Sign In to Follow Application
View All Documents & Correspondence

Recombinant Microorganism For Putrescine Production And Method For Producing Putrescine Using Same

Abstract: The present invention relates to a recombinant microorganism for producing putrescine at high yield in which the NCgl2522 activity is increased in a microorganism which has been modified in the manner such that putrescine production is possible and a method for producing putrescine using the microorganism.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
16 October 2015
Publication Number
28/2016
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
cal@patentindia.com
Parent Application

Applicants

CJ CHEILJEDANG CORPORATION
330 Dongho ro Jung gu Seoul 100 400

Inventors

1. LEE Kyoung Min
716ho 10 20 Yangcheon ro 57 gil Gangseo gu Seoul 157 807
2. JUNG Hee Kyoung
49 Jeungga ro 10 gil Seodaemun gu Seoul 120 806
3. YANG Young Lyeol
1910 101 99 Seongsin ro Deogyang gu Goyang si Gyeonggi do 412 719
4. UM Hye Won
122 101 36 Gwongwang ro 260beon gil Yeongtong gu Suwon si Gyeonggi do 443 710
5. KIM Chang Gyeom
521 604 567 Songpa daero Songpa gu Seoul 138 916
6. LI Hong Xian
B 608 34 Hwagok ro 66 gil Gangseo gu Seoul 157 840
7. PARK Su Jin
506ho 10 20 Yangcheon ro 57 gil Gangseo gu Seoul 157 807
8. YOON Jong Hyun
302 1506 53 Goyang daero 1384beon gil Deogyang gu Goyang si Gyeonggi do 412 710
9. LEE Baek Seok
3rd Floor 19 Ogeum ro 17 gil Songpa gu Seoul 138 829
10. LEE Sun Young
304 707 127 Dunsannam ro Seo gu Daejeon 302 771

Specification

This invention improved productivity with putrescine recombinant microorganisms and can be used as a high-yield putrescine will on how to produce.
[2]
Background technology
[3]
Jasper s. Dean (spermidine), Spurs (spermine) such as poly amines (polyamine) is for the most part exists within the living cells of materials, putrescine (putrescine/1, 4-butanediamine) is a county in the U.S. These spurs push Ambassador Dean and are used as a matter of the bulb spur. Pew trail God gram-negative bacteria or fungus is found in a wide variety of species because the concentration of microorganisms in metabolism will perform an important role in.
[4]
Generally, Pew trail God adipic acid (adipic acid) reacts with the amine to the poly-nylon-4,6 composite is an important raw materials, mainly propylene (propylene) acrylonitrile (acrylonitrile) and Lady Shino is of nitrile (succinonitrile) is produced by chemical synthesis. The Act chemical compound Catalytic oxidation reaction stage, cyanide (cyanide), use the steps and the compound high-pressure hydrogen hydrogenation step using a three-step process, including, but not limited to, lots of environmentally friendly energy consumption the depletion of oil resources that inherently pose an issue. Therefore, the Pew trail God for the production of more environmentally friendly and reduce energy consumption in a way take advantage of biomass are required.
[5]
Microbial biosynthesis path to writing in putrescine ruta mate (glutamate) come from Le NG Tin until arginine biosynthesis pathways (ornithine) is identical to the composite. The substance generated in the Middle o sur Tin di Le Fifi (decarboxylation) as putrescine synthesis, or arginine (L-arginine) through the AAG from Martin (agmatine) to synthesize putrescine is known for two paths (Morris et al J Biol Chem., 241:13, 3129-; 3111, 1996). There are two paths above to generate the energy needed for the metabolism or stress tolerance for acidity.
[6]
Use micro-organisms to produce the putrescine by Escherichia coli and Cory Te Park by Terry hated transgenic putrescine was the way to produce high concentrations (international patent disclosure WO06/005603; WO09/125924 international patent disclosure; Qian ZD et al., Biotechnol. Bioeng. 104:4, 651-662, 2009; Schneider et al., Appl. Microbiol. Biotechnol. 88:4, 859-868, 2010; Schneider et al., Appl. Microbiol. Biotechnol. 91:17-30, 2011). For example, W O 09/125924 in e. coli is present on the computer involved in the decomposition and utilization God in the path that light to activate, Pew trail with God's light bulb switch to chain up unto the path to pregnancy, Al fire, instead of, Oh, active sur Tin biosynthesis pathways by strengthening putrescine and yield to, is there a way to commence the manufacture. In addition, Schneider (2010), putrescine does not have four nights ethereum production Arts belonged to Corey on strain out with putrescine and protein that is converted into the active strengthening and putrescine concentrations produced by the way has been initiated.
[7]
Furthermore, putrescine transporter (transporter), studies on e. coli, yeast, plant, and animal cells are actively targeting is being performed (K Igarashi, Plant Physiol. Biochem. 48:506-512, 2010). E. coli putrescine performed by a total of four routes to the influx, ATP hydrolysis using potABCD or potFGHI, H + SIM Porter (symporter), potE and puu in the path is the influx into the cell by puuP. Putrescine is involved in the complex and their influx Km 0.5 mM, a value PotFGHI is, potABCD is 1.5 mM, 1.8 mM, and it is a potE puuP 3.7 mM exercise, there are four putrescine funnels of potFGHI complex is the most suitable is considered to be. In addition, potE trance Porter putrescine inflow emissions has all of the features, neutral pH, putrescine, this is the influx into cells with Proton. However, the pH is acidic condition changes, putrescine synthase, which was a manifestation, such as extracellular speF of pregnancy as the influx into the cell out at the same time, the synthesized within the cell putrescine is ejected as this extracellular (Kurihara et.al., J. Bacteriology 191:8, 6612-2782, 2009).
[8]
Yeast protein, putrescine emissions b. of transporter of drugs (multidrug transporter), Blt's amino acid sequence similarity with high P T O T O P 1 and 4 is known. The above two exhaust protein of e. coli potE has properties such as, basic conditions, putrescine, and spur the U.S. push into the cell influx Dean, Jasper, while the acid conditions, these cells have the ability to drain to the outside. In addition, golgi secretory vesicles are located on post-golgi or P T O 5, in the case of manifestations strengthened: 120 mM putrescine, whereas visible shortcomings: tolerance for 90 mM putrescine seems a sensitivity on (Biological Chemistry et al, J. Tachihara, 280. (13): 12637-12642, 2005).
[9]
The synthesis and decomposition of God by the Pew trail in the cells of animals, receives a variety of emissions control the influx. Poly amine emissions as much as e. coli or yeast about studies does not have colon epithelial cells (colon epithelial cell) from arginine/L C S daiamin exporters (exporter), 3 A 2 extracellular came over within the cells of the arginine putrescine, acetyl spur s. Dean, acetyl spur residents to drain into the extracellular function has been reported to. However, plant cells, yet putrescine inlet and exhaust have reported about (Igarashi et al., Plant Physiol. & Biochem. 48:506-512, 2010).
[10]
On the other hand, lies four nights ethereum microorganisms is Cory putrescine biosynthesis because it does not have the path to putrescine study on emissions is also nonexistent. But according to a recent report, poly amines of Hakata Ebeling (cadaberine) production Kyun cg2983 membrane protein strengthens the manifestations of cells in the State of growth as a result of the increased productivity in Baie-Lin have been reported (Kind et. al., Metabolic Engineering, 13:617-627, 2011).
[11]
However, so far no Pew trail God emissions related to the protein, putrescine production performing arts or performing arts production of putrescine, which has reported about a raw wall of micro-organisms, nor even in the above literature cg2983 membrane protein and putrescine exhaust is not being mentioned at all Association functions.
[12]
[13]
Against this backdrop, this inventive women putrescine could produce more and yield to strain in order to develop as a result of the research efforts of the example, the putrescine production Kyun owner Cory lies in your night C g l N microbial ethereum 2522 is a Pew trail God says that the exhaust function as protein C N g l compared to the active and strengthens the inherent 2522 you active putrescine can produce high yields was confirmed. In addition, putrescine N C e. coli containing the path to the production of g l the manifestations of culture fluid when my 2522 putrescine N C l g by checking that the increased amount of 2522 is e. coli also functioned as a protein, putrescine emissions check that this invention was complete.
[14]
A detailed description of the invention
Technical challenges
[15]
This is the purpose of one of invent NCgl2522 so that the intensifying variation is active, putrescine, and can produce recombinant microorganisms as the yield is to provide.
[16]
The purpose of this invention uses micro-organisms above other of putrescine gives way to produce high yields.
[17]
Challenges in the Sudan
[18]
To achieve the above objectives, Hamm, this invention is in the column number is listed as 21 or 23: amino acid sequence of the protein that contains the transformed so that the intensifying active, having micro-organisms to produce putrescine.
[19]
One concrete example of this invention is the above microorganisms in addition o le NG Tin Ka-le-BAS to gather Trenton spur la Ajay (ArgF) and engage in emissions or Rue mate protein (NCgl1221) strain to weaken compared to the inherent need to be active for being active, NG Tin di apparel Silas Ajay (ODC) was introduced, which is to be active, having micro-organisms to produce putrescine.
[20]
As an example, one of the other sphere, invention is the aforementioned o le NG Tin Ka-le-BAS Moyle Ajay (ArgF) Trenton spur la go being described as the column number: 29 contains the amino acid sequence, Ruta mate emissions involved in the protein (NCgl1221), this is indicated by the number of columns in the: 30 includes the amino acid sequence, NG Tin di went to my stomach Silla (ODC) is listed as the column number: 33, including the amino acid sequence, having micro-organisms to produce putrescine.
[21]
As an example, this invention is another one of the spheres above microorganisms in addition to acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt LAN spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), and acetyl-NG Tin amino transfer la Ajay (ArgD) compared to active this inherent variation so that strengthen the active, having micro-organisms to produce putrescine.
[22]
Another concrete example, this invention is a reminder that acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt LAN spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), and acetyl-NG Tin amino transfer la Ajay (ArgD) each sequence number: 25, 26, 27 and 28 are described as containing the amino acid sequence, having micro-organisms to produce putrescine.
[23]
Another concrete example, this invention is a reminder that microorganisms are an additional three tilt Len spur la active of weakened, having micro-organisms to produce putrescine.
[24]
Another concrete example, this invention is a reminder that Ah three tilt the column number in the Rennes spur la Ajay: 31 or 32 are listed as containing the amino acid sequence, having micro-organisms to produce putrescine.
[25]
Another concrete example, this invention is a reminder that amidst the microorganisms, or microbes esque Lycian Cory seems to be, a microorganism your brother putrescine having microorganisms to produce.
[26]
Another concrete example, this invention is a reminder that microbes Escherichia coli or Cory four nights will glue ethereum Tammy Combe, having micro-organisms to produce putrescine.
[27]
As seen above, the invention of other Hamm putrescine production to cultivate the culture of microorganisms with the water and microbial cultivation or culture above water from putrescine steps to recover a computer trail that includes God's production methods.
[28]
[29]
This, and this explains in detail an invention.
[30]
This invention is putrescine production having belonged to four nights in the NCgl2522 micro-organisms Cory ethereum inherent active active compared to enforce has been transformed and improved productivity of recombinant putrescine Corey provides four nights ethereum genus microorganisms.
[31]
This term is used in the invention "NCgl2522", Cory ethereum zag four nights Tammy T C A C the pity from Combe 13032 MFS (major facilitator superfamily) as a membrane protein that belongs to the Farr MIA means my (permease). C g l N 2522 above four nights ethereum zag corridor Tammy from die amino pen Tan (diaminopentane) is known to be venting to extracellular. This invention, N C g l 2522 generated within the cell to extracellular putrescine is responsible for discharging the trans Porter works to ensure that. This compared to NCgl2522 active on the basis of implicit active transformed cells to enhance my computer-generated in Tre God and yield by increasing emissions of recombinant microorganisms that indicates the productivity of putrescine.
[32]
This term is used in the invention "implied the active" Iran, is not the original microbes have in this variant of the enzyme is active, which means, "to strengthen the inherent variation means that the active compared to transform former State" enzyme activity when compared with such newly introduced or improved active.
[33]
This invention on "strengthening of the enzyme activity" means, the enzyme is active in and of itself, this newly introduced or increased more than getting the effect of original features to include, as well as an increasing number of inherent genetic active, internal or external factors inherent from gene amplification, suppression of gene expression control arguments paid off above, gene copy number increase, from the outside, gene is introduced, a variation of the column, especially in controlling the manifestations promoter replacement or variation and genetic mutations within the increase in enzyme activity by one of its active includes being increased.
[34]
This invention "implied the active compared to enforce transformation" that, with the introduction of active genes, indicating that a copy of the relevant genes can increase or above, adjust the arguments paid off or the Suppression of gene expression in the column adjusting variations have arisen, for example, the use of manipulation, such as improved promoters have take place prior to the micro-organisms consisting of a subsequent manipulation of microorganisms have the active compared to an increase in the active state.
[35]
This invention is active increases by N C g l 2522, specifically but not limited to, billing number: 21 or 23 amino acid sequence of a protein, or containing more than 70% of the heat from above and more than 80%, even more desirable, desirable is over 90%, 95% or more of the more desirable than the 98% or higher, it is further desirable, optimal is 99% homology amino acid sequence indicating the column can be a protein. In addition, depending on the species of microbes or bacteria protein amino acid sequence indicating the active above, there is a difference in the present case is not limited to, since. In other words, active, by reinforcing the putrescine could be helpful in increasing the productivity of protein, heat number: 21 or 23 amino acid sequence column can have more than one location or one single amino acid substitution of, add, insert, or fruits, including having the mutant proteins, amino acid sequence, or it can be an artificial Plasmodium. At this time, "dog", all of the amino acids of the protein three-dimensional structures depending on location or in the kind of reward but, specifically, 2 to 2 to 10 out of 20, desirable, even more desirable is 2 to 5. In addition, the substitution of these amino acids, fruits, such as an insert, add, or station on the above active polypeptide containing micro-organisms on the basis of the difference between objects or of species of naturally occurring mutants or artificial variation (variant) is caused by.
[36]
Cory lies in four nights, ethereum putrescine biosynthesis microbial path but come from outside out Tin di Le Bok Silas Ajay (ornithine decarboxylase, ODC) introduced the putrescine was this synthetic extracellular putrescine into this vent. This is a large number of microorganisms in the midst of a four-night Cory ethereum putrescine in the passage of the membrane protein in the presence of the protein, i.e. a working discharge will indicate that teuraenseupoteoga. This is seen in the invention lies in the four nights of microorganisms who Corey ethereum putrescine to sympathize with the wild-type protein discharge Cory Yes Park ethereum glue Tammy Combe A T C C 13032 chromosomes produced a library and putrescine production Kyun owner Cory ethereum zag four nights Tammy Combe KCCM11138P on traits and then putrescine strain to grow in at least containing the badge selector. 3 car Colonie Lottery putrescine having resistant clones (B19), the final selection, sequence analysis, and N C g l 2522, was confirmed (see Figure 1). As such, putrescine exhaust protein as Cory Yes Park ethereum glue Tammy C g l N 2522 ATCC13032 origins of Borkum is noted as being the column number: 21 contains amino acid sequence, amino acid sequence, and 98% homology with Cory ethereum glue your nights Tammy C g l N 2522 ATCC13869 origins of Combe is being described as the column number: 23 amino acid sequence.
[37]
This C g l N 2522 of the invention that is similar to the above NCgl2522 proteins and poly-nucleotides are active, the heat number: 21 or 23 amino acid sequence, or more than 70% of the heat from above and more than 80%, even more desirable, desirable is over 90%, 95% or more of the more desirable than the 98% or higher, it is further desirable, optimal is 99% homology to proteins, indicating that coding can include poly-nucleotides, optimal standing heat number: 20 or 22 of the sequence can contain.
[38]
Above, the term "homology" both represent the equivalence between the amino acid sequence, score (score), equality (identity), similarity (similarity) and parameters (parameter) are used to calculate BLAST 2.0, well known to the party promoter can be determined in a way.
[39]
In addition, this C g l N 2522 of the invention that is the column number in the poly-nucleotides: 20 or 22 of the sequence or the above sequence comes from the probe (probe) and strict criteria (stringent conditions) can be mixed in the shoes, g l a N C function normally coded variation that can mold, 2522. In Iran the term "strict conditions" above, Polly never unusual hybrid between nucleotide mad means a condition which makes it possible. For example, these rigorous conditions Bibliography (J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York) is specifically stated.
[40]
This invention "N C g l 2522 compared to enforce implicit active active of transformation", the above coding protein increase, above a copy of Polly nucleotide poly-nucleotides to control increasing manifestations of a variation in the column above, enzymes in the manifestation of the need to be active to enhance chromosome variation of heat from above on the poly-nucleotides, inhibition of gene expression control arguments above fruit, or a combination of these can be performed on the selected methods from.
[41]
Can a copy of the aforementioned increase in the poly-nucleotides, not limited to, specifically, makes it possible to work in a form that is associated with the vector or inserted into the host chromosome within a cell, and can be carried out by. Specifically, this invention of poly-nucleotides are coding the protein enables the associated work, independent of the host and can be replicated and feature vector is introduced within the cells can be done by the host, or make it possible to work with the aforementioned poly nucleotides linked above as the host cell chromosome within, poly-nucleotides, which can be inserted into a host cell being introduced within the above vector, the host cell's chromosome copy of my aforementioned poly nucleotides as a way to increase the number to be performed.
[42]
This terminology is used in the invention "vector" is a suitable host for the purpose of protein expression within an appropriate adjustment so that you can make it possible to work in the aforementioned purposes associated with the protein coding sequence of a poly-nucleotides containing DNA manufacturing means water. The columns in the above control can initiate transcription promoters, such as any for the operator to adjust the Warrior heat, combined with the appropriate parts of the mRNA coding for some in the heat, and to regulate the closing of warriors and heat. Vector is a suitable host cell into the host genome and transgenic, cloned or function independently, and can be integrated into its own genome.
[43]
This invention, which is used in the vector is replicable within the host cells is not specifically limited, known in the industry as per the random vector. Typical examples of the vector is used for natural or recombinant plasmid, of course, the State of the virus and phage. For example, a vector in the vector or course Mead pWE15, phage M13, MBL3, MBL4, t10, t11, APII ASHII IXII,,, Charon4A, and Charon21A, you can use a vector plasmid pBR in meter, pUC, pBluescriptII, pGEM, pTZ, pCL and pET series, etc.. This invention is available in vector is not specifically restricted the expression vector can be used. Desirable is a pDZ, pACYC177, pECCG117, and pUC19, pACYC184, pCL, pBR322, pMW118, pCC1BAC, vector etc. is available and, even more desirable, you can use the pDZ vector.
[44]
In addition, the bacterial chromosomes through my chromosome inserted within the purpose vector for protein-coding nucleotide poly mutated nucleotide can be replaced with poly. Above the insertion into the chromosomes of the poly-nucleotides is known in the industry as per any method, for example, can be done by homologous recombination. This invention can produce recombinant chromosome homology vector can be inserted within, so the above chromosome screening to determine whether to insert a marker (the marker selection) can contain any additional. Selective marker screening transgenic cells as vectors, that is, to determine whether the insertion of poly-nucleotides for the purpose intended, was drug-resistant, nutritional composition, cytotoxic immune or for manifestations of surface proteins, such as selectable phenotype markers are given can be used. Select my (selective agent) is a selective marker expression in environments that are processed cells represent only survival or some other expression traits, transgenic cells can qualify.
[45]
In this invention, the term "transgenic" target protein-coding vectors containing poly-nucleotides within the host cells and host cells by introducing the above within the poly-nucleotides are coding protein expression means to be able to do. Transgenic pulleys can be the host cells have arisen within the nucleotide as a host cell's chromosome, if inserted within the area, or whether the location, in addition to all of these chromosomes. In addition, the aforementioned poly nucleotide DNA and the target protein-coding RNA. As the host cells above poly nucleotides can be arisen with the introduction, in any form, there is no matter to be introduced. For example, the aforementioned poly-nucleotides, which includes all the necessary elements that have arisen by itself is a manifestation of genetic structure in the form of host-cell cassette (cassette expression) can be introduced in the. The above expression cassette is usually above makes it possible to work in poly-nucleotides associated with promoter (promoter), the Warriors terminated the signal, combined with some parts and translation termination signals are. The above expression cassette can be in the form of its own replication expression vector. Also, as mentioned above, in the form of a poly-nucleotides has been introduced in the cells of the host itself, as required by the host cells have arisen from heat and makes it possible to work could be connected.
[46]
Also, as mentioned above, the term "work makes it possible to connect" in a seems to Iran for the purpose of this invention are coding a protein poly-nucleotides to the initiation of transcription and parameters as columns and the columns in the above gene promoter functionally connected.
[47]
By then, Foley to increase the expression of this adjustment in the manifestations of the nucleotide heat strain is not limited to, particularly, to enhance the active column in the control that have arisen more nucleic acid sequences are totally or totally paid off, insert, VIVO as a column or a combination of these displacements induced by variation of the ground, or having a strong, moreover, active and replace it with the heat by nucleic acids can be carried out. Adjust the columns in the above expression, specifically but not limited to, promoter, operator billing, combined with some parts of the code are in line, and to regulate the closing of detoxification that includes heat.
[48]
On the top of the unit above poly nucleotides manifestations are the original promoter of the powerful can be disparate promoters connection instead of the above, an example of a strong promoter CJ7 promoter, promoter, promoter, promoter, groEL EF-Tu lysCP1 aceA or aceB promoter, and, even more desirable is Corey comes your night ethereum peuromoteoin lysCP1 makes it possible to work with the promoter or CJ7 promoters associated with poly-nucleotides are coding the above enzymes manifestations of rate can be improved. This lysCP1 promoter asparagus asparagus Tate Tate kinase and semi aldehyde di Heathrow a coding to poly-nucleotides part promoter of improved through promoter sequence substitution as a manifestation of the Tate Kinase Gene asparagus, increase or decrease the amount of wild-type enzyme activity per via contrast 5 times as much as it is a powerful promoter (WO 2009/096689). In addition, four nights in the corridor, ethereum CJ7 promoters give Ness is a powerful promoter sequence from ammonia with four nights of exploring areas of Corey Nestor and essays to ethereum ammonia Lycian and powerful promoters have arisen from having identified active promoters as Cory ethereum zag four nights at either high intensity Tammy Combe is a possible manifestation of promoters (Korea registered patent no. 10-620092 Lake and WO 2006/065095).
[49]
In addition, chromosome variation, specifically in poly-nucleotides on the column is not limited to, the above pulley to reinforced active column in the nucleotide nucleic acid sequences are totally or totally paid off, insert, VIVO substitution or a combination of these manifestations induced mutations on the heat control to have a strong, moreover, active or perform improved poly nucleotide sequence can be performed by replacing with.
[50]
This invention of desirable conduct Hamm, putrescine productivity improved Corey Yes lies, in order to provide microorganisms embedded ethereum putrescine N g l C concerning discharge 2522 coding sequence number: sequence of 20 or 22 with the poly nucleotide and copy number of genes by introducing within the chromosome, increase, and improve its own promoter NCgl2522 active as a promoter that represents the column numbers: 24, the future of the base column can displace CJ7 with promoters.
[51]
This term is used in the invention "putrescine production having microorganisms" or "to putrescine producing microorganisms," Iran does not have a production of God Almighty, the Pew trail driving fungus week Pew trail God means that the micro-organisms in the production thereof has been granted. Given the aforementioned putrescine production thereof, or micro-organisms to produce putrescine, specifically but not limited to, written by Ruta mate o le NG Tin writing to strengthen the path the biosynthesis from ruta mate acetyl article ruta mate (N-acetylglutamate) to switch to acetyl Cinta or Rue mate Ajay or acetyl-NG Tin climb into Tin-Nishi, Nishi-teen year old tilt LAN spur la Ajay (ArgJ), acetyl-acetyl or Rue mate glue Tamil force Pate (N-acetylglutamyl phosphate) to switch to writing the acetyl ruta mate kinase (ArgB), acetyl glutamate Tamil force fate to acetyl aldehyde (or Rue mate semi N-acetylglutaMate semialdehyde) to switch to acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl aldehyde, or Rue mate semi-acetyl o le NIE (N-acetylornithine) is converted into acetyl-NG Tin amino transfer la Ajay (ArgD) compared to active to increase the inherent active has been transformed by the Pew trail as a raw material used in the biosynthesis of God Oh out of productivity can be enhanced. Also, the above microorganisms is involved in the synthesis of arginine sur 5 sur Tin Ka-le-BAS to gather transfer la Ajay (carbamoyltransfrase, ArgF ornithine), Ruta mate's exhaust are involved in protein (NCgl1221), and/or putrescine to acetyl crystallized protein (NCgl469), an active inherent point mutation active in weakening and/or, NG Tin di Le Bok Silas Ajay (ornithine decarboxylase, ODC) can be transformed to an active introduced.
[52]
At this time, reminded of the acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt LAN spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), acetyl-NG Tin amino transfer la Ajay (ArgD), o le NG Tin Ka-le-BAS Moyle Ajay (ArgF), transfer to writing La Ruta mate's exhaust are involved in protein (NCgl1221) and o out Tin di Le Bok Silas Ajay (ODC), specifically but not limited to, the number of columns in the future respectively: 25, 26, 27, 28, 29, 30 and 33 are listed as more than 70% of the amino acid sequence or something even more desirable is over 80%, even more desirable is having a greater than 90% homology amino acid sequence can contain. In addition, putrescine, acetyl crystallized protein (NCgl469), specifically but not limited to, preferable, as the column number: 31 or 32 are listed more than 70% of the amino acid sequence or something even more desirable is over 80%, even more desirable is having a greater than 90% homology amino acid sequence can contain.
[53]
The above are among the acetyl-gamma protein glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt LAN spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), acetyl-NG Tin amino transfer la Ajay (ArgD) and o out Tin di Le Bok Silas Ajay (ODC) increased N C l g active, active increases in relation to the aforementioned 2522 bar and in the same way, for example, the above coding protein increase, above a copy of Polly nucleotide poly-nucleotides to control increasing manifestations of a variation in the column above, enzymes in the manifestation of the need to be active to enhance chromosome variation of heat from above on the poly-nucleotides, enzymes to suppress manifestations of poly-nucleotides of the conditions of the son of man came to fruition, and a combination of these can be achieved by the selected method from the.
[54]
In addition, NG Tin Ka-le-BAS Moyle Ajay (ArgF) and transfer to writing La Ruta mate's exhaust are involved in protein (NCgl1221), and putrescine to acetyl crystallized protein (NCgl469) the active decline, protein coding the entire or part of the poly-nucleotides to fruition, the above reduces to the manifestations of the manifestations of poly-nucleotides in the column above, transforming protein active controlling this decline to be a variation of the column from above on the chromosome poly nucleotides, and a combination of these can be achieved by the selected method from the.
[55]
Specifically, proteins are poly-nucleotides encrypt some or all of the way to fruition, bacterial chromosomes through my chromosome inserted within the vector for the implicit purpose of poly-nucleotides, proteins, and some nucleic acid sequence paid off pulleys and replace it with a marker gene, nucleotide, or can be done by. The above "some" means that depending on the type of dealer poly-nucleotides, but specifically, or 1 to 100 out of 300, desirable, even more desirable is 1 to 50.
[56]
In addition, for more information about how to adjust the heat, strain the manifestations of the above expression to further weakened the column in the active control nucleic acid sequences are totally or totally paid off, insert, VIVO substitution or a combination of these manifestations induced mutations on the heat control, or even having a weak active nucleic acid sequence by replacing with. Adjust the columns in the above expression promoter, operator billing, combined with some parts of the code are in line, and the warriors and the column to adjust the closure of detoxification.
[57]
In addition, the column deformed poly-nucleotides on the chromosome is a way to further weakening of the above enzymes active poly-nucleotides sequences are totally or totally paid off, insert, VIVO as a column or a combination of these displacements induced by variation of the award, or even to have a weak activity improved by replacing as columns in the poly-nucleotides.
[58]
In addition, the aforementioned enzymes to suppress manifestations of poly-nucleotides of the adjustable parameters for more information about how to disable a fruitful manifestation of the argument are some nucleic acid in poly-nucleotides in this fruitful pulleys and replace it with a marker gene, nucleotide, or can be done by. The above "some" means that depending on the type of dealer poly-nucleotides, but specifically, or 1 to 100 out of 300, desirable, even more desirable is 1 to 50.
[59]
On the other hand, saw the invention of the microbes having microorganisms to produce putrescine, the above sequence number: 21 or 23 to the amino acid sequence is the protein that contains the expression contains microorganisms, won nuclear examples of s Kerry tooth genus (Escherichia sp.), Shigella genus (Shigella sp.), sheets of Park-genus (Citrobacter sp.), salmonella (Salmonella sp.), Tero Park-genus (Enterobacter sp.): Asoke (Yersinia sp.), Rep: Ella (Klebsiella sp.), Winnie Asoke (Erwinia sp.), Cory Yes Park ethereum genus (Corynebacterium sp.), v levy Park ethereum genus (Brevibacterium sp.) The genus lactobacillus, b. (Lactobacillus sp.), Selena Nomo Nasu (Selenomanas sp.), the Vibrio genus (Vibrio sp.), Pseudomonas (Pseudomonas sp.), Rep-Toma ISIS genus (Streptomyces sp.), Kano bacteria genus (Arcanobacterium sp.), alkali-jen (Alcaligenes sp) can be the microorganism to which it belongs. Saw the invention of the future micro-organisms belonging to the genus microorganisms or Lycian esque Cory is a genus of four nights, ethereum even more desirable is the microorganism e. coli or Cory ethereum zag four nights Tammy Combe (Corynebacterium glutamicum).
[60]
This invention of writing with specific, conducted in may, Ruta mate putrescine enhanced path to generate high concentrations of putrescine having to strain produced a number KCCM11138P deposited in Corey lies four nights ethereum microorganisms (Korea patent disclosure for my 2012-0064046) and deposited with the number KCCM11240P Corey lies four nights ethereum microorganisms (Korea Patent No. 2012-0003634 Ho).
[61]
This is another of the invention in Hamm, Corey held four nights ethereum glue Tammy Combe ATCC13032-based KCCM11138P and host fungi produce putrescine KCCM11240P and each having the same genotype (genotype) Cory Yes Park ethereum glue Tammy Combe ATCC13869-based DAB12-a production strain putrescine and DAB12-b. The American type culture collection strain ATCC13869 (American Type Culture Collection; ATCC) can get from. In other words, each strain ATCC catalog has been given a unique registration number is listed on the registration number can be ordered by using the. Specifically, the putrescine production strain DAB12-a are Corey Yes Park ethereum glue A T C C Tammy Combe 13869 come from out Tin Ka-le-BAS (ArgF) La Ajay pooling transfer-coding gene and protein C N emissions or Rue mate g l 1221 coding genes being the shortcomings, NG Tin di Le Bok Silas Ajay (OCD) is a coding gene is introduced, NG Tin biosynthesis gene operon (argCJBD) has been substituted as a promoter of improved promoters. In addition, the putrescine production strain DAB12-b DAB12-a aureus above States, putrescine, acetyl l C N g crystallized protein to be active, rather than weakening the implicit activation of 1469 variation of the.
[62]
[63]
According to this invention desirable, embodiment, the first four nights of wild-type corridor ethereum glue A T C C Tammy Combe in the chromosome-13032 NG Tin Ka-le-BAS Moyle Ajay (ArgF) transfer la coding genes and are involved in emissions or Rue mate protein (NCgl1221) being the genes coding shortcomings, Ruta mate-are involved in enzyme synthesis, Nishi-Tin coding ArgCJBD gene is substituted into the military's improved its own promoters promoters, NG Tin di apparel Silas Ajay (ODC) is a coding gene is introduced in the four nights of my chromosomes ethereum zag Cory Tammy Combe KCCM11138P, the above three are the microbes further tilt LAN C g l N spur Jane 1469 weakens the genes coding for four nights, ethereum Cory zag that Tammy Combe KCCM11240P, putrescine prepared the production strain.
[64]
On the other hand, Cory ethereum zag four nights Tammy Combe ATCC13032 origins of NCgl2522 strain in order to produce the shortcomings, Corey grabbed four nights A glue Tammy Terry T N C C 13032 origins of Combe C g l based on the sequence of 2522 plasmid pDZ-1'NCgl2522 (K/O).
[65]
The aforementioned plasmid pDZ-1'NCgl2522 (K/O) prepared putrescine production strain KCCM11138P and KCCM11240P NCgl2522 after introducing each of the traits were singled out, strain the shortcomings of these NCgl2522 and KCCM11240P each KCCM11138P-strain-N C g l 2522 named. Four nights in the same way as above, Corey ethereum glue Tammy Combe ATCC13869 NCgl2522 shortcomings of the strain originated by making DAB12-a-NCgl2522 and DAB12-b-2522 C g l N were named.
[66]
Four species of NCgl2522 fungi, thus making the driving fungus attention deficit States putrescine production batching, C N g Arts l NCgl2522, KCCM11240P a KCCM11138P this shortcoming-2522-NCgl2522, DAB12-a-NCgl2522 and DAB12-b-NCgl2522, both from the parent strain compared to putrescine was determined that this reduction in yield (table 3). Who invented the above results seen from putrescine N g l C 2522 in the State of a fungus producing active putrescine productivity and ensure that closely related to, and strengthen, through the activation of the Pew and NCgl2522 to increase productivity are new strain to bolster production.
[67]
To this end, this invention desirable implementation example, Cory Yes Park ethereum Clutha Tammy Combe Kyun Note C g l N 2522 John transformers, add my introduction or chromosome NCgl2522 an applicant for a new developed its own promoter saw the CJ7 promoters (KCCM10617, Korea Patent No. 10-0620092) was replaced by.
[68]
This strengthens the fungal NCgl2522 State and authored six driving fungus caution putrescine batching to produce, compared to the parent strain C g l N 2522 transformers zone introduced a strain of adding both in putrescine was determined that this increase in yield (table 6). Increased putrescine production looks to strengthen targeted cell strain NCgl2522 my putrescine concentration as a result of the measure, compared with cell strain my putrescine concentration reduction was confirmed (table 9). Who invented the above results seen from putrescine N C state of a fungus producing g l active strengthening of the cells 2522 my computer-generated from the trail to the emissions increase in extracellular God finally putrescine to productivity.
[69]
At this, the inventor of the putrescine production strain Cory Yes Park ethereum glue N C in g l Tammy Combe KCCM11138P 2522 active compared to enforce this is inherent to the active transform increased putrescine emissions and improve productivity with putrescine by Cory four nights amid a Microbe Corynebacterium glutamicum ethereum C C 01-0510, named Budapest Treaty on 3/8/2013, South Korea microbial Conservation Center (Korean Culture Center of Microorganisms, the KCCM) deposited with the depositary received a grant number KCCM11401P.
[70]
[71]
This saw another dimension of the invention, the invention is
[72]
(I) the aforementioned putrescine productivity culture the microbial cultures as far as the water phase; And
[73]
(Ii) from cultured microorganisms or cultured above putrescine contains the steps to recover, Pew trail gives way to the production of the gods.
[74]
The above method, the above steps to cultivate microbes, specifically but not limited to, notice how the batch cultures, continuous cell culture methods, and how the expression expression, performed by Petri. At this point, culture conditions are not limited to, especially basic compounds (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or acidic compounds (such as phosphate or sulfate) using titration pH (pH 5 to 9, desirable, for example, a pH of 6 to 8, the optimal pH 4.2) you can adjust the oxygen or oxygen-containing gas mixture is introduced into water by aerobic culture conditions can keep the culture temperature is 20 to 45 ° c or 40 ° c, and 25, desirable and , About 10 to 160 hours culture is desirable. The above cultures produced by the Pew trail God badges of secretion or residue within the cells.
[75]
In addition, the badge for the culture used for the carbon sources per and carbohydrates (for example, glucocorticoid-induced Agios, Agios Georgios, Sue Crowe lactose, Agios, Agios luxurious sat say dunno, three on Saturdays, starch and cellulose), maintenance and fat (e.g. soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (such as arm Mitt acid, stearic acid and linoleic acid), alcohol (such as glycerol and ethanol) and organic acids (e.g. acetic acid), as well as individually or you can use a mix; Nitrogen-containing organic compounds with nitrogen sources (such as peptone, yeast extract, malt extract, corn, juicy immersion fluid, for two nights and urea), or inorganic compounds (e.g., ammonium sulfate, ammonium phosphate, ammonium carbonate, ammonium chloride and ammonium nitrate), as well as individually or you can use a mix; Isuso potassium phosphate, phosphoric acid as hydrogen which supplies this contains potassium, equivalent to sodium salts, etc. individually or you can use a mix; Other metal salts (such as magnesium sulfate or iron sulfate), amino acids and vitamin promotes the materials required, such as growth-can contain.
[76]
This invention was produced in cell culture steps above of putrescine for more information about how to recover the cultivation method, for example, batch and continuous culture, depending on how an expression or crude expression shall have been published in the areas of culture, by using the appropriate method for the purpose from the amount you can collect the amino acids.
[77]
The effect of the invention
[78]
This invention of putrescine productivity lies the germ cells of four nights, Cory ethereum within putrescine N g l C 2522 to discharge of the inherent need to be active to be active, rather than strengthening has been transformed to a Pew trail extracellular God increased putrescine emissions for my saints, that has increased.
[79]
Also saw the invention of putrescine N from e. coli containing the path to produce a C g l when cells that may have arisen out of 2522 putrescine was determined that the amount of increase. Therefore, Cory Yes Park ethereum glue Tammy C g l N 2522 of the origins is Combe putrescine production by applying effective microorganisms with Pew to Tre God and you will be able to be widely utilized in the production.
[80]
Drawing, brief description
[81]
According to this invention 1 Cory introduced four nights ethereum chromosome library transgenic colony became the final selection from clones (B19) C g l N 2522 included indicating that the parent is the esophagus.
[82]
According to this invention 2 C g l N 2522 note fruitful or enhanced recombinant bacteria putrescine appreciates my saints, about the result.
[83]
1: KCCM11240P
[84]
2: KCCM11240P △NCgl2522
[85]
3: KCCM11240P P(CJ7)-NCgl2522
[86]
The form for the implementation of the invention
[87]
This invention carried out for more detail. However, these examples of poetic embodiment described in this invention, for the scope of the invention is limited to these implementation examples.
[88]
[89]
See example 1: putrescine student performance lies four nights ethereum microbial production of Cory
[90]
Putrescine student performance produced by microorganisms in the midst of a four-night ethereum Cory, Korea patent disclosure for my 2012-0064046-Ho as stated in o out teen from arginine biosynthesis of blocking the path, Ruta mate come from out the Tin production and enhancing the active route the biosynthesis, NG Tin di Le Bok Silas Ajay (OCD) produced a foreign adoption from putrescine was produced by microorganisms that are granted power.
[91]
Specifically, Cory Yes Park ethereum glue A T C C Tammy Combe based on chromosomal my attention the above bacteria 13032 o le NG Tin Ka-le-BAS to gather Trenton spur la Ajay (ArgF) to encrypt the writing gene and ruta mate (glutamate) emissions involved in the protein C N g l 1221 to encrypt genes homologous recombination by the shortcomings by the o out teen writing Rue mate bulb chain cell increased my content. Also, the above strain to climb out the Pew trail involved in the divine synthesis, wild-type Escherichia coli W3110 origins of Le NG Tin di apparel Silas Ajay (ODC) to encrypt the genes introduced into the chromosomes. In addition, climb or Rue mate Nina teen involved in the synthesis of the enzyme coding, argCJBD gene peuromoteoin into its own military promoters can displace the retrofit CJ7 promoters putrescine production having to glue the four nights of Cory ethereum Tammy Combe produced a strain. In this case, the above argCJBD is written by Ruta mate o le NG Tin biosynthesis pathways are involved in acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt Len spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), acetyl-NG teen Ami Note Len spur la Ajay (ArgD) coding. As such, the putrescine biosynthetic performance produced by Corey ethereum zag four nights Tammy and the Budapest Treaty, giving South Korea a fungus microbes Combe Conservation Center (KCCM) on November 24, 2010 has been deposited with the depositary, dated KCCM11138P, and a number have been given. Putrescine raw performance making your night belonged to Corey ethereum more in relation to the microbial process, that whole seen as references are included in the Korea won Patent No. 0064046 for my 2012-reveal, in detail.
[92]
[93]
See example 2: putrescine student performance lies four nights ethereum microbial production of Cory
[94]
Putrescine grabbed another corridor with the performance of your life lies as reference microorganisms in Les Bhakti for four nights from 1-crafted Corey ethereum glue Tammy Combe KCCM11138P three tilt in Rennes spur la Ajay (acetyltransferase), C g l N 1469 a gene by encrypting N-acetyl putrescine putrescine by not generating production increased Cory ethereum glue your nights Tammy Combe produced a strain.
[95]
Specifically, Cory Yes Park ethereum glue A T C C Tammy Combe 13032 g N C l of 1469 to encrypt based on gene's nucleotide sequence to N C g l N-end parts of 1469, sang-Dong, the column number for obtaining recombinant fragments: a pair of primers 1 and 2, N C l g C-terminus of the homologous recombinant 1469 parts of the column to get segmental code: 3 and 4 to a pair of primers produced as shown in table 1.
[96]
[97]
Table 1 [table 1]
Primers Sequence (5 '-3 ')
NCgl1469-del-F1_BamHI (sequence number: 1) CGGGATCCAACCTTCAGAACGCGAATAC
NCgl1469-del-R1_SalI (sequence number: 2) CGCGTCGACTTGGCACTGTGATTACCATC
NCgl1469-del-F2_SalI (sequence number: 3) CGCGTCGACTTGGGTTATATCCCCTCAGA
NCgl1469-del-R2_XbaI (sequence number: 4) TGCTCTAGATAGTGAGCCAAGACATGGAA

[98]
[99]
Four nights above Corey ethereum glue Tammy Combe A T C C DNA, the genome of 13032 moulds, 2 pairs of primers PCR using each of the N-terminus and C-terminus to the mid-section of the PCR fragments, respectively, after electrophoresis as far as the purpose of the fragment number. At this point, the PCR reaction was 95 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds and repeat the kidneys process 30 times. As far as can be from the BamHI restriction enzyme fragment N-end parts and parts of the C-terminus fragment, as SalI restriction enzyme XbaI and was treated as SalI, BamHI restriction enzyme fragment is processed and XbaI processed by cloning plasmid vector pDZ-NCgl1469 pDZ (K/O).
[100]
The aforementioned plasmid pDZ-NCgl1469 (K/O) electric drilling law Cory ethereum glue your nights Tammy Combe incorporated transgenic KCCM11138P body as far as you can, and it's a transgenic above sieve, maissin (25 ㎍/㎖) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside) containing BHIS reputation badges (37 g/ℓ heart infusion, Braine Le non-toll 91 g/ℓ, agar 2%) also say that culture forms a colony by. This was formed from the Colonie colony of blue from above by selecting the plasmid pDZ-NCgl1469 (K/O) strain Starter introduced.
[101]
Strain selected for CM above the badge (glucose 10 g/10 g/ℓ ℓ, polypeptone, yeast extract 5 g/ℓ ℓ, beef extract NaCl 5 g/2.5 g/ℓ, urea, 2 g/ℓ, pH 6.8) for the eighth time in 30 ° c inoculate binge culture, each 10-4to 10-10after dilution contains solid X-gal sequentially until the badge culture say the colony formation. Formed colony appears relatively low proportion among the white colony, by choosing N g C l is the culmination of the genes coding 1469 putrescine productivity improved Corey ethereum glue your nights Tammy Combe produced a strain. As such authored putrescine student performance improved Corey ethereum glue your nights Tammy g l a N C KCCM11138P strain Drink 1469, named Budapest Treaty on South Korea microbial Conservation Center (KCCM) dated December 26, 2011 in the depositary received a grant number KCCM11240P. Putrescine raw performance making your night belonged to Corey ethereum more in relation to the microbial process, that whole seen as references are included in the Korea won a patent, no. 2012-0003634 HO has described in detail.
[102]
[103]
Implementation example 1: putrescine exhaust protein's navigation and putrescine to confer about sifting of the clones in the library
[104]
Cory four nights in the U.S. or Rue ethereum Combe putrescine biosynthesis path but come from outside out Tin di Le Bok Silas Azay, the sum of the performance if you equip putrescine putrescine was produced by the cells out of the putrescine emissions. This is a large number of microorganisms in the midst of a four-night Cory ethereum membrane protein of putrescine transporter protein which functions as a conduit drain this will indicate that it exists.
[105]
Cory lies in four nights, ethereum putrescine emissions microbial protein separation, in order to sympathize with, the wild-type Cory Yes Park ethereum glue Tammy Combe A T C C 13032 chromosome libraries. Specifically, Cory Yes Park ethereum glue A T C C Tammy Combe 13032 Sau3AI restriction enzymes to process the chromosomes of the imperfect cutting performed, 3 ~ 5 kb of the size of the gene pool by removing the BamHI processed intercept pECCG122 vector (Escherichia coli shuttle vector of four nights with Corey ethereum; Korea patent disclosure in my 1992-0000933-Ho) cloning.
[106]
As far as can be from the corridor you see embedded ethereum chromosome libraries 1 putrescine in accordance with production organisms owner Cory Yes Park ethereum glue Tammy Combe KCCM11138P after you switch on the traits, it contains a minimum of 0.35 M putrescine badge (1 distilled water 10 g of glucose, on the basis of ℓ MgSO4/7 H2O 0.4 g, 4 g, NH4Cl KH2PO4 1 g, K2HPO4 1 g, 2 g element, FeSO4/7 H2O 10 ㎎ MnSO4/5, H2O 1 ㎎, NICOTINAMIDE 5 ㎎, thiamine hydrochloride 5 ㎎, 0.1 ㎎, biotin 1 mM arginine, Cana maissin 25 milligrams, 0.35 M putrescine, pH 7.0), began sifting through the growing strain. Cory introduced four nights ethereum chromosome library transgenic colony about 3.4 × 105 of 413 was singled out, since the dog's claw teeth putrescine my saints secondary as far as from the confirmation of each library clones back to putrescine on strain produced after the introduction of putrescine my saints 3rd OK one clone (B19) through the final details. The above clones as the target sequence analysis is performed as a result, N C g l was confirmed containing 2522 (1).
[107]
Putrescine exhaust protein as Cory Yes Park ethereum glue A T C C Tammy Combe 13032 g l a N C, separated from the column number: 21 written 2522 the amino acid sequence, and this is being listed as a heat number: 20 having a nucleotide sequence is coded from the poly.
[108]
[109]
Implementation example 2: Beware of the fungus and the shortcomings of the NCgl2522 putrescine production performing arts verification
[110]
<2-1> ATCC13032-based NCgl2522 in the State of a fungus producing deficits putrescine fungus produced attention
[111]
Cory Yes Park ethereum glue comes N g l C Tammy Combe ATCC13032 2522 is putrescine emissions involved in N, in order to determine whether the C g l 2522 coding genes making a vector for the shortcomings.
[112]
Specifically, the above coding C g l N 2522 of the genes are listed by column number: 20 in sequence based N C g l N-end parts of homologous recombination 2522 short for obtaining heat number: 5 and 6 of the primer pairs, C g C-terminus of N l 2522 recombinant fragments for homology in the mid-section of the column number: 7 and 8 to the pair of primers produced as shown in table 2.
[113]
[114]
Table 2 [table 2]
Primers Sequence (5 '-3 ')
NCgl2522-del-F1_BamHI (sequence number: 5) CGGGATCCCACGCCTGTCTGGTCGC
NCgl2522-del-R1_SalI (sequence number: 6) ACGCGTCGACGGATCGTAACTGTAACGAATGG
NCgl2522-del-F2_SalI (sequence number: 7) ACGCGTCGACCGCGTGCATCTTTGGACAC
NCgl2522-del-R2_XbaI (sequence number: 8) CTAGTCTAGAGAGCTGCACCAGGTAGACG

[115]
[116]
Four nights above Corey ethereum glue Tammy Combe A T C C DNA, the genome of 13032 moulds, 2 pairs of primers PCR using each of the NCgl2522 gene of the N-terminus and C-terminus after each PCR fragment amplified in the affected area, which is the purpose of electrophoresis short as far as you can. At this point, the PCR reaction was 95 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds and repeat the kidneys process 30 times. As far as can be from the BamHI restriction enzyme fragment N-end parts and parts of the C-terminus fragment, as SalI restriction enzyme XbaI and was treated as SalI, BamHI restriction enzyme fragment is processed and XbaI processed by cloning plasmid vector pDZ-1'NCgl2522 pDZ (K/O).
[117]
The aforementioned plasmid pDZ-1'NCgl2522 (K/O) for 1 and 2 according to Cory Yes Park ethereum glue Tammy KCCM11138P and KCCM11240P, respectively the electric sky law Combe (electroporation) by the introduction of transgenic body as far as you can, and it's a transgenic above sieve, maissin (25 ㎍/㎖) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside) containing BHIS reputation badges (37 g/ℓ heart infusion, Braine Le non-toll 91 g/ℓ, agar 2%) also say that culture forms a colony by. This was formed from the Colonie colony of blue from above by selecting the plasmid pDZ-1'NCgl2522 (K/O) strain Starter introduced.
[118]
Strain selected for CM above the badge (glucose 10 g/10 g/ℓ ℓ, polypeptone, yeast extract 5 g/ℓ ℓ, beef extract NaCl 5 g/2.5 g/ℓ, urea, 2 g/ℓ, pH 6.8) binge culture (30 ° c, 8 HR), each with 10-4to 10-10after dilution contains solid X-gal sequentially until the badge culture say the colony formation. Formed colony appears relatively low proportion among the white colony by selecting the second cross (crossover) by N C g l the genes coding the fruitful 2522 strain to the final selection. The final selection as a strain to the target column number: 5 and 8 of the PCR using primer pairs, C g l N 2522 by doing coding genes has been fruitful, and the aforementioned Cory ethereum zag four nights a week, respectively KCCM11138P-Tammy Combe variations NCgl2522 and KCCM11240P-2522 C g l N were named.
[119]
[120]
<2-2> ATCC13869-based NCgl2522 in the State of a fungus producing deficits putrescine fungus produced attention
[121]
Cory ethereum zag four nights Tammy Combe ATCC13032-based KCCM11138P and host fungi produce putrescine KCCM11240P with the same genotype (genotype) with Cory ethereum zag four nights Tammy Combe ATCC13869-based putrescine production strain DAB12-a (argF shortcomings, NCgl1221 shortcomings, e. coli speC, the arg operon promoter substituted; see example 1) and DAB12-b (argF shortcomings, NCgl1221 shortcomings, e. coli speC, the arg operon promoter, see example 2 NCgl1469 deficits, note) is aimed at producing strain NCgl2522 shortcomings.
[122]
Specifically, Cory Yes Park ethereum glue comes N ATCC13869 C g l Tammy Combe 2522 coding genes and proteins that have arisen from him in order to determine the heat, Corey in four nights ethereum glue A T C C Tammy Combe 13869 genome of DNA to moulds and column number: 5 and 8, using a pair of PCR primers was performed. At this point, the PCR reaction was 95 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for two minutes to process 30 repetitions of the kidney. As far as can be from the PCR products electrophoresis after removing the heat as a result, the corridor analysis of four nights ethereum glue Tammy C g l N 2522 ATCC13869 origins of Combe, gene coding sequence number: 22 is described in the sequence and the protein coding sequence from this number: 23 the amino acid sequence. Cory ethereum zag four nights Tammy C g l N 2522 ATCC13032 origins of Combe and Cory Yes Park ethereum glue Tammy C g l N 2522 ATCC13869 origins of Combe's amino acid sequence comparison of results, these are the column of 98% homology were identified as having.
[123]
Cory Yes Park ethereum glue comes N g l C Tammy Combe ATCC13869 2522 coding gene defect carried out above, for example, to <2-1>, as shown in the corridor you park ethereum glue Tammy Combe A T C C 13869 genome of DNA, moulds, and two pairs listed in table 2 of the primer PCR with each of the NCgl2522 gene of the N-terminus and C-terminus after each PCR fragment amplified in the affected area, which is the purpose of electrophoresis short as far as you can. At this point, the PCR reaction was 95 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds and repeat the kidneys process 30 times. As far as can be from the BamHI restriction enzyme fragment N-end parts and as far as the C-terminus, with SalI parts SalI and XbaI restriction enzyme fragment has been processed, treated as a short restriction enzyme XbaI, and BamHI, which is processed by cloning plasmid vector pDZ-2'NCgl2522 pDZ (K/O).
[124]
The aforementioned plasmid pDZ-2'NCgl2522 (K/O) for four nights in the same way as the <2-1> Corey ethereum glue DAB12-a and DAB12-b, respectively the Tammy Combe transgenic C g l N 2522 by coding the details the genetic strain were fruitful. This night will be chosen from the four Cory ethereum glue Tammy Combe NCgl2522 and DAB12-b each week DAB12-a-buck-2522 C g l N were named.
[125]
[126]
Beware of the fungus <2-3> NCgl2522 shortcomings putrescine production appraisal
[127]
Putrescine production Kyun NCgl2522 shortcomings in the State to produce the effect of putrescine in order to verify the above implementation for <2-1> and <2-2> produced in the four nights of Cory ethereum glue Tammy Combe variations to target a week putrescine was compared to the production.
[128]
Specifically, 4 species of Cory ethereum zag four nights Tammy Combe transient state (KCCM11138P-NCgl2522, KCCM11240P-NCgl2522, DAB12-a-NCgl2522, and DAB12-b-NCgl2522) and 4 species of Mo strain (KCCM11138P, KCCM11240P, DAB12-a, and DAB12-b) for each 1 mM arginine containing CM flat badge (1% glucose, 1% polypeptone, 0.5% yeast extract, beef extract NaCl 0.5%, 0.25%, NaOH urea 0.2%, 50% and 2% agar, pH 6.8 ㎕, 100, 1 ℓ) also said in a 24-hour period began to cultivate 30 ℃. Each strain to cultured from 25 ml of titre badge (8% Glucose, soybean protein 0.25% 0.50%, corn solids (NH4)2SO4 4%, KH2PO4 , 0.1% MgSO4/7 H2O 0.05%, urea, biotin 0.15% 100 g, thiamine hydrochloride 3 mg, 3 mg, NICOTINAMIDE Pantothenic acid calcium-3 mg, CaCO3 5%, 1 ℓ) after one Platinum enough dose to 30 ° c at 200 rpm with 98 hours of binge culture. Beware of all fungal cultures: 1 mM badges add arginine. Each produced from water cultivated putrescine concentration is measured and the result is that indicated in table 3, to.
[129]
[130]
Table 3 [table 3]
Host Genotype Putrescine(g/L)
KCCM11138P (-) 9.8
△NCgl2522 3.0
KCCM11240P(KCCM11138P △NCgl1469) (-) 12.4
△NCgl2522 1.5
DAB12-a (-) 10.2
△NCgl2522 0.7
DAB12-b(DAB12-a △NCgl1469) (-) 13.1
△NCgl2522 0.3

[131]
[132]
The above, as shown in table 3, 4 C g l N 2522 is a shortcoming of the species Cory ethereum glue your nights Tammy Combe variations both in putrescine production significantly reduces that.
[133]
[134]
Example 3: Beware of the fungus strengthen NCgl2522 conducted the production and make the production of putrescine arts
[135]
<3-1> ATCC13032 my NCgl2522 my transformers introduced by John gene chromosomes
[136]
Putrescine student performance lies in the four nights of Cory ethereum KCCM11138P NCgl2522 microbial genes (self promoter parts included) is inserted through my additional chromosomes of putrescine and production in order to determine the effectiveness, N C g l 2522 introduced in the transformers John genes. Cory lies four nights ethereum transformers of microorganisms by using part of the chromosome the gene John genetic traits that enable the introduction of switching vectors pDZTn (Korea patent disclosure 2008-0033054).
[137]
Self-promoter gene NCgl2522 ATCC13032 fungi, including mold in chromosome number note: 9 and 10 using a pair of primers about 1.88 kb gene fragment was amplified (see table 4). At this point, the PCR reaction was 95 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds or 1/2 the kidneys process 30 repetitions. This 0.8% PCR result PUD Ross-gel after electrophoresis in the size that you want the tablets for the band. PDZTn vector and ATCC13032 beware of the fungus NCgl2522 XhoI PCR products fusion cloning. Fusion cloning Cloning Kit (Clontech) In-FusionHD. The resulting plasmid, p D T C N n-1 ' Z g l 2522 dubbed.
[138]
[139]
Table 4 [table 4]
Primers Sequence (5 '-3 ')
1 ' NCgl2522-F-T (sequence number: 9) TGTCGGGCCCACTAGTGGTGCGACTTCAATTGTGCTCTT
NCgl2522-R-T (sequence number: 10) GAATGAGTTCCTCGAGCTAGTGCGCATTATTGGCTCC

[140]
[141]
D Z T n p above the plasmid-1 ' N C g l, see example 1 shown on 2522 Cory ethereum zag four nights Tammy Combe KCCM11138P electric punch (electroporation) by the introduction of transgenic body as far as you can, and, as mentioned above, such as transgenic carried the body for 2 way through C g l N 2522 John transformers has introduced screening strain.
[142]
Can be filled from the genomic DNA strain selected for moulds, heat number: 9 and 10 of the primer pairs to perform PCR using plasmid p D T Z g l C N 2522 n-1 ' by the introduction of the C g l N 2522 transformers zone has been introduced. At this point, the PCR reaction is 94 ° c for 30 sec 30 sec denaturation, annealing, and 55 ° c 72 ° c 2 minutes from the kidneys process 30 repetitions.
[143]
This night will be chosen from the four Cory ethereum glue Tammy Combe KCCM11138P Tn: 1 note ' NCgl2522 mutation in the naming.
[144]
[145]
<3-2> ATCC13032-based NCgl2522 promoter in the State of a fungus producing putrescine substitution Kyun caution productions
[146]
Putrescine production Kyun NCgl2522 active in the State, in order to enhance chromosome NCgl2522 initiation codon preceded CJ7 promoters (WO 2006/65095).
[147]
First of all, as stated in column number: 24 having the sequence contains the aforementioned promoter CJ7 promoters both ends of parts of the extremities is a chromosome having the original NCgl2522 on sequence homology as far as the number of recombinant fragments. Specifically, parts of the 5 '-end of the CJ7 promoter Corey Yes Park ethereum glue A T C C Tammy Combe 13032 genome of DNA to moulds and column numbers: 11 and 12 primer pairs were occasionally able to perform PCR using. At this point, the PCR reaction is 94 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds and repeat the kidneys process 30 times. In addition, parts of the column number CJ7 promoters: 13 and 14 using a pair of primers PCR in the same condition as far as you can by doing, and part of the 3 '-end of the CJ7 promoter Corey Yes Park ethereum glue A T C C Tammy Combe 13032 genome of DNA to moulds and column numbers: 15 and 16 using a pair of primers PCR in the same condition as far as you can by doing. Promoter primers used to displace table 5 as shown in.
[148]
[149]
Table 5 [table 5]
Primers Sequence (5 '-3 ')
NCgl2522-L5 (sequence number: 11) TGCAGGTCGACTCTAGAGTTCTGCGTAGCTGTGTGCC
NCgl2522-L3 (sequence number: 12) GGATCGTAACTGTAACGAATGG
CJ7-F (sequence number: 13) CGTTACAGTTACGATCCAGAAACATCCCAGCGCTACTAATA
CJ7-R (sequence number: 14) AGTGTTTCCTTTCGTTGGGTACG
NCgl2522-R5 (sequence number: 15) CAACGAAAGGAAACACTATGACTTCAGAAACCTTACAGGCG
NCgl2522-R3 (sequence number: 16) TCGGTACCCGGGGATCCCACAAAAAGCGTAGCGATCAACG

[150]
[151]
The above can be filled in each PCR products BamHI and XbaI pDZ processed by fusion of cloning vector. Fusion cloning Cloning Kit (Clontech) In-FusionHD. The resulting plasmid pDZ-P (CJ7)-1 ' C g l N 2522 dubbed.
[152]
The above are manufactured by plasmid pDZ-P (CJ7)-1 C g N ' see for example, 2522, respectively 1 and 2 l in accordance with Cory ethereum zag four nights Tammy Combe KCCM11138P and KCCM11240P introduced by law an electric punch-transgenic to manufacturing. Transgenic body manufactured by 30 CM badge for the eighth time at the vaccination binge culture, and as far as the culture water from 10-4 and 10-10diluted with 25 ㎍/㎖ it's my God and X-gal containing BHIS by cultivating the reputation badge is also said to form a colony.
[153]
Most of the colony is blue whereas low ratio appears to represent the white colony screening, 2nd cross, and finally by the promoter as a replacement NCgl2522 strain Starter CJ7 promoters. Can be filled from the genomic DNA strain selected for moulds, heat number: 13 and 16 of the primer pairs to perform PCR using plasmid pDZ-1'CJ7 (NCgl2522) by the introduction of chromosome initiation codon in front of my NCgl2522 has been introduced CJ7 promoters. At this point, the PCR reaction is 94 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 1 minute in the course of 30 repetitions of the kidney.
[154]
This night will be chosen from the four Cory ethereum glue Tammy Combe KCCM11138P P each week (CJ7) mutations-NCgl2522 and KCCM11240P P (CJ7)-N C g l 2522 dubbed.
[155]
[156]
<3-3> ATCC13869 NCgl2522 my genes my chromosomes transformers introduced John genes
[157]
Cory ethereum zag four nights Tammy Combe ATCC13869 origins putrescine strain NCgl2522 gene from chromosome inserted within putrescine and through additional production in order to determine the effectiveness, NCgl2522 (part of the promoter), transformers, John decided to introduce within the NCgl2522 gene was genetically ATCC13869 bacteria caution as the column number of the cast: the chromosomes 17 and uses a pair of primers of 10 approximately 1.97 kb gene fragment was amplified (table 6). At this point, the PCR reaction is 94 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds or 1/2 the kidneys process 30 repetitions. This PCR fragment from NCgl2522 pDZTn processing vector fusion with XhoI cloning. Fusion cloning Cloning Kit (Clontech) In-FusionHD. The resulting plasmid, p D T Z g l C N 2522 n-2, dubbed the '.
[158]
[159]
Table 6 [table 6]
Primers Sequence (5 '-3 ')
2 ' NCgl2522-F-T (sequence number: 17) TGTCGGGCCCACTAGTCTTCAATTCGAGTTGCTGCCAC
NCgl2522-R-T (sequence number: 10) GAATGAGTTCCTCGAGCTAGTGCGCATTATTGGCTCC

[160]
[161]
D Z T n p plasmids above-2 C N g l ' carried out such as <3-1> and in the same way as 2522 Cory ethereum glue your nights Tammy Combe DAB12-a in transgenic C N g the transformers zone has been introduced l 2522.
[162]
This night will be chosen from the four Cory ethereum glue Tammy Combe NCgl2522 Tn DAB12-a note: a variation 2 ' was named the
[163]
[164]
<3-4> ATCC13869-based NCgl2522 promoter in the State of a fungus producing putrescine substitution Kyun caution productions
[165]
Cory Yes Park ethereum glue comes N g l C Tammy Combe ATCC13869 2522 CJ7 promoters before the commencement of the codon to introduce the above implementation for <3-2> as in Cory ethereum zag four nights Tammy Combe A T C C 13869 genome of DNA, moulds, and listed on the table 7 to 3 pairs of primers used for each PCR CJ7 promoters by doing the parts, parts of the extremities and his N-C-parts of the extremities after each amplified PCR fragment, the fragment the purpose of electrophoresis as far as you can. At this point, the PCR reaction is 94 ° c for 30 sec 30 sec 55 ° c denaturation, annealing, and 72 ° c for 30 seconds and repeat the kidneys process 30 times. As far as you can from this part of the CJ7 promoter, his part of the extremities and N-C-BamHI fragment PCR and XbaI end parts processed by pDZ vector fusion of cloning. Fusion cloning Cloning Kit (Clontech) In-FusionHD. The resulting plasmid pDZ-P (CJ7)-2 ' C g l N 2522 dubbed.
[166]
[167]
Table 7 [table 7]
Primers Sequence (5 '-3 ')
2 ' NCgl2522-L5 (sequence number: 18) TGCAGGTCGACTCTAGACAATTCGAGTTGCTGCCACAC
NCgl2522-L3 (sequence number: 12) GGATCGTAACTGTAACGAATGG
CJ7-F (sequence number: 13) CGTTACAGTTACGATCCAGAAACATCCCAGCGCTACTAATA
CJ7-R (sequence number: 14) AGTGTTTCCTTTCGTTGGGTACG
NCgl2522-R5 (sequence number: 19) CAACGAAAGGAAACACTATGATTTCAGAAACTTTGCAGGCG
NCgl2522-R3 (sequence number: 17) TCGGTACCCGGGGATCCCACAAAAAGCGTAGCGATCAACG

[168]
[169]
The aforementioned plasmid pDZ-'P (CJ7)-2 ' C g l N 2522 conducted for four nights in the same way as <3-2> and Corey ethereum glue DAB12-a and DAB12-b, respectively the Tammy Combe transgenic NCgl2522 initiation codon preceded by CJ7 promoters detailed strain was introduced. This night will be chosen from the four Cory ethereum glue Tammy Combe DAB12-a P each week (CJ7) mutations-NCgl2522 and DAB12-b P (CJ7)-N C g l 2522 named.
[170]
[171]
<3-5> NCgl2522 note the fungus strengthen putrescine production appraisal
[172]
Putrescine-producing bacteria to displace NCgl2522 active promoter in the State of strengthening effect of putrescine in production, in order to verify the above implementation for <3-1> or <3-4> manufactured in six species of Cory ethereum zag four nights Tammy Combe transient state (KCCM11138P Tn: 1 ' NCgl2522, KCCM11138P NCgl2522, KCCM11240P P (CJ7)-P (CJ7)-NCgl2522, Tn DAB12-a: 2 ' NCgl2522, DAB12-a NCgl2522 and DAB12-b P (CJ7)-P (CJ7)-NCgl2522) and 4 species of Mo strain (KCCM11138P, KCCM11240P, DAB12-a and DAB12-b) were compared to the production of putrescine. Each strain carried the above example 2-3 after the same manner each culture produced from water cultivated putrescine concentration, and the results indicated in table 8 to.
[173]
[174]
Table 8 [table 8]
Host Genotype Putrescine(g/L)
KCCM11138P (-) 9.8
Tn:1'NCgl2522 11.7
P(CJ7)-NCgl2522 13.5
KCCM11240P (-) 12.4
P(CJ7)-NCgl2522 15.5
DAB12-a (-) 10.2
Tn:2'NCgl2522 12.3
P(CJ7)-NCgl2522 14.1
DAB12-b (-) 13.1
P(CJ7)-NCgl2522 15.9

[175]
[176]
The above, as shown in table 8, C g l N John transformers, add or promoter through substitution 2522 NCgl2522 active powered six Corey ethereum glue your nights Tammy Combe variations both in an increase in production to putrescine.
[177]
[178]
Beware of the fungus cells that strengthen the implementation example 4: NCgl2522 my putrescine concentration measurement
[179]
NCgl2522 active powered Cory ethereum glue your nights Tammy Combe variation States putrescine emissions performance improved in accordance with the reduction in putrescine concentration within the cell was to make thy nights ethereum Zag, Cory Tammy Combe NCgl2522 KCCM11138P Tn: 1 week ' and a variation parent strain KCCM11138P to target the organic solvent extraction methods used to measure intracellular concentrations of putrescine. Intracellular metabolite (intracellular metabolite) Nakamura J et al the way literature (analysis, Appl. Environ. Microbiol. 73 (14): 4491-4498, 2007) performed, depending on the method that is described in.
[180]
First, Cory ethereum zag four nights Tammy Combe NCgl2522 KCCM11138P Tn: 1 week ' and a variation parent strain KCCM11138P 1 mM each of the arginine-containing CM liquid badge (1% glucose, 1% polypeptone, 0.5% yeast extract, beef extract NaCl 0.5%, 0.25%, 0.2%, 50% NaOH urea 100 l, pH 6.8, 1 ℓ) 25 ml dose by 200 rpm at 30 ℃ after the binge culture. The growth of the cell during exponential proliferation cultured (exponential phase) is reached, the rapid-rapid vacuum filtration, vacuum filtration (Durapore HV, 0.45 m; Millipore, Billerica, MA) to remove the cells from the culture fluid. 10 ml filter, adsorbed cells as a coolant in 2 times after washing, 5 M know Pauline Tan sulfone (morpholine ethanesulfonic acid) and 5 M methionine sulfone (methionine sulfone) containing methanol for 10 minutes to soak. This was obtained from the extract of chloroform and momentum to 0.4 times the volume of water, mix well, and then, the floor (aqueous phase) only spin column (spin column) by applying the protein contaminants were removed. The extract by capillary electrophoresis mass spectrometry (capillary electrophoresis mass spectrometry) analysis, and the results indicated in table 9 to.
[181]
[182]
Table 9 [table 9]
Strain Putrescine(mM)
KCCM11138P 7
KCCM11138P Tn:1'NCgl2522 2

[183]
[184]
The above table 9, as shown in NCgl2522 as compared to KCCM11138P active strain hardened Cory Yes Park ethereum glue Tammy Combe KCCM11138P Tn: 1 week N ' C buck g l 2522 cells reduced the putrescine concentration within that. This is your night to remind Corey ethereum glue Tammy Combe KCCM11138P Tn: 1 ' N C transient state g l due to the active NCgl2522 strengthen in 2522 putrescine emissions performance improved within the cells generated according to putrescine in addition to smooth this cell is expected to be discharged.
[185]
[186]
Implementation example 5: NCgl2522 paid off or the enhanced sterilization caution putrescine review my saints
[187]
C g l N 2522 of putrescine in order to determine your tolerance for the impacts produced by KCCM11240P above, KCCM11240P-NCgl2522, and KCCM11240P P (CJ7)-NCgl2522 strain targets to evaluate my saints putrescine.
[188]
CMA of each strain, 2 ㎖, liquid vaccines by 30 ° c in the badge about 10 hours after the cultivation, 105, 10-4, 10-3, 10-2 and 10-1 , followed by dilution. Each of the diluent to prepare putrescine 0 M/0.8 M, including CMA reputation badges (1% glucose, 1% polypeptone, 0.5% yeast extract, beef extract NaCl 0.5%, 0.25%, urea, 0.2% 1.8%, 1 mM arginine agar,; pH 6.8:1 ℓ) drip (spotting), and then 30 ° c, 48 hours compared to the growth of the fungus to cultivate weekly.
[189]
As a result, there are two other growth aspects of the above fungi States indicated, 2 NCgl2522, as shown in the fungal gene defects in putrescine and the conditions did not grow in the NCgl2522 gene, on the other hand, the manifestation of this enhanced the growth of cells in the same strain conditions. This is due to the strengthening of the NCgl2522 gene, putrescine, and an increase in the concentration of the exhaust Arts putrescine in terms of driving fungus that contains high cell growth in preparation for a week as a result, confirming the high concentrations of putrescine N C g l for fermentation and to indicate that it is essential for the introduction of 2522.
[190]
[191]
Carried out for 6: NCgl2522 in e. coli Putrescine fermentation through the introduction
[192]
Putrescine biosynthesis in wild-type e. coli strain with the path W 3110 Corey Yes Park ethereum glue A T C C Tammy Combe 13032 putrescine NCgl2522 manifestations of the city, an increase in production in order to determine the effect of putrescine synthase in W 3110 speC is NCgl2522 expression vector and the vector manifestation introduced respectively.
[193]
To produce the vector manifestation speC W3110 chromosomes moulds and column numbers: 34 and 35 of the primer pairs in around 2.1 speC of gene fragment was amplified kb (see table 10). This 0.8% PCR result PUD Ross-gel after electrophoresis in the size that you want the tablets for the band. Trc pSE280 vector (Invitrogen), including promoters, NcoI, and PCR products after processing by EcoRI speC fusion cloning. Fusion cloning In-Fusion ® HD Cloning Kit (Clontech) was done using. The resulting plasmid was named pSE280-speC.
[194]
NCgl2522 expression vector p S E 280 to produce moulds and column numbers: 36 and 37 of the primer pair can use Trc promoters as far as short, Corey ethereum zag four nights Tammy Combe ATCC13032 chromosomes moulds and column numbers: 38 and 39 primer pairs were occasionally able to use NCgl2522 short. This 0.8% PCR result PUD Ross-gel after electrophoresis in the size that you want the tablets for the band. Pcc1BAC processed in the trc as a promoter fragment HindIII and NCgl2522 short fusion cloning. The resulting plasmid pcc1BAC-P (trc)-N C g l 2522 dubbed.
[195]
[196]
Table 10 [table 10]
Primers Sequence (5 '-3 ')
SPEC-F (sequence number: 34) CACAGGAAACAGACCATGGATGAAATCAATGAATATTGCCGCCA
SPEC-R (sequence number: 35) GTGCAGGTGCTGAATTCTTACTTCAACACATAACCGTACAAC
Ptrc-F (sequence number: 36) TGCAGGCATGCAAGCTTCGACATCATAACGGTTCTGGC
Ptrc-R (sequence number: 37) ATTATACGAGCCGGATGATTAATTG
NCgl2522-F (sequence number: 38) CATCCGGCTCGTATAATATGACTTCAGAAACCTTACAGGC
NCgl2522-R (sequence number: 39) ATAGAATACTCAAGCTTCTAGTGCGCATTATTGGCTCC

[197]
[198]
The above pSE280-speC and pcc1BAC-P plasmids (trc)-N g C l a W 3110 in transgenic 2522. Escherichia coli, the transition of my traits 2 × TSS using solution (Epicentre), and pSE280-speC are introduced in e. coli is m. p. cylinder (100 ㎍/㎖) containing LB reputation badges (yeast extract Tryptone Nacl 5 g, 10 g, 10 g, 1 a 2% agar, ℓ) is also formed by cultured colony said. Pcc1BAC-P (trc)-N C g l 2522 the COLI chloramphenicol (35 ㎍/㎖) containing LB flat badge also cultivated by the said colony formation. Can be filled from above strain targets the production to putrescine.
[199]
Specifically, W3110, pSE280-speC, and pcc1BAC-P (trc) W3110 W3110-N C g l, LA and LB LC each solid 2522 badge in the 37 ° c inoculate culture 24 hours a day, and each station badge (㎖ (NH4)2PO4 2 g, KH2PO4 6.75 g 0.85 g citric acid,, MgSO4, 7H2O 0.7 g, 0.5% (v/v) trace element, glucose 10 g, AMS 3 g , CaCO3 30 g, 1 to 37 ° c inoculate ℓ) in a 24-hour culture. Trace metal solutions (Trace metal solution) is 1 M HCl: 5 per ℓ FeSO4, 7H2O 10 g, ZnSO4, 7H2O 2.25 g, CuSO4, 5H2O 1 g, MnSO45H2O and 0.5 g, Na2B4O710H2O and g, 0.23 CaCl2and 2H2O 2 g, and (NH4)6Mo7O2/4H2O 0.1 g.
[200]
Each produced from water cultivated putrescine concentration, and the results indicated in table to 11.
[201]
[202]
Table 11 [table 11]
Host Plasmid Putrescine(mg/L)
W3110 (-) 11
pSE280-speC 56
pcc1BAC-P(trc)-NCgl2522 250

[203]
[204]
11 as shown in above table, the putrescine biosynthesis enzyme pcc1BAC-pSE280-speC strain W3110 introduced a speC C g l N 2522 was introduced in preparation for W3110 pcc1BAC-P (trc)-N C g l 2522 in putrescine increased production means more.
[205]
This is a reminder that even in the Escherichia coli NCgl2522 gene putrescine emissions have proven that protein as active.
[206]
[207]
This inventor of the putrescine biosynthetic performance lies in the four nights of Cory ethereum transformers C my microorganisms KCCM11138P N g l John add NCgl2522 by introducing Active 2522 strengthened Cory ethereum glue your nights Tammy Combe Kyun shares increased putrescine emissions through to yield to putrescine could produce a strain, above, making sure that the Corynebacterium glutamicum C C 01-0510 after Budapest Treaty named March 8/2013 under the Republic of Korea deposited microorganism preservation Center (KCCM) and by the number of KCCM11401P have been given to the depositary.
[208]
[209]
From the description above, this saw the invention belongs to the party of the technology sector technical invention ideas or essential features without changing the other concrete can be carried out in the form, you will be able to understand. In this regard, the conduct described above illustrate that in every way, and specific examples rather than as something you have to understand. This invention after the above detailed description of the scope of the patent claims, rather than the meaning and scope of the range and that equivalent concepts drawn from all of the change or modified forms are included in the scope of this invention shall be construed as being.
This invention of putrescine productivity lies the germ cells of four nights, Cory ethereum within putrescine N g l C 2522 to discharge of the inherent need to be active to be active, rather than strengthening has been transformed to a Pew trail extracellular God increased putrescine emissions for my saints, that has increased. Also saw the invention of putrescine N from e. coli containing the path to produce a C g l when cells that may have arisen out of 2522 putrescine was determined that the amount of increase. Therefore, Cory Yes Park ethereum glue Tammy C g l N 2522 of the origins is Combe putrescine production by applying effective microorganisms with Pew to Tre God and you will be able to be widely utilized in the production.

The scope of a claim
[Claims]
As stated in column number: 21 or 23 contains the amino acid sequence of the protein to be transformed, strengthened active putrescine production having to microorganisms.
[Billing section 2]
In paragraph 1, the above microorganisms in addition o le NG Tin Ka-le-BAS to gather Trenton spur la Ajay (ArgF) and engage in emissions or Rue mate protein (NCgl1221) strain to weaken compared to the inherent need to be active for being active, NG Tin di apparel Silas Ajay (ODC) active enhanced, putrescine production having to microorganisms.
[Billing section 3]
In paragraph 2, above, o le NG Tin Ka-le-BAS Moyle Ajay (ArgF) Trenton spur la go being described as the column number: 29 contains the amino acid sequence, Ruta mate emissions involved in the protein (NCgl1221), this is indicated by the number of columns in the: 30 includes the amino acid sequence, NG Tin di went to my stomach Silla (ODC) is listed as the column number: 33, including the amino acid sequence, putrescine production having to microorganisms.
[Billing section 4]
In paragraph 1, in addition to the aforementioned microorganisms acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt LAN spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), and acetyl-NG Tin amino transfer la Ajay (ArgD) compared to active this inherent variation so that strengthen the active, putrescine production having to microorganisms.
[Billing section 5]
In paragraph 4, above, acetyl-gamma glue Tamil force Pate Leduc get Ajay (ArgC), acetyl Cinta or Rue mate Ajay/o out teen three tilt LAN spur la Ajay (ArgJ), acetyl article ruta mate kinase (ArgB), and acetyl-NG Tin amino transfer la Ajay (ArgD) each sequence number: 25, 26, 27 and 28 are described as containing the amino acid sequence, putrescine production having to microorganisms.
[Claim 6]
In paragraph 1, in addition to the above three tilt microbes Azay (NCgl1469) Karen spur la active weakened, putrescine having microorganisms to produce.
[Claim 7]
Section 6, above, Oh three tilt Len spur la Ajay (NCgl1469) as stated in column number: 31 or 32 contains the amino acid sequence, putrescine production having to microorganisms.
[Billing section 8]
In paragraph 1, above, amidst the microorganisms, or microbes esque Lycian Cory seems to be, a microorganism your brother putrescine production having to microorganisms.
[Claims 9]
Section 8 to above microbes Escherichia coli or Cory four nights will glue ethereum Tammy Combe, putrescine production having to microorganisms.
[Claims 10]
(I) of paragraph (1) or article 9 either due to having to produce putrescine microorganisms as far as the culture medium to cultivate the water stage; And (ii) the above cultured microorganisms or cultured from the putrescine contains the steps to recover, Pew trail God's production methods.

Documents

Application Documents

# Name Date
1 Sequence listing [16-10-2015(online)].pdf 2015-10-16
2 Priority Document [16-10-2015(online)].pdf 2015-10-16
3 Form 5 [16-10-2015(online)].pdf 2015-10-16
4 Form 3 [16-10-2015(online)].pdf 2015-10-16
5 Form 18 [16-10-2015(online)].pdf 2015-10-16
6 Drawing [16-10-2015(online)].pdf 2015-10-16
7 Description(Complete) [16-10-2015(online)].pdf 2015-10-16
8 3483-KOLNP-2015-(14-12-2015)-PA.pdf 2015-12-14
9 3483-KOLNP-2015-(14-12-2015)-CORRESPONDENCE.pdf 2015-12-14
10 3483-KOLNP-2015-(14-12-2015)-ASSIGNMENT.pdf 2015-12-14
11 Other Patent Document [04-08-2016(online)].pdf 2016-08-04
12 3483-KOLNP-2015-FER.pdf 2018-09-26
13 3483-KOLNP-2015-OTHERS [26-03-2019(online)].pdf 2019-03-26
14 3483-KOLNP-2015-FER_SER_REPLY [26-03-2019(online)].pdf 2019-03-26
15 3483-KOLNP-2015-CLAIMS [26-03-2019(online)].pdf 2019-03-26
16 3483-KOLNP-2015-HearingNoticeLetter-(DateOfHearing-31-01-2020).pdf 2020-01-01
17 3483-KOLNP-2015-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [27-01-2020(online)].pdf 2020-01-27
18 3483-KOLNP-2015-ExtendedHearingNoticeLetter-(DateOfHearing-02-03-2020).pdf 2020-01-28
19 3483-KOLNP-2015-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [27-02-2020(online)].pdf 2020-02-27
20 3483-KOLNP-2015-ExtendedHearingNoticeLetter-(DateOfHearing-01-04-2020).pdf 2020-02-28
21 Drawing [16-10-2015(online)].pdf 2015-10-16
21 3483-KOLNP-2015-FORM 3 [28-03-2020(online)].pdf 2020-03-28
22 Form 18 [16-10-2015(online)].pdf 2015-10-16
22 3483-KOLNP-2015-US(14)-ExtendedHearingNotice-(HearingDate-20-05-2020).pdf 2020-05-06
23 3483-KOLNP-2015-US(14)-ExtendedHearingNotice-(HearingDate-03-08-2020).pdf 2020-06-22
23 Form 3 [16-10-2015(online)].pdf 2015-10-16
24 3483-KOLNP-2015-Correspondence to notify the Controller [29-07-2020(online)].pdf 2020-07-29
24 Form 5 [16-10-2015(online)].pdf 2015-10-16
25 3483-KOLNP-2015-Written submissions and relevant documents [18-08-2020(online)].pdf 2020-08-18
25 Priority Document [16-10-2015(online)].pdf 2015-10-16
26 3483-KOLNP-2015-PETITION UNDER RULE 137 [18-08-2020(online)].pdf 2020-08-18
26 Sequence listing [16-10-2015(online)].pdf 2015-10-16

Search Strategy

1 3843kolnp2015_24-09-2018.pdf