinoline-
3-carboxylate and 1,3-dichloro-5-(methylsulfonyl)benzene according to the procedure for
Example 43. MS (ES) m/z 486.6.
Examnle 441
8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Step 1: 3-(8-Fluoroquinolin-4-yl)phenol
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 237.8; HRMS: calcd for C15H10FNO + H+, 240.08192; found (ESI,
[M+H]-), 240.0818.
Step 2: 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
The title compound was prepared in a similar manner to that described for Example
43. MS (ES) m/z 393.6; HRMS: calcd for C22H16FNO3S + H+, 394.09077; found (ESI,
[M+H]-Obs'd), 394.0912.
Example 442
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline
Prepared as in Example 43 except using 3-[3-phenyl-8-(trifluoromethyl)quinolin-4-
yl]phenol and 3-fluoro-1-(methylsulfonyl)-benzene as the reactants to afford the title
compound as an clear syrup. MS (ES) m/z 520.0; HRMS: calcd for C29H20F3NO3S- H ,
520.11887; found (ESI, [M+H]+ Obs'd), 520.1190.
Example 443
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Step 1: 4-hydroxyquinoline-8-carbonitrile
Prepared as in Example 415, step 2, first part, except using 2-{[(2,2-dimethyl-4,6-
dioxo-1,3-dioxan-5-ylidene)methyl]amino}benzonitrile as the reactant to afford the title
compound as a tan solid. MS (ES) m/z 171.3.
Step 2: 4-bromoquinoline-8-carbonitrile
Prepared as in Example 415, step 2, second part, except using 4-hydroxyquiroline-8-
carbonitrile and P(O)Br3 in DMF as the reactants to afford the title compound as a tan solid.
MS (ES) m/z 232.8.
Step 3: 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
A mixture of 4-bromoquinoline-8-carbonitrile (700 mg, 3.1 mmol), 3-hydroxyphenyl
boronic acid (832 mg, 6.10 mmol), Pd(PPh3)4 (488 mg, 0.42 mmol), and K3PO4 (1.60 g. 7.5
mmol) in 1,4 dioxane (50 mL) were stirred at reflux for 3 h. The reaction was cooled,
filtered into a separatory tunnel with 100 mL of water and extracted with ethyl acetate. The
extracts were dried over MgSO4 and concentrated in vacuo. The residue was
chromatographed with a gradient of 10:90 to 50:50 E:H to afford the title compound as a
yellow solid (600 mg). MS (ES) m/z 246.8.
Step 4: 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and l-fluoro-3-(methylsulfonyl)benzene as the Teactants to afford the title compound as an
off-white solid. MS (ES) m/z 400.7.
Example 444
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as an off-
white solid. MS (ES) m/z 414.7.
Example 445
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and 1 -fluoro-3-(propylsulfonyl)benzene as the reactants to afford the title compound as an tan
solid. MS (ES) m/z 428.8.
Example 446
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and l-fluoro-3-(isopropylsulfonyl)benzene as the reactants to afford the title compound as an
off-white solid. MS (ES) m/z 428.8.
Example 447
4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and l-(benzylsulfonyl)-3-fIuorobenzene as the reactants to afford the title compound as a red
solid. MS (ES) m/z 476.8.
Example 448
4-(3-{3-[(3-hydroxypropyl)sulfonyl]phenoxy}phenyl)quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and 3-[(3-fluorophenyl)sulfonyl]propan-1-ol as the reactants to afford the title compound as
an off-white solid. MS (ES) m/z 444.7.
Example 449
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxylphenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and 1,3-difluoro-5-(methylsulfonyl)benzene as the reactants to afford the title compound as
an off-white solid. MS (ES) m/z 418.7.
Example 450
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and l,3-difluoro-5-(ethylsulfonyl)benzene as the reactants to afford the title compound as a
light yellow solid. MS (ES) m/z 432.7.
Example 451
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphcnyl)quinoline-8-carbonitrile
and l-fluoro-4-(methylsulfonyl)benzene as the reactants to afford the title compound as an
off-white solid. MS (ES) m/z 400.7.
Example 452
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile
Prepared as in Example 43 except using 4-(3-hydroxyphenyl)quinoline-8-carbonitrile
and 4-(ethylsulfonyl)-1-fluorobenzenc as the reactants to afford the title compound as an off-
white solid; MS (ES) m/z 414.7.
Example 453
Step 1: 4-(2-chloro-5-methoxyphenyl)quinoline-8-carbonitrile
Prepared as in Example 400, step 2, except using 4-bromoquinoline-8-carbonitrile
and 2-chloro-5-(methoxyphenyl)boronic acid as the reactants to afford the title compound as
an off-white solid.
Step 2: 4-(2-chloro-5-hydroxyphenyl)quinoline-8-carbonitrile
Prepared as in Example 400, step 2, except using 4-(2-chloro-5-
methoxyphenyl)quinoline-8-carbonitrile as the reactant to afford the title compound as an off-
white solid. MS (ES) m/z 281.0; HRMS: calcd for C16H9ClN2O + H1, 281.04762; found (ESI,
[M+H]-Obs'd), 281.0482.
Step 3: 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-
carbonitrile
Prepared as in Example 43 except using 4-(2-chloro-5-hydroxyphenyl)quinoli.ne-8-
carbonitrile and l-fluoro-3-(methylsulfonyl)benzene as the reactants to afford the title
compound as an off-white solid. MS (ES) m/z 434.9; HRMS: calcd for C23H15ClN2O3S + H+,
435.05647; found (ESI, [M+H]+ Obs'd), 435.0568.
Example 454
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 3-(8-chloroquinolin-4-yl)phenol and 1-
fluoro-3-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white
solid. MS (ES) m/z 410.0; HRMS: calcd for C22H16ClNO3S + H+, 410.06122; found (ESI,
[M+H]- Obs'd), 410.0615.
Example 455
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 3-(8-chloroquinolin-4-yl)phenol and
1-(ethylsulfonyl)-3-fluorobcnzene as the reactants to afford the title compound as a white
solid. MS (ES) m/z 423.9; HRMS: calcd for C23H18ClNO3S + H+, 424.07687; found (ESI,
[M+H]-), 424.0772.
Example 456
8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Step 1:4-bromo-8-chloroquinoline
Prepared as in Example 415, step 2 except using 8-chloro-quinolin-4-ol as the
reactant and P(O)Br; in DMF to afford the title compound as a tan solid. MS (ES) m/z 241.9;
HRMS: calcd for C9H5BrClN + H+, 241.93666; found (ESI, [M+H]+ Obs'd), 241.9372.
Step 2: 8-chloro-4-(2-chloro-5-methoxyphenyl)quinoline
Prepared as in Example 415, step 3 above except using 4-bromo-8-chloroquinoline
and (2-chloro-5-mcthoxyphenyl)boronic acid as the reactants to afford the title compound as
an off-white solid. MS (ES) m/z 304.0; HRMS: calcd for C16H11C12NO + H+ 304.02904;
found (ESI, [M+H]- Obs'd), 304.0294.
Step 3: 4-chloro-3-(8-chloroquinolin-4-yl)phenol
Prepared as in Example 415, step 4 above except using 8-chloro-4-(2-chloro-5-
methoxyphenyl)quinoline as the reactant to afford the title compound as an off-white solid.
HRMS: calcd for C15H9C12NO + H-, 290.01339; found (ESI, [M+H]+ Obs'd), 290.0141.
Step 4: 8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 4-chloro-3-(8-chloroquinolin-4-yl)phenoI
and 3-fluoro-1-(methylsulfonyl)benzenc as the reactants to afford the title compound as an
off-white solid. MS (ES) m/z 443.9; HRMS: calcd for C22H15C12NO3S H-, 444.02224; found
(ESI, [M+H]- Obs'd), 444.0226.
Example 457
8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 4-chloro-3-(8-chloroquinolin-4-yl)phcnol
and l-(ethylsulfonyl)-3-fluorobenzene as the reactants to afford the title compound as an off-
white solid. MS (ES) m/z 458.1; HRMS: calcd for C23H17Cl2NO3S H-, 458.03789; found
(ESI, [M+H]- Obs'd), 458.0386.
Example 458
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy] phenyl} quinoline
Step 1: 3-(8-methylquinolin-4-y])phenol
Prepared as in Example 415, step 3, above except using 4-bromo-8-methylquinoline
as the reactant to afford the title compound as a yellow solid. MS (ES) m/z 236.2; HRMS:
calcd for C16H13NO + H', 236.10699; found (ESI, [M+H]+ Obs'd), 236.1074.
Step 2: 8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43 except using 3-(8-methylquinolin-4-yl)phenol and 3-
fluoro-1-(methylsulfonyl)benzene as the reactants to afford the title compound as an off-white
solid. MS (ES) m/z 390.1; HRMS: calcd for C23H19NO3S H+, 390.11584; found (ESI,
[M+H]- Obs'd), 390.1165.
Example 459
8-methoxy-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Step 1: 3-(8-methoxyquinolin-4-yl)phenol
Prepared as in Example 415, step 3, above except using 4-bromo-8-mcthoxyquinoline
as the reactant to afford the title compound as a yellow solid. MS (ES) m/z 252.0; HRMS:
calcd for CI6H13NO2 + H1, 252.10190; found (ESI, [M+H]+ Obs'd), 252.1029.
Step 2: 8-methoxy-4-{3-[3-(methylsulfonyl)phenoxy|phenyl}quinoline
Prepared as in Example 43 except using 3-(8-methoxyquinolin-4-yl)phenol and 3-
fluoro-1-(methylsulfonyl)bcnzene as the reactants to afford the title compound as an off-white
solid. MS (ES) m/z 405.9; HRMS: calcd for C23H19NO4S + H+ 406.11076; found (ESI,
[M+H]+Obs'd), 406.1110.
In the preparation of primary and secondary sulfonamides (Rf = SO2Rn, and Rn =
NRgRh), the sulfonamide may be prepared as a 4-methoxybenzyl-protectcd compound.
Treatment with trifluoroacctic acid (TFA) removes the 4-methoxybenzyl group, leaving a
hydrogen.
Example 460
N,N-bis(4-methoxybenzyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl)phenoxy}benzenesulfonamide
Step 1: 3-bromo-N-(4-methoxybenzyl)benzenesulfonamide
A stirred mixture of 3-bromobcnzenesulfonyl chloride (5.11 g, 20.0 mmol) and
triethylamine (3.07 mL, 22.0 mmol) in dichloromethane (100 mL) was treated with 4-
methoxybenzylamine (2.85 mL, 22.0 mmol) over 5 min. After 2 h at ambient temperature,
the reaction was treated with saturated aqueous NaHCO3 (100 mL) and extracted with
dichloromethane (2 x 50 mL). The combined extracts were dried (MgSO4) and concentrated
in vacuo to a solid. Chromatography eluting with a 30:70 to 50:50 E:H gradient affords the
title compound as a white solid (6.18 g, Rf ~ 0.4 in 50:50 E:H). MS (ES-) m/z 353.6 [M-H]-+ .
Step 2: 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide
A solution of 3-bromo-N-(4-methoxybenzyl)benzenesulfonamide (3.56 g, 10.0
mmol) in DMF (20 mL) was treated with 60% NaH in oil (440 mg, 11.0 mmol). Gas
evolved. After 20 min, 4-methoxybenzyl chloride (1.63 mL, 12.0 mmol) was added and the
reaction was stirred at ambient temperature for 5 h. The reaction was poured into water (60
mL) resulting in a white precipitate. The precipitate was filtered off, washed with water, and
dried in vacuo to afford the title compound as a white solid (4.92 g, Rf ~ 0.5 in E:H). MS
(ES+) m/z 475 [M+H]+.
Step 3: N,N-bis(4-methoxybenzyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
A stirred mixture of 3-methyl-8-trifluoromethyl-4-(3-hydroxyphenyl)quinoline (303
mg, 1.00 mmol), 3-bromo-N,N-bis(4-methoxybenzyl)benzenesulfonamide (714 mg, 1.50
mmol), copper (I) iodide (40 mg, 0.20 mmol), N,N-dimethylglycine hydrochloride (53 mg,
0.38 mmol), cesium carbonate (977 mg, 3.00 mmol) in dioxane (20 mL) was heated at 100 °C
for 18 h. The cooled reaction was treated with water (50 mL) and extracted with ethyl acetate
(3 x 30 mL). The extracts were dried with MgSO4, concentrated in vacuo, and
chromatographed eluting with a gradient of 15:85 to 50:50 E:H to afford the title compound
as a white solid (352 mg). MS (ES) m/z 699.0; HRMS: calcd for C39H33F3N2O5S + H+,
699.2135; found (ESI, [M+H]+ Obs'd), 699.2128.
Example 461
N,N-bis(4-methoxybenzyl)-3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
In the same manner as Example 460 but using 4-(3-hydroxyphenyl)-8-
trifluoromethyl-quinoline and 3-bromo-N,N-bis(4-methoxybenzyl)benzcnesulfonamide was
prepared the title compound as a white solid. MS (ESI) m/z 685; HRMS: calcd for
C38H31F3N2O5S + H-, 685.1979; found (ESI, [M+H]+ Obs'd), 685.1984.
Example 462
N,N-bis(4-methoxybenzyl)-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
Step 1:4-fluoro-N-(4-methoxybenzyl)benzenesulfonamide
The title compound was prepared by essentially the same procedure of Example 460,
step 1, except starting with 4-fluorobenzenesulfonyl chloride in place of 3-
bromobenzenesulfonyl chloride, isolating a white solid. MS (ESI) m/z 293.9 [M-H]-.
Step 2: 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide
A solution of 4-fluoro-N-(4-methoxybenzyl)benzenesulfonamide (2.95 g, 10.0 mmol)
in DMF (20 mL) was treated with 60% NaH in oil (440 mg, 11.0 mmol). Gas evolved. After
20 min, 4-methoxybenzyl chloride (1.63 mL, 12.0 mmol) was added and the reaction was
stirred at ambient temperature for 5 h. The reaction was treated with water (60 mL)
producing a white precipitate. The material was chromatographed using a 20:80 to 40:60 E:H
gradient to afford the title compound as a white solid (3.08 g). MS (ES) m/z 415.
Step 3: N,N-bis(4-methoxybenzyl)-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yllphenoxy}benzenesulfonamide
A stirred mixture of 3-methyl-8-trifluoromethyl-4-(3-hydroxyphenyl)quinoline (303
mg, 1.00 mmol), 4-fluoro-N,N-bis(4-methoxybenzyl)benzencsulfonamide (499 mg, 1.20
mmol), K2CO3 (276 mg, 2.00 mmol) in DMF (5.0 mL) was heated at 130 °C for 18 h. The
cooled reaction was treated with water (20 mL) and brine (2 mL). The mixture was extracted
with ethyl acetate (3 x 10 mL). The extracts were dried with MgSO4, concentrated in vacuo,
and chromatographed cluting with a gradient of 15:85 to 40:60 E:H to afford the title
compound as a white solid (582 mg). MS (ES) m/z 699.1; HRMS: calcd for C39H33F3N2O5S +
H+, 699.21350; found (ESI, [M+H]+ Obs'd), 699.2129.
Example 463
N,N-bis(4-methoxybenzyl)-4-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
In the same manner as Example 462, step 3, but using 8-trifluoromethyl-4-(3-
hydroxyphenyl)quinoline and 4-fluoro-N,N-bis(4-methoxybenzyl)benzenesulfonamide as
substrates was prepared the title compound as an off-white solid. MS (ESI) m/z 685; HRMS:
calcd for C38H31F3N2O5S + H+, 685.19785; found (ESI, [M+H]+ Obs'd), 685.1978.
3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
A mixture of N,N -bis(4-methoxybenzyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolin-
4-yl]phenoxy}benzenesulfonamide (302 mg, 0.43 mmol) in trifluoroacetic acid (4 mL) and
CH2Cl: (4 mL) was stirred at ambient temperature under nitrogen for 18 h. The reaction was
concentrated in vacuo, treated with saturated aqueous NaHCO3 (10 mL) and extracted with
CH2Cl2 (2x5 mL). The dried (MgSO4) extracts were chromatographed using a gradient of
20:80 to 50:50 E:H to afford the title compound as a white solid (199 mg). MS (ES) m/z
458.9; HRMS: calcd for C23H17F3N2O3S + H+, 459.09847; found (ESI, [M+H]+ Obs'd),
459.0987.
Example 465
4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
In the same manner as Example 464 but using N,N-bis(4-mcthoxybenzyl)-3- (3-[8-
(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as substrate was prepared the
title compound as an off-white solid. MS (ES) m/z 444.9; HRMS: calcd for C22H15F3N2O3S +
H+, 445.0828; found (ESI, [M+H]+ Obs'd), 445.0835.
Example 466
4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
In essentially the same manner as Example 464 but using AvV-bis(4-methoxybenzyl)-
4- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy }benzenesulfonamide as substrate
was prepared the title compound as a white solid. MS (ES) m/z 458.9; HRMS: calcd for
C23H17F3NO3S + H+, 459.09847; found (ESI, [M+H]+ Obs'd), 459.0988.
Example 467
4-{3-[8-(trifIuoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide
In essentially the same manner as Example 464 but using N,N-bis(4-methoxybenzyl)-
4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as substrate was
prepared the title compound as an off-white solid. MS (ES) m/z 444.6; HRMS: calcd for
C22H15F3N2O3S + H+, 445.08282; found (ESI, [M+H]+ Obs'd), 445.0833.
Example 468
3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Step 1: 3-isopropyl-4-(3-methoxyphenyl)-8-(trifluoromethyl)quinoline
In the same manner as Example 425, step 1, but using [2-amino-3-
(trifluoromethyl)phenyl](3-methoxyphenyl)methanone and 3-methylbutanal as substrates was
prepared the title compound as an pale yellow solid. MS (ES) m/z 346.0; HRMS: calcd for
C20H18F3NO + H+, 346.1413; found (ESI, [M+H]+ Obs'd), 346.1422.
Step 2: 3-[3-isopropyl-8-(trifluoromethyl)quinolin-4-yl]phenol
In the same manner as Example 425, step 2, but using 3-isopropyl-4-(3-
methoxyphenyl)-8-(trifluoromethyl)quinoline as substrate was prepared the title compound as
an off-white solid. MS (ES) m/z 332.1; HRMS: calcd for C19H16F3NO + H+, 332.1257; found
(ESI, [M+H]+ Obs'd), 332.1266.
Step 3: 3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
In the same manner as Example 43 but using 3-[3-isopropyl-8-
(trifluoromethyl)quinolin-4-yl]phenol and l-fluoro-3-(methylsulfonyl)benzene as substrates
was prepared the title compound. MS (ES) m/z 485.9.
Example 469
3-methyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
In the same manner as Example 212, except using 3-methyl-4-(3-hydroxyphenyl)-8-
(trifluoromethyl)quinoline and l-(bromomethyl)-3-(methylsulfonyl)benzene as substrates was
prepared the title compound as a white solid. MS (ES) m/z 472.0; HRMS: calcd for
C25H20F3NO3S + H+, 472.1189; found (ESI, [M+H]+ Obs'd), 472.1191.
Example 470
3-methyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
In the same manner as Example 212, except using 3-methyl-4-(3-hydroxyphenyl)-8-
(trifluoromethyl)quinoline and l-(chloromethyl)-4-(methylsulfonyl)benzene as substrates was
prepared the title compound as a white solid. MS (ES) m/z 472.0: HRMS: calcd for
C25H20F3NO3S + H+, 472.1189; found (ESI, [M+H]+ Obs'd), 472.1192.
Examples 471 to 482
The following compounds in Examples 471 to 482 were prepared essentially
according to the procedure of Example 259 except using the appropriate reactants for the
desired substitution pattern.
Example 471
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-3-methyl-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 461.7; HRMS: calcd for C23H18F3NO2S2 + H+, 462.08038; found (ES1,
[M+H]-), 462.0800.
Example 472
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 447.7; HRMS: calcd for C22H16F3NO2S2 + H+, 448.06473; found (ESI,
[M+H]+Obs'd), 448.0653.
Example 473
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-1,3-thiazol-2-yl}-8-
(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Eixample
259. MS (ES) m/z 448.9; HRMS: calcd for C21H15F3N2O2S2 + H+, 449.05998; found (ESl,
[M+H]+ Obs'd), 449.0603.
Example 474
ethyl 4-{5-[3-(methylsulfonyl)pheny]]-2-thieny]}-8-(trifluoromethyl)quinoline-3-
carboxylate
The title compound was prepared in a similar manner to that described for Example
259.
Example 475
4-{5-[3-(methylsulibnyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline-3-
carboxamide
The title compound was prepared in a similar manner to that described for Example
276. MS (ES) m/z 477.0.
Example 476
ethyl 4-{5'-[3-(methylsulfonyl)phenyl]-2,2'-bithiophen-5-yl}-8-
(trifluoromethyl)quinoline-3-carboxylate
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 587.9; HRMS: calcd for C28H20F3NO4S3 + H+, 588.05793; found (ESI,
[M+H]+ Obs'd), 588.0582.
Example 477
8-fluoro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
Step I: 3-(8-iluoroquinolin-4-yl)phenyl trifluoromethanesulfonate
The compound was prepared in a similar manner to that described for Example 258.
MS (ES)m/z 371.7.
Step 2: 8-fluoro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 378.3; HRMS: calcd for C22H16FNO2S + H+, 378.09585; found (ESI,
[M+H]+ Obs'd), 378.0963.
Example 478
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-
(trifluoromethyl)quinoline
Step 1: 4-(5-chloro-2-thienyl)-3-methyl-8-(trifluoromethyl)quinoline
The compound was prepared in a similar manner to that described for Example 259.
MS (ES) m/z 327.6; HRMS: calcd for C15H9ClF3NS + H+, 328.01691; found (ESI, [M+H]+
Obs'd), 328.0175.
Step 2: 3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-
(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 447.6; HRMS: calcd for C22H16F3NO2S2 + H+, 448.06473; found (ESI,
[M+H]+ Obs'd), 448.0650.
Example 479
4-[3-(methylsulfonyl)phenyl]-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 351.9.
Example 480
4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
Step 1: 4-(5-chloro-2-thienyl)-8-(trifluoromethyl)quinoline
The compound was prepared in a similar manner to that described for Example 259.
MS (ES) m/z 313.6.
Step 2: 4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 433.6.
Example 481
N,N-dimethyl-3-{5-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]-2-
thicnyl} benzenesulfonamide
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 476.6; HRMS: calcd for C23H19F3N2O2S2 + H+, 477.09128; found (ESI.
[M+H]+Obs'd), 477.0911.
Example 482
3-methyl-4-{5-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-
(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 447.6; HRMS: calcd for C22H16F3NO2S2 + H+, 448.06473; found (ESI,
[M+H]+ Obs'd), 448.0648.
Examples 483 to 506
The following compounds in Examples 483 to 506 were prepared essentially
according to the procedure of Example 279 except using the appropriate reactants for the
desired substitution pattern.
Example 483
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)quinoline
and 3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a
white solid. MS (ES) m/z 427.8.
Example 484
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-
methyl)quinoline and 4-methyl-3-(methylsulfonyl)phenylboronic acid as the reactants to
afford the title compound as a white solid. MS (ES) m/z 442.1.
Example 485
4-[3'-(methylsulfonyl)biphenyl-3-yl]-3-phenyl-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-3-phenyl-8-
(trifluoromethyl)quinolone and 3-(methylsulfonyl)phenylboronic acid as the reactants to
afford the title compound as an off-white solid. MS (ES) m/z 503.7.
Example 486
3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-
methyl)quinoline and 3-sulfamoylphenylboronic acid as the reactants to afford the title
compound as a tan solid. MS (ES) m/z 429.1.
Example 487
ethyl 4-(3'-(3-(1,3-dioxoisoindolin-2-yl)propylthio)biphenyl-3-yl)-8-
(trifluoromethyl)quinoline-3-carboxylate
Prepared as in Example 279 except using ethyl 8-(trifluoromethyl)-4-(3-(trifluoro-
methylsulfonyloxy)phenyl)quinoline-3-carboxylate and 3-(3-(1 ,3-dioxoisoindolin-2-
yl)propylthio)phenylboronic acid as the reactants to afford the title compound as a tan solid.
MS (ES) m/z 640.1.
2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxamide
Step 1:2-amino-4-(3-bromophenyl)-8-(trifluoromethy])quinoline-3-carboxamide
A stirred mixture of (2-amino-3-(trifluoromethyl)phenyl)(3-bromophenyl)methanonc
(1.0 g, 2.9 mmol) and 2-cyanoacctamide (366 mg, 4.4 mmol) in DMSO (5.0 mL) was treated
with NaH (348 mg, 8.7 mmol, 60% dispersion in oil). After gas evolution the reaction vessel
was capped and heated at 110 oC for 20 h. The cooled reaction was poured into water (80 mL)
and extracted with ethyl acetate. The extracts were dried with MgSO4 and concentrated in
vacuo. The reside was purified by chromatography eluting with a 20:80 to 100:0 E:H gradient
to afford the title compound as a white solid (713 mg, 60%).
MS (ES) m/z 409.6; HRMS: calcd for C17H11BrF3N3O + H+, 410.01103; found (ESI,
[M+H]+Obs'd), 410.0114.
Step 2: 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline-3-carboxamide
Prepared as in Example 279 except using 2-amino-4-(3-bromophenyl)-8-
(trifluoromethyl)quinoline-3-carboxamide and 3-(methylsulfonyl)phenylboronic acid as the
reactants to afford the title compound as a white solid. MS (ES) m/z 486.0; HRMS: calcd for
C24H18N3O3S + H+, 486.10937; found (ESI, [M+H]+ Calc'd), 486.1094.
Example 489
4-[4'-fluoro-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using using 4-(3-(4,4,5,5-tctramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinoline and 4-chloro-1-fluoro-2-
(methylsulfonyl)benzene, potassium phosphate and palladium (II) acetate as the reactants to
afford the title compound as a white solid. MS (ES) m/z 445.8.
Example 490
4-[4'-fluoro-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 279 except using using 3-methyl-4-(3-(4,4,5,5-tetramethyl-
1,3,2-dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 4-chloro-1 -fluoro-2-
(methylsulfonyl)benzenc, potassium phosphate and palladium (11) acetate as the reactants to
afford the title compound as a white solid. MS (ES) m/z 459.8.
Example 491
2-[3-({3,-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}thio)propyl]-1H-
isoindole-1,3(2H)-dione
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)-
quinoline and 2-(3-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenylthio)-
propyl)isoindoline-1,3-dione as the reactants to afford the title compound as a white solid. MS
(ES) m/z 568.7.
Example 492
N-ethyl-3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-amine
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 3-(3-bromophenylsulfonyl)-N-
ethylpropan-1-amine as the reactants to afford the title compound as a white solid.
MS (ES) m/z 513.1.
Example 493
N-methyl-3-({3,-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-amine
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-l,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 3-(3-bromophenylsulfonyl)-N-
methylpropan-1-amine as the reactants to afford the title compound as a white solid.
MS (ES) m/z 499.1.
Example 494
N-ethyl-3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-
1-amine
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)-
quinoline and 3-(3-bromophenylsulfonyl)-N-ethylpropan-1-amine as the reactants to afford
the title compound as a white solid. MS (ES) m/z 499.0.
Example 495
N-methyl-3-({3'-8-trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-amine
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)-
quinoline and 3-(3-bromophenylsulfonyl)-N-methylpropan-1-amine as the reactants to afford
the title compound as a white solid. MS (ES) m/z 484.1.
Example 496
8-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
Step 1: 4-(3-bromophenyl)-8-chloroquinoline
4-Bromo-8-chloroquinoline (0.200 g, 0.82 mmol) in dioxane (3 mL) was treated with
3-bromophenylboronic acid (0.15 mmol), potassium phosphate (0.26 g, 1.2 mmol), and
Pd(PPh3)4 (20 mg, 0.017 mmol). The reaction was heated at 90 °C for 8 h. The solvent was
removed and the residue was chromatographed using 10:90 E:H to obtain 0.085 g of the title
compound. MS (ES) m/z 317.8.
Step 2: 8-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-chloroquinoline and
3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound as a white
solid. MS (ES) m/z 393.9.
Example 497
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 5-bromothiophene-2-
sulfonamide as the reactants to afford the title compound as a white solid. MS (ES) m/z 449.1.
Example 498
5-{3-[8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)-
quinoline and 5-bromothiophenc-2-sulfonamide as the reactants to afford the title compound
as a white solid. MS (ES) m/z 434.9.
Example 499
3-methyl-4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-(methyl-
sulfonyl)thiophcne as the reactants to afford the title compound as a white solid.MS (ES) m/z
447.9.
Example 500
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-(trifluoromethyl)quinoline
Step 1: 2-bromo-5-(ethylsulfonyl)thiophene
The title compound was prepared as in Example 1 using 5-bromothiophene-2-
sulfonyl chloride as the arylsulfonyl chloride and iodoethane as the alkylating agent.
MS (ES) m/z 253.9.
Step2:4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-(ethylsulfonyl)-
thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z 462.0.
Example 501
3-methyl-4-{3-[5-(propylsulfonyl)-2-thienyl]phenyl}-8-
(trifluoromethyl)quinolone
Step 1: 2-bromo-5-(propylsulfonyl)thiophene
The title compound was prepared as in Example 1 except using 5-bromothiophcne-2-
sulfonyl chloride as the arylsulfonyl chloride and 1-iodopropanc as the alkylating agent.
MS (ES) m/z 268.9.
Step 2: 3-methyl-4-{3-[5-(propylsulfonyl)-2-thienyl]phenyl}-8-
(trifluoromethyl)quinolone
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-
(propylsulfonyl)thiophene as the reactants to afford the title compound as a white solid.
MS (ES) m/z 476.0.
Example 502
4-{3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
Step 1: 2-bromo-5-(isopropylsulfonyl)thiophene
The title compound was prepared as in Example 1 except using 5-bromothiophene-2-
sulfonyl chloride as the arylsulfonyl chloride and l-iodo-2-methylpropane as the alkylating
agent. MS (ES) m/z 268.9.
Step 2: 4-{3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 2-bromo-5-(isopropyl-
sulfonyl)thiophene as the reactants to afford the title compound as a white solid. MS (ES) m/z
476.0.
Example 503
3-[(5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-2-thienyl)sulfonyl]-
propan-1-ol
Prepared as in Example 279 except using 3-methyl-4-(3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)phenyl)-8-(trifluoromethyl)quinolone and 3-(5-bromothiophen-2-
ylsulfonyl)propan-1-ol as the reactants to afford the title compound as a white solid.
MS (ES) m/z 492.0.
Example 504
4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline
Step 1: 2-bromo-5-(methylsulfonyl)thiophene
The title compound was prepared using 5-bromothiophene-2-sulfonyl chloride as the
arylsulfonyl chloride and iodomethane as the alkylating agent.
MS (ES) m/z 240.9.
Step 2: 4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoromelhyl)-
quinoline and 2-bromo-5-(methylsulfonyl)thiophene as the reactants to afford the title
compound as a white solid. MS (ES) m/z 433.9.
Example 505
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-brornophenyl)-8-(trifluoromethyl)-
quinoline and 2-bromo-5-(ethylsulfonyl)-thiophene as the reactants to afford the title
compound as a white solid. MS (ES) m/z 447.9.
Example 506
4-{3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline
Prepared as in Example 279 except using 4-(3-bromophenyl)-8-(trifluoro-methyl)-
quinoline and 2-bromo-5-(isopropylsulfonyl)thiophcne as the reactants to afford the title
compound as a white solid. MS (ES) m/z 462.0.
Example 507
The following compound of Example 507 was prepared essentially according to the
procedure of Example 233.
N-(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3-
yl)methanesulfonamide
The title compound was prepared in a manner similar to that described in Example
233.
MS (ES) m/z 536.9; HRMS: calcd for C24H19F3N2O5S2 + H+, 537.07602; found (ESI,
[M+H]+ Obs'd), 537.0757.
Examples 508 to 526
The following compounds in Examples 508 to 526 were prepared in a manner similar
to that described in Example 276, except using the appropriate reactants.
Example 508
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxarnide
MS (ES) m/z 453.0; HRMS: calcd for C23H17ClN2O4S - H+, 451.05248; found (ESl.
[M-H]+), 451.0526.
Example 509
N-benzyl-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl] phenoxy}phenyl)sulfonyl] propan-1 -amine
MS (ES) m/z 576.9; HRMS: calcd for C32H27F3N2O3S + H+, 577.17672; found (ESI,
[M+H]+Obs'd), 577.1766.
Example 510
N-(4-fluorobenzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 594.8; HRMS: calcd for C32H26F4N2O3S + H+, 595.16730; found (ESI,
[M+H]+Obs'd), 595.1685.
Example 511
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yllphenoxy}phenyl)sulfonyl|propyl}prop-2-en-1-amine
MS (ES) m/z 526.8.
Example 512
3-( {3- [(3-{3- [8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}amino)propanenitrile
MS (ES) m/z 539.8; HRMS: calcd for C28H24F3N3O3S + H+, 540.15632; found (ESI,
[M+H]+Obs'd), 540.1561.
Example 513
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl] phenoxy}phenyl)sulfonyl] propyl} prop-2-yn-1-amine
MS (ES) m/z 524.8; HRMS: calcd for C28H23F3N2O3S + H+, 525.14542; found (ESI,
[M+H]+-Obs'd), 525.1456.
Example 514
N-(2-fluoroethyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 532.8.
Example 515
N-methoxy-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 516.8; HRMS: calcd for C26H23F3N2O4S + H+, 517.14034; found (ESI,
[M+H]+), 517.1399.
Example 516
4-(3-{3-[(3-chloropropyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline
The product was isolated from the above reaction (Example 515) using N-methyl
hydroxyamine hydrochloride as the starting material. MS (ES) m/z 505.7; HRMS: calcd for
C25H19ClF3NO3S + H+, 506.07990; found (ESI, [M+H]+ Obs'd), 506.0796.
Example 517
N-methyl-N-{3-[(3-{3-[8-(trlfluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-yn-1-amine
MS (ES) m/z 538.8; HRMS: calcd for C29H25F3N2O3S + H+, 539.16107; found (ESI,
[M+H]+Obs'd), 539.1608.
Example 518
(2R)-N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine
MS (ESI) m/z 543; HRMS: calcd for C29H29F3N2O3S + H+, 543.19237; found (ESI,
[M+H]+ Obs'd), 543.1935.
Example 519
(2S)-N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine
MS (ES) m/z 542.9; HRMS: calcd for C29H29F3N2O3S +H+, 543.19237; found (ESI,
[M+H]+Obs'd), 543.1922.
Example 520
N-(3-chlorobenzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl] phenoxy}phenyl)sulfonyl]propan-1-amine
MS (ES) m/z 610.8; HRMS: calcd for C32H26ClF3N2O3S + H+, 611.13775; found
(ESI, [M+H]+ Obs'd), 611.1386.
Example 521
(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3-
yl)methanamine
MS (ES) m/z 473.0; HRMS: calcd for C24H19F3N2O3S + H+, 473.11412; found (ESI,
[M+H]+Obs'd), 473.1143.
Example 522
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3-
carboxamide
The title compound was prepared in a similar manner to that described for Example
276. MS (ES) m/z 470.6; HRMS: calcd for C23H16ClFN2O4S + H+, 471.05761; found (ESI,
[M+H] ), 471.0578.
Example 523
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-cyanoquinoline-3-
carboxamide
The title compound was prepared in a similar manner to that described for Example
276. MS (ES) m/z 478.0.
Example 524
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide
The title compound was prepared in a similar manner to that described for Example
276. MS (ES) m/z 433.0; HRMS: calcd for C24H20N2O4S + H+, 433.12165; found (ESI,
[M+H]+Obs'd), 433.1225.
Example 525
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carboxamide
The title compound was prepared from ethyl 8-trifluoromethyl-4-(3-
hydroxyphenyl)quinoline-3-carboxylate and 1,3-dichloro-5-(methylsulfonyl)benzene
according to the procedure for Example 276. MS (ES) m/z 521.0.
Example 526
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide
The title compound was prepared from ethyl 8-trifluoromethyl-4-(3-
hydroxyphenyl)quinoline-3-carboxylatc and l-(ethylsulfonyl)-3-fluoroben7cne according to
the procedure for Example 276. MS (ES) m/z 501.1.
In embodiments, sulfide precursors to compounds in which Rf is -S(O)2Rn can be
oxidized to the corresponding sulfone using Oxone® under conventional conditions, and
according to Example 35 above for the preparation of halogenated arylsulfones from
thiophenols.
Example 527
ethyl 4-(3'-{[3-(1,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)propyl]sulfonyl}biphenyl-
3-yl)-8-(trifluoromethyl)quinoline-3-carboxylate
Prepared as in Example 35 except using ethyl 4-(3'-(3-(1,3-dioxoisoindolin-2-yl)-
propylthio)biphenyl-3-yl)-8-(trifluoromethyl)quinoline-3-carboxylate as the reactant to afford
the title compound as a white solid. MS (ES) m/z 672.7.
Example 528
2-[3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propyl]-1H-isoindole-1,3(2H)-dione
Prepared as in Example 35 except using 2-(3-(3'-(3-methyl-8-
(trifluoromethyl)qumoIin-4-yl)biphenyl-3-ylthio)propyl)isoincloline-1,3-dione as the reactant
to afford the title compound as a white solid. MS (ES) m/z 614.7.
Example 529
2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propyl]-1H-
isoindoIe-1,3(2H)-dione
Prepared as in Example 35 except using 2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-
3-yl}thio)propyl]-1H-isoindole-1,3(2H)-dionc as the reactant to afford the title compound as a
white solid. MS (ES) m/z 600.6.
In some embodiments, Rn can be alkyl substituted with a phthaloyl group. In these
embodiments, the corresponding primary amine can be obtained by treatment of the
phthaloyl-substituted compound, e.g., with hydrazine in a solvent, generally heated at reflux
for several hours.
Example 530
3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-amine
2-(3-(3'-(8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylsulfonyl)propyl)isoindoline-1,3-dionc
(0.050 g, 0.083 mmol) was dissolved in ethanol (15 mL) and hydrazine (1.0 mL) was added.
The solution was refluxed for 3 h and the solvent was removed. The residue was purified via
reverse phase HPLC (acetonitrile/water) to obtain the title compound as a gummy solid (25
mg). MS (ES) m/z 470.7.
Example 531
3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-
1-amine
Prepared as in Step 4 of Example 398 except using 2-(3-(3'-(3-methyl-8-(trifluoro-
methyl)quinolin-4-yl)biphenyl-3-ylsulfonyl)propyl)isoindoline-1,3-dione as the reactant to
afford the title compound as a semi-solid. MS (ES) m/z 484.7.
Example 532
ethyl 4-{3'-[(3-aminopropyl)sulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline-3-carboxylate
Prepared as in Step 4 of Example 398 except using ethyl 4-(3'-{[3-(1,3-dioxo-1,3-
dihydro-2H-isoindol-2-yl)propyl]sulfonyl}biphenyl-3-yl)-8-(trifluoromethyl)quinoline-3-
carboxylate as the reactant to afford the title compound as a semi-solid. MS (ES) m/z 542.7.
3-(4,5-dihydro-1H-imidazol-2-yl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
A mixture of 4- {3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-
3-carbonitrile (50 mg, 0.10 mmol), ethylenediamine (10 mL), and P2S5 (5 mg) was heated at
70 °C for 4 h. The mixture was poured into water, extracted with ethyl acetate, and
concentrated. The residue was chromatographed eluting with an E:H gradient to give the title
compound as a yellowish solid (15 mg). MS (ES) m/z 511.8; HRMS: calcd for
C26H20F3N3O3S + H+, 512.12502; found (ESI, [M+H]+ Obs'd), 512.1247.
Example 534
benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)thio]piperidine-1-carboxylate
Step 1: 3-(l-(benzyloxycarbonyl)piperidin-4-ylthio)phenylboronic acid
A mixture of 3-mercaptophenylboronic acid (0.77 g, 5.00 mmol), benzyl 4-
bromopiperidinc-1-carboxylate (1.49 g, 5.00 mmol), and cesium carbonate (5.00 g, 15.2
mmol) in DMF (15 mL) was stirred at room temperature for 2 h. The reaction was poured into
water and extracted with ethyl acetate. The extracts were dried over MgSO4 and concentrated
to give 3-(1-(benzyloxycarbonyl)piperidin-4-ylthio)phenylboronic acid. The crude material
was used for the next reaction without any further purification.
Step 2: benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl|phenoxy}phenyl)thio]piperidine-1-carboxylate
A mixture of 3-(l-(benzyloxycarbonyl)piperidin-4-ylthio)phenylboronic acid (0.190
g, 0.50 mmol), 3-(8-(trifluoromethyl)quinolin-4-yl)phenol (0.15 g, 0.5 mmol), Cu(II) acetate
(0.18 g, 1.0 mmol), triethylamine (0.25 g, 3.5 mmol), and 4Å molecular sieves in
dichloromethane (15 mL) was stirred at room temperature overnight. The solid was filtered
off and the liquid was poured into water and extracted with ethyl acetate. The extracts were
dried over MgSO4 and concentrated. The residue was chromatographed eluting with an E:H
gradient to give the title compound as a white solid (130 mg). MS (ES) m/z 615.0; HRMS:
calcd for C35H29F3N2O3S + H+, 615.19237; found (ESI, [M+H]+ Obs'd), 615.1923.
Example 535
benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]piperidine-1-carboxylate
A mixture of benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)thio]piperidine-1-carboxylate (100 mg, 0.16 mmol) and 50% H2O2 (3.0
mL) in acetic acid (3.0 mL) was heated at 60 °C for 1 h. The mixture was poured into water,
extracted with ethyl acetate, and concentrated. The residue was chromatographed eluting
with a gradient of E:H to give the title compound as solid (45 mg). (ES) m/z 647.0; HRMS:
calcd for C35H29F3N2O5S + H4, 647.18220; found (ESI, [M+H]-), 647.1821.
Example 536
4-{3-[3-(piperidin-4-ylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
A solution of 48% HBr (1.0 mL) in acetic acid (45% volume) was added drop wise to
a mixture of benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]piperidine-1-carboxylate (30 mg, 0.050 mmol) in acetic acid
(1mL). The mixture was stirred at room temperature for 0.5 h. Diethyl ether was added and
the solid was collected to give the title compound as an off-white solid (21 mg). MS (ES) m/z
513.0; HRMS: calcd for C27H23F3N2O3S + H+, 513.14542; found (ESI, [M+H]+ Obs'd),
513.1454.
Example 537
benzyl 4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}thio)piperidine-1-
carboxylate
The title compound was prepared in a manner similar to that described in Example
259.
MS (ES) m/z 598.7; HRMS: calcd for C35H29F3N2O2S + H+, 599.19746; found (ESI,
[M+H]+Obs'd), 599.1967.
Example 538
benzyl 4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)piperidine-
1-carboxylate
The title compound was prepared in a manner similar to that described in Example
535. MS (ES) m/z 631.0; HRMS: calcd for C35H29F3N2O4S + H+, 631.18729; found (ESI,
[M+H]++Obs'd), 631.1862.
Example 539
4-[3'-(piperidin-4-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
The title compound was prepared in a manner similar to that described in Example
536. MS (ES) m/z 496.7; HRMS: calcd for C27H23F3N2O2S + H+, 497.15051; found (ESI,
[M+H]+Obs'd), 497.1502.
Example 540
methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxylate
A solution of 4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinoline-
3-carboxylic acid (5.00 g, 10.3 mmol), methyl iodide (3.0 m.L, 42 mmol), and K2CO3 (5.0 g,
36 mmol) in acetone (50 mL) was heated to reflux. After 2 h, the reaction was cooled,
filtered and concentrated . The product was purified by column chromatography
eluting with a 25:75 E:H gradient to give a yellow foam (3.50 g, 68%). MS (ES) m/z 502.0.
Example 541
[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl] methanol
To a cooled (0 °C) solution of methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline-3-carboxylate (0.10 g, 0.20 mmol) in THF (5.0 mL) was added a
solution of 1.0 M LiAlH4 in THF (0.25 mL). After 1 h, the reaction was poured in 2N aqueous
HC1 and extracted with ethyl acetate. The organic layer was dried (MgSO4), concentrated, and
purified by column chromatography cluting with 50:50 E:H to give a white foam (35 mg,
37%). MS (ES) m/z 474.0.
Example 542
4-[3-(3-{[3-(methylamino)propyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carboxamide
Step 1: methyl 4-(3-(3-(3-(methylsulfonyloxy)propylsulfonyl)phenoxy)phenyl)-8-
(trifluoromethyl)quinoline-3-carboxylate
To a cooled (0 °C) solution of methyl 4-(3-(3-(3-
hydroxyproylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylate
(1.20 g, 2.2 mmol) in CH2Cl2 (20 mL) and NEt3 (1.00 mL, 7.2 mmol) was added
methanesulfonyl chloride (0.30 mL, 4.0 mmol). After 1 h, the reaction was poured in 2N
aqueous HCl and extracted with CH2Cl2. The organic layer was dried (MgSO4) and
concentrated to give the title compound as an oil (1.20 g, 88%), which was used without
further purification. MS (ES) m/z 623.8.
Step 2: methyl 4-(3-(3-(3-(terbutoxycarbonyl(methyl)amino)propylsulfonyl)
phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylate
A solution of methyl 4-(3-(3-(3-
(methylsulfonyloxy)propylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-
carboxylate (0.80 g, 1.30 mmol) and a solution of 2.0 M methylamine in methanol (20 mL)
was stirred at ambient temperature. After 40 h, the reaction was concentrated and taken up
into ethyl actate. The organic layer was washed with saturated aqueous NaHCO3, dried, and
concentrated. The resulting oil was dissolved in CH2Cl2 (10 mL) and di-t-butyl dicarbonate
(1.00 g, 4.6 mmol) was added. The reaction was stirred at ambient temperature for 24 h and
then concentrated. The crude product was purified by column chromatography eluting with
30:70 E:H to afford the title compound as an oil (0.15 g, 18%). MS (ES) m/z 658.9.
Step 3: 4-(3-(3-(3-(tert-butoxycarbonyl(methyl)amino)propylsulfonyl)
phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid
A solution of methyl 4-(3-(3-(tert-butoxycarbonyl(methyl)amino)propylsulfonyl)
phenoxy)phenyl)-8-(trifluoromethyl)quinoline-3-carboxylate (0.15 g, 0.23 mmol) and 2.0 M
aqueous NaOH (1 mL) in THF/MeOH (5 mL) was heated to reflux. After 3 h, the reaction
was poured into water (100 mL) containing 1N aqueous HCl (3 mL) and extracted with ethyl
acetate. The organic layer was dried and concentrated to give the title compound as a foam
(0.12 g, 81%). MS (ES) m/z 645.0.
Step 4: tert-butyl 2-(3-(3-(3-carbamoyl-8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propyl(methyl)carbamate
A solution of 4-(3-(3-(3-(tert-butoxycarbonyl(methyl)amino)propylsulfonyl)phenoxy)
henyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid (0.12 g, 0.19 mmol) and carbonyl
diimidazole (0.15 g, 0.95 mmol) in DMF (5.0 mL) was heated to 60 °C. After 1 h, the reaction
was cooled to room temperature and concentrated ammonium hydroxide (2 mL) solution was
added. After 1 h, the reaction was poured into water and extracted with EtOAc. The EtOAc
was dried and concentrated to give an oil (0.10 g, 82%). MS (ES) m/z 643.9.
Step 5: 4-[3-(3-{[3-(methylamino)propyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carboxamide
A solution of tert-butyl 3-(3-(3-(3-carbamoyl-8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propyl(methyl)carbamate (0.10 g, 0.16 mmol) and trifluoroacetic
acid (0.5 mL) in CH2Cl2 (5 mL) was stirred at room temperature. After 2 h, the reaction was
washed with aqueous saturated NaHCO3, dried, and concentrated to give the title compound
as a foam (0.050 g, 57%). MS (ES) m/z 543.9.
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yllphenoxy}phenyl)sulfonyl]
propyl} methanesulfonamide
A mixture of 3-(3-(3-(8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propan-1-amine (50 mg, 0.103 mmol), methanesulfonyl chloride
(41 mg, 0.124 mmol), and pyridine (12 mg, 0.14 mmol) in CH2Cl2 (5 mL) was stirred 1.5 h
and then concentrated in vacuo to a brown powder. The crude product was purified by
reverse phase-HPLC eluting w ith an acetonitrile.water gradient to afford the title compound
as an off-white powder (42 mg, 72%). MS (ES) m/z 564.8.
Example 544
1-ethyl-3-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]
propyl} urea
A mixture of 3-(3-(3-(8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propan-1-amine (50 mg, 0.103 mmol), ethyl isocyanate (9.0 mg,
0.124 mmol) in CH2Cl2 (5 mL) was stirred 1.5 h and then concentrated in vacuo to a brown
powder. The crude product was purified by reverse phase-HPLC eluting with an
acctonitrilc:watcr gradient to afford the title compound as an off-white powder (52 mg, 91%).
MS (ES) m/z 557.9.
Example 545
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]
propyl} acetamide
A mixture of 3-(3-(3-(8-(rrifluoromcthyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propan-1-amine (50 mg, 0.103 mmol), acetyl chloride (11 mg,
0.124 mmol), pyridine (12 mg, 0.14 mmol) in CH2Cl2 (5 mL) was stirred 1.5 h and then
concentrated in vacuo to a powder. The crude product was purified by reverse phase-HPLC
eluting with an acetonitrile:water gradient to afford the title compound as an off-white powder
(39 mg, 68%). MS (ES) m/z 528.8.
Example 546
2-({3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yllphenoxy}phenyl)sulfonyl)propyl}carbamoyl)benzoic acid
A mixture of 3-(8-(trifluoromethyl)quinolm-4-yl)phenol (200 mg, 0.69 mmol), 1-
fluoro-3-(methylsulfonyl)benzene (212 mg, 1.04 mmol), and potassium carbonate (286 mg,
2.08 mmol) in DMA (5 mL) was sealed in a vial and heated at 210 °C for 1 h. Cooling to
room temperature and filtration afforded as filtrate a brown syrup. The crude intermediate
was purified by reverse phase-HPLC eluting with an acetonitrile:water gradient to afford 2-
(3-(3-(3-(8-(trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propyl)isoindoline-1,3-
dione a as a brown powder (310 mg, 73%). To this brown powder was added anhydrous
hydrazine (1.0 mL) in ethanol (5 mL) and the reaction heated at 60 °C for 3 h. Cooling to
room temperature concentrated in vacuo to a brown powder. The crude product was purified
by reverse phase-HPLC eluting with an acetonitrile:water gradient to afford the title
compound as a yellow syrup (9 mg, 6%). MS (ES) m/z 634.8.
Example 547
4-{3-[3-(methylsutfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboximidamide
Step 1: To a suspension of ammonium chloride (1.07 g, 20 mmol) in toluene (20 mL)
at 0 to 5 "C was slowly added 2 M trimethylaluminum in toluene (10 mL). After the addition
was complete the reaction was allowed to warm to room temperature and was stirred for 1 h.
Step 2: To a solution of 4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-
(trifluoromethyl)quinoline-3-carbonitrile (15 mg) in toluene (2 mL) was added 2 M
trimethylaluminum in toluene (3 mL). The solution was heated to 80 °C for 24 h. The
reaction mixture was cooled and the aluminum complex was decomposed by carefully
pouring the solution into a slurry of silica gel in chloroform. The mixture was stirred for 5
min and the silica gel was filtered. The filter cake was washed with methanol. The solution
was concentrated in vacuo. Purification by chromatography afforded the title compound. MS
(ES) m/z 486.0.
Example 548
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid
4-{3-[3-(Methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile (300 mg, 0.75
mmol) was heated in AcOH (5 mL) and concentrated H2SO4 at 120 °C for 20 h. The reaction
was cooled and poured into ice water (100 mL). Upon stirring vigorously, a precipitate
formed which was filtered, washed with water, and dried in vacuo to afford the title
compound as an off-white solid (256 mg). MS (ESI) m/z 420; HRMS: calcd for C23H17NO5S
+ H' 420.09002; found (ESI, [M+H]- Obs'd), 420.0905.
Example 549
methyl 4-{3-[3-(methylsulfonyl)phenoxy] phenyl} quinoline-8-carboxylate
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid (200 mg, 0.47
mmol), was heated in MeOH (40 mL) and cone. H2SO4 (2 mL) at 80 °C for 12 h. The
reaction was cooled, treated with water (50 mL), and extracted with ethyl acetate (3 x 50 mL).
The extracts were dried with MgSO4 and concentrated in vacuo to afford the title compound
as a white solid (189 mg). MS (ES) m/z 433.9; HRMS: calcd for C24H19NO5S + H-,
434.10567; found (ESI, [M+H]- Obs'd), 434.1059.
Example 550
4-{3-[3-(methylsu]fonyl)phenoxy]pheny]}quinoline-8-carboxamide
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid (70 mg, 0.17
mmol) and carbonyldiimidazole (76 mg, 0.47 mmol) was heated in DMF (10 mL) at 60 oC
for 1 h. The reaction was cooled, and treated with NH4OH (4.0 mL, 64 mmol) and stirred at
room temperature for 10 h. The reaction mixture was treated with water (50 mL) and
extracted with ethyl acetate (3 x 50 mL). The extracts were dried with MgSO4 and
concentrated in vacuo. Chromatography on silica gel cluting with a 10:90 to 100:0 E:H
gradient gave the title compound as an off-white solid (36 mg). MS (ES) m/z 418.8; HRMS:
calcd for C23H18N2O4S + H+, 419.10600: found (ESI, [M+H]- Obs'd), 419.1064.
4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
Step 1: 5-bromo-2-chlorobenzenesulfonyl chloride
5-Bromo-2-chloroaniline (2.6 g, 9.7 mmol) was combined with acetic acid (8 mL)
and cone. HC1 (4 mL) in acctonitrile. NaNO2 (802 mg, 11.6 mmol) in water (3 mL) was
added drop wise over 10 minutes and the reaction was cooled in an ice bath. After 20 min,
sulfur dioxide gas was bubble through the reaction for 1 h. A solution of CuCl2 (1.62 g, 12.1
mmol) in water (3 mL) was added and the reaction was stirred at ambient temperature
overnight. The reaction was poured into ice water (100 mL). Upon stirring vigorously, a
precipitate formed. The precipitate was filtered, washed with water, and dried in vacuo to
afford the title compound as a white solid (3.1 g), used without further purification.
Step 2: 4-bromo-1-chloro-2-(methylsulfonyl)benzene
In a similar manner to that described for Example 1, the title compound was prepared
using 5-bromo-2-chlorobenzenesulfonyl chloride and iodomethane. MS (ES) m/z 268.7.
Step 3: 4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 124 except using 3-[8-(trifluoromethyl)quinolin-4-yl]phenol
and 4-bromo-1-chloro-2-(methylsulfonyl)benzene as the reactants to afford the title
compound as an off-white solid. MS (ES) m/z 478.0; HRMS: calcd for C23H15ClF3NO3S+
H+ 478.0486; found (ESI, [M+H]+ Obs'd), 478.0479.
Example 552
4-{4-[3-(methylsulfonyl)phenyl]pyridin-2-yl}-8-(trifluoromethyl)quinoline
Step 1: 2-chloro-4-[3-(methylsulfonyl)phenyl]pyridine
Nitrogen was bubbled through a vigorously stirred mixture of 2-chloro-4-
iodopyridine (478 mg, 2 mmol), 3-(methylsulfonyl)phenylboronic acid (400 mg, 2.00 mmol),
2 M aqueous Na2CO3 (2.0 mL, 4.0 mmol), and dimethoxyethane (6.0 mL) for 10 min.
Palladium tetrakis-triphenylphosphine (119 mg, 0.100 mmol) was added and the mixture was
vigorously stirred at 80 oC for 6 h. The mixture was cooled and partitioned between ethyl
acetate (40 mL) and water (30 mL). The layers were separated and the organic layer was
washed with water (2x10 mL) and brine (20 mL). The organic layer was dried with Na2SO4
and concentrated in vacuo. The residue was purified by SiO2 chromatography eluting with a
gradient of 5:95 to 50:50 E:H to yleld the title compound as an off-white solid. MS (ES) m/z
267.8; HRMS: calcd for C12H10ClNO2S + H+, 268.01935; found (ESI, [M+H]- Obs'd),
268.0196.
Step 2: 4-{4-[3-(methylsulfonyl)phenyl]pyridin-2-yl}-8-(trifluoromethyl)quinoline
A mixture of 4-chloro-8-(trifluoromethyl)quinoline (462 mg, 2 mmol),
bis(pinacolato)diboron (560 mg, 2.2 mmol), Pd2(dba)3 (50 mg, 0.055 mmol), 2-
(dicyclohexylphosphino)biphenyl (100 mg, 0.29 mmol), and KOAc (300 mg 3 mmol) was
heated in dioxane (12 mL) at 90 °C for 16 h. The mixture was cooled and partitioned
between ethyl acetate (40 mL) and water (20 mL). The layers were separated and the organic
layer was washed with saturated aqueous NaHCO3 (2x10 mL), water (20 mL) and brine (20
mL). The organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was
purified by Si02 chromatography eluting with a gradient of 0:100 to 15:85 E:H, ylelding 4-
(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-8-(trifluoromethyl)quinoline which was
contaminated with 8-trifluoromethylquinoline (~ 1:1 ratio). The crude material (310 mg) was
put in a vial with 2-chloro-4-[3-(methylsulfonyl)phenyl]pyridine (140 mg, 0.52 mmol),
aqueous Na2CO3 (2.0 M, 2.0 mL, 4.0 mmol), and dimethoxyethane (5 mL). Nitrogen was
bubbled through the mixture for 10 min and palladium tetrakis-triphenylphosphine (120 mg,
0.100 mmol) was added. The mixture was heated at 85 °C for 4 h, then the mixture was
cooled and partitioned between ethyl acetate (40 mL) and water (20 mL). The layers were
separated and the organic layer was washed with water (2 x 20 mL) and brine (20 mL). The
organic layer was dried with Na2SO4 and concentrated in vacuo. The residue was purified by
SiO2 chromatography eluting with a gradient of 2:98 to 50:50 E:H. The residual material was
further purified by C18 reverse-phase chromatography using a gradient of 5:95 to 100:0
acetonitrile:H20 to afford the title compound as a white foam. MS (ES) m/z 428.7; HRMS:
calcd for C22H15F3N2O2S + H+ 429.08791; found (ESI, [M+H]-), 429.0882
Example 553
3-methyl-4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-
(trifluoromethyl)quinoline
Step 1:3-methyl-4-(thiophen-2-yl)-8-(trifluoromethyl)quinoline
The compound was prepared in a similar manner to that described for Example 279.
MS (ES) m/z 293.3.
Step 2: 4-(4-bromothiophen-2-yl)-3-methyl-8-(trifluoromethyl)quinoline
To a mixture of 3-methyl-4-(thiophen-2-yl)-8-(trifluoromethyl)quinoline (250 mg,
0.896 mmol) and sodium acetate (294 mg, 2.69 mmol) in water (10 mL) was added drop wise
bromine (429 mg, 2.69 mmol) in water (5 mL) over 30 min. Zinc (175 mg, 2.69 mmol) was
added and the resulting brown mixture was heated at 50oC for 15 h. The cooled brown
mixture was extracted with ethyl acetate (20 mL), filtered, dried with MgSO4, and
concentration in vacuo to a crude brown powder as 4-(4-bromothiophen-2-yl)-3-methyl-8-
(trifluoromethyl)quinoline (360 mg). MS (ES) m/z 372.0. This product was used in the next
step without purification.
Step 3: 3-methyl-4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-
(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
279. MS (ES) m/z 447.9.
Example 554
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8-
(trifluoromethyl)quinoline
Step 1: 4-bromo-2-(3-(methylsulfonyl)phenyl)thiophene
The intermediate was prepared in a similar manner to that described for Example 279.
MS (ES) m/z 317.2.
Step 2: 3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8-
(trifluoromethyl)quinoline
In a reaction vial at room temperature was placed 4-bromo-2-(3-
(methylsulfonyl)phenyl)thiophene (88 mg, 0.276 mmol), 4-bromo-6-methyl-8-
(trifluoromethyl)quinoline acid (80 mg, 0.276 mmol), 4,4,4',4',5,5,5',5'-octamethyl-2,2'-
bi(l,3,2-dioxaborolanc) (77 mg, 0.304 mmol), potassium carbonate (81 mg, 0.828 mmol),
dichlorobis(triphenylphosphine)palIidum (II) (49 mg, 0.276 mmol) in DMSO (2.0 mL). The
vial was capped and heated at 90 °C for 3 h. After cooling and filtration, the filtrate was
subjected to purification by RP-HPLC (acetonitrile:H2O) to afford the title compound as a
yellow powder (17 mg, 28%). MS (ES) m/z 447.9.
Example 555
N-(4-methoxybenzyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
Prepared as in Example 460, step 3, except using 3-[3-(methylsulfonyl)-8-
(trifluoromethyl)quinolin-4-yl]phenol and 3-bromo-N-(4-methoxybenzyl)-N-
methylbenzenesulfonamide as the reactants to afford the title compound as a white solid. MS
(ES) m/z 593.0.
Example 556
N-(4-methoxybenzyl)-N-methyl-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
Prepared as in Example 462, step 3, except using 3-[3-(methylsulfonyl)-8-
(trifluoromethyl)quinolin-4-yl]phenol and 4-bromo-N-(4-methoxybenzyl)-N-
methylbenzenesulfonamide as the reactants to afford the title compound as a white solid.. MS
(ES) m/z 593.0.
Example 557
N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
Prepared as in Example 464, except using N-(4-methoxybenzyl)-N-methyl-3- [3-[3-
methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as the reactant to
afford the title compound as a white solid. MS (ES) m/z 472.8.
Example 558
N-methyl-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide
Prepared as in Example 464, except using N-(4-methoxybenzyl)-N-methyl-4-{3-[3-
methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide as the reactant to
afford the title compound as a white solid. MS (ES) m/z 472.8.
Example 559
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and 3-(ethylsulfonyl)-1-fluorobenzene as substrates to afford the title compound.
MS (ES) m/z 499.8.
Example 560
3-isopropyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and 3-fluoro-1-(propylsulfonyl)-benzene as substrates to afford the title
compound. MS (ES) m/z 513.9.
Example 561
3-isopropyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and 3-fluoro-1-(isopropylsulfonyl)-benzene as substrates to afford the title
compound. MS (ES) m/z 513.8.
Example 562
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phcnol and 3,5-difluoro-1-(methylsulfonyl)bcnzene as substrates to afford the title
compound. MS (ES) m/z 503.8.
Example 563
4-{3-l3-(ethylsulfonyl)-5-fluorophenoxyJphenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and 3,5-difluoro-1-(ethylsulfonyl)benzene as substrates to afford the title
compound. MS (ES) m/z 517.8.
Example 564
4-{3-[3-chloro-5-(methylsulfonyl)phenoxylphenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifIuoromethyl)quinolin-
4-yl]phenol and 3,5-dichloro-1-(methylsulfonyl)benzene as substrates to afford the title
compound. MS (ES) m/z 519.8.
Example 565
3-isopropyl-4-{3-[2-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and 2-fluoro-1-(methylsulfonyl)-benzene as substrates to afford the title
compound. MS (ES) m/z 485.8.
Example 566
3-isopropyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phcnol and 4-fluoro-1-(methylsulfonyl)-benzenc as substrates to afford the title
compound. MS (ES) m,z 485.8.
Example 567
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline
Prepared as in Example 43, except using 3-[3-isopropyl-8-(trifluoromethyl)quinolin-
4-yl]phenol and l-(ethylsulfonyl)-4-fluorobenzene as substrates to afford the title compound.
MS (ES) m/z 499.8.
Example 568
8-Methoxy-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methoxyquinolin-4-yl)phenol and 3-fluoro-1-(rnethylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 405.9; HRMS: calcd for C23H19NO4S +
H-, 406.11076; found (ESI, [M+H]- Obs'd), 406.1110.
Example 569
4-{3-[3-(Ethylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methoxyquinolin-4-yl)phenol and 1-(ethylsulfonyl)-3-fluorobenzene as
substrates to afford the title compound. MS (ES) m/z 420.0; HRMS: calcd for C24H21NO4S+
H+, 420.12641; found (ESI, [M+H]+ Obs'd), 420.1268
Example 570
4-{3-[3-(Isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 oC for 1
h and using 3-(8-methoxyquinolin-4-yl)phenol and 3-fluoro-1-(isopropylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 434.1; HRMS: calcd for C25H23NO4S +
H, 434.14206; found (ESI, [M+H]- Obs'd), 434.1426.
Example 571
4-{3-[3-Fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-mcthoxyquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methoxyquinolin-4-yl)phenol and 3,5-difluoro-1-(methylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 423.9; HRMS: calcd for C23H18FNO4S +
H+ 424.10133; found (ESI, [M+H] Obs'd), 424.1015.
Example 572
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methoxyquinolin-4-yl)phenol and 3,5-difluoro-1-(ethylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 438.0; HRMS: calcd for C24H20FNO4S +
H-, 438.11698; found (ESI, [M+H]+ Obs'd), 438.1176.
Example 573
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-methylquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 oC for 1
h and using 3-(8-methylquinolin-4-yl)phenol and 1-(ethylsulfonyl)-3-fluorobenzene as
substrates to afford the title compound. MS (ES) m/z 404.0; HRMS: calcd for C24H21NO3S +
FT, 404.13149; found (ESI, [M+H] Obs'd), 404.1319.
Example 574
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methylquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methylquinolin-4-yl)phenol and 3-fluoro-1-(isopropylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 418.1; HRMS: calcd for C25H23NO3S +
H-, 418.14714; found (ESI, [M+H]+ Obs'd), 418.1473.
Example 575
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methylquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methylquinolin-4-yl)phenol and 3,5-difluoro-1-(methylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 407.9; HRMS: calcd for C23H18FNO3S +
H+, 408.10642; found (ESI, [M+H]- Obs'd), 408.1066.
Example 576
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methylquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methylquinolin-4-yl)phcnol and 3,5-difluoro-1-(ethylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 422.1; HRMS: calcd for C24H2OFNO3S +
H-, 422.12207; found (ESI, [M+H] Obs'd), 422.1225.
Example 577
3-({3-[3-(8-methylquinolin-4-yl)phenoxy] phenyl}sulfonyl)propan-1-ol
Prepared as in Example 43, except heating in a microwave reactor at 205-210 oC for 1
h and using 3-(8-methylquinolin-4-yl)phenol and 3-[(3-fluorophenyl)sulfonyl]propan- 1-ol as
substrates to afford the title compound. MS (ES) m/z 433.8; HRMS: calcd for C25H23NO4S +
H1, 434.14206; found (ESI, [M+H]+ Obs'd), 434.1420.
Example 578
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methylquinoline
Prepared as in Example 43, except heating in a microwave reactor at 205-210 °C for 1
h and using 3-(8-methylquinolin-4-yl)phenol and 3,5-dichloro-1-(methylsulfonyl)benzene as
substrates to afford the title compound. MS (ES) m/z 423.7; HRMS: calcd for C23H18ClNO3S
+ H+, 424.07687; found (ESI, [M+H]- Obs'd), 424.0766.
Example 579
4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI,
[M+H]+ Obs'd), 434.0486.
Example 580
4-{4-[2-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI,
[M+H]+Obs'd), 434.0491.
Example 581
4-{4-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 433.8; HELMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI,
[M+H]+ Obs'd), 434.0484.
Example 582
4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8-(trifluoromethyl)quinoline
The title compound was prepared in a similar manner to that described for Example
259. MS (ES) m/z 433.8; HRMS: calcd for C21H14F3NO2S2 + H+, 434.04908; found (ESI,
[M+H]+ Obs'd), 434.0484.
Examples 583 to 593
The following compounds in Examples 583-593 were prepared in a manner similar to
that described in Example 276.
Example 583
({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl}amino)acetonitrile
MS (ES) m/z 511.9.
Example 584
2-methoxy-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifIuoromethyl)quinolin-3-yl]methyl}ethanamine
MS (ES) m/z 531.0.
Example 585
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl}propan-2-amine
MS (ES) m/z 515.0.
Example 586
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifiuoromethyl)quinolin-3-
yl] methyl} prop-2-en-1-amine
MS (ES) m/z 513.0.
Example 587
1-cyclopropyl-N-{[4-{3-[3-(methylsu]fonyl)phenoxy]phenyl}-8-
(trifluoromcthyl)quinolin-3-yl]methyl}methanamine
MS (ES) m/z 527.0.
Example 588
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl] methyl} ethanamine
MS (ES) m/z 500.9.
Example 589
N-methyl-1-[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinolin-3-yl]methanamine
MS (ES) m/z 486.9.
Example 590
3-({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl] methyl} amino)propanenitrile
MS (ES) m/z 525.9.
Example 591
2-fluoro-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinolin-3-yl]methyl}ethanamine
MS (ES) m/z 519.0.
Example 592
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl] methyl} propan-1-amine
MS (ES) m/z 515.0.
Example 593
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl] methyl} cyclopentanamine
MS (ES) m/z 541.0.
Example 594
2-amino-4-(3-methoxyphenyl)-8-(trifluoromethyl)quinoline-3-carboxamide
Prepared as in Example 488, except using (2-amino-3-(trifluoromethyl)phenyl)(3-
methoxyphenyl)methanone and 2-cyanoacetamide as the reactants to afford the title
compound as a white solid. MS (ES) m/z 362.0; HRMS: calcd for C18H14F3N3O2 + H+,
362.11109; found (ESI, [M+H]+ Calc'd), 362.1111.
Example 595
2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carbonitrile
Step 1: 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile
Prepared as in Example 488, except using (2-amino-3-(trifluoromethyl)phenyl)(3-
bromophenyl)mcthanone and malononitrile as the reactants to afford the title compound as a
white solid. MS (ES) m/z 391.8.
Step 2: 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline-3-carbonitrile
Prepared as in Example 279, except using 2-amino-4-(3-bromophenyl)-8-
(trifluoromethyl)quinoline-3-carbonitrile and 3-(methylsulfonyl)phenylboronic acid as the
reactants to afford the title compound as a white solid. MS (ES) m/z 467.9.
Example 596
2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxylic acid
Step 1: 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carboxylic
acid
A solution of 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carbonitrile
(1.0 g, 2.5 mmol) and AcOH:H2SO4 (cone) (1:1) was heated to reflux. After 48 h, the reaction
was poured into water (100 mL) and extracted with ethyl acetate. The organic layer was dried
and concentrated to give the title compound as a white solid (0.89 g, 85%). MS (ES) m/z
410.8.
Step 2: 2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline-3-carboxylic acid
Prepared as in Example 279 except using 2-amino-4-(3-bromophenyl)-8-(trifluoro-
methyl)quinoline-3-carboxylic acid and 3-(methylsulfonyl)phenylboronic acid as the reactants
to afford the title compound as a white solid. MS (ES) m/z 486.9.
Example 597
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinolin-2-amine
Step 1:4-(3-bromophenyl)-8-(trifluoromethyl)quinolin-2-amine
A solution of 2-amino-4-(3-bromophenyl)-8-(trifluoromethyl)quinoline-3-carboxylic acid (0.1
g, 0.24 mmol) in a minimal amount of Dowtherm (5 mL) was heated to 250 °C. After 1 h, N2
(g) was passed over the reaction and the Dowtherm removed and the residue
chromatographed eluting with a gradient of 15:85 to 40:60 E:H to afford the title compound
as a white solid (80 mg). MS (ES) m/z 366.8.
Step 2: 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinolin-2-amine
Prepared as in Example 279, except using 4-(3-bromophenyl)-8-(trifluoromethyl)-quinolin-2-
amine and 3-(methylsulfonyl)phenylboronic acid as the reactants to afford the title compound
as a white solid. MS (ES) m/z 443.0.
Example 598
The compounds below are prepared similar to the reaction conditions described in Example
43, using the appropriate starting materials.
A. 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
B. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
C. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
D. 4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
E. 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline
F. 4-{2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
G. 4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-methoxyquinoline
H. 4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
I. 4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-methoxyquinoline
J. 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
K. 4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-methoxyquinoline
L. 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline
M. 4-{2-chloro-5-[3-(methylsulfonyl)phenoxylphenyl}-8-(methylsufonyl)quinoline
N. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline
O. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline
P. 4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(methylsufonyl)quinoline
Q. 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-
(methylsufonyl)quinoline
R. 4-{2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(methylsufonyl)quinoline
S. 4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-
(methylsufonyl)quinoline
T. 4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(methylsufonyl)quinoline
U. 4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-
(methylsufonyl)quinoline
V. 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline
W. 4-{5-l3-(ethylsultbnyl)phenoxyj-2-fluorophenyl}-8-(methylsufonyl)quinoline
X. 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline
Y. 2-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
Z. 4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-(tritluoromethyl)quinoline
AA. 4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
BB. 4-{3-[3-fluoro-5-(methylsultbnyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
CC. 4- {3- [3-(ethylsulfonyl)-5-fluorophenoxy] phenyl} -2-methyl-8-
(trifluoromethyl)quinoline
DD. 2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
EE. 4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
FF. 4-{5-[3-(ethylsulfonyl)phenoxy]2-fluoro-phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
GG. 4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
HH. 4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
II. 4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluoro-phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
JJ. 4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
KK. 4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
LL. 4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxylphenyl}-2-mothyl-8-
(trifluoromethyl)quinoline
MM. 4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
NN. 4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline
OO. 4-{2-methyl-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline
PP. 4-{5-[4-(ethylsulfonyl)phenoxy]2-methylphenyl}-8-(trifluoromethyl)quinoline
QQ. 4-{5-l4-(isopropylsulfonyl)phenoxy]2-methylphenyl}-8-
(trifluoromethyl)q uinoline
RR. [(4-{4-methyl-3-I8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]acetonitrile
SS. 8-chIoro-4-{2-chIoro-5-[3-(methylsulfonyl)phenoxylphenyl}-2-methylquinoline
TT. 8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline
UU. 8-chloro-4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy)phenyl}-2-methylquinoline
W. 8-chloro-4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-
methylquinoline
WW. 8-ch]oro-4-{2-chloro-5-[3-(ethylsu]fonyl)-5-fluorophenoxy]phenyl}-2-
methylquinoline
XX. 8-chIoro-4-{2-fluoro-5-[3-(methylsulfonyl)phenoxylphenyl}-2-methylquinoline
YY. 8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline
ZZ. 8-chloro-4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxylphenyl}-2-methylquinoline
AAA. 8-chloro-4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-
methylquinoline
BBB. 8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-
methylquinoline
CCC. 8-chloro-4-{5-[3-(methylsulfonyl)phenoxylphenyl}-2-methylquinoline
DDD. 8-chloro-4-{5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline
EEE. 8-chloro-4-{5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline
FFF. 8-chloro-4-{5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline
GGG. 8-chloro-4-{5-[3-(ethylsulfony])-5-fluorophenoxy]phenyl}-2-methylquinoline
Example 599
The compounds below are prepared similar to the reaction conditions described in Example
212, using the appropriate starting materials.
A. 2-methyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(trifluoromethyl)quinoline
B. 4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8-
(trifluoromethyl)quinoline
C. 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8-
(trifluoromethyl)quinoline
D. 4-(2-fluoro-5-{[3-(methy]sulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline
E. 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline
F. 4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(methanesulfonyl)quinoline
G. 4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(methancsulfonyl)quinoline
H. 8-chloro-4-(2-fluoro-S-{[3-(methylsulfonyl)benzyloxy}phenyl)-2-
methylquinoline
I. 8-chloro-4-(2-chloro-5-{ [3-(methylsulfonyl)benzyl]oxy} phenyl)-2-
methylquinoline
Example 600
The compounds below arc prepared similar to the reaction conditions described in Example
259, using the appropriate starting materials.
A. 2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline
B. 4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-2-methyl-8-
(trifluoromethyl)quinoline
C. 4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-2-methyl-8-
(trifluoromethyl)quinoline
D. 4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline
E. 4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline
F. 4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline
G. 4-[4-fluoro-3,-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline
H. 8-methoxy-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline
I. 8-(methanesulfonyl)-4-[3'-(methylsulfonyl)biphenyl-3-yllquinoline
Example 601
The intermediates below are prepared similar to the reaction conditions described in Example
258, using the appropriate starting materials.
A. 4-chloro-3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl
trifluoromethancsulfonate
B. 4-fluoro-3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl
trifluoromethancsulfonate
C. 3-(8-methoxyquinolin-4-yl)phenyl trifluoromethancsulfonate
D. 4-chloro-3-(8-methoxyquinolin-4-yl)phenyl trifluoromethanesulfonate
E. 4-fluoro-3-(8-methoxyquinolin-4-yl)phenyl trifluoromethanesulfonate
F. 4-chIoro-3-(8-(methanesulfonyl)quinolin-4-yl)phenyl trifluoromethanesulfonate
G. 4-fluoro-3-(8-(methanesulfonyl)quinolin-4-yl)phenyl trifluoromethanesulfonate
H. 3-(8-chIoro-2-methylquinolin-4-yl)phenyl trifluoromethanesulfonate
I. 4-chloro-3-(8-chloroquinolin-4-yl)phenyl trifluoromethanesulfonate
J. 8-chloro-(4-fluoro-3-quinolin-4-yl)phenyl trifluoromethanesulfonate
K. 8-chloro-(4-chloro-3-quinolin-4-yl)phenyl trifluoromethanesulfonate
Example 602
The intermediates below are prepared similar to the reaction conditions described in Example
400, step 2, using the appropriate starting materials.
A. 3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol
B. 4-chIoro-3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol
C. 4-fluoro-3-[2-methyl-8-(trifluoromethyl)quinolin-4-yl]phenol
D. 4-chloro-3-[8-methoxyquinolin-4-yl]phenol
E. 4-fluoro-3-[8-methoxyquinolin-4-yl]phenol
F. 4-methyl-3-[8-(trifluoromethyl)quinolin-4-yl]phenol
G. 4-chloro-3-[8-(methanesulfonyl)quinolin-4-yl]phenol
H. 4-fluoro-3-[8-(methanesulfonyl)quinolin-4-yl]phenol
I. 3-(8-chloro-2-methylquinolin-4-yl)phenol
J. 3-(8-chloro-2-methylquinolin-4-yl)4-fluorophenol
K. 4-chloro-3-(8-chloro-2-methylquinolin-4-yl)phenol
Example 603
The intermediates below are prepared similar to the reaction conditions described in Example
400, step 1, using the appropriate starting materials.
A. 4-(2-fluoro-5-methoxyphenyl)-2-methyl-8-(trifluoromethyl)quinoline
B. 4-(2-chloro-5-mcthoxypheny])-2-methyl-8-(trifluoromethyl)quinoline
C. 4-(3-methoxyphenyl)-2-methyl-8-(trifluoromethyl)quinoline
D. 4-(3-methoxy-6-methylphenyl)-8-(trifluoromethyl)quinoline
E. 4-(2-fluoro-5-methoxyphenyl)-8-methoxyquinoline
F. 4-(2-chloro-5-methoxyphenyl)-8-methoxyquinoline
G. 4-(2-fluoro-5-methoxyphenyl)-8-(methanesulfonyl)quinoline
H. 4-(2-chloro-5-methoxyphenyl)-8-(methanesulfonyl)quinoline
I. 8-chloro-4-(2-chloro-5-methoxyphenyl)-2-methylquinoline
J. 8-chloro-4-(2-fluoro-5-methoxyphenyl)-2-methylquinoline
Example 604
Biological testing
Representative compounds of this invention were evaluated in conventional
pharmacological test procedures which measured their affinity to bind to LXR and to
upregulate the gene ABCA1, which causes cholesterol efflux from atherogenic cells, such as
macrophages.
LXR activation can be critical for maintaining cholesterol homeostasis, but its
coincident regulation of fatty acid metabolism may lead to increased serum and hepatic
triglyceride levels. Selective LXR modulators that activate cholesterol efflux with minimal
impact on SREBP-lc expression and triglyceride synthesis in liver would be expected to
reduce atherosclerotic risk with an improved therapeutic index and minimize the potential for
deleterious effects on metabolic balance.
Accordingly, LXR ligands were identified initially in cell-free LXR beta and LXR
alpha competition binding assays. LXR ligands were further characterized by gene
expression profiling for tissue selective gene regulation. Selective LXR modulators
demonstrate agonist activity for ABCA1 transactivation.
The test procedures performed, and results obtained are briefly described in the
following sections:
I. Ligand-Binding Test Procedure for Human LXRβ
II. Ligand-Binding Test Procedure for Human LXRα
III. Quantitaive Analysis of ABCA1 Gene Regulation in THP-1 Cells
IV. Results
I. Ligand-Binding Test Procedure for Human LXRβ
Ligand-binding to the human LXRβ was demonstrated for representative compounds of
formula (I) by the following procedure.
Materials and Methods:
Buffer: 100mM KCl, 100mM TRIS (pH 7.4 at +4°C), 8.6%glycerol, 0.1mM PMSF*, 2mM
MTG* ,0.2% CHAPS (* not used in wash buffer)
Tracer: 3HT0901317
Receptor source: E.coli extract from cells expressing biotinylated hLXRβ. Extract was made
in a similar buffer as above, but with 50mM TRIS.
Day 1
Washed streptavidin and coated flash plates with wash buffer.
Diluted receptor extract to give Bmax ~ 4000 cpm and add to the wells.
Wrapped the plates in aluminum foil and stored them at +4°C over night.
Day 2
Made a dilution series in DMSO of the test ligands.
Made a 5nM solution of the radioactive tracer in buffer.
Mixed 250µl diluted tracer with 5µl of the test ligand from each concentration of the dilution
series.
Washed the receptor-coated flash plates.
Added 200µl per well of the ligand/radiolabel mixture to the receptor-coated flash plates.
Wrapped the plates in aluminum foil and incubate at +4°C over night.
Day 3
Aspirated wells, and wash the flashed plates. Sealed the plate.
Measured the remaining radioactivity in the plate.
II. Ligand-Binding Test Procedure for Human LXRa.
Ligand-binding to the human LXRa was demonstrated for representative compounds
of formula (I) by the following procedure.
Materials and Methods:
Buffer: 100mM KCl, 100mM TRIS (pH 7.4 at +4°C), 8.6%glycerol, 0.1mM PMSF*,
2mM MTG* ,0.2% CHAPS (* not used in wash buffer)
Tracer: 3H T0901317
Receptor source: E.coli extract from cells expressing biotinylated hLXRα. Extract
was made in a similar buffer as above, but with 50mM TRIS.
Day 1
Washed streptavidin and coated flash plates with wash buffer.
Diluted receptor extract to give Bmax ~ 4000 cpm and add to the wells.
Wrapped the plates in aluminum foil and stored them at +4°C over night.
Day 2
Made a dilution series in DMSO of the test ligands.
Made a 5nM solution of the radioactive tracer in buffer.
Mixed 250µl diluted tracer with 5µl of the test ligand from each concentration of the
dilution series.
Washed the receptor-coated flash plates.
Added 200µl per well of the ligand/radiolabel mixture to the receptor-coated flash
plates.
Wrapped the plates in aluminum foil and incubate at +4°C over night.
Day 3
Aspirated wells, and wash the flashed plates. Sealed the plate. Measured the
remaining radioactivity in the plate.
III. Quantitative Analysis of ABCA1 Gene Regulation in THP-1 Cells.
The compounds of formula (I) effect on the regulation of the ABCA1 gene was
evaluated using the following procedure.
Materials and Methods
Cell culture: The THP-1 monocytic cell line (ATCC # TIB-202) was obtained from
American Type Culture Collection (Manassas, VA) and cultured in RPMI 1640 medium
(Gibco, Carlsbad, Ca) containing 10% FBS, 2 mM L-glutamine, and 55 uM beta-
Mercaptoethanol (BME). Cells were plated in 96-well format at a density of 7.5 X 104 in
complete medium containing 50-100 ng/ml phorbal 12, 13-dibutyrate (Sigma, St.Louis, Mo)
for three days to induce differentiation into adherent macrophages. Differentiated THP-1
cells were treated with test compounds or ligands dissolved in DMSO (Sigma, D-8779) in
culture medium lacking phorbal ester. Final concentrations of DMSO did not exceed 0.3% of
the media volume. Dose response effects were measured in duplicate, in the range of 0.001 to
30 micromolar concentrations and treated cells were incubated for an additional 18 hrs prior
to RNA isolation. Unstimulated cells treated with vehicle were included as negative controls
on each plate. An LXR agonist reference, N-(2,2,2-trifluoro-ethyl)-N-[4-(2,2,2-trifluoro-1-
hydroxy-1-trifluoromethyl-ethyl)-phenyl]-benzenesulfonamide (Schultz, Joshua R., Genes &
Development (2000), 14(22), 2831-2838), was dosed at 1.0 uM and served as a positive
control. In antagonist mode, the compound under study is analyzed in the presence of
150nM GW3965, trifluoromethyl-benzyl)-(2,2-diphenyl-ethyl)-amino]-propoxy]-phenyl)-
acctic acid (Collins, J.L., J. Med. Chem. (2000), 45:1963-1966.). Results of antagonist
analysis are expressed as % antagonism and IC50 (in µM).
RNA isolation and quantitation: Total cellular RNA was isolated from treated cells cultured
in 96-well plates using PrepStation 6100 (Applied Biosystems, Foster City, Ca), according to
the manufacturer's recommendations. RNA was resuspended in ribonuclcasc-frcc water and
stored at -70°C prior to analysis. RNA concentrations were quantitatcd with RiboGreen test
procedure, #R-11490 (Molecular Probes, Eugene, OR).
Gene expression analysis: Gene-specific mRNA quantitation was performed by real-time
PCR with the Perkin Elmer Corp. chemistry on an ABI Prism 7700 Sequence detection
system (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions.
Samples (50-100 ng) of total RNA were assayed in duplicate or triplicate in 50 ul reactions
using one-step RT-PCR and the standard curve method to estimate specific mRNA
concentrations. Sequences of gene-specific primer and probe sets were designed with Primer
Express Software (Applied Biosystems, Foster City, CA). The human ABCA1 primer and
probe sequences are: forward, CAACATGAATGCCATTTTCCAA, reverse,
ATAATCCCCTGAACCCAAGGA, and probe, 6FAM-
TAAAGCCATGCCCTCTGCAGGAACA-TAMRA. RT and PCR reactions were performed
according to PE Applied Biosystem's protocol for Taqman Gold RT-PCR or Qiagen's protocl
for Quantitect probe RT-PCR. Relative levels of ABCA 1 mRNA are normalized using
GAPDH mRNA or 18S rRNA probe/primer sets purchased commercially (Applied
Biosystems, Foster City, CA).
Statistics:
Mean, standard deviation and statistical significance of duplicate evaluations of RNA samples
were assessed using ANOVA, one-way analysis of variance using SAS analysis.
Reagents:
- GAPDH Probe and Primers - Taqman GAPDH Control Reagents 402869 or 4310884E
18S Ribosomal RNA - Taqman 18S Control Reagents 4308329
10 Pack Taqman PCR Core Reagent Kit 402930
Qiagen Quantitect probe RT-PCR 204443.
IV. Results
Based on the results obtained in the standard pharmacological test procedures, the
compounds of this invention can be useful in treating or inhibiting LXR mediated diseases.
In particular, the compounds of this invention can be useful in the treatment and inhibition of
atherosclerosis and atherosclerotic lesions, lowering LDL cholesterol levels, increasing HDL
cholesterol levels, increasing reverse cholesterol transport, inhibiting cholesterol absorption,
treatment or inhibition of Alzheimer's disease, type I diabetes, type II diabetes, multiple
sclerosis, rheumatoid arthritis, acute coronary syndrome, restenosis, inflammatory bowel
disease (IBD), Crohn's disease, endometriosis, celiac, and thyroiditis.
A number of embodiments of the invention have been described. Nevertheless, it will
be understood that various modifications may be made without departing from the spirit and
scope of the invention. Accordingly, other embodiments are in the claims.
WHAT IS CLAIMED IS:
1. A compound having formula (I):
wherein:
R1 is hydrogen, C1-C6 alkyl, NH2, NH(C1-C6 alkyl), or N(C1-C6 alkyl)2;
R2is:
(i) hydrogen, cyano, or halo; or
(ii) C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally substituted with from
1-5 Ra; or
(iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally
substituted with from 1-10 Rb; or
(iv) C2-C12 alkenyl or C2-C12 alkynyl, each of which is optionally substituted with
from 1-10 Rc;
(v) C3-C10 cycloalkyl, hcterocyclyl including 3-10 atoms, or heterocycloalkenyl
including 3-10 atoms, each of which is optionally substituted with from 1-5 Rb; or
(vi) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd; or
(vii) -XR8, wherein:
X is -C(O)-; -O-; -S(O)t-, wherein t is 0-2; -NR9-; -C(O)NR9-; -C(NH)NR9-; -C(O)O-;
-CH2O-; -NR9SO2-; or -SO2NR9-, wherein R9 is hydrogen or C1-C6 alkyl; and
R8is:
(i) hydrogen; or
(ii) C1-C12 alkyl or C1-C12 haloalkyl, each of which is optionally substituted with from
1-5 Ra; or
(iii) C7-C20 aralkyl or heteroaralkyl including 6-20 atoms, each of which is optionally
substituted with from 1-10 Rh; or
(iv) C2-C12 alkenyl or C1-C12 alkynyl, each of which is optionally substituted with
from 1-10 Rc;
(v) C3-C10 cycloalkyl or heterocyclyl including 3-10 atoms, each of which is
optionally substituted with from 1-5 Rb; or
(vi) C6-C18 aryl or hetcroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd;
R3 is C6-C14 aryl or heteroaryl including 5-14 atoms, each of which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; wherein:
R10 is WA, wherein:
W at each occurrence is, independently, a bond:; -O-; -S(O)t-, wherein t is 0-2;
-NR9-; -C(O)NR9-; C1-6 alkylene; or C2-6 alkynylene; -W1(C1-C6 alkylene)-; or -(C1-C6
alkylene)W1-;
W1 at each occurrence is, independently, -O-; -S(O)t-, wherein t is 0-2;
-NR9-; -C(O)NR9-; or C2-6, alkynylene; and
A at each occurrence is, independently:
(i) C6-C10 aryl, which is:
(a) substituted with from 1-2 Rf; and
(b) optionally substituted with from 1-4 Rc;
or
(ii) heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1-2 Rf or includes a substituted ring atom selected
from the group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1-4 Rc;
provided that the heteroaryl including 5-10 atoms is not [1,2,4]-oxadiazolyl;
or
(iii) arylazaeyelyl including 8-12 atoms, each of which is:
(a) substituted with from 1-2 Rf, and
(b) optionally substituted with from 1-4 Rc;
or
(iv) arylsulfinyleyclyl, heteroarylsulfinylcyclyl, arytsulfonylcyclyl or
heteroarylsulfonylcyclyl, each of which includes 8-10 atoms and is optionally substituted with
from 1-4 Re;
or
(v) [l,2,4]-oxadiazolyl, optionally substituted with 1 Re;
each of R4, R5, R6, and R7 is, independently:
(i) hydrogen; or
(ii) Rc; or
(iii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with
from 1-10 Ra; or
(iv) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(v) C7-C20 aralkyl or heteroaralkyl, each of which is optionally substituted with from
1-10 Rb;
Ra at each occurrence is, independently:
(i) NRgRh; nitro; azido; hydroxy; oxo; thioxo; =NRf; C1-C20 alkoxy or C1-C20,
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoXy, C3-C20
cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including
3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20
thioalkoxy; C1-C20 thiohaloalkoxy; C6-C18 thioaryloxy or thiohcteroaryloxy including 5-16
atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy,
thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkcnyloxy
including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -
NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORs)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, hcterocyclyl including 3-20 atoms,
heterocycloalkenyl including 3-20 atoms, arylheterocyclyl including 8-20 atoms, or
heteroarylheterocyclyl including 8-20 atoms, each of which is optionally substituted with
from 1-10 Rb;
Ra at each occurrence is, independently, NR8Rh; nitro; azido; hydroxy; oxo; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRaRb; -
NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; -P(O)(ORs)(ORh); C3-C20 cycloalkyl, C3-C20 cycloalkenyl,
heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms;
Rb at each occurrence is, independently:
(i) halo; NRgRh; nitro; azido; hydroxy; oxo; thioxo; =NRi; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, hctcroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20
cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including
3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20
thioalkoxy; C1-C20 thiohaloalkoxy; C6-C18 thioaryloxy or thiohcteroaryloxy including 5-16
atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioarallcoxy,
thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy
including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -
NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRsRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nR; or -P(O)(ORg)(ORh); or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C6-C18 aryl or heteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd; or
(v) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-
10 Rb';
Rb' at each occurrence is, independently, Ra'; halo; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
hetcroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
R ; C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from 1-10
Rd; C2-C20 alkenyl; C2-C20 alkynyl; or C6-C18 aryl or heteroaryl including 5-16 atoms, each of
which is optionally substituted with from 1-10 Rd;
Rc at each occurrence is, independently:
(i) halo; NRgRh; nitro; azido; hydroxy; oxo; thioxo; =NRi; C1-C20 alkoxy or C1-C20
haloalkoxy, each of which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or
heteroaryloxy including 5-16 atoms, each of which is optionally substituted with from 1-10
Rd; C7-C20 aralkoxy, heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20
cycloalkenyloxy, heterocyclyloxy including 3-20 atoms, or heterocycloalkcnyloxy including
3-20 atoms, each of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20
thioalkoxy; C1-C20 thiohaloalkoxy; C6-C18 thioaryloxy or thioheteroaryloxy including 5-16
atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy,
thioheteroaralkoxy including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20
thiocycloalkenyloxy, thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy
including 3-20 atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -
C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -
NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein
n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORg)(ORh); or
(ii) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, each of which is optionally substituted with from 1-
10 Rb; or
(iii) C6-C18 aryl or hcteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd;
Rd at each occurrence is, independently:
(i) halo; NRgRh; nitro; azido; hydroxy; C1-C20 alkoxy or C1-C20 haloalkoxy, each of
which is optionally substituted with from 1-10 Ra; C6-C18 aryloxy or hcteroaryloxy including
5-16 atoms, each of which is optionally substituted with from 1-10 Rd; C7-C20 aralkoxy,
heteroaralkoxy including 6-20 atoms, C3-C16 cycloalkoxy, C3-C20 cycloalkenyloxy,
heterocyclyloxy including 3-20 atoms, or heterocycloalkenyloxy including 3-20 atoms, each
of which is optionally substituted with from 1-10 Rb; mercapto; C1-C20 thioalkoxy; C1-C20
thiohaloalkoxy; C6-C18 thioaryloxy or thioheteroaryloxy including 5-16 atoms, each of which
is optionally substituted with from 1-10 Rd; C7-C20 thioaralkoxy, thioheteroaralkoxy
including 6-20 atoms, C3-C16 thiocycloalkoxy, C3-C20 thiocycloalkcnyloxy,
thioheterocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy including 3-20
atoms, each of which is optionally substituted with from 1-10 Rb; cyano; -C(O)Rj, -C(O)ORj;
-OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -SC(S)Rj; -C(O)NRgRh; -NRkC(O)Rj; -C(NRi)Rj; -
OC(O)NRgRh; -NRkC(O)NRgRh; -NRkC(O)ORj; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm;
or -P(O)(ORs)(ORh);;
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Re; or
(iv) C7-C20 aralkyl, heteroaralkyl including 6-20 atoms, C3-C20 cycloalkyl, C3-C20
cycloalkenyl, heterocyclyl including 3-20 atoms, or heterocycloalkenyl including 3-20 atoms,
each of which is optionally substituted with from 1-10 Rb; or
(v) C6-C18 aryl or hcteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1-10 Rd;
Rd at each occurrence is, independently, halo; NRgRh; nitro; azido; hydroxy; C1-C20
alkyl, C1-C20 haloalkyl, C2-C20 alkenyl; C2-C20 alkynyl; C3-C20 cycloalkyl; C3-C20
cycloalkenyl, heterocyclyl including 3-20 atoms; heterocycloalkenyl including 3-20 atoms;
C7-C20 aralkyl; heteroaralkyl including 6-20 atoms; C1-C20 alkoxy; C1-C20 haloalkoxy; C6-C18
aryloxy; heteroaryloxy; C7-C20 aralkoxy; heteroaralkoxy including 6-20 atoms; C3-C16,
cycloalkoxy; C3-C20 cycloalkenyloxy; heterocyclyloxy including 3-20 atoms;
heterocycloalkenyloxy including 3-20 atoms; mercapto; C1-C20 thioalkoxy; C1-C20
thiohaloalkoxy; C6-C18 thioaryloxy; thioheteroaryloxy including 5-16 atoms; C7-C20
thioaralkoxy, thioheteroaralkoxy including 6-20 atoms, C3-C16, thiocycloalkoxy C3-C20
thiocycloalkenyloxy, thiohetcrocyclyloxy including 3-20 atoms, or thioheterocycloalkenyloxy
including 3-20 atoms; cyano; -C(O)Rj, -C(O)ORj; -OC(O)Rj; -C(O)SRj; -SC(O)Rj; -C(S)SRj; -
SC(S)Rj; -C(O)NRgRh; -NRkC(O)Rj; -C(NRi)Rj; -OC(O)NRgRh; -NRkC(O)NRgRh; -
NRkC(O)ORj; -S(O)nRm, wherein n is 1 or 2; -NRkS(O)nRm; or -P(O)(ORg)(ORh);
Re at each occurrence is, independently, C1-C6 alkyl, optionally substituted with from
1-3 Ra; C1-C6; haloalkyl; phenyl; 4-fluorophenyl; halo; hydroxyl; NRgRh; nitro; C2-C6 alkenyl;
C2-C6 alkynyl; C1-C6 alkoxy; C1-C6 haloalkoxy; cyano; or -C(O)Ri;
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)aRa, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh -NRkC(O)ORj, -OC(O)NRgRh, or-OC(O)ORj; or
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1 -3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or 1H-benzolmidazolyl, each of which
is optionally substituted with from 1-3 Re; or
(v) -YRf, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-;
R1 at each occurrence is, independently:
(i) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1 -3 Re; or
(ii) heterocycloalkenyl including 5-10 atoms or lH-benzolmidazolyl, each of which is
optionally substituted with from 1 -3 Re;
each of Rg, Rh, Ri, and Rk, at each occurrence is, independently:
(i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20
atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-C18 aryl or hcteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1 -10 Rd; or
(vi) -ORj, -C(O)Rj, -C(O)ORj; -C(O)NRgRh; or -S(O)nRm, wherein n is 1 or 2;
Rj at each occurrence is, independently:
(i) hydrogen; or
(ii) C1-C20 alkyl or C1-C20 haloalkyl, each of which is optionally substituted with from
1-10 Ra; or
(iii) C2-C20 alkenyl or C2-C20 alkynyl, each of which is optionally substituted with
from 1-10 Rc; or
(iv) C3-C20 cycloalkyl, C3-C20 cycloalkenyl, heterocyclyl including 3-20 atoms, or
heterocycloalkenyl including 3-20 atoms, C7-C20 aralkyl, or heteroaralkyl including 6-20
atoms, each of which is optionally substituted with from 1-10 Rb; or
(v) C6-C18 aryl or hcteroaryl including 5-16 atoms, each of which is optionally
substituted with from 1 -10 Rd; or
Rm at each occurrence is, independently, Rj, ORj, or NRgRh;
Rn at each occurrence is, independently, Rj or NRgRh;
or an N-oxide and/or a pharmaceutically acceptable salt thereof.
2. The compound of claim 1, wherein:
R3 is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, C6-C10 aryl, which is:
(a) substituted with from 1-2 R1; and
(b) optionally substituted with from 1-4 Re; and
R' at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nR3, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh -NRkC(O)ORj, -OC(O)NRgRh, or-OC(O)ORj.
3. The compound of claim 1, wherein:
R3 is heteroaryl including 5-14 atoms, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Rc; and
A at each occurrence is, independently, C6-C10 aryl, which is:
(a) substituted with from 1-2 Rf; and
(b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)ORj.
4. The compound of claim 1, wherein:
R3 is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Rc; and
A at each occurrence is, independently, heteroaryl including 5-10 atoms, which is:
(a) substituted with from 1 -2 Rf or includes a substituted ring atom selected from the
group consisting of S(O) and SO2; and
(b) is optionally substituted with from 1-4 Re;
provided that the heteroaryl including 5-10 atoms is not optionally substituted [1,2,4]-
oxadiazolyl; and
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or-OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh, -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)OR.
5. The compound of claim 1, wherein:
R3 is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, C6-C10 aryl, which is:
(a) substituted with from 1-2 Rf; and
(b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(iii) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1-3 Re; or
(iv) heterocycloalkenyl including 5-10 atoms or 1H-benzolmidazolyl, each of which
is optionally substituted with from 1 -3 Re; or
(v) -YRf, wherein Y at each occurrence is, independently, C1-C6 alkylene, -O-, or -
NR9-; and
Rf at each occurrence is, independently:
(i) heterocyclyl including 5-10 atoms that is substituted with from 1-2 oxo and
optionally substituted with from 1 -3 Re; or
(ii) heterocycloalkenyl including 5-10 atoms or 1H-benzolmidazolyl, each of which is
optionally substituted with from 1-3 Re;
6. The compound of claim 1, wherein:
R3 is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, arylazacyclyl including 8-12 atoms, each of
which is:
(a) substituted with from 1 -2 Rf, and
(b) optionally substituted with from 1-4 Re; and
Rf at each occurrence is, independently:
(i) -S(O)nRn, -(CH2)1-6S(O)nRn, -NRkS(O)nRn, or -OS(O)nRn, wherein n at each
occurrence is, independently, 1 or 2; or
(ii) -NRkC(O)NRgRh -NRkC(O)ORj, -OC(O)NRgRh, or -OC(O)ORj.
7. The compound of claim 1, wherein:
R3 is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Rc; and
A at each occurrence is, independently, arylsulfinylcyclyl, heteroarylsulfinylcyclyl,
arylsulfonylcyclyl or hetcroarylsulfonylcyclyl, each of which includes 8-10 atoms and is
optionally substituted with from 1 -4 Re.
8. The compound of claim 1, wherein:
R3 is C6-C14 aryl, which is:
(i) substituted with from 1-2 R10, and
(ii) optionally substituted with from 1-4 Re; and
A at each occurrence is, independently, [1,2,4]-oxadiazolyl, optionally substituted
with from 1-2 Re.
9. The compound of claim 1, wherein R3 is C6-C10 aryl, which is (i) substituted
with 1 R10; and (ii) optionally substituted with from 1-2 Re.
10. The compound of claim 1, wherein R' has formula (A-4):
wherein R32 is hydrogen or Rc.
11. The compound of claim 1, wherein R3 is heteroary 1 including 5-10 atoms,
which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Re.
12. The compound of claim 1, wherein R' is pyridyl, thienyl, thiazolyl, or
pyrazolyl, which is (i) substituted with 1 R10, and (ii) optionally substituted with from 1-2 Re.
13. The compound of claim 1, wherein W is selected from the group consisting
of
-O-, a bond, -O(C1-C3 alkylene)-, and -(C1-C3 alkylene)0-.
14. The compound of claim 1, wherein A is phenyl, which is (a) substituted with
1 Rf, and (b) optionally substituted with from 1 -2 Re.
15. The compound of claim 1, wherein A is hetcroaryl including 5-8 atoms,
which is (a) substituted with 1 R1, and (b) optionally substituted with from 1-3 Re, provided
that the heteroaryl including 5-8 atoms is not [1,2,4]-oxadiazolyl.
16. The compound of claim 1, wherein A is tetrahydroquinolyl or
tetrahydroisoquinolyl, which is (a) substituted with from 1 Rf, and (b) optionally substituted
with from 1-2 Re.
17. The compound of claim 1, wherein A is benzo[b]thienyl-1,1-dioxide, 3,4-
dihydro-2H-thiopyrano[2,3-b]pyridyl-1,1 -dioxide, or 2,3-dihydrobenzo[b]thienyl-1,1 -dioxide,
each of which is optionally substituted with from 1-3 Rc.
18. The compound of claim 1, wherein R1 is -SO2Rn.
19. The compound of claim 18, wherein Rn is C1-C10 alkyl, optionally substituted
with from l-2Ra.
20. The compound of claim 19, wherein Rn is unsubstituted C1-C3 alkyl.
21. The compound of claim 19, wherein Rn is CH3.
22. The compound of claim 19, wherein Rn is C3-C8 alkyl, which is substituted
with from 1-2 Ra, wherein Ra at each occurrence is, independently, hydroxyl; C1-C3 alkoxy;
NRgRh; halo; arylheterocyclyl including 8-10 atoms, optionally substituted with from 1-3 Rb;
cyano; or C(O)ORj.
23. The compound of claim 18, wherein Rn is NRgRh.
24. The compound of claim 23, wherein Rg and Rh are each, independently,
hydrogen; C1-C10 alkyl, optionally substituted with from 1-2 Ra; C7-C10 aralkyl, optionally
substituted with from 1 -3 Rb; or -C(O)Rj.
25. The compound of claim 18, wherein Rn is heterocyclyl including 5-10 atoms,
C7-C10 aralkyl, or C3-C8 cycloalkyl, each of which is optionally substituted with from 1-5 Rb.
26. The compound of claim 1, wherein R1 is:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally
substituted with from 1-2 Rc: or
(ii) heterocycloalkenyl including 5-7 atoms that is optionally substituted with from 1-
2Re.
27. The compound of claim 26, wherein R1 is 4,5-dihydrooxazolyl, 2-oxo-
imidazolidinyl, 4,5-dihydro-1H-imidazolyl, 1,2,5,6-tetrahydro-pyrimidinyl, 5,6-dihydro-2H-
[1,3]oxazinyl, or 2-oxo-oxazolidinyl.
28. The compound of claim 1, wherein Rf is 1H-benzolmidazolyl.
29. The compound of claim 1, wherein R3 has formula D-1:
wherein:
R32 is hydrogen or Rc;
W is -O- or a bond;
each of RA22 and RA23 is, independently, hydrogen or Re; and
one of RA24 and RA25 is -SO2Rn, and the other is hydrogen or Re;
provided that only one of RA22, RA23, RA24, and RA25 is Re.
30. The compound of claim 29, wherein R32 is hydrogen, fluoro, or chloro.
31. The compound of claim 1, wherein:
R' is heteroaryl including 5-10 atoms, which is (i) substituted with 1 R10, and (ii)
optionally substituted with from 1-2 Re; and
W is a bond; and
A has formula (B-9):
wherein:
each of RA22 and RA23 is, independently, hydrogen or Re; and
one of RA24 and RA25 is -SO2Rn and the other is hydrogen or Re;
provided that only one of RA22, R23, RA24, and RA25 is Re.
32. The compound of claim 1, wherein:
R3 has formula (A-4):
wherein R32 is hydrogen or Re; and
W is a bond; and
A is heteroaryl including 5-8 atoms, which is (a) substituted with 1 Rf, and (b)
optionally substituted with from 1-3 Re, provided that the heteroaryl including 5-8 atoms is
not [1,2,4]-oxadiazolyl.
33. The compound of claim 1, wherein:
R3 has formula (A-4):
wherein R32 is hydrogen or Rc; and
W is a bond; and
A is tetrahydroquinolyl or tetrahydroisoquinolyl, which is (a) substituted with from 1
Rf, and (b) optionally substituted with from 1-2 Re.
34. The compound of claim 1, wherein:
R3 has formula (A-4):
wherein R32 is hydrogen or Re; and
W is a bond; and
A is benzo[b]thienyl-1,1 -dioxide, 3,4-dihydro-2H-thiopyrano[2,3-b]pyridyl-1,1-
dioxide, or 2,3-dihydrobenzo[b]thienyl-1,1-dioxide, each of which is optionally substituted
with from 1-3 Re.
35. The compound of claim 1, wherein R3 has formula D-1:
wherein:
R32 is hydrogen or Rc;
W is -O- or a bond:
each of RA22 and RA23 is, independently, hydrogen or Re; and
one of RA24 and RA25 is:
(i) heterocyclyl including 5-7 atoms that is substituted with 1 oxo and optionally
substituted with from 1-2 Re; or
(ii) heterocycloalkenyl including 5-7 atoms or 1H-benzolmidazolyl, each of which is
optionally substituted with from 1-2 Re; and the other is hydrogen or Re;
provided that only one of RA22, RA23, RA24, and RA25 is Re.
36. The compound of claim 1, wherein R3 has formula F:
wherein Re at each occurrence is, independently, hydrogen; halo; C1-C6 alkyl,
optionally substituted with from 1-2 Ra; C1-C3 haloalkyl; C1-C3 alkoxy; NRgRh; phenyl; or 4-
fluorophenyl.
37. The compound of any one of claims 1 to 36, wherein R1 is hydrogen.
38. The compound of any one of claims 1 to 37, wherein R2 is hydrogen.
39. The compound of any one of claims 1 to 37, wherein R2 is:
(ii) C1-C6 alkyl that is optionally substituted with from 1-2 Ra; or
(iii) C7-C10 aralkyl that is optionally substituted with from 1-3 Rb; or
(vii) -XR8.
40. The compound of any one of claims 1 to 39, wherein each of R4, R5 and R6 is
hydrogen.
41. The compound of any one of claims 1 to 40, wherein R7 is chloro, cyano, C1-
C6 alkyl, C1-C3 haloalkyl, C1-C6 alkoxy, C(O)ORj, C(O)NRgRh, or SO2Rm.
42. The compound of claim 41, wherein R7 is C1-C3 haloalkyl.
43. The compound of claim 42, wherein R7 is CF3.
44. The compound of claim 1, wherein the compound is selected from the group
consisting of:
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
4-{3-[3-(ben7ylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4- {3-[2-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{3-t3-(isobutylsulfonyl)phenoxy]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
3 -methyl-4-(3- {3-[(3-methylbutyl)sulfonyl]phenoxy} phenyl)- 8-
(trifluoromethyl)quinoline;
3-[(2-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
4- {3-[3-chloro-5-(propylsulfonyl)phenoxy]phenyl} -3-methyl-8-
(trifluoromethyl)quinoline;
3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
4-(3-{3-[(3-methoxypropyl)sulfonyl]phenoxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline;
4-(3-{3-chloro-5-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline;
3-[(4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy }phenyl)sulfonyl]propan-1 -ol;
3-methyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
2-methyl-4-[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]butan-2-ol;
3-benzyl-8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline;
8-chloro-3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline;
2,2-dimethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
4-[(3-{3-[3-methyl-8-(trifluoromethyl)qumolin-4-yl]phenoxy}phenyl)sulfonyl]butan-
l-ol;
5-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy }phenyl)sulfonyl]pentan-1-ol;
3-benzyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)qumoline:
3-benzyl-4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-[(3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
3-ben7yl-4-{3-[4-(cthylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-f4-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
3-[(4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
4-{3-[4-(butylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
2-[(4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]cthanol;
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(cthylsulfonyl)phenoxy]phenyl}-8-(tTifluoromethyl)quinoline;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-(3-{3-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
4-{3-[3-(cyclopentylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
ethyl (4-{[(4-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]methyl}phenyl)acetate;
4-(3-{4-[(2,5-dimethylbenzyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[4-(isobutylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{4-[(3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
3-benzyl-4-(3-{4-[(2-fluorobenzyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethy l)quinoline;
3-[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phcnyl)sulfonyl]propan-1-ol;
4-{3-[4-(allylsulfonyl)phenoxy]phenyl}-3-benzyl-8-(trifluoromethyl)quinoline;
3-benzyl-4- {3-[4-(butylsulfonyl)phenoxy]phenyl) -8-(trifluoromethyl)quinoline;
3 -benzy 1-4- {3 -[3 -(ethylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quino line;
3-benzyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3- {3-[(3-methoxypropyl)sulfonyl]phenoxy} phenyl)-8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(cyclopentylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-[(3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]-2-
methylbutan-2-ol;
4-{3-[4-methyl-2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-methyl-3-(methylsulfonyr)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[2-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-f3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile;
4-(3-{3-[(3-hydroxy-3-methylbutyl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline-3-earbonitrile;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-carbonitrile;
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile;
[(4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]acctic
acid;
N-{2-[(4-{3-[3-bcnzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]ethyl}propan-2-amine;
4-[3-(4-{[2-(isopropylamino)ethyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carbonitrile;
ethyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxylate;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-carboxylic
acid;
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile;
4-{3-[4-methoxy-3-(methylsulfonyl)phenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline;
3-methyl-4-(3-{3-[(methylsulfonyl)methyl]phenoxy}phenyl)-8-
(trifluoromethyl)quline;
8-chloro-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-propylquinoline;
3-benzyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-phenyl-8-
(trifluoromethyl)quinoline;
4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N-
methylbcnzenesulfonamide;
4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N-
ethylben7enesulfonamide;
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N-
dimethylbenzenesulfonamide;
4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-ethyl-N-
methylbenzenesulfonamide;
4-{3-[3-benzyl-8-(trifluoromethyl)qumolin-4-yl]phenoxy}-N,N-
diethylbenzenesulfonamide;
3-benzyl-4-{3-[4-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-benzyl-4- {3-[4-(piperidin- -ylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-(3-{4-[(4-methylpipcrazin-1-yl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
4- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N-
propylbenzenesulfonamide:
4- {3-[3-benzyl-8-(trifluoromethyl)quinolm-4-yl]phenoxy} -N-
isopropylbenzenesulfonamide;
N-benzyl-4-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
3-benzyl-4- {3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
methylbenzenesulfonamide;
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N-
dimethylbenzenesulfonamide;
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-ethyl-N-
methylbenzenesulfonamide;
3-{3-[3-bcnzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N,N-
diethylbenzenesulfonamide;
3-bcnzyl-4- {3-[3-(pyrrolidin-1-ylsulfonyl)phenoxy]phcnyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(piperidin-1-ylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-bcnzyl-4-(3-[3-[(4-methylpiperazin-1-yl)sulfonyl]phenoxy}phenyl)-8-
(trifluoromethyl)quinoline;
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
propylbenzenesulfonamide;
3- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy} -N-
isopropylbenzenesulfonamide;
N-benzyl-3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}bcnzcnesulfonamide;
3-methyl-4- {3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
8-chloro-3-methyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-isopropyl-4-{3-[4-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-dimethylbcnzenesulfonamide;
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethyl-N-
methylbenzenesulfonamide;
8-chloro-3-methyl-4-{3-[4-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}quinoline;
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbcnzenesulfonamide;
8-chloro-4-{3-[3-fluoro-5-(morpholin-4-ylsulfonyl)phenoxy]phenyl}-3-
methylquinoline;
4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzencsulfonamide;
N-benzyl-4-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-methylbcnzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-cthylbcnzcncsulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-propylbenzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-isopropylbenzenesulfonamide;
N-benzyl-3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]benzencsulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-dimethylbenzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-ethyl-N-
methylbcnzenesulfonamide;
8-chloro-3-methyl-4-{3-[3-(pyrrolidin-1-ylsulfonyl)phenoxy]phenyl}quinoline;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N,N-diethylbcnzenesulfonamide;
8-chloro-3-methyl-4-{3-[3-(piperidin-1-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-methyl-4-(3-{3-[(4-methylpipcrazin-1-
yl)sulfonyl]phenoxy} phenyl )quinoline;
8-chloro-3-methyl-4-{3-[3-(piperazin-1-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-methyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-3-methyl-4-{3-[3-(morpholin-4-ylsulfonyl)phenoxy]phenyl}quinoline;
tert-butyl 4-({3-[3-(8-chloro-3-tnethylqumolin-4-
yl)phenoxy]phenyl}sulfonyl)piperazine-1 -carboxylate;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-(2-
hydroxyethyl)benzenesulfonamide;
3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]-N-(2-hydroxyethyl)-N-
methylbenzenesulfonamide;
3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-
propylbenzenesulfonamide;
N-ethyl-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(2-hydroxyethyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(2-hydroxycthyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(2-hydroxypropyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(2-hydroxy-2-methylpropyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(2-hydroxy-2-methylpropyl)-N-methyl-3-{3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl]phenoxy} benzenesulfonamide;
N-(2-mcthoxy-2-methylpropyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(2-methoxy-2-methylpropyl)-iV-methyl-3-{3-[3-methyl-8-
(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
N-(2-hydroxy-1,1 -dimethylethyl)-3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}bcnzenesulfonamide;
4-[3-(6-fluoro-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-quinoline;
3-methyl-4-(3-{[6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline;
3-methyl-4-[3-(4-methylsulfanyl-pyridin-2-yloxy)-phenyl]-8-trifluoromethyl-
quinoline;
3-methyl-4-(3-{[4-(methylsulfonyl)pyridin-2-yl]oxy }phenyl)-8-
(trifluoromethyl)quinoline:
2-methyl-4-[(6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}pyridin-2-
yl)sulfonyl]butan-2-ol;
4-[3-({6-[(3-methoxy-3-methylbutyl)sulfonyl]pyridin-2-yl}oxy)phenyl]-3-methyl-8-
(trifluoromethyl)quinoline;
3-methyl-4-(3-{[5-(methylsulfonyl)pyridin-3-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline;
3- Methyl-4-[3-(2-methylsulfanyl-pyridin-4-yloxy)-phenyl]-8-trifluoTomethyl-
quinoline;
3-methyl-4-(3-{[2-(methylsulfonyl)pyridin-4-yl]oxy}phenyl)-8-
(trifluoromethyl)quinoline;
7-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-y]]phenoxy}-3,4-dihydro-2H-
thiopyrano[2,3-b]pyridine 1,1 -dioxide;
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-3,4-dihydro-2H-
thiopyrano[2,3-b]pyridine 1,1 -dioxide;
4-[3-(4,6-Dichloro-1-oxy-pyridin-2-yloxy)-phenyl]-3-methyl-8-trifluoromethyl-
quinoline;
4-(3-{[4-chloro-6-(methylsulfonyl)-1-oxidopyridin-2-yl]oxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline;
4-[3-(4-Chloro-6-methanesulfonyl-pyridin-2-yloxy)-phenyl]-3-methyl-8-
trifluoromethyl-quinoline;
3,5-dichloro-2-fluoro-6-{3-[3-methyl-8-(trifluoromethyl)qumolin-4-
yl]phenoxy}pyridin-4-amine;
3,5-dichloro-2-(methylsulfonyl)-6-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}pyridin-4-amine;
2-methanesulfonyl-6-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-phenoxy]-
pyridin-4-ylamine;
4-(3-{[4-fluoro-6-(methylsulfonyl)pyridin-2-yl]oxy}phenyl)-3-methyl-8-
(trifluoromethyl)quinoline;
4-(3-{[3-(methylsulfonyl)bcnzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
4-(3-{[4-(methylsulfonyl)bcnzyt]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
3-methyl-4-{3-[3-(methylsulfonyl)bcnzyl]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(ethylsulfonyl)benzyl]phenyl}-8-(trifluoromethyl)quinoline;
3-[3-(3-methyl-8-trifluoromethyl-quinolin-4-yl)-benzyl]-benzenesulfonic acid
pentafluorophenyl ester;
3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl} -A-
propylbenzenesulfonamide;
N-ethyl-A-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]benzyl} benzenesulfonamide;
A'-(2-hydroxycthyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]benzyl} benzenesulfonamide;
1-(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)imidazolidin-2-
one;
3-(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]benzyl}phenyl)-1,3-oxazolidin-2-
one;
8-chloro-3-methyl-4-|3-(3-nitro-phenoxy)-phenyl]-quinoline;
3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenylamine;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}benzenesulfonamide;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}methanesulfonamide;
N-{3-[3-(8-ehloro-3-methylquinolin-4-yl)phenoxy]phenyl}cthancsulfonamide;
methyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate;
ethyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate;
isobutyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}carbamate;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N-ethylurea;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N-isopropylurea;
N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-N-phenylurea;
N-(2-chloroethyl)-N-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}urea;
2-chloroethyl {3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl} carbamate ;
8-chloro-3-methyl-4-{3-[3-(5-methyl-4,5-dihydro-1,3-oxazol-2-
yl)phenoxy]phenyl}quinoline;
1-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-3-methylimida7:olidin-2-
one;
1-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-3-ethylimidazolidin-2-
one;
8-chloro-4-{3-[3-(4-isopropyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-3-
methylquinoline;
8-chloro-3-methyl-4-{3-[3-(4-propyl-4,5-dihydro-1,3-oxazol-2-
yl)phenoxy]phenyl} quinoline;
8-chloro-4- {3-( 3-(4,4-dimethyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl} -3-
methylquinoline;
3- {3-[3-(8-chloro-3-methyl-quinolin-4-yl)-phenoxy]-phenyl} -2-oxo-imidazolidin-1 -
yl)-acetic acid methyl ester;
(3-{3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}-2-oxoimidazolidin-1-
yl)acetic acid;
4-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]butan-
2-ol;
1 -[(3- {3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]pentan-3-ol;
l-[(3-{3-t3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]hexan-
3-ol;
4-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)butan-2-ol;
4-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)-2-methylbutan-
2-ol;
4-(3-{3-[3-(tert-Butyl-dimethyl-silanyloxy)-propane-1-sulfonyl]-phenoxy}-phenyl)-
8-chloro-3-methyl-quinoline;
3-({3-[3-(8-chloro-3-methylquinolin-4-yl)phenoxy]phenyl}sulfonyl)propan-1-ol;
N-{3'-[S-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}methanesulfonamide;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
N-{3,-t3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-yl}methanesulfonamide;
N-{3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}-4-
methylbenzenesulfonamide;
4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
4-{3-[l-(phenylsulfonyl)-1H-indol-3-yl]phenyl}-8-(trifluoromcthyl)quinoline-3-
carbonitrile;
3'-[3-cyano-8-(trifluoromethyl)qumolin-4-yl]-N-methylbiphenyl-3-sulfonamide;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-(1H-tetrazol-5-yl)-8-
(trifluoromethyl)quinoline;
3-methyl-4-[3-({[1-(methylsulfonyl)-1,2,3,4-tetrahydroquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
3-ben7yl-4-[3-({[1-(methylsulfonyl)-l,2,3,4-tetrahydroquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3-({[2-(methylsulfonyl)-1,2,3,4-tetrahydroisoquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
3-methyl-4-[3-({[2-(methylsulfonyl)-1,2,3,4-tetrahydroisoquinolin-5-
yl]oxy}methyl)phenyl]-8-(trifluoromethyl)quinoline;
Methyl 2-(3'-(3-cyano-8-(trifluoromethyl)quinolin-4-yl)biphenyl-3-ylthio)acctate;
({3'-[3-cyano-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)acetic acid;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
N-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
N-ethyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quiroline-3-
carboxamide;
3-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-ethyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-3-propyl-8-(trifluoromethyl)quinoline;
3-isopropyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3-(2-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluorotnethyl-quinoline;
4-[3-(6-chloro-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-quinoline;
3-methyl-4-[3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl]-8-
(trifluoromethyl)quinoline;
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxy-2-
methylpropyl)biphenyl-3-sulfonamide;
3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxycthyl)biphenyl-3-
sulfonamide;
3-benzyl-4-[3'-(morpholin-4-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3'-[3-ben2yl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxyethyl)-N-
methylbiphenyl-3-sulfonamide;
3-bcn2yl-4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)qumoline;
3-benzyl-4-[3'-chloro-4'-(isopropylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
3-benzyl-4-[3'-chloro-4'-(isobutylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
3-ben2yl-4-{3'-chloro-4'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline;
3-bcnzyl-4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-(allylsulfonyl)-3'-chlorobiphenyl-3-yl]-3-benzyl-8-(trifluoromethyl)quinoline;
3-({3'-[3-benzyl-8-(trifluoTomethyl)quinolin-4-yl]-3-chlorobiphenyl-4-
yl} sulfonyl)propan-1-ol;
3-benzyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(isobutylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-!3'-[(3-methylbutyl)sulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(allylsulfonyl)biphenyl-3-yl]-3-benzyl-8-(trifluoromethyl)quinoline;
3-({3'-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan-1-
ol;
3-benzyl-4- {3-[5-(methylsulfonyl)pyridin-3-yl]phenyl} -8-(trifluoromethyl)quinoline;
3-benzyl-4-[4'-(pyrrolidin-1-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-bcnzyl-4-[3'-(pyrrolidin-1-ylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
4-[3'-(allylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-3-benzy1-8-
(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(isobutylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
3-benzyl-4-[3'-(propylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline:
3-benzyl-4-[3'-[(3-methylbutyl)sulfonyl]-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
3-{[3'-[3-benzyl-8-(trifluoromethyl)quinolm-4-yl]-5-(trifluoromethyl)biphenyl-3-
yl]sulfonyl}propan-1-ol;
3-benzyl-4-[3'-(isopropylsulfonyl)-5'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline:.
3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-
ol;
4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
3-({3-chloro-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-
yl}sulfonyl)propan-1-ol;
3-methyl-4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
3-methyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
4-[4'-(allylsulfonyl)-3'-chlorobiphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
3-benzyl-4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[5-(cthylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
3-benzyl-4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-methyl-4-{3'-[(1E)-prop-1-en-1-ylsulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{3'-[( 1E)-prop-1-en-1-ylsulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline;
3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-ol;
4-[3'-chloro-4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-chloro-4'-(propylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{3'-chloro-4'-[(l£)-prop-1-en-1-ylsulfonyl]biphenyl-3-yl}-8-
(trifluoromethyl)quinoline;
3-({3-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-4-yl}sulfonyl)propan-1-ol;
4-{3-[5-(methylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
4-[4'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoroniethyl)quinolme;
4-{3-[5-(ethylsultbnyl)-1-oxidopyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)pyridin-3-yl]phenyl}-8-(trifluoromethyl)quinoline;
N-methyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
N-ethyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]-N-propylbiphenyl-3-sulfonamide;
N-isopropyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
3-methyl-4-[3'-(pyrrolidin-1-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
N-methyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
N-ethyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
N-propyl-3'-[8-(trifluoromethyl)quinolm-4-yl]biphenyl-3-sulfonamide;
N-isopropyl-3'-[8-(tritluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
4-[3'-(pyrrolidin-1-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-methyl-4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
3-methyl-4-[4'-(methylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-8-
(trifluoromethyl)quinoline;
4-[4'-(ethylsulfonyl)-2'-(trifluoromethyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
3-benzyl-4-[3-(1,1-dioxido-1 -benzothien-4-yl)phenyl]-8-(trifluoromethyl)quinoline;
3-methyl-4-{3-[2-(methylsulfonyl)pyrimidin-4-yl]phenyl} -8 (trifluoromethyl)-
quinoline;
4-[3-(1,1 -dioxido-1 -benzothien-3-yl)phenyl]-3-methyl-8-(trifluoromethyl)quinoline;
4-[3-(6-Methanesulfonyl-pyrimidin-4-yl)-phenyl]-3-methyl-8-trifluoromethyl-
quinoline;
3-benzyl-4-(3-{[5-(methylsulfonyl)pyridin-3-yl]ethynyl}phenyl)-8-
(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[4-(pyrrolidin-1-ylsulfonyl)phenyl]ethynyl}phenyl)-8-
(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[3-(pyrrolidin-1-ylsulfonyl)phenyl]ethynyl}phenyl)-8-
(trifluoromethyl)quinoline;
3-benzyl-4-(3-{[3-(pyrrolidin-1-ylsulfonyl)-5-
(trifluoromethyl)phenyl]ethynyl}phenyl)-8-(trifluoromethyl)quinoline;
4-{3-[(1,1-dioxido-2,3-dihydro-1-benzothien-6-yl)oxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]-N-(2-hydroxy-2-
phenylethyl)benzamide;
3-{3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}-N-(3-
hydroxypropyl)benzamide;
3-benzyl-4-{3-[3-(5-methyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-benzyl-4- {3-[3-(5-phenyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl}-8-
trifluoromethyl)quinoline;
3-benzyl-4- {3-[3-(4,4-dimethyl-4,5-dihydro-1,3-oxazol-2-yl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4- {3-[3-(5,6-dihydro-4H-1,3-oxazin-2-yl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4,5-dihydro-1H-imidazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4- {3 - [3 -(1H-benzimidazol-2-yl)phenoxy]phenyl} -3-benzyl-8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4-methyl-4,5-dihydro-1H-imidazol-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-benzyl-4- {3-[3-( 1-methyl-4,5-dihydro-1H-imidazol-2-yl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-t3-(1,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(1-methyl-1,4,5,6-tetrahydropyrimidin-2-yl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline:
3-benzyl-4-t3-(3-methyl-1,2,4-oxadiazol-5-yl)phenyl]-8-(trifluoromethyl)quinoline;
3-benzyl-4-{3-[3-(4-fluorophenyl)-1,2,4-oxadiazol-5-yl]phenyl}-8-
(trifluoromethyl)quinoline;
2-(5- {3-[3-benzyl-8-(trifluoromethyl)quinolin-4-yl]phenyl} -1,2,4-oxadiazol-3-
yl)acetamide;
3-benzyl-4-[3-(3-phenyl-1,2,4-oxadiazol-5-yl)phenyl]-8-(trifluoromethyl)quinoline;
8-bromo-3-methyl-4-(3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
3-methyl-8-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-[3'-(ethylsulfonyl)-4'-methylbiphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carbonitrile;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carbonitrile;
4-{3-[3-(memylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[2',5'-difluoro-4'-(methylsulfonyl)biphcnyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-8-(trifluoromethy])quinoline;
4-[2',4'-difluoro-5'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[5'-(ethylsulfonyl)-2',4'-difluorobiphenyl-3-yl]-8-(trifluoromethyl)quinoline;
2-methyl-4-[(3-{3-[S-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]butan-
2-ol;
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-{3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline:
4-[4'-bromo-3'-(ethylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
4-[2',5'-difluoro-4'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyJ)quinoline;
4-[4'-(ethylsulfonyl)-2',5'-difluorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-[2',4'-difluoro-5'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-[5'-(ethylsulfony[)-2',4'-difluorobiphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinol.inc-3-
carboxamide;
3-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxylic acid;
Ethyl 4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxylatc;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxamide;
4- {3-[3-(propylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3-
carboxamide;
4-[4'-bromo-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carbonitrile;
ethyl 8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylate;
8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl},quinoline-3-carboxamide;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-[4'-mcthoxy-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-
(trifluoromethyl)quinoline;
4-[4'-methoxy-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
3-({4-methyl-3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)propan-1-ol;
3-( {4-methyl-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl} sulfonyl)propan-1-
ol;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid;
3-({4-chloro-3'-[3-Tnethyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl} sulfonyl)propan-1 -ol;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-[3'-(ethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-carboxamide;
3-(f4-bromo-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-
ol;
4-{3'-[(dimethylamino)sulfonyl]biphenyl-3-yl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline;
3-({4-chloro-3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-ol;
4-[3'-(isopropylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
8-chloro-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline;
4-[3'-(aminosulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quino]inc-3-carboxamide;
2-methyl-4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)butan-2-ol;
2-methyl-4-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl}sulfonyl)butan-2-ol;
8-cyano-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
4-(3-{3-[(dimethylamino)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinulinc-3-
carboxamide;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-1-amine;
N-methyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4-yl)phenoxy)phenylsulfonyl)propan-
1 -amine;
3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} phenyl)sulfonyl]propan-1 -amine;
N-methyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine;
N-ethyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} phenyl)sulfonyl]propan-1 -amine;
N-isopropyl-3-[(3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine;
N-ethyl-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]propan-
1 -amine;
N-isopropyl-3-(3-(3-(8-(trifluoromethyl)quinolin-4-
yl)phenoxy)phenylsulfonyl)propan-1 -amine;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-[(3-{4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4- {2-chloro-5- [4-(mcthy lsulfony l)phenoxy]pheny 1} -8-(tri fluoromethy l)quinoline;
4-{2-chloro-5-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{2-chloro-5-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{5-[4-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline;
4-{2-fluoro-5-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{2-chloro-5-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-{5-[3-(cthylsulfonyl)phenoxy]-2-fluorophenyl}-8-(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4- {2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
4- {2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
3-[(4-{4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-ol;
4-{2-fluoro-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4- {2-chloro-5-[2-chloro-4-(methylsulfonyl)phenoxy]phenyl} -8-
(trifluoromethyl)quinoline;
[(4-{4-chloro-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]acetonitrile;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
3-[(3- {3-[8-(methylsulfonyl)quinolin-4-yl]phenoxy }phenyl)sulfonyl]propan-1 -ol;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
8-(methylsulfonyl)-4-{3-[4-(propylsulfonyl)phenoxy]phenyl}quinoline;
4-{3-[4-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsulfonyl)quinoline;
8-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
8-(methylsulfonyl)-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}quinoline;
4- {3-[2-fluoro-4-(methylsulfonyl)phenoxy]phenyl} -8-(methylsulfonyl)quinoline;
3-(methylsulfonyl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
3-(methylsulfonyl)-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-(methylsulfonyl)-8-
(trifluoromethyl)quinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-3-methyl-8-
(trifluoromethyl)quinoline;
8-chloro-3-isopropyl-4-{3-[3-(methylsulfonyl)phetioxylphenyl}quinoline;
3-methyl-8-(trifluoromethyl)-4-(3-{3-[(trifluoromethyl)
sulfonyl]phenoxy}phenyl)quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-aminc;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3-carboxylic
acid;
3-methyl-4- {l-[3-(methylsulfonyl)phenyl]-1H-pyrazol-4-yl}-8-
(trifluoromethyl)quinoline;
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxylic acid;
8-chloro-4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
8-chloro-4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}quinoline-3-
carboxamide;
8-fluoro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-3-phenyl-8-(trifluoromethyl)quinoline;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(propylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(benzylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-(3-{3-[(3-hydroxypropyl)sulfonyl]phenoxy}phenyl)quinoline-8-carbonitrile;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[4-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carbonitrile;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{3-[3-(cthylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}quinoline;
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
8-methoxy-4-(3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
N,N-bis(4-methoxybcnzyl)-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide;
N,N-bis(4-mcthoxybenzyl)-3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide;
N,N-bis(4-mcthoxybcnzyl)-4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N,N-bis(4-methoxybenzyl)-4-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzencsulfonamide;
4-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
4-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}benzenesulfonamide;
3-isopropyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-methyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)- 8-(trifluoromethyl)quinoline;
3-methyl-4-(3-{[4-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
4-{5-[3-(cthylsulfonyl)phenyl]-2-thienyl}-3-methyl-8-(trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-1,3-thiazol-2-yl}-8-
(trifluoromethyl)quinoline;
ethyl 4- {5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline-3-
carboxylate;
4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
ethyl 4- {5'-[3-(methylsulfonyl)phenyl]-2,2'-bithiophen-5-yl} -8-
(trifluoromethyl)quinoline-3-carboxylate;
8-fluoro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline;
3-methyl-4-{5-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4-[3-(methylsulfonyl)phenyl]-8-(trifluoromethyl)quinoline;
4- {5-[3-(methylsulfonyl)phenyl]-2-thienyl} -8-(trifluoromethyl)quinoline;
N,N-dimethyl-3-{5-[3-methyl-8-(trifluoromethyl)quinolin-4-yl )-2-
thienyl} benzenesulfonamide;
3-methyl-4-{5-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinaline;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-methyl-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-3-phenyl-8-(trifluoromethyl)quinoline;
3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-sulfonamide;
ethyl 4-(3'-(3-(1,3-dioxoisoindolin-2-yl)propylthio)biphenyl-3-yl)-8-
(trifluoromethyl)quinoline-3-carboxylate;
2-amino-4-[3'-Cmethylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-[4'-fluoro-3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4'-fluoro-3'-(methylsulfonyl)biphenyl-3-yl]-3-methyl-8-(trifluoromethyl)quinoline;
2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}thio)propyl]-1H-isoindole-
1,3(2H)-dione;
N-ethyl-3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl} sulfonyl)propan-1- amine;
N-methyl-3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-
yl} sulfonyl)propan-1 -amine;
N-ethyl-3-({3'-[8-(triftuoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-
amine;
N-methyl-3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-
amine;
8-chloro-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline;
5-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide;
5-{3-[8-(trifluoromethyl)quinolin-4-yl]phenyl}thiophene-2-sulfonamide;
3-methyl-4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-3-methyl-8-(trifluoromethyl)quinoline;
3-methyl-4-{3-[5-(propylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinolone;
4- {3-[5-(isopropylsulfonyl)-2-thienyl]phenyl} -3-methyl-8-(trifluoromethyl)quinoline;
3-[(5-{3-t3-methyl-8-(trifluoromethyl)quinolin-4-yl]phenyl}-2-thienyl)sulfonyl]-
propan-1-ol;
4-{3-[5-(methylsulfonyl)-2-thienyl]phenyl}-8-(trifiuoromethyl)quinoline;
4-{3-[5-(ethylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline;
4- {3-[5-(isopropylsulfonyl)-2-thienyl]phenyl}-8-(trifluoromethyl)quinoline;
N-(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3-
yl)methanesulfonamide;
8-chloro-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide:
N-benzyl-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy} phenyl)sulfonyl]propan-1 -amine;
N-(4-fluorobenzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy} phenyl)sulfonyl]propan-1 -amine;
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy} phenyl)sulfonyl]propyl} prop-2-en-1 -amine;
3-( {3-[(3- {3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}amino)propanenitrile;
N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}prop-2-yn-1-amine;
N-(2-fluoroethyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine;
N-methoxy-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy} pheny l)sulfonyl]propan-1 -amine;
4-(3-{3-[(3-chloropropyl)sulfonyl]phenoxy}phenyl)-8-(trifluoromethyl)quinoline;
N-methyl-N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy} phenyl)sulfonyl]propyl} prop-2-yn-1 -amine;
(2R)-N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine;
(2S)-N- {3-[(3- {3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}butan-2-amine;
N-(3-chlorobcnzyl)-3-[(3-{3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propan-1-amine;
(4-(3-(3-(methylsulfonyl)phenoxy)phenyl)-8-(trifluoromethyl)quinolin-3-
yl)methanamine;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-fluoroquinoline-3-
carboxamide;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-cyanoquinoline-3-
carboxamide;
8-methyl-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-3-carboxamide;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboxamide;
ethyl 4-(3'-{[3-(l,3-dioxo-1,3-dihydro-2H-isoindol-2-yl)propyl]sulfonyl}biphenyl-3-
yl)-8-(trifluoromethyl)quinoline-3-carboxylate;
2-[3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propyl]-
1H-isoindole-1,3(2H)-dione;
2-[3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propyl]-1H-
isoindole-1,3(2H)-dione;
3-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-amine;
3-({3'-[3-methyl-8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)propan-1-
amine;
ethyl 4- {3'-[(3-aminopropyl)sulfonyl]biphenyl-3-yl} -8-(trifluoromethyl)quinoline-3-
carboxylate;
3-(4,5-dihydro-1H-imidazol-2-yl)-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
benzyl 4-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)thio]piperidine-1-
carboxylate;
benzyl 4-[(3- {3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]piperidine-1-carboxylate;
4-{3-[3-(piperidin-4-ylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
benzyl 4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}thio)piperidine-1-
carboxylate;
benzyl 4-({3'-[8-(trifluoromethyl)quinolin-4-yl]biphenyl-3-yl}sulfonyl)pipcridinc-1-
carboxylate;
4-[3'-(piperidin-4-ylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
methyl 4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline-3-
carboxylate;
[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl] methanol;
4-[3-(3-{[3-(methylamino)propyl]sulfonyl}phenoxy)phenyl]-8-
(trifluoromethyl)quinoline-3-carboxamide;
N-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]
propyl}methanesulfonamide;
1-ethyl-3-{3-[(3-{3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]
propyl} urea;
N-{3-[(3-(3-[8-(trifluoromethyl)quinolin-4-yl]phenoxy}phenyl)sulfonyl]
propyl} acetamide;
2-({3-[(3- {3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]propyl}carbamoyl)benzoic acid;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline-3-
carboximidamide;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylic acid;
methyl 4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxylate;
4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline-8-carboxamide;
4-{3-[4-chloro-3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{4-[3-(methylsulfonyl)phenyl]pyridin-2-yl}-8-(trifluoTomethyl)quinoline;
3-methyl-4-{4-f3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
3-methyl-4-55-[3-(methylsulfony1)phenyl]-3-thienyl}-8-(trifluoromethyl)quinoline:
N-(4-methoxybenzyl)-N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-(4-methoxybenzyl)-N-methyl-4-{3-[3-methyl-8-(trifluoromethyt)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-methyl-3-{3-[3-methyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy} benzenesulfonamide;
N-methyl-4-{3-[3-metbyl-8-(trifluoromethyl)quinolin-4-
yl]phenoxy}benzenesulfonamide;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline;
3-isopropyl-4-{3-[3-(propylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-isopropyl-4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-
(trifluoromethyl)quinoline;
3-isopropyl-4-{3-[2-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
3-isopropyl-4-{3-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{3-[4-(ethylsulfonyl)phenoxy]phenyl}-3-isopropyl-8-(trifluoromethyl)quinoline;
8-methoxy-4-{3-[3-(methylsulfonyl)phenoxy]phenyl}quinoline;
4- {3-[3-(ethylsulfonyl)phenoxy]phenyl} -8-mcthoxyquinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phcnyl}-8-methoxyquinoline;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-8-methylquinoline;
4- {3-[3-(isopropylsulfonyl)phenoxy]phenyl} -8-methylquinoline;
4-{3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methylquinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methylquinoline;
3-( {3-[3-(8-methylquinolin-4-yl)phenoxy]phenyl} sulfonyl)propan-1-ol;
4-{3-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methylquinoline;
4-{4-[3-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4-{4-[2-(methylsultbnyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4-{4-[4-(methylsulfonyl)phenyl]-2-thienyl}-8-(trifluoromethyl)quinoline;
4-{5-[3-(methylsulfonyl)phenyl]-3-thienyl}-8-(trifluoromethyl)quinoline;
({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl} amino )acetonitrile;
2-methoxy-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinolin-3-yl]methyl}ethanamine;
N- {[4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinolin-3-
yl]methyl}propan-2-amine;
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl}prop-2-en-1-amine;
1-cyclopropyl-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-
(trifluoromethyl)quinolin-3-yl]methyl}methanamine;
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl}ethanamine;
N-methyl-1-[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-
3-yl]methanamine;
3-({[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl} amino)propanenitrile;
2-fluoro-N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-
3-yl]methyl}ethanamine;
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl}propan-1-amine;
N-{[4-{3-[3-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinolin-3-
yl]methyl}cyclopentanamine;
2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carbonitrile;
2-amino-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline-3-
carboxylic acid;
4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinolin-2-amine;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(cthylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-methoxyquinoline;
4- {2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -8-methoxyquinoline;
4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-methoxyquinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluorophenyl}-8-methoxyquinoline;
4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-methoxyquinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{2-chloro-5-[3-(isopropylsutfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(methylsufonyl)quinoline;
4-{2-chloro-5-[3-(cthylsulfonyl)-5-fluorophenoxy]phenyl}-8-
(methylsufonyl)quinoline;
4- {2-chloro-5-[3-chloro-5-(methylsulfonyl)phenoxy]phenyl} -8-
(methylsufonyl)quinoline;
4-{5-[3-chloro-5-(methylsulfonyl)phenoxy]2-fluorophenyl}-8-
(methylsufonyl)quinoline;
4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-8-
(methylsufonyl)quinoline;
4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluorophenyl}-8-
(methylsufonyl)quinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenoxy]-2-fluoropheny-8-(methylsufonyl)quinoline;
4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-8-(methylsufonyl)quinoline;
2-methyl-4- {3-[3-(methylsulfonyl)phenoxy]phenyl} -8-(trifluoromethyl)quinoline;
4-{3-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-(trifluoromethyl)quinoline;
4-{3-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-(trifluoromethyl)quinoline;
4- {3-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -2-methyl-8-
(trifluoromethyl)quinoline;
4-{3-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)phenoxy]2-fluoro-phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4- {2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl} -2-methyl-8-
(trifluoromethyl)quinoline;
4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]2-fluoro-phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-chloro-5-[3-(cthylsulfonyl)-5-fluorophenoxy]phenyl}-2-methyl-8-
(trifluoromethyl)quinoline;
4-{2-methyl-5-[4-(methylsulfonyl)phenoxy]phenyl}-8-(trifluoromethyl)quinoline;
4-{5-[4-(cthylsultbnyl)phenoxy]2-methylphen.yl}-8-(trifluoromethyl)quinoline;
4-{5-[4-(isopropylsulfonyl)phenoxy]2-methylphenyl}-8-(trifluorotnethyl)quinoline;
[(4-{4-methyl-3-[8-(trifluoromethyl)quinolin-4-
yl]phenoxy}phenyl)sulfonyl]acetonitrile;
8-chloro-4-{2-chloro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-chloro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-chloro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-
methylquinoline;
8-chloro-4-{2-chloro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-
methylquinoline;
8-chloro-4-{2-fluoro-5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-fluoro-5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{2-fluoro-5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-
methylquinoline;
8-chloro-4-{2-fluoro-5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-
methylquinoline;
8-chloro-4-{5-[3-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{5-[3-(ethylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{5-[3-(isopropylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{5-[3-fluoro-5-(methylsulfonyl)phenoxy]phenyl}-2-methylquinoline;
8-chloro-4-{5-[3-(ethylsulfonyl)-5-fluorophenoxy]phenyl}-2-methylquinoline;
2-methyl-4-(3-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-(trifluoromethyl)quinoline;
4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8-
(trifluoromethyl)quinoline;
4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methyl-8-
(trifluoromethyl)quinoline;
4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-methoxyquinoline;
4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-mcthoxyquinoline;
4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-8-
(methanesulfonyl)quinoline;
4-(2-chloro-5-{[3-(methylsulfonyl)bcnzyl]oxy}phenyl)-8-
(methanesulfonyl)quinoline;
8-chloro-4-(2-fluoro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methylquinoline;
8-chloro-4-(2-chloro-5-{[3-(methylsulfonyl)benzyl]oxy}phenyl)-2-methylquinoline;
2-methyl-4-[3'-(methylsulfonyl)biphenyl-3-yl]-8-(trifluoromethyl)quinoline;
4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-2-methyl-8-(trifluoromethyl)quinoline;
4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-y1]-2-methy1-8-(trifluoromethyl)quinoline;
4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline;
4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-methoxyquinoline;
4-[4-chloro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline;
4-[4-fluoro-3'-(methylsulfonyl)biphenyl-5-yl]-8-(methanesulfonyl)quinoline;
8-methoxy-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline; and
8-(methanesulfonyl)-4-[3'-(methylsulfonyl)biphenyl-3-yl]quinoline.
45. A pharmaceutical composition comprising a compound of any one of claims
1 to 44, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable
carrier.
46. A method of preventing or treating a Liver X receptor-mediated disease or
disorder, the method comprising administering to a subject in need of such treatment an
effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically
acceptable salt thereof.
47. A method of preventing or treating a cardiovascular disease, the method
comprising administering to a subject in need of such treatment an effective amount of a
compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
48. The method of claim 47, wherein the cardiovascular disease is acute coronary
syndrome or restenosis.
49. A method of preventing or treating Alzheimer's disease or dementia, the
method comprising administering to a subject in need of such treatment an effective amount
of a compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
50. A method of preventing or treating type I or type II diabetes, the method
comprising administering to a subject in need of such treatment an effective amount of a
compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
51. A method of preventing or treating atherosclerosis and or atherosclerotic
lesions, the method comprising administering to a subject in need of such treatment an
effective amount of a compound of any one of claims 1 to 44 or a pharmaceutically
acceptable salt thereof.
52. A method of preventing or treating Syndrome X, the method comprising
administering to a subject in need of such treatment an effective amount of a compound of
any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
53. A method of preventing or treating obesity, the method comprising
administering to a subject in need of such treatment an effective amount of a compound of
any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
54. A method of preventing or treating one or more lipid disorders selected from
the group consisting of dyslipidemia, hyperlipidemia, hypertriglyceridemia,
hypercholesterolemia, low HDL and high LDL, the method comprising administering to a
subject in need of such treatment an effective amount of a compound of any one of claims 1
to 44 or a pharmaceutically acceptable salt thereof.
55. A method of preventing or treating an inflammatory disease, the method
comprising administering to a subject in need of such treatment an effective amount of a
compound of any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
56. The method of claim 55, wherein the inflammatory disease is multiple
sclerosis, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, endometriosis,
LPS-induced sepsis, acute contact dermatitis of the ear, or chronic atherosclerotic
inflammation of the artery wall.
57. The method of claim 55, wherein the inflammatory disease is rheumatoid
arthritis.
58. A method of preventing or treating celiac, the method comprising
administering to a subject in need of such treatment an effective amount of a compound of
any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
59. A method of preventing or treating thyroiditis, the method comprising
administering to a subject in need of such treatment an effective amount of a compound of
any one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
60. A method of treating a connective tissue disease, the method comprising
administering to a mammal in need thereof an effective amount of a compound of any one of
claims 1 to 44 or a pharmaceutically acceptable salt thereof.
61. The method of claim 60, wherein the compound inhibits cartilage degradation
and induces cartilage regeneration.
62. The method of claim 60, wherein the compound inhibits aggrecanase activity.
63. The method of claim 60, wherein the compound inhibits elaboration of pro-
inflammatory cytokines in osteoarthritic lesions.
64. The method of claim 60, wherein the connective tissue disease is
osteoarthritis or tendonitis.
65. The method of claim 60, wherein the mammal is a human.
66. A method of treating skin aging, the method comprising administering to a
mammal in need thereof an effective amount of a compound of any one of claims 1 to 44 or a
pharmaceutically acceptable salt thereof.
67. The method of claim 66, wherein the mammal is a human.
68. The method of claim 66, wherein the compound is topically administered.
69. The method of claim 66, wherein the skin aging is derived from
chronological aging, photoaging, steroid-induced skin thinning, or a combination thereof.
70. A method of increasing serum HDL cholesterol levels in a subject, the
method comprising administering to the subject an effective amount of a compound of any
one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
71. A method of decreasing serum LDL cholesterol levels in a subject, the
method comprising administering to the subject an effective amount of a compound of any
one of claims 1 to 44 or a pharmaceutically acceptable salt thereof.
72. A method of increasing reverse cholesterol transport in a subject, the method
comprising administering to the subject an effective amount of a compound of any one of
claims 1 to 44 or a pharmaceutically acceptable salt thereof.
73. A method of decreasing cholesterol absorption in a subject, the method
comprising administering to the subject an effective amount of a compound of any one of
claims 1 to 44 or a pharmaceutically acceptable salt thereof.
This invention relates generally to quinoline-based modulators of Liver X receptors (LXRs) and related methods.
| # | Name | Date |
|---|---|---|
| 1 | 1460-kolnp-2009-specification.pdf | 2011-10-07 |
| 2 | 1460-kolnp-2009-pct request form.pdf | 2011-10-07 |
| 3 | 1460-kolnp-2009-pct priority document notification.pdf | 2011-10-07 |
| 4 | 1460-kolnp-2009-international publication.pdf | 2011-10-07 |
| 5 | 1460-kolnp-2009-gpa.pdf | 2011-10-07 |
| 6 | 1460-kolnp-2009-form 5.pdf | 2011-10-07 |
| 7 | 1460-kolnp-2009-form 3.pdf | 2011-10-07 |
| 8 | 1460-KOLNP-2009-FORM 3.1.pdf | 2011-10-07 |
| 9 | 1460-KOLNP-2009-FORM 18.pdf | 2011-10-07 |
| 10 | 1460-kolnp-2009-form 1.pdf | 2011-10-07 |
| 11 | 1460-kolnp-2009-description (complete).pdf | 2011-10-07 |
| 12 | 1460-kolnp-2009-correspondence.pdf | 2011-10-07 |
| 13 | 1460-kolnp-2009-CORRESPONDENCE-1.1.pdf | 2011-10-07 |
| 14 | 1460-kolnp-2009-claims.pdf | 2011-10-07 |
| 15 | 1460-kolnp-2009-ASSIGNMENT.pdf | 2011-10-07 |
| 16 | 1460-kolnp-2009-abstract.pdf | 2011-10-07 |
| 17 | 1460-KOLNP-2009_EXAMREPORT.pdf | 2016-06-30 |
| 18 | 1460-KOLNP-2009-FIRST EXAMINATION REPORT-1-1.pdf | 2018-12-26 |