Sign In to Follow Application
View All Documents & Correspondence

Recombinant Escherichia Coli For The Preparation Of D Amino Acids

Recombinant microorganism for the preparation of D-aminoacids starting from N-carbamoylamino acids or 5-monosubstitutedhydantoins in which the gene which codes for a D-amino acidoxidase and/or the gene which codes for a D-serine dehydratase isinactivated by mutagenesis and has a cloned gene for ahydantoinase, a cloned gene for a D-carboamoylase and either acloned gene for a hydantoin racemase or a cloned gene for acarbamoyl amino acid racemase.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
04 May 2005
Publication Number
23/2006
Publication Type
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2010-01-28
Renewal Date

Applicants

DEGUSSA AG
BENNIGSENPLATZ 1, DE-40474 DUSSELDORF

Inventors

1. MAY, DR. OLIVER
AM REBENBORN 17A, 60388 FRANKFURT
2. BUCHHOLZ, DR. STEFAN
AM WIESENGRUND 1, 63456 HANAU
3. SCHWARM, DR. MICHAEL
MESSMERSTRASSE 23A, 63755 ALZENAU
4. DRAUZ, PROF. KARLHEINZ
ZUR MARIENRUHE 13, 63579 FREIGERICHT
5. TURNER, PH. D. ROBERT J
2282 DAYBREAK, AURORA, IL 60504
6. FOTHERINGHAM, DR. IAN
19 RAVELRIG GAIT, BALERNO, EDINBURGH, LOTHIAN EH14 7NH

Claims

1. Recombinant microorganism for the preparation of D-amino acids starting from N-carbamoylamino acids or 5-monosubstituted hydantoins in which the gene which codes for a D-amino acid oxidase and/on the gene which codes for a D-serine dehydratase) is inactivated by mutagenesis and has a cloned gene for a hydantoinase, a cloned gene for a D-carboamoylase and either a cloned gene for a hydantoin racemase or a cloned gene for a carbamoyl amino acid racemase.

2. Recombinant microorganism as claimed in claim 1 wherein it is an organism of the genum Escherichia coli.

3. Recombinant microorganism as claimed in claim 1 and/or 2, wherein this has a Decarbamoylase gene from Agrobacterium sp., Arthrobacter sp . or Bacillus sp.

4. Recombinant Escherichia coli DSM 15181 and mutants derived therefrom.

5. Recombinant Escherichia coli DSM 15182 and mutants derived therefrom.

6. Process for the preparation of D-amino acids with a recombinant microorganism as claimed in claims 1-5.

7. Process as claimed in claim 6 wherein D-aminobutyric acid, D-serine, D-methionine, D-tryptophan and D-phenylalanine are prepared. Recombinant microorganism for the preparation of D-amino acids starting from N-carbamoylamino acids or 5-monosubstituted hydantoins in which the gene which codes for a D-amino acid oxidase and/or the gene which codes for a D-serine dehydratase is inactivated by mutagenesis and has a cloned gene for a hydantoinase, a cloned gene for a D-carboamoylase and either a cloned gene for a hydantoin racemase or a cloned gene for a carbamoyl amino acid racemase.

Specification

Mutants for the preparation of D-amino acids
The present invention relates to a process for the
preparation of D-amino acids. In particular, these are
obtained enzymatically via the so-called hydantoinase
route using recombinant microorganisms. The present
invention likewise relates to microorganisms modified in
this way.
D-Amino acids are compounds which are often employed in
organic synthesis as intermediates for the preparation of
pharmaceutical active compounds.
Enzymatic hydrolysis of 5-substituted hydantoins to give
N-carbamoyl-amino acids and further reaction thereof to
give the corresponding enantiomerically enriched amino
acids is a standard method in organic chemistry ("Enzyme
Catalysis in Organic Synthesis", eds.: Drauz, Waldmann,
VCH, 1st and 2nd ed.). The enantiodifferentiation can take
place here either at the stage of hydantoin hydrolysis by
hydantoinases, or optionally during cleavage of N-
carbamoylamino acids by means of enantioselective
carbamoylases. Since the enzymes in each case convert only
one optical antipode of the corresponding compound,
attempts are made to racemize the other in the mixture (in
situ) in order to ensure complete conversion of the
racemic hydantoin, which is easy to prepare, into the
corresponding enantiomerically enriched amino acid. The
racemization can take place here either at the stage of
the hydantoins by means of chemical (base, acid, elevated
temp.) or enzymatic processes, or can proceed at the stage
of the N-carbamoylamino acids by means of e.g. acetylamino
acid racemases (DE10050124). The latter variant of course
functions successfully only if enantioselective
carbamoylases are employed. The following equation
illustrates this state of affairs.
It has been found that the use of recombinant
microorganisms which have hydantoinase, carbamoylase and
racemase activities for the preparation of various D-amino
acids presents problems. Fig. 1 shows the conversion of
hydroxymethylhydantoin and ethylhydantoin with E.coli
JM109 transformed with a D-carbamoylase and D-hydantoinase
from Arthrobacter crystallopoietes DSM 20117 (in
accordance with the patent application DE10114999.9 and
DE10130169.3). The reaction conditions are chosen
according to example 1.
As fig. 1 shows by way of example, in the conversion of
various 5-monosubstituted hydantoins, marked breakdown of
the D-amino acids formed takes place. This reduces the
yield which can be achieved and makes working up of the
product difficult.
The expert knows that various enzymes, such as D-amino
acid oxidases [EC 1.4.3.3], D-amino acid dehydrogenases
[EC 1.4.99.1], D-amino acid aminotransferases [EC
2.6.1.21], D-amino acid N-acetyltransferases [EC
2.3.1.36], D-hydroxyamino acid dehydratases [EC 4.2.1.14]
and D-amino acid racemases [EC 5.1.1.10] can participate
in the breakdown of D-amino acids. Various methods for
inactivating these genes in a targeted or also non-
targeted manner are also known to--the expert [The pKNOCK
series of broad-host-range mobilizable suicide vectors for
gene knockout and targeted DNA insertion into the
chromosome of Gram-negative bacteria. Alexeyev, Mikhail F.
BioTechniques (1999), 26(5), 824-828; One-step
inactivation of chromosomal genes in Escherichia coli K-12
using PCR products, Datsenko, Kirill A. and Wanner, Barry
L. PNAS (2000), 97(12), 6640-6645; D-amino acid
dehydrogenase of Escherichia coli K12: positive selection
of mutants defective in enzyme activity and localization
of the structural gene, Wild, Jadwiga and Klopotowski, T.
Mol.Gen.Genet. (1981), 181(3), 373-378.].
Unfortunately, however, the effect to be expected on cell
growth when the various enzymes are inactivated is unknown
and unforeseeable. What enzyme or whether a combination of
various enzymes has to be inactivated in order to reduce
the breakdown of a particular D-amino acid to the desired
extent also cannot be predicted.
The object of the present invention was therefore to
provide a microorganism which is capable of production of
D-amino acids via the carbamoylase/hydantoinase route and
helps to render possible a higher yield of D-amino acid
produced. It should be possible to employ this
advantageously on an industrial scale under economic and
ecological aspects. In particular, it should have very
good growth properties under the usual economically
appropriate conditions, and a sufficient genetic and
physical stability and a sufficiently fast rate of
conversion for hydantoins.
This object is achieved according to the claims. Claims 1
to 5 relate to particular microorganisms modified in this
way, while claims 6 and 7 protect a process for the
preparation of D-amino acids.
By providing a recombinant microorganism for the
preparation of D-amino acids starting from N-
carbamoylamino acids or 5-monosubstituted hydantoins in
which the gene which codes for a D-amino acid oxidase
and/or the gene which codes for a D-serine dehydratase is
inactivated by mutagenesis, the objects mentioned are
surprisingly and nevertheless advantageously achieved. In
particular, it is to be considered surprising that
microorganisms with the gene profile according to the
invention which have been produced by a recombinant method
are in fact stable and are capable of producing D-amino
acids to an extent sufficient for industrial orders of
size.
Microorganisms for recombinant embodiments which can be
used are in principle all the organisms possible to the
expert for this purpose, such as fungi, e.g. Aspergillus
sp., Streptomyces sp. , Hansenula polymorpha, Pichia
pastoris and Saccharomyces cerevisiae, or also
prokaryotes, such as E. coli and Bacillus sp.
Microorganisms of the genus Escherichia coli can be
regarded a~s preferred microorganisms according to the
invention. The following are very particularly preferred:
E. coli XL1 Blue, NM 522, JM101, JM109, JM105, BL21,
W3110, RR1, DH5a, TOP 10" or HB101. Organisms modified in
this way can be produced by methods familiar to the
expert. This serves to multiply and produce a sufficient
amount of the recombinant enzymes. The processes for this
are well-known to the expert (Sambrook, J.; Fritsch, E. F.
and Maniatis, T. (1989), Molecular cloning: a laboratory
manual, 2nd ed., Cold Spring Harbor Laboratory Press, New
York)
The said nucleic acid sequences} are thus cloned into a
host organism with plasmids or vectors by known methods
and the polypeptides expressed in this way can be detected
with suitable screening methods. All the possible
detection reactions for the molecules formed are in
principle suitable for the detection. In particular,
detection reactions which are suitable in principle are
all the possible detection reactions for ammonia and
ammonium ions, such as Nessler reagent (Vogel, A., I.,
(1989) Vogel's textbook of quantitative chemical analysis,
John Wiley & Sons, Inc., 5th ed., 679-698, New York), the
indophenol reaction, also called Berthelot's reaction
(Wagner, R., (1969) Neue Aspekte zur Stickstoffanalytik in
der Wasserchemie, Vom Wasser, VCH-Verlag, vol. 36,
263-318, Weinheim), in particular enzymatic determination
by means of glutamate dehydrogenase (Bergmeyer, H.,U., and
Beutler, H.-O. (1985) Ammonia, in: Methods of Enzymatic
Analysis, VCH-Verlag, 3rd edition, vol. 8: 454-461,
Weinheim) and also detection with ammonium-sensitive
electrodes. HPLC methods are furthermore used for
detection of amino acids, such as e.g. a derivative method
based on o-pthaldialdehyde and N-isobutyryl-cysteine for
enantiomer separation of amino acids (Bruckner, H.,
Wittner R., and Godel H., (1991), Fully automated high-
performance liquid chromatographic separation of DL-amino
acids derivatized with o-Phthaldialdehyde together with N-
isopropyl-cysteine. Application to food samples, Anal.
Biochem. 144, 204-206).
Possible plasmids or vectors are in principle all the
embodiments available to the expert for this purpose. Such
plasmids and vectors can be found e.g. in Studier and
colleagues (Studier, W. F.; Rosenberg A. H.; Dunn J. J.;
Dubendroff J. W.; (1990), Use of the T7 RNA polymerase to
direct expression of cloned genes, Methods Enzymol. 185,
61-89) or the brochures of Novagen, Promega, New England
Biolabs, Clontech or Gibco BRL. Further preferred plasmids
and vectors can be found in: Glover, D. M. (1985), DNA
cloning: A Practical Approach, vol. I-III, IRL Press Ltd.,
Oxford; Rodriguez, R.L. and Denhardt, D. T (eds) (1988),
Vectors: a survey of molecular cloning vectors and their
uses, 179-204, Butterworth, Stoneham; Goeddel, D. V.
(1990), Systems for heterologous gene expression, Methods
Enzymol. 185, 3-7; Sambrook, J.; Fritsch, E. F. and
Maniatis, T. (1989), Molecular cloning: a laboratory
manual, 2nd ed., Cold Spring Harbor Laboratory Press, New
York.
Particularly preferred cloning vectors of D-carbamoylases
in E.coli are, for example, derivatives of pBR322,
pACYC184, pUC18 or pSClOl, which can carry constitutive
and also inducible promoters for expression control.
Particularly preferred promoters are lac, tac, trp, trc,
T3, T5, T7, rhaBAD, araBAD, ?pL and phoA promoters, which
are sufficiently known to the expert [Strategies for
achieving high-level expression of genes in Escherichia
coli, Makrides S.C. Microbiol.Rev. 60(3), 512-538].
The inactivation of the D-amino acid oxidase (dadA) or D-
serine dehydratase (dsdA) of these organisms is carried
out here by methods described above, which are known to
the expert. For production of the recombinant embodiments
of the D-serine dehydratase- or D-amino acid oxidase-
deficient strains with D-carbamoylase activity, the
fundamental molecular biology methods are thus known to
the expert (Sambrook, J.; Fritsch, E. F. and Maniatis, T.
(1989), Molecular cloning: a laboratory manual, 2nd ed.,
Cold Spring Harbor Laboratory Press, New York). Gene
sequences of various D-carbamoylases e.g. from
Agrobacterium sp., Arthrobacter sp. or Bacillus sp. and
Ralstonia pickettii, which are preferably used, are
likewise known (inter alia from US 5858759, US 5807710, US
6083752, US 6083752, US 6083752, US 6083752, US 6083752).
The same methods can be used for the production of
organisms which additionally contain a hydantoinase and
optionally a hydantoin or carbamoyl racemase. Preferred
hydantoinases which are to be employed here are those from
Thermus sp., Bacillus sp., Mycobacterium sp.,
Corynebacterium sp., Agrobacterium sp., E.coli,
Burkholderia sp., Pseudomonas sp., or Arthrobacter sp.
Hydantoin racemase can preferably be used from Pseudomonas
sp., Arthrobacter sp., or Agrobacterium sp., optionally
with the addition of auxiliary substances, such as metal
ions, for example Mn2+ ions.
It was thus possible to produce the successful mutants
Escherichia coli DSM 15181 and Escherichia coli DSM 15182.
These therefore form, together with the further mutants
which can be derived from them, the next subject matter of
the present invention.
In the process which is likewise according to the
invention, e.g. a hydantoin is converted with the said
cells or cell constituents in a suitable solvent, such as,
for example, water, to which further water-soluble or
water-insoluble organic solvents can be added, at pH
values of between 6.0 and 11, preferably between 7 and 10,
and a temperature of between 10 °C and 100 °C, preferably
between 30 °C and 70 °C, particularly preferably between
37 °C and 60 °C. The enzymes in question can also be used
in the free form for the use. The enzymes can furthermore
also be employed as a constituent of an intact guest
organism or in combination with the broken-down cell mass
of the host organism, which has been purified to any
desired extent.
It is also possible to use the recombinant cells in
flocculated, cross-linked or immobilized form, for example
using agar, agarose, carrageenan, alginates, pectins,
chitosan, polyacrylamides and other synthetic carriers
(Chemical aspects of immobilized systems in
biotechnologies. Navratil, Marian; Sturdik, Ernest.
Chemicke Listy (2000), 94(6), 380-388; Industrial
applications of immobilized biocatalysts and biomaterials.
Chibata, Ichiro. Advances in Molecular and Cell Biology
(1996), 15A(Biochemical Technology), 151-160;
Immobilization of genetically engineered cells: a new
strategy for higher stability. Kumar, P. K. R.; Schuegerl,
K. Journal of Biotechnology (1990), 14(3-4), 255-72.).
A process for the preparation of D-amino acids with a
microorganism according to the invention accordingly forms
the next subject matter of the invention. D-Aminobutyric
acid, D-serine, D-methionine, D-tryptophan and D-
phenylalanine are preferably prepared.
Organisms with D-carbamoylase-active and hydantoinasp-
active and dadA-inactivated and/or dsdA-inactivated cells
are preferably used in this process for the preparation of
D-amino acids. It should be mentioned here that both L-,
D- or DL-carbamoylamino acids and 5-monosubstituted
hydantoins, which can be converted into the corresponding
carbamoylamino acids via sufficiently known hydantoinases,
are possible as the educt ("Enzyme Catalysis in Organic
Synthesis", eds. : Drauz, Waldmann, VCH, 1st and 2nd ed. ) .
The dadA- and/or dsdA-deficient strains used can co-
express here the carbamoylase and hydantoinase, optionally
also a hydantoin racemase or carbamoylamino acid racemase,
and can be employed either in the free or in the
immobilized form (see above).
As has now been found, the inactivation of various enzymes
is necessary in order to reduce the breakdown to a
sufficient extent (< 10% breakdown within > 10 hours) for
of the accompanying drawings.
various D-amino acids (see fig. 2. For the breakdown of
D-serine it has been found, surprisingly, that the
inactivation of the gene of the D-amino acid oxidase
(dadA) is not sufficient to reduce breakdown thereof
effectively. For an effective reduction in the breakdown
of this amino acid, D-serine hydratase had to be
additionally inactivated. In contrast to this, it had been
reported in the literature that a breakdown of D-serine
reduced > 3-fold is achieved by an inactivation of dadA
[D-Amino acid dehydrogenase of Escherichia coli K12:
positive selection of mutants defective in enzyme activity
and localization of the structural gene. Wild, J.;
Klopotowski, T. Mol. Gen. Genet. (1981), 181(3), 373-378].
Likewise in contrast to the results described there, it
has been found, surprisingly, that D-serine is broken down
very much faster than, for example, D-methionine.
In contrast to D-serine, the breakdown of aromatic and
aliphatic D-amino acids, such as, for example, D-
phenylalanine, D-methionine or D-aminobutyric acid, is
achieved sufficiently by an inactivation of the D-amino
acid oxidase. However, for D-phenylalanine, surprisingly,
both deletions (AdsdA & AdadA)_ show a positive effect,
while for D-methionine the deletion in dsdA shows no
additional effect. These results are summarized in fig. 2
(Breakdown of various amino acids with various mutants of
E.coli BW25113. E.coli ET3 has a deletion of the D-amino
acid oxidase (AdadA); E.coli ET4 additionally has a
deletion of D-serine dehydratase (AdsdA). For the reaction
conditions see example 3).
The literature references cited in this specification are
regarded as also included in the disclosure.
The organisms DSM15181 (ET3) and DSM15182 (ET4) were
deposited by Degussa AG on 04.09.2002 at the Deutsche
Sammlung for Mikroorganismen und Zellkulturen [German
Collection of Microorqanisms and Cell Cultures]
mascheroder Weg lb, D-38124 Braunschweig.
Examples
Example 1: Production of D-amino acids by means of
recombinant E.coli cells
Chemically competent E.coli JM109 (Promega) were

transformed with pJAVI16 (see fig. 3. This plasmid
carries a D-carbamoylase and a D-hydantoinase from
Arthrobacter crystalloppietes DSM20117. The sequences of
the D-hydantoinase and D-carbamoylase are shown in Seq. 1
and 3 (see also DE10114999.9 and DE10130169.3).
The E.coli cells transformed with pJAVIER16 were placed
individually on LBamp plates (ampicillin concentration:
100 µg/ml) . 2.5 ml LBamp medium with 1 mM ZnCl2 were
inoculated with an individual colony and incubated for 30
hours at 37 °C and 250 rpm. This culture was diluted 1:50
in 100 ml LBamp medium with 1 mM ZnCl2 and 2 g/1 rhamnose
and incubated for 18 h at 30 °C. The culture was
centrifuged for 10 min at 10,000 g, the supernatant was
discarded and the biomass was weighed. Various hydantoin
derivatives, e.g. 100 mM DL-hydroxymethylhydantoin or DL-
ethylhydantoin, pH 7.5, were added to the biomass so that
a biomass concentration of 40 g moist biomass per litre
results. The reaction solution was incubated at 37 °C.
After various periods of time, samples were taken and
centrifuged and the amino acids formed were quantified by
means of HPLC.
Example 2: Production of DsdA- and DadA-deficient E.coli
strains
DadA was deleted in E.coli BW25113 (deposited at CGSC
under number CGSC7636) by the method described by Datsenko
& Wanner (One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products, Datsenko, Kirill
A. and Wanner, Barry L. PNAS (2000), 97(12),6640-6645).
The following primers were used for this for amplification
of the chloramphenicol resistance from pKD13 (deposited at
CGSC under number CGSC7 633):
5'_AACCAGTGCCGCGAATGCCGGGCAAATCTCCCCCGGATATGCTGCACCGTATTCCG
GGGATCCGTCGACC_3' : Seq. 5
5'_AGGGGTACCGGTAGGCGCGTGGCGCGGATAACCGTCGGCGATTCCGGGG
ATCCGTCGACC-3' : Seq. 6
A transformation of the amplified product in E.coli
BW25113 (pKD46) (deposited at CGSC under number CGSC7630)
and selection of kanamycin-resistant clones rendered
possible the isolation of E.coli ET2. After removal of the
chloramphenicol resistance in accordance with the protocol
of Datsenko & Wanner, it was possible to isolate the
strain E.coli ET3. For the deletion of dsdA in E.coli ET3,
the chloramphenicol resistance from pKD13 was in turn
amplified with the following primers:
5'_GCGGGCACATTCCTGCTGTCATTTATCATCTAAGCGCAAAGAGACGTACTGTGTAG
GCTGGAGCTGCTTC_3' : Seq. 7
5'_GCAGCATCGCTCACCCAGGGAAAGGATTGCGATGCTGCGTTGAAACGTTAATGGGA
ATTAGCCATGGTCC_3' : Seq. 8
Transformation of the amplified product in E.coli ET3
(pKD46) and selection of kanamycin-resistant clones
rendered possible the isolation of E.coli ET4r which
carries a deletion both in dadA and in dsdA.
Example 3 Investigation of the breakdown of D-amino acids
2.5 ml LB medium were inoculated with an individual colony
of E.coli BW25113, E.coli ET3 and E.coli ET4 and incubated
for 18 hours at 37 °C and 250 rpm. These cultures were
diluted 1:50 in 100 ml LB medium and incubated for 18 h at
37 °C. The cultures were centrifuged for 10 min at
10,000 g, the supernatant was discarded and the biomass
was weighed. Various 100 mM D-amino acid solutions, pH 7.5
(e.g. D-methionine, D-phenylalanine, D-aminobutyric acid,
D-serine) were added to the biomass so that a biomass
concentration of 100 g moist biomass per litre results.
These reaction solutions were incubated at 37 °C and
centrifuged after 10 hours. The clear supernatant was
analysed for the remaining amino acid concentration by
means of HPLC. The %breakdown stated was calculated from
the quotient of the starting concentration and the final
concentration after incubation for 10 hours.
WE CLAIM:
1. Recombinant microorganism for the preparation of D-amino
acids starting from N-carbamoylamino acids or 5-monosubstituted
hydantoins in which the gene which codes for a D-amino acid
oxidase and/on the gene which codes for a D-serine dehydratase) is

inactivated by mutagenesis and has a cloned gene for a
hydantoinase, a cloned gene for a D-carboamoylase and either a
cloned gene for a hydantoin racemase or a cloned gene for a
carbamoyl amino acid racemase.
2. Recombinant microorganism as claimed in claim 1 wherein it
is an organism of the genum Escherichia coli.
3. Recombinant microorganism as claimed in claim 1 and/or 2,
wherein this has a Decarbamoylase gene from Agrobacterium
sp., Arthrobacter sp . or Bacillus sp.
4. Recombinant Escherichia coli DSM 15181 and mutants derived
therefrom.
5. Recombinant Escherichia coli DSM 15182 and mutants
derived therefrom.
6. Process for the preparation of D-amino acids with a
recombinant microorganism as claimed in claims 1-5.

7. Process as claimed in claim 6 wherein D-aminobutyric
acid, D-serine, D-methionine, D-tryptophan and D-phenylalanine
are prepared.

Recombinant microorganism for the preparation of D-amino
acids starting from N-carbamoylamino acids or 5-monosubstituted
hydantoins in which the gene which codes for a D-amino acid
oxidase and/or the gene which codes for a D-serine dehydratase is
inactivated by mutagenesis and has a cloned gene for a
hydantoinase, a cloned gene for a D-carboamoylase and either a
cloned gene for a hydantoin racemase or a cloned gene for a
carbamoyl amino acid racemase.

Documents

Application Documents

# Name Date
1 807-kolnp-2005-specification.pdf 2011-10-07
2 807-kolnp-2005-reply to examination report.pdf 2011-10-07
3 807-kolnp-2005-priority document.pdf 2011-10-07
4 807-KOLNP-2005-PA.pdf 2011-10-07
5 807-KOLNP-2005-PA 1.1.pdf 2011-10-07
6 807-kolnp-2005-granted-translated copy of priority document.pdf 2011-10-07
7 807-kolnp-2005-granted-specification.pdf 2011-10-07
8 807-kolnp-2005-granted-reply to examination report.pdf 2011-10-07
9 807-kolnp-2005-granted-gpa.pdf 2011-10-07
10 807-kolnp-2005-granted-form 5.pdf 2011-10-07
11 807-kolnp-2005-granted-form 3.pdf 2011-10-07
12 807-kolnp-2005-granted-form 2.pdf 2011-10-07
13 807-kolnp-2005-granted-form 18.pdf 2011-10-07
14 807-kolnp-2005-granted-form 1.pdf 2011-10-07
15 807-kolnp-2005-granted-examination report.pdf 2011-10-07
16 807-kolnp-2005-granted-drawings.pdf 2011-10-07
17 807-kolnp-2005-granted-description (complete).pdf 2011-10-07
18 807-kolnp-2005-granted-correspondence.pdf 2011-10-07
19 807-kolnp-2005-granted-claims.pdf 2011-10-07
20 807-kolnp-2005-granted-abstract.pdf 2011-10-07
21 807-kolnp-2005-gpa.pdf 2011-10-07
22 807-kolnp-2005-form 5.pdf 2011-10-07
23 807-kolnp-2005-form 3.pdf 2011-10-07
24 807-KOLNP-2005-FORM 27.pdf 2011-10-07
25 807-kolnp-2005-form 2.pdf 2011-10-07
26 807-kolnp-2005-form 18.pdf 2011-10-07
27 807-KOLNP-2005-FORM 13.pdf 2011-10-07
28 807-KOLNP-2005-FORM 13.1.2.pdf 2011-10-07
29 807-KOLNP-2005-FORM 13.1.1.pdf 2011-10-07
30 807-kolnp-2005-form 1.pdf 2011-10-07
31 807-kolnp-2005-examination report.pdf 2011-10-07
32 807-kolnp-2005-drawings.pdf 2011-10-07
33 807-kolnp-2005-description (complete).pdf 2011-10-07
34 807-kolnp-2005-correspondence.pdf 2011-10-07
35 807-KOLNP-2005-CORRESPONDENCE 1.3.pdf 2011-10-07
36 807-KOLNP-2005-CORRESPONDENCE 1.2.pdf 2011-10-07
37 807-KOLNP-2005-CORRESPONDENCE 1.1.pdf 2011-10-07
38 807-kolnp-2005-claims.pdf 2011-10-07
39 807-KOLNP-2005-CERTIFIED COPIES(OTHER COUNTRIES).pdf 2011-10-07
40 807-KOLNP-2005-ASSIGNMENT.pdf 2011-10-07
41 807-kolnp-2005-abstract.pdf 2011-10-07
42 807-KOLNP-2005-(13-10-2011)-OTHER PATENT DOCUMENTS.pdf 2011-10-13
43 807-KOLNP-2005-FORM-27.pdf 2013-04-11
44 807-KOLNP-2005-Form 27-030315.pdf 2015-04-01
45 807-KOLNP-2005-Correspondence-030315.pdf 2015-04-01
46 807-KOLNP-2005-(02-03-2016)-FORM-27.pdf 2016-03-02
47 Form 27 [17-03-2017(online)].pdf 2017-03-17
48 807-KOLNP-2005-RELEVANT DOCUMENTS [08-03-2018(online)].pdf 2018-03-08
49 807-KOLNP-2005-RELEVANT DOCUMENTS [19-03-2019(online)].pdf 2019-03-19
50 807-KOLNP-2005-PROOF OF ALTERATION [30-01-2020(online)].pdf 2020-01-30
51 807-KOLNP-2005-RELEVANT DOCUMENTS [20-03-2020(online)].pdf 2020-03-20
52 807-KOLNP-2005-FORM-26 [23-12-2020(online)].pdf 2020-12-23
53 807-KOLNP-2005-RELEVANT DOCUMENTS [28-09-2021(online)].pdf 2021-09-28
54 807-KOLNP-2005-RELEVANT DOCUMENTS [19-09-2022(online)].pdf 2022-09-19
55 807-KOLNP-2005-RELEVANT DOCUMENTS [30-09-2022(online)].pdf 2022-09-30
56 807-KOLNP-2005-03-01-2023-Relevant Document.pdf 2023-01-03
57 807-KOLNP-2005-24-02-2023-ALL DOCUMENTS.pdf 2023-02-24
58 807-KOLNP-2005-RELEVANT DOCUMENTS [26-09-2023(online)].pdf 2023-09-26

ERegister / Renewals

3rd: 20 Apr 2010

From 15/10/2005 - To 15/10/2006

4th: 20 Apr 2010

From 15/10/2006 - To 15/10/2007

5th: 20 Apr 2010

From 15/10/2007 - To 15/10/2008

6th: 20 Apr 2010

From 15/10/2008 - To 15/10/2009

7th: 20 Apr 2010

From 15/10/2009 - To 15/10/2010

8th: 20 Apr 2010

From 15/10/2010 - To 15/10/2011

9th: 28 Sep 2011

From 15/10/2011 - To 15/10/2012

10th: 27 Sep 2012

From 15/10/2012 - To 15/10/2013

11th: 27 Sep 2013

From 15/10/2013 - To 15/10/2014

12th: 13 Oct 2014

From 15/10/2014 - To 15/10/2015

13th: 14 Oct 2015

From 15/10/2015 - To 15/10/2016

14th: 14 Oct 2016

From 15/10/2016 - To 15/10/2017

15th: 13 Oct 2017

From 15/10/2017 - To 15/10/2018

16th: 13 Oct 2018

From 15/10/2018 - To 15/10/2019

17th: 10 Oct 2019

From 15/10/2019 - To 15/10/2020

18th: 09 Oct 2020

From 15/10/2020 - To 15/10/2021

19th: 06 Oct 2021

From 15/10/2021 - To 15/10/2022

20th: 28 Sep 2022

From 15/10/2022 - To 15/10/2023