Sign In to Follow Application
View All Documents & Correspondence

Recombinant Microorganism For Putrescine Production And Method For Producing Putrescine Using Same

Abstract: ABSTRACT RECOMBINANT MICROORGANISM FOR PUTRESCINE PRODUCTION AND METHOD FOR PRODUCING PUTRESCINE USING SAME The present invention relates to a recombinant microorganism capable of producing putrescine, in which the microorganism is modified to have enhanced NCgl2522 activity, thereby producing putrescine in a high yield, and a method for producing putrescine using the microorganism. FIG. 1

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
06 August 2020
Publication Number
40/2020
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
cal@patentindia.com
Parent Application
Patent Number
Legal Status
Grant Date
2024-08-22
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu Seoul 100-400

Inventors

1. KIM, Chang Gyeom
521-604, 567, Songpa-daero, Songpa-gu, Seoul 138-916
2. LEE, Kyoung Min
716ho, 10-20, Yangcheon-ro 57-gil, Gangseo-gu, Seoul 157-807
3. UM, Hye Won
122-101, 36, Gwongwang-ro 260beon-gil, Yeongtong-gu, Suwon-si, Gyeonggi-do 443-710
4. PARK, Su Jin
506ho, 10-20, Yangcheon-ro 57-gil, Gangseo-gu, Seoul 157-807
5. YANG, Young Lyeol
1910-101, 99, Seongsin-ro, Deogyang-gu, Goyang-si, Gyeonggi-do 412-719
6. YOON, Jong Hyun
302-1506, 53, Goyang-daero 1384beon-gil, Deogyang-gu, Goyang-si, Gyeonggi-do 412-710
7. LEE, Baek Seok
3rd Floor, 19, Ogeum-ro 17-gil, Songpa-gu, Seoul 138-829
8. LEE, Sun Young
304-707, 127, Dunsannam-ro, Seo-gu, Daejeon 302-771
9. JUNG, Hee Kyoung
49, Jeungga-ro 10-gil, Seodaemun-gu, Seoul 120-806
10. LI, Hong Xian
B-608, 34, Hwagok-ro 66-gil, Gangseo-gu Seoul 157-840

Specification

Technical field
[One]
The present invention relates to a recombinant microorganism having improved putrescine productivity and a method for producing putrescine in high yield using the same.
[2]
Background
[3]
Polyamines such as spermidine and spermine are substances present in most living cells, and putrescine (1,4-butanediamine) is a precursor in the metabolism of spermidine and spermine. Is used. Putresin is found in Gram-negative bacteria and fungi and is expected to play an important role in microbial metabolism because it is present in high concentrations in various species.
[4]
In general, putrescine is an important raw material for synthesizing polyamine nylon-4,6 by reacting with adipic acid, and mainly acrylonitrile and succinonitrile from propylene. It is produced by fermentation chemical synthesis. This chemical synthesis method is a three-step process including a catalytic oxidation reaction step, a step using a cyanide compound, and a hydrogenation step using high pressure hydrogen, which consumes a lot of energy, is not environmentally friendly, and runs out of petroleum resources. It has a problem called. Therefore, there is a demand for a method using biomass that is more environmentally friendly and can reduce energy consumption for the production of putrescine.
[5]
The biosynthetic pathway of arginine is the same from glutamate to ornithine synthesis in the microbial putrescine biosynthesis pathway. Two pathways are known to synthesize putresin through decarboxylation of ornithine produced as an intermediate material, or through agmatine from arginine (Morris). et al., J Biol. Chem. 241: 13, 3129-3135, 1996). These two pathways either generate energy required for metabolism or confer stress tolerance to acid.
[6]
As a method of producing putresin using microorganisms, a method of producing putrescine at high concentration by transforming E. coli and Coritebacterium has been disclosed (International Patent Publication WO06/005603; International Patent Publication WO09/125924; Qian ZD et al., Biotechnol.Bioeng. 104: 4, 651-662, 2009; Schneider et al., Appl. Microbiol. Biotechnol. 88: 4, 859-868, 2010; Schneider et al., Appl. Microbiol. Biotechnol. 91 : 17-30, 2011). For example, in WO09/125924, instead of inactivating the pathway involved in the decomposition and use of putrescine present in E. coli, and inactivating the pathway in which ornithine, a precursor of putrescine, is converted to arginine, the ornithine biosynthetic pathway A method of preparing putrescine in high yield by strengthening is disclosed. In addition, Schneider (2010) discloses a method for producing putrescine at a high concentration by introducing a protein that converts ornithine to putresin in a strain of the genus Corynebacterium that does not have putresin-producing ability and enhancing its activity. .
[7]
Furthermore, studies on putrescine transporters have been actively conducted on E. coli, yeast, plant and animal cells (K Igarashi, Plant Physiol. Biochem. 48: 506-512, 2010). E. coli putrescine influx is carried out by a total of four pathways: potABCD or potFGHI using ATP hydrolysis, and potE, an H+ symporter, and puuP in the puu pathway. Looking at the Km values ​​of the complexes involved in the influx of putrescine, PotFGHI is 0.5 mM, potABCD is 1.5 mM, potE is 1.8 mM, and puuP is 3.7 mM. Is considered to be. In addition, the potE transporter has both putrescine inlet and outlet functions. At neutral pH, putrescine enters the cell along with protons. However, when the pH is changed to acidic conditions, it is expressed with speF, a putrescine synthase, and ornithine from outside the cell is introduced into the cell, and putrescine synthesized inside the cell is released to the outside of the cell (Kurihara et.al., J. Bacteriology 191: 8, 2776-2782, 2009).
[8]
As yeast putrescine-releasing proteins, TPO1 and TPO4, which are highly similar to the amino acid sequence of Blt, a multidrug transporter of Bacillus, are known. The two excreted proteins have the same characteristics as potE of E. coli. In basic conditions, putrescine, spermidine, and spermin are introduced into the cell, whereas in acidic conditions, they have the function of excreting them out of the cell. In addition, TPO5 located in golgi or post-golgi secretory vesicles showed resistance to 120 mM putrescine when enhanced expression, while sensitivity to 90 mM putrescine when defective (Tachihara et. al,, J. Biological Chemistry, 280(13): 12637-12642, 2005).
[9]
In animal cells, the synthesis, degradation, inflow and excretion of putrescine are subject to various controls. Although there are not as many studies on polyamine excretion as E. coli or yeast, SLC3A2, an arginine/diamine exporter in colon epithelial cells, introduces extracellular arginine into the cell and putrescine and acetylspur. It has been reported that it acts to excrete mydin and acetylspermine to the outside of the cell. However, in plant cells, putrescine influx and excretion have not yet been reported (Igarashi et al., Plant Physiol. & Biochem. 48: 506-512, 2010).
[10]
On the other hand, because microorganisms in Corynebacterium do not have a pathway for biosynthesis of putrescine, there is no research on the release of putrescine. However, according to a recent report, it has been reported that enhancing the expression of cg2983 membrane protein in a strain producing cadaverine, a type of polyamine, restores cell growth and increases cadaverine productivity (Kind et. al., Metabolic). Engineering 13: 617-627, 2011).
[11]
However, there has been no report on the growth of a microorganism having putresin-producing ability or putresin-producing ability in relation to the putrescine-releasing protein, and the relationship between cg2983 membrane protein and putresin-releasing function has not yet been reported. Is not mentioned at all.
[12]
[13]
Under this background, the present inventors have made intensive research efforts to develop a strain capable of producing putresin at a higher yield, as a result of which NCgl2522 functions as a protein excreting putresin in a microorganism of the genus Corynebacterium, a strain producing putresin. And it was confirmed that if the activity of NCgl2522 was enhanced compared to its intrinsic activity, putrescine could be produced in high yield. In addition, by confirming that the amount of putrescine in the culture medium increased when NCgl2522 was expressed in Escherichia coli having a putrescine production pathway, the present invention was completed by confirming that NCgl2522 acts as a putrescine-releasing protein in E. coli.
[14]
Detailed description of the invention
Technical challenge
[15]
One object of the present invention is to provide a recombinant microorganism capable of producing putrescine in high yield by mutating to enhance NCgl2522 activity.
[16]
Another object of the present invention is to provide a method for producing putrescine in high yield using the microorganism.
[17]
Means of solving the task
[18]
As one aspect for achieving the above object, the present invention provides a microorganism having putrescine-producing ability, modified to enhance the activity of a protein comprising an amino acid sequence represented by SEQ ID NO: 21 or 23.
[19]
In one embodiment, the present invention is modified so that the activity of the microorganism is further weakened compared to the intrinsic activity of ornithine carbamoyl transferase (ArgF) and glutamate excretion protein (NCgl1221), It provides a microorganism having putrescine-producing ability, in which the activity of boxylase (ODC) has been introduced.
[20]
As another embodiment, in the present invention, the ornithine carbamoyl transferase (ArgF) comprises an amino acid sequence represented by SEQ ID NO: 29, and the protein (NCgl1221) involved in glutamate release is SEQ ID NO: 30 It includes the amino acid sequence described as, and ornithine dicarboxylase (ODC) is that comprising the amino acid sequence set forth in SEQ ID NO: 33, provides a microorganism having putrescine-producing ability.
[21]
In yet another embodiment, the present invention is that the microorganism is additionally acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), and It provides a microorganism having putrescine-producing ability, which is modified so that the activity of acetylornithine aminotransferase (ArgD) is enhanced compared to its intrinsic activity.
[22]
In another embodiment, the present invention provides the acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), and acetylornithine aminotransfer. Raase (ArgD) provides a microorganism having putrescine-producing ability, which comprises an amino acid sequence represented by SEQ ID NOs: 25, 26, 27 and 28, respectively.
[23]
In another embodiment, the present invention provides a microorganism having putrescine-producing ability, wherein the microorganism is further weakened in the activity of acetyltransferase.
[24]
In another embodiment, the present invention provides a microorganism having putrescine-producing ability, wherein the acetyltransferase comprises an amino acid sequence represented by SEQ ID NO: 31 or 32.
[25]
In another embodiment, the present invention provides a microorganism having putrescine-producing ability, wherein the microorganism is a microorganism of the genus Escherichia or a coryneform microorganism.
[26]
In another embodiment, the present invention provides a microorganism having putrescine-producing ability, wherein the microorganism is E. coli or Corynebacterium glutamicum.
[27]
In another aspect, the present invention provides a method for producing putrescine comprising the step of culturing a microorganism having putrescine-producing ability to obtain a culture, and recovering putrescine from the cultured microorganism or culture. .
[28]
[29]
Hereinafter, the present invention will be described in detail.
[30]
The present invention provides a recombinant Corynebacterium genus microorganism having a putrescine-producing ability in a microorganism of the genus Corynebacterium whose NCgl2522 activity is enhanced compared to its intrinsic activity, thereby improving putrescine productivity.
[31]
The term "NCgl2522" used in the present invention refers to a permease belonging to the major facilitator superfamily (MFS) as a membrane protein identified in Corynebacterium glutamicum ATCC13032. The NCgl2522 is known to excrete diaminopentane from Corynebacterium glutamicum to the outside of cells. In the present invention, it was confirmed that NCgl2522 acts as a transporter responsible for excreting putrescine generated in cells to the outside of cells. Based on this, a recombinant microorganism exhibiting high yield of putrescine productivity is provided by modifying the NCgl2522 activity to be enhanced compared to its intrinsic activity to increase the excretion of putrescine generated in cells.
[32]
The term "intrinsic activity" as used in the present invention refers to the active state of the enzyme possessed by the original microorganism in an unmodified state, and "modified to be enhanced compared to the intrinsic activity" means that the enzyme activity in the state before modification When the activity is newly introduced or further improved.
[33]
In the present invention, "enhancement of enzyme activity" includes not only introducing or increasing the activity of the enzyme itself to derive an effect beyond the original function, but also increasing intrinsic gene activity, amplifying intrinsic gene from internal or external factors, the above Including that the activity is increased by deletion of a regulatory factor that inhibits gene expression, an increase in the number of gene copies, introduction of a gene from the outside, modification of the expression control sequence, particularly promoter replacement or modification, and an increase in enzyme activity due to mutations in the gene. do.
[34]
In the present invention, "modified so as to be enhanced compared to intrinsic activity" means that a gene exhibiting activity is introduced or the copy number of the gene is increased, the deletion of the inhibitory regulator of the gene expression, or modification of the expression control sequence, for example, improvement This refers to a state in which the activity of the microorganism after the manipulation is increased compared to the activity of the microorganism before the manipulation such as the use of a promoter that has been modified.
[35]
NCgl2522 whose activity is increased by the present invention is not particularly limited thereto, but is a protein comprising the amino acid sequence of SEQ ID NO: 21 or 23, or 70% or more, preferably 80% or more, more preferably It may be a protein of an amino acid sequence showing homology of 90% or more, even more preferably 95% or more, even more preferably 98% or more, and most preferably 99% or more. In addition, there is a case where there is a difference in the amino acid sequence of the protein exhibiting the activity according to the species or strain of the microorganism, and is not limited thereto. That is, as long as it is a protein that can help increase putrescine productivity by enhancing its activity, substitution, deletion, insertion or addition of one or several amino acids at one or more positions of the amino acid sequence of SEQ ID NO: 21 or 23 It may be a protein mutant or artificial variant having an amino acid sequence including the like. At this time, the term "several" varies depending on the position and type in the three-dimensional structure of the amino acid residue of the protein, but is specifically 2 to 20, preferably 2 to 10, more preferably 2 to 5 . In addition, substitutions, deletions, insertions, additions, or inversions of these amino acids include those occurring due to naturally occurring mutations or artificial mutations based on differences in individual or species of microorganisms containing the activity of the polypeptide. do.
[36]
Microorganisms in the genus Corynebacterium do not have a pathway for biosynthesis of putrescine, but when ornithine decarboxylase (ODC) is introduced from the outside, putrescine is synthesized and putrescine is released to the outside of the cell. This indicates that among the numerous membrane proteins of microorganisms in the genus Corynebacterium, an excreted protein that acts as a putrescine pathway, that is, a transporter exists. Accordingly, the present inventors produced a chromosomal library of wild-type Corynebacterium glutamicum ATCC13032 to identify putrescine-releasing proteins from microorganisms in the genus Corynebacterium, and this is a putrescine producing strain, Corynebacterium glutamicum KCCM11138P. After transformation, strains growing in a minimal medium containing putresin were selected. A clone (B19) having putrescine resistance was finally selected through the third colony selection, and it was confirmed that it contained NCgl2522 through nucleotide sequence analysis (see FIG. 1). As such, as a putrescine-releasing protein, NCgl2522 derived from Corynebacterium glutamicum ATCC13032 contains the amino acid sequence described in SEQ ID NO: 21, and has 98% homology to the amino acid sequence. NCgl2522 from ATCC13869 comprises the amino acid sequence set forth in SEQ ID NO: 23.
[37]
As long as the polynucleotide encoding NCgl2522 of the present invention has similar activity to the NCgl2522 protein, the amino acid sequence of SEQ ID NO: 21 or 23 or 70% or more, preferably 80% or more, more preferably 90% of the sequence Or more, more preferably 95% or more, even more preferably 98% or more, most preferably 99% or more, may comprise a polynucleotide encoding a protein showing homology, most preferably SEQ ID NO: 20 Or it may include the nucleotide sequence of 22.
[38]
In the above, the term "homology" refers to the identity between two amino acid sequences, and uses BLAST 2.0 to calculate parameters such as score, identity, and similarity, which are well known to those skilled in the art. Can be determined in a way.
[39]
In addition, the polynucleotide encoding NCgl2522 of the present invention can be hybridized with a nucleotide sequence of SEQ ID NO: 20 or 22 or a probe derived from the nucleotide sequence under stringent conditions, and normally functions NCgl2522. It may be a coding variant. As used herein, the term "strict conditions" means conditions that allow specific hybridization between polynucleotides. For example, such stringent conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols. in Molecular Biology, John Wiley & Sons, Inc., New York).
[40]
In the present invention, "modifying the activity of NCgl2522 to be enhanced compared to intrinsic activity" means that the number of copies of the polynucleotide encoding the protein is increased, the expression control sequence is modified to increase the expression of the polynucleotide, and the activity of the enzyme is Modification of the polynucleotide sequence on the chromosome to be enhanced, deletion of inhibitory regulatory factors of the gene expression, or combinations thereof.
[41]
In the above, the increase in the copy number of the polynucleotide is not particularly limited thereto, but may be performed in a form operably linked to a vector, or by being inserted into a chromosome in a host cell. Specifically, the polynucleotide encoding the protein of the present invention can be operably linked, can be carried out by introducing a vector capable of replicating and functioning independently of the host into a host cell, or the polynucleotide is operably linked, a host A vector capable of inserting the polynucleotide into a chromosome in a cell is introduced into a host cell, thereby increasing the number of copies of the polynucleotide in the chromosome of the host cell.
[42]
The term "vector" as used herein refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable control sequence so that the protein of interest can be expressed in a suitable host. Such regulatory sequences include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling termination of transcription and translation. Vectors can be transformed into a suitable host cell and then replicated or function independently of the host genome, and can be integrated into the genome itself.
[43]
The vector used in the present invention is not particularly limited as long as it is capable of replicating in host cells, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used. The vector usable in the present invention is not particularly limited, and a known expression vector may be used. Preferably, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector, etc. may be used, and more preferably pDZ vector may be used.
[44]
In addition, a polynucleotide encoding a target protein in a chromosome can be replaced with a mutated polynucleotide through a vector for chromosome insertion into bacteria. Insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, by homologous recombination. Since the vector of the present invention may be inserted into a chromosome by causing homologous recombination, it may further include a selection marker for confirming whether the chromosome is inserted. Selectable markers are used to select cells transformed with a vector, that is, to confirm the insertion of the desired polynucleotide, and give a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins. Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
[45]
In the present invention, the term "transformation" means introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette usually includes a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell.
[46]
In addition, the term "operably linked" in the above means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a protein of interest of the present invention and the gene sequence are functionally linked.
[47]
Next, modifying the expression control sequence to increase the expression of the polynucleotide is not particularly limited thereto, but deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence to further enhance the activity of the expression control sequence, or It can be carried out by inducing a mutation in the sequence in combination, or by replacing it with a nucleic acid sequence having a stronger activity. The expression control sequence includes, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling the termination of transcription and translation, and the like.
[48]
A strong heterologous promoter may be connected to the top of the polynucleotide expression unit instead of the original promoter.Examples of the strong promoter include CJ7 promoter, lysCP1 promoter, EF-Tu promoter, groEL promoter, aceA or aceB promoter, and the like, more preferably Specifically, it is operably linked to the lysCP1 promoter or the CJ7 promoter, which is a promoter derived from Corynebacterium, thereby improving the expression rate of the polynucleotide encoding the enzyme. Here, the lysCP1 promoter is an improved promoter through nucleotide sequence substitution in the promoter region of the polynucleotide encoding aspartate kinase and aspartate semialdehyde dehydrogenase. It is a powerful promoter that can be increased five times (WO 2009/096689). In addition, the CJ7 promoter can be expressed in Corynebacterium ammoniagenes and Escherichia while searching for a region having a strong promoter sequence from Corynebacterium ammoniagenes, and it is confirmed that it has a strong promoter activity. It is a promoter that can also be expressed with high intensity in Nebacterium glutamicum (Korean Patent No. 10-620092 and WO 2006/065095).
[49]
In addition, modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but mutations in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof to further enhance the activity of the polynucleotide sequence It can be performed by inducing or by replacing with a polynucleotide sequence modified to have stronger activity.
[50]
In a preferred embodiment of the present invention, in order to provide a microorganism of the genus Corynebacterium with improved putresin productivity, a polynucleotide having a nucleotide sequence of SEQ ID NO: 20 or 22 encoding NCgl2522 involved in putrescine excretion is chromosome. The gene copy number may be increased by introducing into it, or the NCgl2522 own promoter may be substituted with a promoter exhibiting improved activity, preferably the CJ7 promoter having the nucleotide sequence of SEQ ID NO: 24 may be substituted.
[51]
The term "a microorganism having putresin-producing ability" or "a microorganism that produces putresin" as used in the present invention means a microorganism to which putrescine-producing ability is given to a parent strain that does not have putresin-producing ability. The microorganisms that are endowed with the putresin-producing ability or produce putresin are not particularly limited thereto, but acetylglutamate synta that converts glutamate to N-acetylglutamate in order to strengthen the biosynthetic pathway from glutamate to ornithine. Ornithine acetyltransferase (ArgJ), which converts acetylornithine to ornithine, acetylglutamate kinase (ArgB), which converts acetylglutamate to acetylglutamyl phosphate, and acetylglutamyl phosphate. Acetyl gamma glutamyl phosphate reductase (ArgC) converts to glutamate semialdehyde (N-acetylglutamate semialdehyde), acetylornithine aminotransferase (ArgD) converts acetylglutamate semialdehyde to N-acetylornithine It may be that the productivity of ornithine, which is used as a raw material for biosynthesis of putrescine, is improved so as to increase the activity of the intrinsic activity. In addition, the microorganisms are ornithine carbamoyltransfrase (ArgF) involved in the synthesis of arginine from ornithine, a protein involved in the excretion of glutamate (NCgl1221), and/or a protein that acetylates putrescine (NCgl469 ) Is mutated to weaken the activity of the intrinsic activity compared to, and/or
[52]
At this time, the acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), acetylornithine aminotransferase (ArgD), ornithine Carbamoyl transferase (ArgF), protein involved in the excretion of glutamate (NCgl1221), and ornithine decarboxylase (ODC) are not particularly limited thereto, but are preferably SEQ ID NOs: 25, 26, respectively. The amino acid sequence described as 27, 28, 29, 30, and 33, or an amino acid sequence having 70% or more, more preferably 80% or more, and more preferably 90% or more homology thereto may be included. In addition, the protein for acetylating putrescine (NCgl469) is not particularly limited thereto, but preferably, the amino acid sequence represented by SEQ ID NO: 31 or 32 or 70% or more, more preferably 80% or more, more preferably May comprise an amino acid sequence having 90% or more homology.
[53]
Among the proteins, acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), acetylornithine aminotransferase (ArgD) and ornithine Increasing the activity of decarboxylase (ODC) is a method as previously described in relation to the increase in the activity of NCgl2522, such as increasing the copy number of the polynucleotide encoding the protein, and controlling the expression to increase the expression of the polynucleotide. Modification of the sequence, modification of the polynucleotide sequence on the chromosome to enhance the activity of the enzyme, deletion of a modulator that inhibits the expression of the polynucleotide of the enzyme, and combinations thereof.
[54]
In addition, attenuation of the activity of the protein involved in the excretion of ornithine carbamoyl transferase (ArgF) and glutamate (NCgl1221), and the protein that acetylates putresin (NCgl469) is a part of the polynucleotide encoding the protein or Deletion of the whole, modification of the expression control sequence to reduce the expression of the polynucleotide, modification of the polynucleotide sequence on the chromosome such that the activity of the protein is weakened, and combinations thereof.
[55]
Specifically, the method of deleting some or all of the polynucleotide encoding the protein is to convert a polynucleotide encoding an intrinsic target protein in a chromosome through a vector for chromosomal insertion into a bacterium as a polynucleotide or a marker gene in which some nucleic acid sequences are deleted. It can be done by replacing. The "part" is different depending on the type of polynucleotide, but is specifically 1 to 300, preferably 1 to 100, more preferably 1 to 50.
[56]
In addition, the method of modifying the expression control sequence is performed by inducing a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination of the nucleic acid sequence to further weaken the activity of the expression control sequence, or further This can be done by replacing with a nucleic acid sequence having weak activity. The expression control sequence includes a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling the termination of transcription and translation.
[57]
In addition, the method of modifying the polynucleotide sequence on the chromosome is performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination of the polynucleotide sequence so as to further weaken the activity of the enzyme. This can be done by replacing with a polynucleotide sequence that has been improved to have activity.
[58]
In addition, the method of deleting a regulatory factor that inhibits the expression of the polynucleotide of the enzyme may be performed by replacing the polynucleotide of the expression suppression factor with a polynucleotide or a marker gene from which some nucleic acid sequences have been deleted. The "part" is different depending on the type of polynucleotide, but is specifically 1 to 300, preferably 1 to 100, more preferably 1 to 50.
[59]
On the other hand, the microorganism of the present invention is a microorganism having putrescine-producing ability, and includes a prokaryotic microorganism expressing a protein comprising an amino acid sequence represented by SEQ ID NO: 21 or 23, examples of which include Escherichia genus ( Escherichia sp.), Shigella sp., Citrobacter sp., Salmonella sp., Enterobacter sp.) Yersinia sp., Kreb Ciel d in ( Klebsiella SP.), air Winiah in ( Erwinia SP.), the genus Corynebacterium ( of Corynebacterium SP.), Brevibacterium genus ( Brevibacterium SP.), Lactobacillus genus ( Lactobacillus SP.), celecoxib Nomonas ( Selenomanas sp.), Vibriosp.), Pseudomonas sp., Streptomyces sp., Arcanobacterium sp., Alcaligenes sp. Preferably, the microorganism of the present invention is a microorganism belonging to the genus Escherichia or a microorganism belonging to the genus Corynebacterium, more preferably E. coli or Corynebacterium glutamicum .
[60]
In a specific embodiment of the present invention, a microorganism of the genus Corynebacterium having accession number KCCM11138P as a strain having a high-concentration putresin-producing ability by enhancing the pathway for producing putresin from glutamate (Korea Patent Publication No. 2012-0064046) and Microorganisms of the genus Corynebacterium with accession number KCCM11240P (Korean Patent Application No. 2012-0003634) were used.
[61]
In another embodiment of the present invention, putresins based on Corynebacterium glutamicum ATCC13869 each having the same genotype as KCCM11138P and KCCM11240P, which are putrescine-producing strains based on Corynebacterium glutamicum ATCC13032 Production strains DAB12-a and DAB12-b were used. The ATCC13869 strain can be obtained from the American Type Culture Collection (ATCC). That is, each strain is assigned a unique registration number listed in ATCC's catalog, and can be ordered using this registration number. Specifically, putrescine-producing strain DAB12-a is a gene encoding ornithine carbamoyl transferase (ArgF) from Corynebacterium glutamicum ATCC13869 and a gene encoding glutamate excreting protein NCgl1221 is deleted, orni A gene encoding tin decarboxylase (OCD) is introduced, and the promoter of the ornithine biosynthetic gene operon (argCJBD) is replaced with an improved promoter. In addition, the putrescine-producing strain DAB12-b is characterized in that the activity of the protein NCgl1469 that acetylates putresin in the DAB12-a strain is modified so that the activity of the protein NCgl1469 is weakened than the intrinsic activity.
[62]
[63]
According to a preferred embodiment of the present invention, first, a gene encoding ornithine carbamoyl transferase (ArgF) in a chromosome in wild-type Corynebacterium glutamicum ATCC13032 and a protein involved in glutamate release (NCgl1221) are encoded. The gene is deleted, and the promoter of the ArgCJBD gene group, which encodes the enzyme involved in the synthesis of ornithine in glutamate, is replaced with an improved promoter, and the gene encoding ornithine decarboxylase (ODC) is introduced into the chromosome. Corynebacterium glutamicum KCCM11138P and Corynebacterium glutamicum KCCM11240P, which further weakened the gene encoding the acetyltransferase NCgl1469 in the microorganism, were prepared as putrescine-producing strains.
[64]
On the other hand, in order to produce an NCgl2522-deficient strain derived from Corynebacterium glutamicum ATCC13032, a plasmid pDZ-1'NCgl2522 (K/O) was prepared based on the nucleotide sequence of NCgl2522 derived from Corynebacterium glutamicum ATCC13032. I did.
[65]
The plasmid pDZ-1'NCgl2522 (K/O) was transduced into the prepared putrescine-producing strains KCCM11138P and KCCM11240P, respectively, and then selected as NCgl2522-deficient strains, and these strains were named as KCCM11138P ΔNCgl2522 and KCCM11240P ΔNCgl2522, respectively. In the same manner as described above, an NCgl2522-deficient strain derived from Corynebacterium glutamicum ATCC13869 was prepared and named DAB12-a ΔNCgl2522 and DAB12-b ΔNCgl2522.
[66]
As a result of comparing putrescine-producing ability of the four NCgl2522-deficient strains prepared in this way and the parent strain, KCCM11138P △NCgl2522, KCCM11240P △NCgl2522, DAB12-a △NCgl2522 and DAB12-b △NCgl2522 deficient in NCgl2522. It was confirmed that putrescine production was decreased compared to (see Table 3). From the above results, the present inventors confirmed that the activity of NCgl2522 in putrescine-producing strains is closely related to putrescine productivity, and to increase putresin productivity through enhancing its activity, the present inventors produced an NCgl2522-enhanced strain.
[67]
To this end, in a preferred embodiment of the present invention, the CJ7 promoter newly developed by the applicant by introducing additional NCgl2522 in the transposon of the Corynebacterium cleutamicum strain or NCgl2522 itself in the chromosome (KCCM10617, Korean Patent No. 10-0620092).
[68]
As a result of comparing the putrescine-producing ability of the six types of NCgl2522-enhanced strains produced in this way and the parent strain, it was confirmed that putrescine production was increased in all strains that additionally introduced NCgl2522 into the transposon compared to the parent strain (Table 6). Reference). As a result of measuring the intracellular putresin concentration of the NCgl2522-enhanced strain showing an increased putrescine-producing ability, it was confirmed that the intracellular putresin concentration decreased compared to the parent strain (see Table 9). From the above results, the present inventors confirmed that as the activity of NCgl2522 in the putrescine-producing strain was enhanced, the excretion of putrescine produced in the cell to the outside of the cell was increased, and finally putresin productivity was improved.
[69]
Accordingly, the present inventors modified to enhance the activity of NCgl2522 compared to intrinsic activity in the putrescine-producing strain Corynebacterium glutamicum KCCM11138P, thereby showing increased putrescine excretion capacity, thereby improving putrescine productivity. The microorganism in the genus Corynebacterium glutamicum CC01-0510 was named Corynebacterium glutamicum CC01-0510, and was deposited with the Korean Culture Center of Microorganisms (KCCM) on March 8, 2013 under the Budapest Treaty, and was given the deposit number KCCM11401P.
[70]
[71]
According to another aspect of the present invention, the present invention
[72]
(i) obtaining a culture by culturing the microorganism having improved putrescine productivity; And
[73]
(ii) It provides a method for producing putrescine, comprising the step of recovering putrescine from the cultured microorganism or culture.
[74]
In the above method, the step of culturing the microorganism is not particularly limited thereto, but is preferably performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, preferably pH 6 to 8, most preferably pH 6.8) can be adjusted, oxygen or an oxygen-containing gas mixture can be introduced into the culture to maintain aerobic conditions, and the culture temperature is 20 to 45°C, preferably 25 to It is possible to maintain 40 ℃, it is preferable to incubate for about 10 to 160 hours. Putresin produced by the culture may be secreted into the medium or may remain in the cells.
[75]
In addition, the culture medium used is a carbon source such as sugars and carbohydrates (eg glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (eg, soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol), and organic acids (such as acetic acid) can be used individually or in combination, ; Nitrogen sources include nitrogen-containing organic compounds (e.g. peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea), or inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and Ammonium nitrate) or the like may be used individually or in combination; Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, corresponding sodium-containing salts, etc. may be used individually or in combination as the phosphorus source; Other metal salts (eg magnesium sulfate or iron sulfate), amino acids and essential growth-promoting substances such as vitamins may be included.
[76]
The method of recovering putrescine produced in the culturing step of the present invention is to collect the desired amino acid from the culture medium using a suitable method known in the art according to a cultivation method, for example, a batch, continuous, or fed-batch cultivation method. can do.
[77]
Effects of the Invention
[78]
The microorganisms of the genus Corynebacterium with improved putresin productivity of the present invention have been modified so that the activity of NCgl2522, which releases putrescine in the cell, is enhanced more than intrinsic activity, thereby increasing the release of putrescine to the outside of the cell. It was confirmed that the resistance to the also increased.
[79]
In addition, it was confirmed that when NCgl2522 was expressed in Escherichia coli including the putrescine production pathway of the present invention, the amount of putrescine out of the cells was increased. Therefore, NCgl2522 derived from Corynebacterium glutamicum may be widely used in the production of effective putresin by applying it to microorganisms having putrescine-producing ability.
[80]
Brief description of the drawing
[81]
1 is a schematic diagram showing that NCgl2522 is contained in a clone (B19) finally selected from a transformed colony into which a Corynebacterium chromosome library was introduced according to the present invention.
[82]
2 is a result of evaluating the resistance to putrescine of the recombinant strain in which NCgl2522 was deleted or enhanced according to the present invention.
[83]
1: KCCM11240P
[84]
2: KCCM11240P △NCgl2522
[85]
3: KCCM11240P P(CJ7)-NCgl2522
[86]
Mode for carrying out the invention
[87]
Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.
[88]
[89]
Reference Example 1: Preparation of microorganisms in the genus Corynebacterium having putrescine-producing ability
[90]
In order to produce a microorganism of the genus Corynebacterium having putrescine-producing ability, as described in Korean Patent Publication No. 2012-0064046, a biosynthetic pathway that blocks the biosynthetic pathway from ornithine to arginine and produces ornithine from glutamate The microorganisms with putrescine-producing ability were prepared by enhancing the activity of and introducing ornithine decarboxylase (OCD) from foreign sources.
[91]
Specifically, based on Corynebacterium glutamicum ATCC13032, a gene encoding ornithine carbamoyl transferase (ArgF) in the chromosome of the strain and a gene encoding NCgl1221, a protein involved in glutamate excretion Was deleted by homologous recombination to increase the intracellular content of glutamate, an ornithine precursor. In addition, a gene encoding ornithine dicarboxylase (ODC) derived from wild-type E. coli W3110, which is involved in the synthesis of putrescine from ornithine, was introduced into the strain into the chromosome. In addition, a Corynebacterium glutamicum strain having putrescine-producing ability was produced by replacing the own promoter of the argCJBD gene group, which encodes an enzyme involved in the synthesis of ornithine in glutamate, with the improved promoter CJ7 promoter. At this time, the argCJBD is acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), acetyl orni, which is involved in the ornithine biosynthesis pathway in glutamate. It encodes for tin aminotransferase (ArgD). The Corynebacterium glutamicum strain having putrescine-producing ability thus produced was deposited on November 24, 2010 with the Korea Microbial Conservation Center (KCCM) under the Budapest Treaty, and was given the deposit number KCCM11138P. A detailed process with respect to the production of microorganisms of the genus Corynebacterium having putrescine-producing ability is described in detail in Korean Patent Application Publication No. 2012-0064046, the whole of which is incorporated herein by reference.
[92]
[93]
Reference Example 2: Preparation of microorganisms in the genus Corynebacterium having putrescine-producing ability
[94]
As another microorganism of the genus Corynebacterium having putrescine-producing ability, the gene encoding NCgl1469, an acetyltransferase in Corynebacterium glutamicum KCCM11138P produced in Reference Example 1, was weakened to By not generating tresine, a Corynebacterium glutamicum strain with increased putrescine production was produced.
[95]
Specifically, based on the nucleotide sequence of the gene encoding NCgl1469 of Corynebacterium glutamicum ATCC13032, a primer pair of SEQ ID NOs: 1 and 2 for obtaining a homologous recombination fragment of the N-terminal region of NCgl1469 and C of NCgl1469 -Primer pairs of SEQ ID NOs: 3 and 4 to obtain a homologous recombination fragment at the terminal site were prepared as shown in Table 1 below.
[96]
[97]
Table 1 [Table 1]
primer Sequence (5'-3')
NCgl1469-del-F1_BamHI (SEQ ID NO: 1) CGGGATCCAACCTTCAGAACGCGAATAC
NCgl1469-del-R1_SalI (SEQ ID NO: 2) CGCGTCGACTTGGCACTGTGATTACCATC
NCgl1469-del-F2_SalI (SEQ ID NO: 3) CGCGTCGACTTGGGTTATATCCCCTCAGA
NCgl1469-del-R2_XbaI (SEQ ID NO: 4) TGCTCTAGATAGTGAGCCAAGACATGGAA
[98]
[99]
Using the genomic DNA of the Corynebacterium glutamicum ATCC13032 as a template, PCR was performed using each of two pairs of primers to obtain PCR fragments of the N-terminal region and the C-terminal region, respectively, and then subjected to electrophoresis. The desired fragment was obtained. At this time, the PCR reaction was repeated 30 times of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. The obtained N-terminal fragment was treated with restriction enzymes BamHI and SalI, and the C-terminal fragment was treated with restriction enzymes SalI and XbaI, and the treated fragment was treated with restriction enzymes BamHI and XbaI in pDZ vector. By cloning, plasmid pDZ-NCgl1469 (K/O) was prepared.
[100]
The plasmid pDZ-NCgl1469 (K/O) was introduced into Corynebacterium glutamicum KCCM11138P by electroporation to obtain a transformant, and the transformants were kanamycin (25 μg/ml) and X-gal( 5-bromo-4-chloro-3-indolin--D-galactoside) containing BHIS plate medium (Braine heart infusion 37 g/ℓ, sorbitol 91 g/ℓ, agar 2%) and cultured to form colonies Made it. The strain into which the plasmid pDZ-NCgl1469 (K/O) was introduced was selected by selecting a blue colony from the colonies formed therefrom.
[101]
In CM medium (glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8) the selected strain After inoculation and incubation with shaking at 30° C. for 8 hours, each of them was sequentially diluted from 10 -4 to 10 -10 , spread on a solid medium containing X-gal, and cultured to form colonies. Among the formed colonies, white colonies appearing at a relatively low ratio were selected, and the gene encoding NCgl1469 was deleted, thereby producing a Corynebacterium glutamicum strain with improved putrescine productivity. The Corynebacterium glutamicum strain with improved putrescine-producing ability thus produced was named KCCM11138P NCgl1469, and was deposited with the Korea Microbial Conservation Center (KCCM) on December 26, 2011 under the Budapest Treaty, and the deposit number KCCM11240P was given. received. A detailed process with respect to the production of microorganisms in the genus Corynebacterium having putrescine-producing ability is described in detail in Korean Patent Application No. 2012-0003634, the whole of which is incorporated herein by reference.
[102]
[103]
Example 1: Screening of putrescine-releasing protein and selection of library clones conferring resistance to putresin
[104]
Corynebacterium glutamicum does not have a putrescine biosynthetic pathway, but when ornithine decarboxylase is introduced from the outside to have putrescine synthesis ability, putrescine is produced and putrescine is excreted from the cell. This indicates that among the numerous membrane proteins of microorganisms in the genus Corynebacterium, there is a transporter protein that acts as a pathway for excreting putrescine.
[105]
In order to isolate and identify putrescine-releasing proteins from microorganisms in Corynebacterium genus, a chromosomal library of wild-type Corynebacterium glutamicum ATCC13032 was constructed. Specifically, the chromosome of Corynebacterium glutamicum ATCC13032 was treated with the restriction enzyme Sau3AI to perform incomplete cleavage, and a gene fragment of 3 to 5 kb was isolated and treated with BamHI pECCG122 vector (E. coli and Corynebacterium Shuttle vector of the; Korean Patent Publication No. 1992-0000933) was cloned.
[106]
After transforming the obtained Corynebacterium chromosome library into Corynebacterium glutamicum KCCM11138P, a putrescine-producing strain according to reference 1, a minimum medium containing 0.35 M putresin (based on distilled water 1 liter) Glucose 10 g, MgSO 4 ㆍ7H 2 O 0.4 g, NH4Cl 4 g, KH 2 PO 4 1 g, K 2 HPO 4 1 g, Urea 2 g, FeSO 4 ㆍ7H 2 O 10 mg, MnSO 4 ㆍ5H 2 O 1 mg, nicotinamide 5 mg, thiamine lead hydrochloride 5 mg, biotin 0.1 mg, 1 mM arginine, kanamycin 25 mg, 0.35 M putresin containing, pH 7.0) were selected. About 5.5×10 5 transformed colonies into which the Corynebacterium chromosome library was introduced Among 413 clones were selected, and then each library clone obtained from the second confirmation of putresin resistance was re-introduced into the putrescine-producing strain, and then the final one clone ( B19) was selected. As a result of performing nucleotide sequence analysis on the clone, it was confirmed that it contained NCgl2522 (FIG. 1).
[107]
NCgl2522 isolated and identified from Corynebacterium glutamicum ATCC13032 as a putrescine-releasing protein has an amino acid sequence set forth in SEQ ID NO: 21, which is encoded from a polynucleotide having a nucleotide sequence set forth in SEQ ID NO: 20 .
[108]
[109]
Example 2: Preparation of NCgl2522 Defective Strain and Confirmation of Its Putrescine Producing Ability
[110]
<2-1> Construction of NCgl2522-deficient strain from ATCC13032-based putrescine-producing strain
[111]
In order to confirm whether NCgl2522 derived from Corynebacterium glutamicum ATCC13032 is involved in putrescine excretion, a vector for deleting the gene encoding NCgl2522 was constructed.
[112]
Specifically, primer pairs of SEQ ID NOs: 5 and 6 for obtaining a homologous recombination fragment of the N-terminal region of NCgl2522 based on the nucleotide sequence of SEQ ID NO: 20 of the gene encoding NCgl2522, and C- Primer pairs of SEQ ID NOs: 7 and 8 for obtaining a homologous recombination fragment of the terminal region were prepared as shown in Table 2 below.
[113]
[114]
Table 2 [Table 2]
primer Sequence (5'-3')
NCgl2522-del-F1_BamHI (SEQ ID NO: 5) CGGGATCCCACGCCTGTCTGGTCGC
NCgl2522-del-R1_SalI (SEQ ID NO: 6) ACGCGTCGACGGATCGTAACTGTAACGAATGG
NCgl2522-del-F2_SalI (SEQ ID NO: 7) ACGCGTCGACCGCGTGCATCTTTGGACAC
NCgl2522-del-R2_XbaI (SEQ ID NO: 8) CTAGTCTAGAGAGCTGCACCAGGTAGACG
[115]
[116]
Using the genomic DNA of the Corynebacterium glutamicum ATCC13032 as a template, PCR was performed using each of two pairs of primers to amplify the N-terminal and C-terminal PCR fragments of the NCgl2522 gene, respectively, and then The desired fragment was obtained by electrophoresis. At this time, the PCR reaction was repeated 30 times of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. The obtained N-terminal fragment was treated with restriction enzymes BamHI and SalI, and the C-terminal fragment was treated with restriction enzymes SalI and XbaI, and the treated fragment was treated with restriction enzymes BamHI and XbaI in pDZ vector. By cloning, plasmid pDZ-1'NCgl2522 (K/O) was prepared.
[117]
The plasmid pDZ-1'NCgl2522 (K/O) was introduced into Corynebacterium glutamicum KCCM11138P and KCCM11240P according to Reference Examples 1 and 2 by electroporation, respectively, to obtain a transformant, and the transformation BHIS plate medium containing kanamycin (25 μg/ml) and X-gal (5-bromo-4-chloro-3-indolin--D-galactoside) (Braine heart infusion 37 g/ℓ, sorbitol 91 g) /ℓ, agar 2%) and cultured to form colonies. From the colonies formed therefrom, a blue colony was selected to select a strain into which the plasmid pDZ-1'NCgl2522 (K/O) was introduced.
[118]
In CM medium (glucose 10 g/l, polypeptone 10 g/l, yeast extract 5 g/l, beef extract 5 g/l, NaCl 2.5 g/l, urea 2 g/l, pH 6.8) the selected strains After shaking culture (30° C., 8 hours), each of them was sequentially diluted from 10 -4 to 10 -10 , spread on a solid medium containing X-gal, and cultured to form colonies. Among the formed colonies, white colonies appearing at a relatively low ratio were selected, thereby finally selecting a strain in which the gene encoding NCgl2522 was deleted by secondary crossover. PCR was performed using the primer pairs of SEQ ID NOs: 5 and 8 for the finally selected strain, confirming that the gene encoding NCgl2522 was deleted, and the Corynebacterium glutamicum mutants were respectively KCCM11138P △NCgl2522 and KCCM11240P △ It was named NCgl2522.
[119]
[120]
<2-2> Construction of NCgl2522-deficient strain from ATCC13869-based putrescine-producing strain
[121]
Corynebacterium glutamicum ATCC13869-based putrescine-producing strain DAB12-a (argF deletion, NCgl1221) having the same genotype as KCCM11138P and KCCM11240P, which are putresin-producing strains based on Corynebacterium glutamicum ATCC13032 Deletion, E. coli speC introduction, arg operon promoter substitution; see Reference Example 1) and DAB12-b (argF deletion, NCgl1221 deletion, E. coli speC introduction, arg operon promoter substitution, NCgl1469 deletion, reference Example 2) NCgl2522 deletion strains Was produced.
[122]
Specifically, in order to confirm the gene encoding NCgl2522 derived from Corynebacterium glutamicum ATCC13869 and the protein sequence expressed therefrom, the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template and SEQ ID NOs: 5 and 8 PCR was performed using a pair of primers. At this time, the PCR reaction was repeated 30 times of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and stretching for 2 minutes at 72°C. As a result of sequencing after separating the PCR product obtained therefrom by electrophoresis, the gene encoding NCgl2522 derived from Corynebacterium glutamicum ATCC13869 contains the nucleotide sequence described in SEQ ID NO: 22, and thus The protein encoded from contains the amino acid sequence set forth in SEQ ID NO: 23. As a result of comparing the amino acid sequences of NCgl2522 derived from Corynebacterium glutamicum ATCC13032 and NCgl2522 derived from Corynebacterium glutamicum ATCC13869, they were confirmed to have 98% sequence homology.
[123]
In order to delete the gene encoding NCgl2522 derived from Corynebacterium glutamicum ATCC13869, as in Example <2-1>, the genomic DNA of Corynebacterium glutamicum ATCC13869 was used as a template, and 2 shown in Table 2 PCR using each pair of primers was performed to amplify the N-terminal and C-terminal PCR fragments of the NCgl2522 gene, respectively, and then electrophoresis to obtain the desired fragment. At this time, the PCR reaction was repeated 30 times of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. The resulting fragment of the N-terminal region was treated with restriction enzymes BamHI and SalI, the obtained C-terminal region fragment was treated with restriction enzymes SalI and XbaI, and the treated fragment was treated with restriction enzymes BamHI and XbaI pDZ The plasmid pDZ-2'NCgl2522 (K/O) was constructed by cloning into a vector.
[124]
The plasmid pDZ-2'NCgl2522 (K/O) was transformed into Corynebacterium glutamicum DAB12-a and DAB12-b in the same manner as in Example <2-1>, and the gene encoding NCgl2522 was deleted. Strains were selected. Corynebacterium glutamicum mutants selected therefrom were named as DAB12-a ΔNCgl2522 and DAB12-b ΔNCgl2522, respectively.
[125]
[126]
<2-3> Evaluation of putrescine production ability of NCgl2522 deficient strain
[127]
In order to confirm the effect of the NCgl2522 deletion on putrescine production in putrescine-producing strains, targeting the Corynebacterium glutamicum mutant strains produced in Examples <2-1> and <2-2> The tresine production capacity was compared.
[128]
Specifically, 4 types of Corynebacterium glutamicum mutant strains (KCCM11138P ΔNCgl2522, KCCM11240P ΔNCgl2522, DAB12-a ΔNCgl2522, and DAB12-b ΔNCgl2522) and 4 parent strains (KCCM11138P, KCCM-a240P, DAB12a , And DAB12-b) 1 mM arginine-containing CM plate medium (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 µl, agar 2) %, pH 6.8, 1 ℓ standard) and incubated at 30°C for 24 hours. Each strain cultured therefrom is 25 ml of titer medium (Glucose 8%, soy protein 0.25%, corn solid 0.50%, (NH 4 ) 2 SO 4 4%, KH 2 PO 4 0.1%, MgSO 4 ㆍ7H 2 O 0.05%, urea 0.15%, biotin 100 g, thiamine hydrochloride 3 mg, calcium-pantothenic acid 3 mg, nicotinamide 3 mg, CaCO 35%, based on 1 ℓ) after inoculation of about one platinum, it was incubated with shaking at 30°C at 200 rpm for 98 hours. 1 mM arginine was added to the culture medium for all strains. The concentration of putrescine produced from each culture was measured and the results are shown in Table 3 below.
[129]
[130]
Table 3 [Table 3]
Host Genotype Putrescine(g/L)
KCCM11138P (-) 9.8
△NCgl2522 3.0
KCCM11240P(KCCM11138P △NCgl1469) (-) 12.4
△NCgl2522 1.5
DAB12-a (-) 10.2
△NCgl2522 0.7
DAB12-b (DAB12-a △NCgl1469) (-) 13.1
△NCgl2522 0.3
[131]
[132]
As shown in Table 3, it was confirmed that putrescine production was significantly reduced in all four Corynebacterium glutamicum mutant strains lacking NCgl2522.
[133]
[134]
Example 3: Preparation of NCgl2522-enhanced strain and confirmation of its putrescine-producing ability
[135]
<3-1> Introduction of NCgl2522 into transposon gene in ATCC13032 chromosome
[136]
In order to confirm the effect of high putrescine production through the addition of the NCgl2522 gene (including the autologous promoter region) into the chromosome in the microorganism of the genus Corynebacterium KCCM11138P having putrescine production ability, NCgl2522 was introduced into the transposon gene. A transformation vector pDZTn (Korean Patent Laid-Open No. 2008-0033054) was used to enable gene introduction into a chromosome using a transposon gene site of a microorganism of the genus Corynebacterium.
[137]
NCgl2522 gene including an autologous promoter amplified a gene fragment of about 1.88 kb using the chromosome of the ATCC13032 strain as a template, and primer pairs of SEQ ID NOs: 9 and 10 (see Table 4). At this time, the PCR reaction was repeated 30 times of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and stretching at 72°C for 30 seconds or 2 minutes. The PCR result was subjected to electrophoresis on a 0.8% agarose gel, and then a band of a desired size was eluted and purified. The pDZTn vector was treated with XhoI, and the NCgl2522 PCR product of ATCC13032 strain was fusion cloned. Fusion cloning was performed using In-FusionHD Cloning Kit (Clontech). The resulting plasmid was named pDZTn-1'NCgl2522.
[138]
[139]
Table 4 [Table 4]
primer Sequence (5'-3')
1'NCgl2522-FT (SEQ ID NO: 9) TGTCGGGCCCACTAGTGGTGCGACTTCAATTGTGCTCTT
NCgl2522-RT (SEQ ID NO: 10) GAATGAGTTCCTCGAGCTAGTGCGCATTATTGGCTCC
[140]
[141]
The plasmid pDZTn-1'NCgl2522 was introduced into Corynebacterium glutamicum KCCM11138P described in Reference Example 1 by electroporation to obtain a transformant, and the transformant was subjected to the same method as in Example 2. Through this, a strain into which NCgl2522 was introduced into the transposon was selected.
[142]
Using the genomic DNA obtained from the selected strain as a template, PCR was performed using primer pairs of SEQ ID NOs: 9 and 10 to confirm that NCgl2522 was introduced in the transposon by introduction of the plasmid pDZTn-1'NCgl2522. At this time, the PCR reaction was repeated 30 times of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and stretching for 2 minutes at 72°C.
[143]
Corynebacterium glutamicum mutant strain selected therefrom was named KCCM11138P Tn:1'NCgl2522.
[144]
[145]
<3-2> Construction of NCgl2522 promoter-substituted strain from ATCC13032-based putrescine-producing strain
[146]
In order to enhance NCgl2522 activity in putrescine-producing strains, a CJ7 promoter (WO 2006/65095) was introduced before the NCgl2522 initiation codon in the chromosome.
[147]
First, a CJ7 promoter having a nucleotide sequence represented by SEQ ID NO: 24 was included, and a homologous recombination fragment having the original sequence of NCgl2522 on the chromosome was obtained at both ends of the promoter. Specifically, the 5'-end portion of the CJ7 promoter was obtained by performing PCR using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and primer pairs of SEQ ID NOs: 11 and 12. At this time, the PCR reaction was repeated 30 times of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. In addition, the CJ7 promoter region was obtained by performing PCR under the same conditions using a primer pair of SEQ ID NOs: 13 and 14, and the 3'-end region of the CJ7 promoter is the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template. And obtained by performing PCR under the same conditions using the primer pairs of SEQ ID NOs: 15 and 16. Primers used for promoter substitution are shown in Table 5 below.
[148]
[149]
Table 5 [Table 5]
primer Sequence (5'-3')
NCgl2522-L5 (SEQ ID NO: 11) TGCAGGTCGACTCTAGAGTTCTGCGTAGCTGTGTGCC
NCgl2522-L3 (SEQ ID NO: 12) GGATCGTAACTGTAACGAATGG
CJ7-F (SEQ ID NO: 13) CGTTACAGTTACGATCCAGAAACATCCCAGCGCTACTAATA
CJ7-R (SEQ ID NO: 14) AGTGTTTCCTTTCGTTGGGTACG
NCgl2522-R5 (SEQ ID NO: 15) CAACGAAAGGAAACACTATGACTTCAGAAACCTTACAGGCG
NCgl2522-R3 (SEQ ID NO: 16) TCGGTACCCGGGGATCCCACAAAAAGCGTAGCGATCAACG
[150]
[151]
Each PCR product obtained above was fusion cloned into a pDZ vector treated with BamHI and XbaI. Fusion cloning was performed using In-FusionHD Cloning Kit (Clontech). The resulting plasmid was named pDZ-P(CJ7)-1'NCgl2522.
[152]
The plasmid pDZ-P(CJ7)-1'NCgl2522 prepared above was introduced into Corynebacterium glutamicum KCCM11138P and KCCM11240P according to Reference Examples 1 and 2, respectively, by electroporation to prepare transformants. The prepared transformant was inoculated into CM medium and cultured with shaking at 30° C. for 8 hours, and the obtained culture was diluted with 10 -4 to 10 -10 to contain 25 μg/ml kanamycin and X-gal. Colonies were formed by spreading and culturing on BHIS plate medium.
[153]
While most of the colonies show blue color, white colonies appearing at a low ratio were selected to select a strain in which the NCgl2522 promoter was finally replaced with the CJ7 promoter by secondary crossover. Using the genomic DNA obtained from the selected strain as a template, PCR was performed using the primer pairs of SEQ ID NOs: 13 and 16, and the CJ7 promoter was in front of the NCgl2522 initiation codon in the chromosome by introduction of the plasmid pDZ-1'CJ7 (NCgl2522) It was confirmed that it was introduced. At this time, the PCR reaction was repeated 30 times of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and stretching for 1 minute at 72°C.
[154]
Corynebacterium glutamicum mutants selected therefrom were designated as KCCM11138P P(CJ7)-NCgl2522 and KCCM11240P P(CJ7)-NCgl2522, respectively.
[155]
[156]
<3-3> Introduction of gene NCgl2522 in transposon gene in ATCC13869 chromosome
[157]
In order to confirm the effect of high putrescine production through additional insertion of the NCgl2522 gene into the chromosome from the putresin strain derived from Corynebacterium glutamicum ATCC13869, it was decided to introduce NCgl2522 (including the promoter site) into the transposon gene NCgl2522 As for the gene, a gene fragment of about 1.97 kb was amplified using the chromosome of the ATCC13869 strain as a template and primer pairs of SEQ ID NOs: 17 and 10 (see Table 6). At this time, the PCR reaction was repeated 30 times of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and stretching at 72°C for 30 seconds or 2 minutes. From this, the NCgl2522 PCR fragment was fusion cloned into a pDZTn vector treated with XhoI. Fusion cloning was performed using In-FusionHD Cloning Kit (Clontech). The resulting plasmid was named pDZTn-2'NCgl2522.
[158]
[159]
Table 6 [Table 6]
primer Sequence (5'-3')
2'NCgl2522-FT (SEQ ID NO: 17) TGTCGGGCCCACTAGTCTTCAATTCGAGTTGCTGCCAC
NCgl2522-RT (SEQ ID NO: 10) GAATGAGTTCCTCGAGCTAGTGCGCATTATTGGCTCC
[160]
[161]
The plasmid pDZTn-2'NCgl2522 was transformed into Corynebacterium glutamicum DAB12-a in the same manner as in Example <3-1>, confirming that NCgl2522 was introduced in the transposon.
[162]
The Corynebacterium glutamicum mutant selected therefrom was named DAB12-a Tn:2'NCgl2522.
[163]
[164]
<3-4> Construction of NCgl2522 promoter-substituted strain from ATCC13869-based putrescine-producing strain
[165]
In order to introduce the CJ7 promoter in front of the start codon of NCgl2522 derived from Corynebacterium glutamicum ATCC13869, the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template as in Example <3-2>, and Table 7 below. PCR using each of the three pairs of primers described in was performed to amplify the CJ7 promoter region, its N-terminal region, and the C-terminal region PCR fragments, respectively, and electrophoresis to obtain a desired fragment. At this time, the PCR reaction was repeated 30 times of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds. The resulting CJ7 promoter region, its N-terminal region, and PCR fragments of its C-terminal region were fusion cloned into a pDZ vector treated with BamHI and XbaI. Fusion cloning was performed using In-FusionHD Cloning Kit (Clontech). The resulting plasmid was named pDZ-P(CJ7)-2'NCgl2522.
[166]
[167]
Table 7 [Table 7]
primer Sequence (5'-3')
2'NCgl2522-L5 (SEQ ID NO: 18) TGCAGGTCGACTCTAGACAATTCGAGTTGCTGCCACAC
NCgl2522-L3 (SEQ ID NO: 12) GGATCGTAACTGTAACGAATGG
CJ7-F (SEQ ID NO: 13) CGTTACAGTTACGATCCAGAAACATCCCAGCGCTACTAATA
CJ7-R (SEQ ID NO: 14) AGTGTTTCCTTTCGTTGGGTACG
NCgl2522-R5 (SEQ ID NO: 19) CAACGAAAGGAAACACTATGATTTCAGAAACTTTGCAGGCG
NCgl2522-R3 (SEQ ID NO: 17) TCGGTACCCGGGGATCCCACAAAAAGCGTAGCGATCAACG
[168]
[169]
The plasmid pDZ-'P(CJ7)-2'NCgl2522 was transformed into Corynebacterium glutamicum DAB12-a and DAB12-b in the same manner as in Example <3-2>, respectively, and CJ7 promoter in front of the NCgl2522 initiation codon Was selected the strain introduced. Corynebacterium glutamicum mutants selected therefrom were designated as DAB12-a P(CJ7)-NCgl2522 and DAB12-b P(CJ7)-NCgl2522, respectively.
[170]
[171]
<3-5> Evaluation of putrescine production ability of NCgl2522-enhanced strain
[172]
In order to confirm the effect of enhancing NCgl2522 activity by promoter substitution on putrescine production in putrescine-producing strains, 6 types of Corynebacterium prepared in Examples <3-1> to <3-4> Glutamicum mutants (KCCM11138P Tn: 1'NCgl2522, KCCM11138P P(CJ7)-NCgl2522, KCCM11240P P(CJ7)-NCgl2522, DAB12-a Tn:2'NCgl2522, DAB12-a P(CJ7)-NCgl2522 and DAB12-b P(CJ7)-NCgl2522) and four parent strains (KCCM11138P, KCCM11240P, DAB12-a and DAB12-b) were compared with the putrescine production capacity. After culturing each strain in the same manner as in Example 2-3, the concentration of putrescine produced from each culture was measured, and the results are shown in Table 8 below.
[173]
[174]
Table 8 [Table 8]
 Host Genotype Putrescine(g/L)
KCCM11138P (-) 9.8
Tn:1'NCgl2522 11.7
P(CJ7)-NCgl2522 13.5
KCCM11240P (-) 12.4
P(CJ7)-NCgl2522 15.5
DAB12-a (-) 10.2
Tn:2'NCgl2522 12.3
P(CJ7)-NCgl2522 14.1
DAB12-b (-) 13.1
P(CJ7)-NCgl2522 15.9
[175]
[176]
As shown in Table 8, it was confirmed that putrescine production was increased in all six Corynebacterium glutamicum mutants whose NCgl2522 activity was enhanced through additional introduction of NCgl2522 into transposon or through promoter substitution.
[177]
[178]
Example 4: Measurement of putrescine concentration in cells of NCgl2522 enriched strain
[179]
In order to confirm whether the intracellular putrescine concentration decreased as the putrescine excretion ability was improved in the Corynebacterium glutamicum mutant strain with enhanced NCgl2522 activity, the Corynebacterium glutamicum mutant strain KCCM11138P Tn:1'NCgl2522 and The parent strain KCCM11138P was subjected to an extraction method using an organic solvent to measure the intracellular putrescine concentration. Intracellular metabolite analysis method was performed according to the method described in Nakamura J et al., Appl. Environ. Microbiol. 73(14): 4491-4498, 2007.
[180]
First, Corynebacterium glutamicum mutant strain KCCM11138P Tn:1'NCgl2522 and parent strain KCCM11138P were respectively used in CM liquid medium containing 1 mM arginine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25). %, 0.2% urea, 50% NaOH 100 l, pH 6.8, 1 ℓ standard) After inoculation in 25 ml, shaking culture was performed at 30°C at 200 rpm. When cell growth reached the exponential phase during cultivation, cells were separated from the culture medium through rapid vacuum filtration (Durapore HV, 0.45 m; Millipore, Billerica, MA). The filter to which the cells were adsorbed was washed twice with 10 ml of cooling water, and then immersed in methanol containing 5 M morpholine ethanesulfonic acid and 5 M methionine sulfone for 10 minutes. After the same amount of chloroform and 0.4 times the volume of water were well mixed with the obtained extract, only an aqueous phase was applied to a spin column to remove protein contaminants. The filtered extract was analyzed using a capillary electrophoresis mass spectrometry, and the results are shown in Table 9 below.
[181]
[182]
Table 9 [Table 9]
Strain Putrescine(mM)
KCCM11138P 7
KCCM11138P Tn:1'NCgl2522 2
[183]
[184]
As shown in Table 9, it was confirmed that the intracellular putresin concentration of the Corynebacterium glutamicum mutant strain KCCM11138P Tn: 1'NCgl2522 with enhanced NCgl2522 activity compared to the parent strain KCCM11138P decreased. It is predicted that putrescine produced in cells is smoothly excreted out of the cells as putrescine excretion capacity is improved due to the enhancement of NCgl2522 activity in the Corynebacterium glutamicum mutant strain KCCM11138P Tn: 1'NCgl2522.
[185]
[186]
Example 5: Evaluation of putrescine tolerance of strains with NCgl2522 deletion or enhanced
[187]
In order to confirm the effect of NCgl2522 on putresin resistance, the KCCM11240P, KCCM11240P ΔNCgl2522, and KCCM11240P P(CJ7)-NCgl2522 strains produced above were evaluated for putresin resistance.
[188]
Each strain was inoculated in 2 ml of CMA liquid medium, incubated at 30° C. for about 10 hours, and then diluted in order of 10 5 , 10 4 , 10 3 , 10 2 and 10 1 . Each prepared dilution was prepared on a CMA plate medium containing 0 M or 0.8 M putrescine (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%.agar 1.8%, 1) mM arginine, pH 6.8. 1 ℓ standard) and cultured at 30° C. for 48 hours to compare growth between strains.
[189]
As a result, the strains showed two different growth patterns.As shown in FIG. 2, the strain in which the NCgl2522 gene was deleted did not grow under conditions containing a high concentration of putrescine, whereas the expression of the NCgl2522 gene was enhanced. In the strain, cell growth was increased under the same conditions. This is a result of confirming that the increase in putrescine excretion ability due to the enhancement of the NCgl2522 gene was higher than that of the parent strain in the condition containing high concentration of putrescine. will be.
[190]
[191]
Example 6: Putrescine fermentation through introduction of NCgl2522 into E. coli
[192]
In order to confirm the effect of increasing putrescine production on NCgl2522 expression of Corynebacterium glutamicum ATCC13032 in E. coli wild-type strain W3110 having a putrescine biosynthetic pathway, the putresin synthase speC expression vector and NCgl2522 expression vector were used in W3110. Respectively introduced.
[193]
To construct a speC expression vector, a speC gene fragment of about 2.1 kb was amplified using a W3110 chromosome as a template and a primer pair of SEQ ID NOs: 34 and 35 (see Table 10). The PCR result was subjected to electrophoresis on a 0.8% agarose gel, and then a band of a desired size was eluted and purified. After the pSE280 vector (Invitrogen) containing the Trc promoter was treated with NcoI and EcoRI, the speC PCR product was fusion cloned. Fusion cloning was performed using In-Fusion® HD Cloning Kit (Clontech). The resulting plasmid was named pSE280-speC.
[194]
To construct the NCgl2522 expression vector, pSE280 was used as a template and a Trc promoter fragment was obtained using a primer pair of SEQ ID NOs: 36 and 37, and a Corynebacterium glutamicum ATCC13032 chromosome as a template and SEQ ID NOs: 38 and 39 NCgl2522 fragment was obtained using a primer pair of. The PCR result was subjected to electrophoresis on a 0.8% agarose gel, and then a band of a desired size was eluted and purified. The trc promoter fragment and the NCgl2522 fragment were fusion cloned into pcc1BAC treated with HindIII. The resulting plasmid was named pcc1BAC-P(trc)-NCgl2522.
[195]
[196]
Table 10 [Table 10]
primer Sequence (5'-3')
SPEC-F (SEQ ID NO: 34) CACAGGAAACAGACCATGGATGAAATCAATGAATATTGCCGCCA
SPEC-R (SEQ ID NO: 35) GTGCAGGTGCTGAATTCTTACTTCAACACATAACCGTACAAC
Ptrc-F (SEQ ID NO: 36) TGCAGGCATGCAAGCTTCGACATCATAACGGTTCTGGC
Ptrc-R (SEQ ID NO: 37) ATTATACGAGCCGGATGATTAATTG
NCgl2522-F (SEQ ID NO: 38) CATCCGGCTCGTATAATATGACTTCAGAAACCTTACAGGC
NCgl2522-R (SEQ ID NO: 39) ATAGAATACTCAAGCTTCTAGTGCGCATTATTGGCTCC
[197]
[198]
The plasmids pSE280-speC and pcc1BAC-P(trc)-NCgl2522 were transformed into W3110. The transformation in E. coli was performed using a 2× TSS solution (Epicentre), and the E. coli into which pSE280-speC was introduced was LB plate medium (Tryptone 10 g, yeast extract 5 g, containing empicillin (100 ㎍ / ㎖), Nacl 10 g, agar 2%, 1 ℓ standard) was plated and cultured to form colonies. E. coli into which pcc1BAC-P(trc)-NCgl2522 was introduced was plated on LB plate medium containing chloramphenicol (35 µg/ml) and cultured to form colonies. The putrescine-producing ability was confirmed for the strain obtained above.
[199]
Specifically, W3110, W3110 pSE280-speC, and W3110 pcc1BAC-P(trc)-NCgl2522 were inoculated into LB, LA and LC solid media, respectively, and cultured at 37° C. for 24 hours, respectively, and 25 ml titer medium ((NH 4 ) 2 PO 4 2 g, KH 2 PO 4 6.75 g, citric acid 0.85 g, MgSO 4 7H 2 O 0.7 g, trace element 0.5% (v/v), glucose 10 g, AMS 3 g, CaCO 3 30 g , 1 ℓ standard) and cultured at 37°C for 24 hours. Trace metal solution is 5 M HCl per 1 liter: FeSO 4 7H 2 O 10 g, ZnSO 4 7H 2 O 2.25 g, CuSO 4 5H 2O 1 g, MnSO 4 5H 2 O 0.5 g, Na 2 B 4 O 7 10H 2 O 0.23 g, CaCl 2 2H 2 O 2 g, and (NH 4 ) 6 Mo 7 O 2 4H 2 O 0.1 Contains g.
[200]
The concentration of putrescine produced from each culture was measured and the results are shown in Table 11 below.
[201]
[202]
Table 11 [Table 11]
Host Plasmid Putrescine (mg/L)
W3110 (-) 11
pSE280-speC 56
pcc1BAC-P(trc)-NCgl2522 250
[203]
[204]
As shown in Table 11, it was confirmed that putrescine production was further increased in W3110 pcc1BAC-P(trc)-NCgl2522 into which NCgl2522 was introduced compared to the W3110 pcc1BAC-pSE280-speC strain into which the putrescine biosynthetic enzyme speC was introduced . .
[205]
This proves that the NCgl2522 gene has an activity as a putrescine-releasing protein in E. coli.
[206]
[207]
The present inventors have added NCgl2522 in transposon from KCCM11138P, a microorganism of the genus Corynebacterium having putrescine-producing ability, to enhance NCgl2522 activity, in a high yield through increased putrescine excretion capacity. After confirming that putrescine can be produced, the strain was named Corynebacterium glutamicum CC01-0510, and was deposited with the Korea Microbial Conservation Center (KCCM) on March 08, 2013 under the Budapest Treaty, and was given the deposit number KCCM11401P.
[208]
[209]
From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, the embodiments described above are illustrative in all respects and should be understood as non-limiting. The scope of the present invention should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts thereof.
[210]
Industrial availability
[211]
The microorganisms of the genus Corynebacterium with improved putresin productivity of the present invention have been modified so that the activity of NCgl2522, which releases putrescine in the cell, is enhanced more than intrinsic activity, thereby increasing the release of putrescine to the outside of the cell. It was confirmed that the resistance to the also increased. In addition, it was confirmed that when NCgl2522 was expressed in Escherichia coli including the putrescine production pathway of the present invention, the amount of putrescine out of the cells was increased. Therefore, NCgl2522 derived from Corynebacterium glutamicum may be widely used in the production of effective putresin by applying it to microorganisms having putrescine-producing ability.
Claims
[Claim 1]
A microorganism having a putrescine-producing ability that has been modified to enhance the activity of a protein comprising an amino acid sequence set forth in SEQ ID NO: 21 or 23.
[Claim 2]
The method of claim 1, wherein the microorganism is further modified so that the activity of ornithine carbamoyl transferase (ArgF) and a protein involved in glutamate excretion (NCgl1221) is weakened compared to the intrinsic activity, and ornithine dicarboxylase Microorganisms having a putrescine-producing ability that have enhanced (ODC) activity.
[Claim 3]
The amino acid according to claim 2, wherein the ornithine carbamoyl transferase (ArgF) comprises an amino acid sequence set forth in SEQ ID NO: 29, and a protein involved in glutamate release (NCgl1221) is an amino acid set forth in SEQ ID NO: 30. A microorganism having a putrescine-producing ability, comprising a sequence, and wherein ornithine decarboxylase (ODC) comprises an amino acid sequence set forth in SEQ ID NO: 33.
[Claim 4]
The method of claim 1, wherein the microorganism is additionally acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), and acetylornithine aminotransfer. Raase (ArgD) will be modified to enhance the activity of the intrinsic activity, a microorganism having putrescine production ability.
[Claim 5]
The method of claim 4, wherein the acetyl gamma glutamyl phosphate reductase (ArgC), acetyl glutamate synthase or ornithine acetyltransferase (ArgJ), acetyl glutamate kinase (ArgB), and acetylornithine aminotransferase ( ArgD) is a microorganism having a putrescine-producing ability, each comprising the amino acid sequence described in SEQ ID NOs: 25, 26, 27 and 28.
[Claim 6]
The microorganism according to claim 1, wherein the microorganism has an additionally weakened activity of acetyltransferase (NCgl1469).
[Claim 7]
The microorganism according to claim 6, wherein the acetyltransferase (NCgl1469) comprises an amino acid sequence represented by SEQ ID NO: 31 or 32.
[Claim 8]
The microorganism according to claim 1, wherein the microorganism is a microorganism of the genus Escherichia or a coryneform microorganism.
[Claim 9]
The microorganism according to claim 8, wherein the microorganism is E. coli or Corynebacterium glutamicum.
[Claim 10]
(i) obtaining a culture by culturing the microorganism having putrescine-producing ability according to any one of claims 1 to 9; And (ii) recovering putrescine from the cultured microorganism or culture.

Documents

Application Documents

# Name Date
1 202038033779-STATEMENT OF UNDERTAKING (FORM 3) [06-08-2020(online)].pdf 2020-08-06
2 202038033779-SEQUENCE LISTING(PDF) [06-08-2020(online)].pdf 2020-08-06
3 202038033779-SEQUENCE LISTING [06-08-2020(online)].txt 2020-08-06
4 202038033779-REQUEST FOR EXAMINATION (FORM-18) [06-08-2020(online)].pdf 2020-08-06
5 202038033779-FORM 18 [06-08-2020(online)].pdf 2020-08-06
6 202038033779-FORM 1 [06-08-2020(online)].pdf 2020-08-06
7 202038033779-DRAWINGS [06-08-2020(online)].pdf 2020-08-06
8 202038033779-DECLARATION OF INVENTORSHIP (FORM 5) [06-08-2020(online)].pdf 2020-08-06
9 202038033779-COMPLETE SPECIFICATION [06-08-2020(online)].pdf 2020-08-06
10 202038033779-Proof of Right [27-08-2020(online)].pdf 2020-08-27
11 202038033779-FORM-26 [27-08-2020(online)].pdf 2020-08-27
12 202038033779-FORM 3 [09-12-2020(online)].pdf 2020-12-09
13 202038033779-FER.pdf 2023-07-05
14 202038033779-FORM 3 [03-01-2024(online)].pdf 2024-01-03
15 202038033779-FER_SER_REPLY [04-01-2024(online)].pdf 2024-01-04
16 202038033779-CLAIMS [04-01-2024(online)].pdf 2024-01-04
17 202038033779-US(14)-HearingNotice-(HearingDate-19-07-2024).pdf 2024-06-21
18 202038033779-Correspondence to notify the Controller [16-07-2024(online)].pdf 2024-07-16
19 202038033779-Written submissions and relevant documents [03-08-2024(online)].pdf 2024-08-03
20 202038033779-Response to office action [16-08-2024(online)].pdf 2024-08-16
21 202038033779-PatentCertificate22-08-2024.pdf 2024-08-22
22 202038033779-IntimationOfGrant22-08-2024.pdf 2024-08-22

Search Strategy

1 TheapplicationisdivisionaloftheparentapplicationE_04-07-2023.pdf

ERegister / Renewals

3rd: 06 Sep 2024

From 25/02/2016 - To 25/02/2017

4th: 06 Sep 2024

From 25/02/2017 - To 25/02/2018

5th: 06 Sep 2024

From 25/02/2018 - To 25/02/2019

6th: 06 Sep 2024

From 25/02/2019 - To 25/02/2020

7th: 06 Sep 2024

From 25/02/2020 - To 25/02/2021

8th: 06 Sep 2024

From 25/02/2021 - To 25/02/2022

9th: 06 Sep 2024

From 25/02/2022 - To 25/02/2023

10th: 06 Sep 2024

From 25/02/2023 - To 25/02/2024

11th: 06 Sep 2024

From 25/02/2024 - To 25/02/2025

12th: 10 Dec 2024

From 25/02/2025 - To 25/02/2026