Sign In to Follow Application
View All Documents & Correspondence

Rt Lamp Primer Sets And Kit For Detecting Sars Cov 2 And Application Thereof

Abstract: RT-LAMP PRIMER SETS AND KIT FOR DETECTING SARS COV-2 AND APPLICATION THEREOF ABSTRACT A primer mix for detection of coronavirus disease (COVID-19) is provided. the primer mix comprises a set of primers designed using conserved region of N-gene and S-gene. The primer mix ensure better specific annealing with complementary target region for detection of coronavirus disease. The present invention also provides reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19). The detection kit comprises the primer mix, at least one reaction buffer mix, at least one reaction enzyme mix, and at least one developer. The detection kit being cost-effective and enables specific, sensitive, and rapid detection of coronavirus disease. The present invention also provides a reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19). The method enables cost-effective, specific and rapid diagnosis of coronavirus disease. The RT-LAMP method having simplified operation step and performed in a single tube for cDNA conversion and amplification. FIG.1

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
13 March 2021
Publication Number
37/2022
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

Shankaranarayana Life Sciences LLP
10th floor, Southwest wing, No144-C/1, Sai Vishram Kirloskar road, Hebbagoddi, Bommasandra Industrial Area, Bangalore 560099, Karnataka, India

Inventors

1. Kauser Banu
Shankaranarayana Life Sciences LLP, 10th floor, Southwest wing, No144-C/1, Sai Vishram Kirloskar road, Hebbagoddi, Bommasandra Industrial Area, Bangalore 560099, Karnataka, India
2. Bhairab Mondal
Shankaranarayana Life Sciences LLP, 10th floor, Southwest wing, No144-C/1, Sai Vishram Kirloskar road, Hebbagoddi, Bommasandra Industrial Area, Bangalore 560099, Karnataka, India
3. Nisha.S
Shankaranarayana Life Sciences LLP, 10th floor, Southwest wing, No144-C/1, Sai Vishram Kirloskar road, Hebbagoddi, Bommasandra Industrial Area, Bangalore 560099, Karnataka, India
4. Bhawana Rai
Shankaranarayana Life Sciences LLP, 10th floor, Southwest wing, No144-C/1, Sai Vishram Kirloskar road, Hebbagoddi, Bommasandra Industrial Area, Bangalore 560099, Karnataka, India

Claims

1. A primer mix, comprising: one of a set of primers specific to N-gene of SARS CoV-2 and a set of primers specific to S-gene of SARS CoV-2, wherein the set of primers specific to N-gene of SARS CoV-2 are selected from a group consisting: a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2, wherein the set of primers specific to S-gene of SARS CoV-2 are selected from a group consisting: a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2.

2. The primer mix as claimed in claim 1, wherein the set of primers specific to N-gene of SARS CoV-2 and the set of primers specific to S-gene of SARS CoV-2 are configured to enable detection of coronavirus disease (COVID-19) in a clinical sample via a reverse transcription loop mediated isothermal amplification (RT-LAMP) process.

3. A reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19), comprising: a primer mix (PM) comprising one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration, wherein the set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2, wherein the set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2; at least one reaction buffer mix (RBM); at least one reaction enzyme mix (REM); and at least one developer.

4. The kit as claimed in claim 3, wherein the predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being 0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2.

5. The kit as claimed in claim 3, wherein the at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer.

6. The kit as claimed in claim 3, wherein the at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT.

7. The kit as claimed in claim 3, wherein the at least one developer comprises 1.0 µl of 120µM HNB (Hydroxy Napthol Blue).

8. A reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19), comprising: a) mixing a reaction buffer mix (RBM), a reaction enzyme mix (REM), a primer mix (PM), and sterilized deionized water in a predefined volume to obtain a first RT-LAMP reaction solution, wherein the primer mix (PM) comprises one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration; wherein the set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2, wherein the set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2; b) adding 2 µl RNA sample to obtain a RT-LAMP reaction solution, wherein the RNA sample is extracted from a clinical sample obtained from suspected COVID-19 patient using RNA extraction method; c) carrying the RT-LAMP reaction by incubating the RT-LAMP reaction solution for a duration of 60minutes at 63? followed by enzyme inactivation at 80°C for a duration of 10 minutes; and d) detecting the coronavirus disease (COVID-19) in the clinical sample by analysing outcome of step (c) by at least one of colorimetric detection method, and a conventional agarose gel electrophoresis method, wherein the detecting of the coronavirus disease (COVID-19) in the clinical sample by the colorimetric detection method comprises observing a visible change in colour of product of step (c) resulting due to formation of DNA-dye complex, wherein occurrence of blue colour indicates presence of COVID-19 virus in the clinical sample contains, and wherein the detecting of the coronavirus disease (COVID-19) in the clinical sample by the conventional agarose gel electrophoresis provide qualitative results depicting presence or absence of COVID-19 virus in the clinical sample.

9. The method as claimed in claim 8, wherein the predefined volume of RBM, REM, PM, and sterilized deionized water in the first RT-LAMP reaction solution is 7 µl, 3 µl, 1.8 µl and 11.2 µl, respectively.

10. The method as claimed in claim 8, wherein the at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer.

11. The method as claimed in claim 8, wherein the at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT.

12. The method as claimed in claim 8, wherein the predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2.

13. The method as claimed in claim 8, wherein the detecting of the coronavirus disease (COVID-19) in the sample by the colorimetric detection method comprises using at least one developer comprising HNB (Hydroxy Napthol Blue) imparting blue colour. Dated this 13th day of March 2021 Vidya Bhaskar Singh Nandiyal Patent Agent (IN/PA-2912) Agent for applicant , Description:FIELD OF INVENTION [0001] Embodiments of a present invention relates to biological technical field, and more particularly to a reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit and method for detecting coronavirus disease (COVID-19). BACKGROUND [0002] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the strain of coronavirus that causes coronavirus disease (COVID-19). The SARS-CoV-2 is a large positive-sense single-strand RNA having four structural proteins namely, nucleocapsid protein (N), spike protein (S), envelope protein (E), and membrane protein (M). The spike proteins present on the surface of SARS-CoV-2 recognize and bind to the ACE2 receptors in epithelial lining of lungs. The SARS-CoV-2 then enters the cells in human lungs and starts multiplying using the replication mechanism of the human cells. Meanwhile, the viral infection triggers a cascade of events including inflammation. As a response to the infection, the infected person develops cough, high fever, and difficulty in breathing. In few cases, the infection is asymptomatic. [0003] The SARS-CoV-2 transmits in the human population by aerosol and fomites. The aerosol transmission from infected individuals to susceptible individuals is cause for a rapid spread of the virus in the population. The SARS-CoV-2 may also survive on surfaces such as tables, clothes, metal, paper, and objects used by humans regularly. [0004] Currently, supportive care and symptom-based treatment are the only solutions for the coronavirus disease. Therefore, it is necessary to detect the viral infection in the human at the earliest to avoid further spread of the COVID-19. The currently available diagnosis for COVID-19 depends on CT-scan and reverse transcription Real-Time PCR. The two possible molecular approaches of detection of the pathogen are either by nucleotide or antigen-based routes. Retrospectively, the viral infection may also be indirectly detected by identifying the IgG/IgM antibodies generated specific to the viral antigens. [0005] Since there are certain limitations in these methods namely in cycle length, specificity, susceptibility aspects, expensive, reliability, rapidity, and sensitivity hence they are limited in promoting the use of basic amplification unit like heat block. [0006] In recent times, Loop-mediated isothermal amplification (LAMP) technique is gaining interest in detection of viral antigens. [0007] T. Notomi et al., 2000, in their paper, Loop-mediated isothermal amplification of DNA, published in Nucleic Acids Res., disclosed that the technology relies on primers and a kind of bacterial DNA polymerase with strand displacement activity which can specifically amplify target sequence efficiently under isothermal condition. [0008] In recent years, this technology is widely used for pathogen detection. The LAMP assays are also used to detect human relevant virus such as viral hemorrhagic septicemia (VHS), cytomegalovirus (CMV), Ebola virus (EBOV), chronic burkitt's lymphoma virus (EBV), rainbow virus, human herpes virus type 8, hematopoietic tissue necrosis virus (IHHNV), tomato spotted wild virus, tomato yellow leaf curl virus etc. [0009] However, there is a need for cost effective and specific reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit comprising specific set of primers for detection of coronavirus disease (COVID-19). SUMMARY [0010] In accordance with an embodiment of the present invention, a primer mix is provided. The primer mix includes one of a set of primers specific to N-gene of SARS CoV-2 and a set of primers specific to S-gene of SARS CoV-2. The set of primers specific to N-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. [0011] In accordance with another embodiment of the present invention, a reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19). The kit includes a primer mix (PM) comprising one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. The kit also includes at least one reaction buffer mix (RBM). The kit includes at least one reaction enzyme mix (REM). The kit further includes at least one developer. [0012] In accordance with yet another embodiment of the present invention, a reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19). The method includes mixing of reaction buffer mix (RBM), of reaction enzyme mix (REM), of a primer mix (PM), and of sterilized deionized water in a predefined volume to obtain a first RT-LAMP reaction solution. The primer mix (PM) comprises one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. The method also includes adding 2 µl RNA sample to the RT-LAMP reaction solution. The RNA sample is extracted from a clinical sample obtained from suspected COVID-19 patient using RNA extraction method. The method also includes carrying the RT-LAMP reaction by incubating the RT-LAMP reaction solution for a duration of 60minutes at 63? followed by enzyme inactivation at 80°C for a duration of 10 minutes. The method further includes detecting the coronavirus disease (COVID-19) in the clinical sample by analysing outcome of the RT-LAMP reaction by at least one of colorimetric detection method, and a conventional agarose gel electrophoresis method. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the visual detection method comprises observing a visible change in colour of product of step (c) resulting due to formation of DNA-dye complex, wherein occurrence of change in colour indicates presence of SARS-CoV-2 in the clinical sample. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the conventional agarose gel electrophoresis provide qualitative results depicting presence or absence of SARS-CoV-2 in the clinical sample. BRIEF DESCRIPTION OF THE DRAWINGS The invention will be described and explained with additional specificity and detail with the accompanying figures in which: [0013] FIG. 1 is a flow diagram (100) representing steps involved in a reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19), in accordance with an embodiment of the present invention; [0014] FIG. 2 illustrate specificity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with an embodiment of the present invention; [0015] FIG. 3 illustrate specificity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with an embodiment of the present invention; [0016] FIG. 4 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with embodiment of the present invention; and [0017] FIG. 5 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with embodiment of the present invention. [0018] Further, those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and may not have necessarily been drawn to scale. Furthermore, in terms of the construction of the device, one or more components of the device may have been represented in the figures by conventional symbols, and the figures may show only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the figures with details that will be readily apparent to those skilled in the art having the benefit of the description herein. DETAILED DESCRIPTION [0019] For the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to the embodiment illustrated in the figures and specific language will be used to describe them. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Such alterations and further modifications in the illustrated system, and such further applications of the principles of the disclosure as would normally occur to those skilled in the art are to be construed as being within the scope of the present disclosure. [0020] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more components, compounds, and ingredients preceded by "comprises... a" does not, without more constraints, preclude the existence of other components or compounds or ingredients or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment. [0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting. [0022] In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. [0023] Embodiments of the present invention relates to a reverse transcription [0024] loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19). The invention mainly focuses on a specific set of primers designed using N-gene and S-gene of SARS CoV-2 for detection of coronavirus disease (COVID-19). [0025] According to different gene sequences published by a GenBank, RT-LAMP primers being designed by aiming at a relative conserved domain of N-gene and S-gene. The sequences announced by GenBank being further analyzed using CUSTAL W and DNAstar5.0 software. The analytical results showed, a region of N-gene from 420nt - 650nt and a region of S-gene from 15nt - 220nt as highly conserved regions due to extremely less chances of mutation among the COVID-19 virus strain in these regions. Hence, specific primers being designed using the conserved regions of N-gene and S-gene. [0026] In the present invention three pairs of unique and highly specific primers including a pair of outer primers (a forward outer primer F3, a backward outer primer B3), a pair of inner primers (a forward inner primer FIP(F2), a backward inner primer BIP(B2)), and a pair of loop primers (a forward loop primer LF(F1C), a backward loop primer LB(B1C)) being employed to provide loop-mediated amplification within an optimum specific region of a target sequence for detection of coronavirus disease (COVID-19). [0027] In an embodiment of the present invention, a primer mix is provided. The primer mix includes one of a set of primers specific to N-gene of SARS CoV-2 and a set of primers specific to S-gene of SARS CoV-2. The set of primers specific to N-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. [0028] The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed with 23 to 25 bases. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed using the conserved regions of N-gene and S-gene. The nucleotide sequences provided by the present invention do not contain repetitive A/T sequences which are most likely to be present in gene sequence of viruses. The Repetitive A or T sequences lead to stem loop formations that hinder the LAMP amplification. The short-sized primers i.e., containing 23 to 25 bases in the nucleotide sequence ensure better specific annealing with complementary target region in short duration and minimize the formation of secondary structures and motifs and also improve specificity. The designed primers includes low Tm value while maintaining the specificity to primer binding sites on target cDNA molecules or templates. [0029] The set of primer specific to N-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows: SEQ ID No. 1 – N_F3– AGATCACATTGGCACCCG, SEQ ID No. 2 - N_B3– CCATTGCCAGCCATTCTAGC, SEQ ID No. 3 - N_F1C – GCCTCTGCTCCCTTCTGCGTA, SEQ ID No. 4 - N_F2 – GCTAACAATGCTGCAATCGT, SEQ ID No. 5 - N_B1C – GCAGTCAAGCCTCTTCTCGT, and SEQ ID No. 6 - N_B2 – CCTACTGCTGCCTGGAGTT. [0030] The set of primer specific to S-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows: SEQ ID No. 7 – S_F3– TGTTTTATTGCCACTAGTCTCT, SEQ ID No. 8 - S_B3– GGTCCCAGAGACATGTATAGC, SEQ ID No. 9 - S_F1C – ACCACGTGTGAAAGAATTAGTGTAT, SEQ ID No. 10 - S_F2 – ACAACCAGAACTCAATTACCCCC, SEQ ID No. 11 - S_B1C – AGTTTTCAGATCCTCAGTTTTACA, and SEQ ID No. 12 - S_B2 – GTAACATTGGAAAAGAAAGGTAAG. [0031] In another embodiment of the present invention, a reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19) is provided. The kit includes a primer mix (PM) comprising one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed with 23 to 25 bases. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed using the conserved regions of N-gene and S-gene. [0032] The predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being 0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2. [0033] The set of primer specific to N-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows: SEQ ID No. 1 – N_F3– AGATCACATTGGCACCCG, SEQ ID No. 2 - N_B3– CCATTGCCAGCCATTCTAGC, SEQ ID No. 3 - N_F1C – GCCTCTGCTCCCTTCTGCGTA, SEQ ID No. 4 - N_F2 – GCTAACAATGCTGCAATCGT, SEQ ID No. 5 - N_B1C – GCAGTCAAGCCTCTTCTCGT, and SEQ ID No. 6 - N_B2 – CCTACTGCTGCCTGGAGTT. [0034] The set of primer specific to S-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows: SEQ ID No. 7 – S_F3– TGTTTTATTGCCACTAGTCTCT, SEQ ID No. 8 - S_B3– GGTCCCAGAGACATGTATAGC, SEQ ID No. 9 - S_F1C – ACCACGTGTGAAAGAATTAGTGTAT, SEQ ID No. 10 - S_F2 – ACAACCAGAACTCAATTACCCCC, SEQ ID No. 11 - S_B1C – AGTTTTCAGATCCTCAGTTTTACA, and SEQ ID No. 12 - S_B2 – GTAACATTGGAAAAGAAAGGTAAG. [0035] In an embodiment, the kit also includes at least one reaction buffer mix (RBM). the at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer. The reaction buffer mix provides a suitable chemical environment for activity of reaction enzymes. [0036] In an embodiment, the kit also includes at least one reaction enzyme mix (REM). The at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT. [0037] In such embodiment, the kit includes at least one developer. The at least one developer comprises 1.0 µl of 120µM HNB (Hydroxy Napthol Blue). [0038] In yet another embodiment of the present invention, a reverse transcript loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19) is provided. [0039] FIG. 1 is a flow diagram (100) representing steps involved in the reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19), in accordance with an embodiment of the present invention. [0040] The method for detection of coronavirus disease (COVID-19) begins with mixing a reaction buffer mix (RBM), a reaction enzyme mix (REM), a primer mix (PM), and sterilized deionized water in a predefined volume to obtain RT-LAMP reaction solution at step 102. The primer mix (PM) comprises one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. [0041] The predefined volume of RBM, REM, PM, and sterilized deionized water in the first RT-LAMP reaction solution is 7 µl, 3 µl, 1.8 µl and 11.2 µl, respectively. The at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer. The at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT. The predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2. [0042] The set of primer specific to N-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows: SEQ ID No. 1 – N_F3– AGATCACATTGGCACCCG, SEQ ID No. 2 - N_B3– CCATTGCCAGCCATTCTAGC, SEQ ID No. 3 - N_F1C – GCCTCTGCTCCCTTCTGCGTA, SEQ ID No. 4 - N_F2 – GCTAACAATGCTGCAATCGT, SEQ ID No. 5 - N_B1C – GCAGTCAAGCCTCTTCTCGT, and SEQ ID No. 6 - N_B2 – CCTACTGCTGCCTGGAGTT. [0043] The set of primer specific to S-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows: SEQ ID No. 7 – S_F3– TGTTTTATTGCCACTAGTCTCT, SEQ ID No. 8 - S_B3– GGTCCCAGAGACATGTATAGC, SEQ ID No. 9 - S_F1C – ACCACGTGTGAAAGAATTAGTGTAT, SEQ ID No. 10 - S_F2 – ACAACCAGAACTCAATTACCCCC, SEQ ID No. 11 - S_B1C – AGTTTTCAGATCCTCAGTTTTACA, and SEQ ID No. 12- S_B2 – GTAACATTGGAAAAGAAAGGTAAG. [0044] The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed with 23 to 25 bases. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed using the conserved region of N-gene and S-gene. The amplicon region for the RT-LAMP reaction is <250 base pair, which is highly conserved for COVID-19 virus that decreases primer susceptibility towards cross-reactivity, thereby leading to specific amplification and subsequent detection of all possible COVID-19 strains and not the other related group of viruses. [0045] In an embodiment, 2 µl RNA sample is assed to obtain a RT-LAMP reaction solution at step 104. The RNA is extracted from a clinical sample obtained from suspected COVID-19 patient using RNA extraction method. The RNA extraction method includes extraction of RNA from the clinical sample using conventional RNA extraction kit or magnetic beads method or conventional Trizol method as per manufacturer’s guidelines. [0046] In an embodiment, the RT-LAMP reaction is carried by incubating the RT-LAMP reaction solution for a duration of 60minutes at 63? followed by enzyme inactivation at 80°C for a duration of 10 minutes at step 106. The incubating of the RT-LAMP reaction solution is carried using at least one of a Heat block and a water bath. In the RT-LAMP reaction mRNA molecules from the RNA sample being converted into cDNA and LAMP is immediately performed in a same vial without shifting into different reaction vials. This step reduces the time taken for achieving results and saves material resources, thereby making the entire method cost-effective. The unique combination of primers used in the RT-LAMP reaction leads to more efficient polymerization which is evident in the formation of a precipitation of a large amount of nucleic acid and magnesium pyrophosphate in the product of modified RT-LAMP reaction. [0047] In such an embodiment, the coronavirus disease (COVID-19) is detected in the clinical sample by analysing outcome of step 106 by at least one of colorimetric detection method, and a conventional agarose gel electrophoresis method at step 108. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the colorimetric detection method comprises observing a visible change in colour of product of step (c) resulting due to formation of DNA-dye complex, wherein occurrence of blue colour indicates presence of COVID-19 virus in the clinical sample contains. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the conventional agarose gel electrophoresis provide qualitative results depicting presence or absence of COVID-19 virus in the clinical sample. The detecting of the coronavirus disease (COVID-19) in the sample by the colorimetric detection method comprises using at least one developer comprising HNB (Hydroxy Napthol Blue) imparting blue colour. [0048] In one embodiment, the coronavirus disease (COVID-19) is detected in the clinical sample by monitoring outcome of step 106 in real-time with the fluorescent dye, enabling quantification if needed in a laboratory setup. In one embodiment, the detection may be achieved using a conventional EtBr based gel electrophoresis under UV-transilluminator or fluorometer. [0049] The RT-LAMP reaction specificity and sensitivity carried using the primer mix provided by the present invention being evaluated against suspected COVID-19 clinical samples w.r.t. to real time PCR technique approved by World Health Organization (WHO) for detection of coronavirus disease. The sensitivity of the RT-LAMP reaction carried using the primer mix provided by the present invention is also analyzed using various concentrations of RNA copy number. [0050] FIG. 2 illustrate specificity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with embodiment of the present invention. [0051] FIG. 3 illustrate specificity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with embodiment of the present invention. [0052] The specificity of the RT-LAMP reaction is interpretated by analysing results of RT-LAMP reaction using both the colorimetric detection method and the conventional agarose gel electrophoresis method. In the colorimetric detection method, positive results i.e. presence of COVID-19 virus in the clinical samples are indicated by occurrence of blue color and negative results i.e. absence of COVID-19 virus in the clinical samples are indicated by occurrence of deep violet color. In the conventional agarose gel electrophoresis method, positive results i.e. presence of COVID-19 virus in the clinical samples are indicated by distinctive scalariform band and negative results i.e. absence of COVID-19 virus in the clinical samples are indicated by absence of band. [0053] FIG. 4 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with embodiment of the present invention. [0054] FIG. 5 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with embodiment of the present invention. [0055] The RT-LAMP reaction sensitivity is pressed with the respective synthesized RNA templates (1,00,000copies/µl, 10,000copies/µl, 1,000copies/µl, 100copies/µl, 10copies/µl, and 1copy/µl). The test finds that along with an increased dilution the color intensity decreases and both the set of primer specific to N-gene and the set of primer specific to S-gene are able to detect 10 copies/µl. [0056] The present invention provides the primer mix containing 23 to 25 bases in the nucleotide sequence which ensure better specific annealing with complementary target region in short duration and minimize the formation of secondary structures and motifs and also improve specificity. The present invention also provides the reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19). The detection kit being cost-effective and enables specific, sensitive, and rapid detection of coronavirus disease. Moreover, the detection kit enables acquiring diagnosis results within an hour or even a shorter time, thereby initiating highly effective response mechanisms to check spread of the coronavirus disease. The invention also provides the reverse transcription loop mediated isothermal amplification (RT-LAMP) method for coronavirus disease (COVID-19). The method enables cost-effective, specific and rapid diagnosis of coronavirus disease. The method being highly sensitive and may enable detection between 10 to 50 fg RNA from non-invasive clinical samples obtained from suspected COVID-19 patient. The RT-LAMP method having simplified operation step and performed in a single tube for cDNA conversion and amplification. [0057] While specific language has been used to describe the disclosure, any limitations arising on account of the same are not intended. As would be apparent to a person skilled in the art, various working modifications may be made to the method in order to implement the inventive concept as taught herein. [0058] The figures and the foregoing description give examples of embodiments. Those skilled in the art will appreciate that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be split into multiple functional elements. Elements from one embodiment may be added to another embodiment. Moreover, the actions of any flow diagram need not be implemented in the order shown; nor do all of the acts need to be necessarily performed. Also, those acts that are not dependant on other acts may be performed in parallel with the other acts. The scope of embodiments is by no means limited by these specific examples.

Specification

Claims:WE CLAIM:
1. A primer mix, comprising:
one of a set of primers specific to N-gene of SARS CoV-2 and a set of primers specific to S-gene of SARS CoV-2,
wherein the set of primers specific to N-gene of SARS CoV-2 are selected from a group consisting:
a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3,
a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3,
a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C,
a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2,
a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C,
a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2,
wherein the set of primers specific to S-gene of SARS CoV-2 are selected from a group consisting:
a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3,
a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3,
a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C,
a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2,
a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and
a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2.
2. The primer mix as claimed in claim 1, wherein the set of primers specific to N-gene of SARS CoV-2 and the set of primers specific to S-gene of SARS CoV-2 are configured to enable detection of coronavirus disease (COVID-19) in a clinical sample via a reverse transcription loop mediated isothermal amplification (RT-LAMP) process.
3. A reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19), comprising:
a primer mix (PM) comprising one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration,
wherein the set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2,
wherein the set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2;
at least one reaction buffer mix (RBM);
at least one reaction enzyme mix (REM); and
at least one developer.
4. The kit as claimed in claim 3, wherein the predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being 0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2.
5. The kit as claimed in claim 3, wherein the at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer.
6. The kit as claimed in claim 3, wherein the at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT.
7. The kit as claimed in claim 3, wherein the at least one developer comprises 1.0 µl of 120µM HNB (Hydroxy Napthol Blue).
8. A reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19), comprising:
a) mixing a reaction buffer mix (RBM), a reaction enzyme mix (REM), a primer mix (PM), and sterilized deionized water in a predefined volume to obtain a first RT-LAMP reaction solution,
wherein the primer mix (PM) comprises one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration;
wherein the set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2,
wherein the set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2;
b) adding 2 µl RNA sample to obtain a RT-LAMP reaction solution,
wherein the RNA sample is extracted from a clinical sample obtained from suspected COVID-19 patient using RNA extraction method;
c) carrying the RT-LAMP reaction by incubating the RT-LAMP reaction solution for a duration of 60minutes at 63? followed by enzyme inactivation at 80°C for a duration of 10 minutes; and
d) detecting the coronavirus disease (COVID-19) in the clinical sample by analysing outcome of step (c) by at least one of colorimetric detection method, and a conventional agarose gel electrophoresis method,
wherein the detecting of the coronavirus disease (COVID-19) in the clinical sample by the colorimetric detection method comprises observing a visible change in colour of product of step (c) resulting due to formation of DNA-dye complex, wherein occurrence of blue colour indicates presence of COVID-19 virus in the clinical sample contains, and
wherein the detecting of the coronavirus disease (COVID-19) in the clinical sample by the conventional agarose gel electrophoresis provide qualitative results depicting presence or absence of COVID-19 virus in the clinical sample.
9. The method as claimed in claim 8, wherein the predefined volume of RBM, REM, PM, and sterilized deionized water in the first RT-LAMP reaction solution is 7 µl, 3 µl, 1.8 µl and 11.2 µl, respectively.
10. The method as claimed in claim 8, wherein the at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer.
11. The method as claimed in claim 8, wherein the at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT.
12. The method as claimed in claim 8, wherein the predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2.
13. The method as claimed in claim 8, wherein the detecting of the coronavirus disease (COVID-19) in the sample by the colorimetric detection method comprises using at least one developer comprising HNB (Hydroxy Napthol Blue) imparting blue colour.
Dated this 13th day of March 2021



Vidya Bhaskar Singh Nandiyal
Patent Agent (IN/PA-2912)
Agent for applicant
, Description:FIELD OF INVENTION

[0001] Embodiments of a present invention relates to biological technical field, and more particularly to a reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit and method for detecting coronavirus disease (COVID-19).

BACKGROUND

[0002] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the strain of coronavirus that causes coronavirus disease (COVID-19). The SARS-CoV-2 is a large positive-sense single-strand RNA having four structural proteins namely, nucleocapsid protein (N), spike protein (S), envelope protein (E), and membrane protein (M). The spike proteins present on the surface of SARS-CoV-2 recognize and bind to the ACE2 receptors in epithelial lining of lungs. The SARS-CoV-2 then enters the cells in human lungs and starts multiplying using the replication mechanism of the human cells. Meanwhile, the viral infection triggers a cascade of events including inflammation. As a response to the infection, the infected person develops cough, high fever, and difficulty in breathing. In few cases, the infection is asymptomatic.

[0003] The SARS-CoV-2 transmits in the human population by aerosol and fomites. The aerosol transmission from infected individuals to susceptible individuals is cause for a rapid spread of the virus in the population. The SARS-CoV-2 may also survive on surfaces such as tables, clothes, metal, paper, and objects used by humans regularly.

[0004] Currently, supportive care and symptom-based treatment are the only solutions for the coronavirus disease. Therefore, it is necessary to detect the viral infection in the human at the earliest to avoid further spread of the COVID-19. The currently available diagnosis for COVID-19 depends on CT-scan and reverse transcription Real-Time PCR. The two possible molecular approaches of detection of the pathogen are either by nucleotide or antigen-based routes. Retrospectively, the viral infection may also be indirectly detected by identifying the IgG/IgM antibodies generated specific to the viral antigens.

[0005] Since there are certain limitations in these methods namely in cycle length, specificity, susceptibility aspects, expensive, reliability, rapidity, and sensitivity hence they are limited in promoting the use of basic amplification unit like heat block.

[0006] In recent times, Loop-mediated isothermal amplification (LAMP) technique is gaining interest in detection of viral antigens.

[0007] T. Notomi et al., 2000, in their paper, Loop-mediated isothermal amplification of DNA, published in Nucleic Acids Res., disclosed that the technology relies on primers and a kind of bacterial DNA polymerase with strand displacement activity which can specifically amplify target sequence efficiently under isothermal condition.

[0008] In recent years, this technology is widely used for pathogen detection. The LAMP assays are also used to detect human relevant virus such as viral hemorrhagic septicemia (VHS), cytomegalovirus (CMV), Ebola virus (EBOV), chronic burkitt's lymphoma virus (EBV), rainbow virus, human herpes virus type 8, hematopoietic tissue necrosis virus (IHHNV), tomato spotted wild virus, tomato yellow leaf curl virus etc.

[0009] However, there is a need for cost effective and specific reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit comprising specific set of primers for detection of coronavirus disease (COVID-19).

SUMMARY

[0010] In accordance with an embodiment of the present invention, a primer mix is provided. The primer mix includes one of a set of primers specific to N-gene of SARS CoV-2 and a set of primers specific to S-gene of SARS CoV-2. The set of primers specific to N-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2.

[0011] In accordance with another embodiment of the present invention, a reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19). The kit includes a primer mix (PM) comprising one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. The kit also includes at least one reaction buffer mix (RBM). The kit includes at least one reaction enzyme mix (REM). The kit further includes at least one developer.

[0012] In accordance with yet another embodiment of the present invention, a reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19). The method includes mixing of reaction buffer mix (RBM), of reaction enzyme mix (REM), of a primer mix (PM), and of sterilized deionized water in a predefined volume to obtain a first RT-LAMP reaction solution. The primer mix (PM) comprises one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. The method also includes adding 2 µl RNA sample to the RT-LAMP reaction solution. The RNA sample is extracted from a clinical sample obtained from suspected COVID-19 patient using RNA extraction method. The method also includes carrying the RT-LAMP reaction by incubating the RT-LAMP reaction solution for a duration of 60minutes at 63? followed by enzyme inactivation at 80°C for a duration of 10 minutes. The method further includes detecting the coronavirus disease (COVID-19) in the clinical sample by analysing outcome of the RT-LAMP reaction by at least one of colorimetric detection method, and a conventional agarose gel electrophoresis method. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the visual detection method comprises observing a visible change in colour of product of step (c) resulting due to formation of DNA-dye complex, wherein occurrence of change in colour indicates presence of SARS-CoV-2 in the clinical sample. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the conventional agarose gel electrophoresis provide qualitative results depicting presence or absence of SARS-CoV-2 in the clinical sample.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention will be described and explained with additional specificity and detail with the accompanying figures in which:

[0013] FIG. 1 is a flow diagram (100) representing steps involved in a reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19), in accordance with an embodiment of the present invention;

[0014] FIG. 2 illustrate specificity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with an embodiment of the present invention;

[0015] FIG. 3 illustrate specificity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with an embodiment of the present invention;

[0016] FIG. 4 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with embodiment of the present invention; and
[0017] FIG. 5 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with embodiment of the present invention.

[0018] Further, those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and may not have necessarily been drawn to scale. Furthermore, in terms of the construction of the device, one or more components of the device may have been represented in the figures by conventional symbols, and the figures may show only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the figures with details that will be readily apparent to those skilled in the art having the benefit of the description herein.

DETAILED DESCRIPTION
[0019] For the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to the embodiment illustrated in the figures and specific language will be used to describe them. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Such alterations and further modifications in the illustrated system, and such further applications of the principles of the disclosure as would normally occur to those skilled in the art are to be construed as being within the scope of the present disclosure.
[0020] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more components, compounds, and ingredients preceded by "comprises... a" does not, without more constraints, preclude the existence of other components or compounds or ingredients or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment.
[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting.
[0022] In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.
[0023] Embodiments of the present invention relates to a reverse transcription
[0024] loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19). The invention mainly focuses on a specific set of primers designed using N-gene and S-gene of SARS CoV-2 for detection of coronavirus disease (COVID-19).
[0025] According to different gene sequences published by a GenBank, RT-LAMP primers being designed by aiming at a relative conserved domain of N-gene and S-gene. The sequences announced by GenBank being further analyzed using CUSTAL W and DNAstar5.0 software. The analytical results showed, a region of N-gene from 420nt - 650nt and a region of S-gene from 15nt - 220nt as highly conserved regions due to extremely less chances of mutation among the COVID-19 virus strain in these regions. Hence, specific primers being designed using the conserved regions of N-gene and S-gene.
[0026] In the present invention three pairs of unique and highly specific primers including a pair of outer primers (a forward outer primer F3, a backward outer primer B3), a pair of inner primers (a forward inner primer FIP(F2), a backward inner primer BIP(B2)), and a pair of loop primers (a forward loop primer LF(F1C), a backward loop primer LB(B1C)) being employed to provide loop-mediated amplification within an optimum specific region of a target sequence for detection of coronavirus disease (COVID-19).
[0027] In an embodiment of the present invention, a primer mix is provided. The primer mix includes one of a set of primers specific to N-gene of SARS CoV-2 and a set of primers specific to S-gene of SARS CoV-2. The set of primers specific to N-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene of SARS CoV-2 are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2.
[0028] The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed with 23 to 25 bases. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed using the conserved regions of N-gene and S-gene. The nucleotide sequences provided by the present invention do not contain repetitive A/T sequences which are most likely to be present in gene sequence of viruses. The Repetitive A or T sequences lead to stem loop formations that hinder the LAMP amplification. The short-sized primers i.e., containing 23 to 25 bases in the nucleotide sequence ensure better specific annealing with complementary target region in short duration and minimize the formation of secondary structures and motifs and also improve specificity. The designed primers includes low Tm value while maintaining the specificity to primer binding sites on target cDNA molecules or templates.
[0029] The set of primer specific to N-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows:
SEQ ID No. 1 – N_F3– AGATCACATTGGCACCCG,
SEQ ID No. 2 - N_B3– CCATTGCCAGCCATTCTAGC,
SEQ ID No. 3 - N_F1C – GCCTCTGCTCCCTTCTGCGTA,
SEQ ID No. 4 - N_F2 – GCTAACAATGCTGCAATCGT,
SEQ ID No. 5 - N_B1C – GCAGTCAAGCCTCTTCTCGT, and
SEQ ID No. 6 - N_B2 – CCTACTGCTGCCTGGAGTT.
[0030] The set of primer specific to S-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows:
SEQ ID No. 7 – S_F3– TGTTTTATTGCCACTAGTCTCT,
SEQ ID No. 8 - S_B3– GGTCCCAGAGACATGTATAGC,
SEQ ID No. 9 - S_F1C – ACCACGTGTGAAAGAATTAGTGTAT,
SEQ ID No. 10 - S_F2 – ACAACCAGAACTCAATTACCCCC,
SEQ ID No. 11 - S_B1C – AGTTTTCAGATCCTCAGTTTTACA, and
SEQ ID No. 12 - S_B2 – GTAACATTGGAAAAGAAAGGTAAG.
[0031] In another embodiment of the present invention, a reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19) is provided. The kit includes a primer mix (PM) comprising one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed with 23 to 25 bases. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed using the conserved regions of N-gene and S-gene.
[0032] The predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being 0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2.
[0033] The set of primer specific to N-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows:
SEQ ID No. 1 – N_F3– AGATCACATTGGCACCCG,
SEQ ID No. 2 - N_B3– CCATTGCCAGCCATTCTAGC,
SEQ ID No. 3 - N_F1C – GCCTCTGCTCCCTTCTGCGTA,
SEQ ID No. 4 - N_F2 – GCTAACAATGCTGCAATCGT,
SEQ ID No. 5 - N_B1C – GCAGTCAAGCCTCTTCTCGT, and
SEQ ID No. 6 - N_B2 – CCTACTGCTGCCTGGAGTT.
[0034] The set of primer specific to S-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows:
SEQ ID No. 7 – S_F3– TGTTTTATTGCCACTAGTCTCT,
SEQ ID No. 8 - S_B3– GGTCCCAGAGACATGTATAGC,
SEQ ID No. 9 - S_F1C – ACCACGTGTGAAAGAATTAGTGTAT,
SEQ ID No. 10 - S_F2 – ACAACCAGAACTCAATTACCCCC,
SEQ ID No. 11 - S_B1C – AGTTTTCAGATCCTCAGTTTTACA, and
SEQ ID No. 12 - S_B2 – GTAACATTGGAAAAGAAAGGTAAG.
[0035] In an embodiment, the kit also includes at least one reaction buffer mix (RBM). the at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer. The reaction buffer mix provides a suitable chemical environment for activity of reaction enzymes.
[0036] In an embodiment, the kit also includes at least one reaction enzyme mix (REM). The at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT.
[0037] In such embodiment, the kit includes at least one developer. The at least one developer comprises 1.0 µl of 120µM HNB (Hydroxy Napthol Blue).
[0038] In yet another embodiment of the present invention, a reverse transcript loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19) is provided.
[0039] FIG. 1 is a flow diagram (100) representing steps involved in the reverse transcription loop mediated isothermal amplification (RT-LAMP) method for detection of coronavirus disease (COVID-19), in accordance with an embodiment of the present invention.
[0040] The method for detection of coronavirus disease (COVID-19) begins with mixing a reaction buffer mix (RBM), a reaction enzyme mix (REM), a primer mix (PM), and sterilized deionized water in a predefined volume to obtain RT-LAMP reaction solution at step 102. The primer mix (PM) comprises one of a set of primers specific to N-gene and a set of primers specific to S-gene in a predefined concentration. The set of primers specific to N-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with N_F3, a nucleotide sequence as set forth in SEQ ID No. 2 with N_B3, a nucleotide sequence as set forth in SEQ ID No. 3 with N_F1C, a nucleotide sequence as set forth in SEQ ID No. 4 with N_F2, a nucleotide sequence as set forth in SEQ ID No. 5 with N_B1C, and a nucleotide sequence as set forth in SEQ ID No. 6 with N_B2. The set of primers specific to S-gene are selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 7 with S_F3, a nucleotide sequence as set forth in SEQ ID No. 8 with S_B3, a nucleotide sequence as set forth in SEQ ID No. 9 with S_F1C, a nucleotide sequence as set forth in SEQ ID No. 10 with S_F2, a nucleotide sequence as set forth in SEQ ID No. 11 with S_B1C, and a nucleotide sequence as set forth in SEQ ID No. 12 with S_B2.
[0041] The predefined volume of RBM, REM, PM, and sterilized deionized water in the first RT-LAMP reaction solution is 7 µl, 3 µl, 1.8 µl and 11.2 µl, respectively. The at least one reaction buffer mix (RBM) comprises 1.0 µl of 100 mM MgSO4, 3.5 µl of 10mM dNTPs, and 2.5 µl of 10X isothermal amplification buffer. The at least one reaction enzyme mix (REM) comprises 1.0 µl of 8U/µl Bst 2.0 WarmStart DNA polymerase, 1.0 µl of 400U/µl AMV Thermo Script II and 2.0 µl of 1 µmol/µl DTT. The predefined concentration of the set of primers specific to N-gene and S-gene in the primer mix being0.5 µl of 100 pmol/µl F3, 0.5 µl of 100 pmol/µl B3, 0.2 µl of 100 pmol/µl F1C, 0.2 µl of 100 pmol/µl F2, 0.2 µl of 100 pmol/µl B1C, and 0.2 µl of 100 pmol/µl B2.
[0042] The set of primer specific to N-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows:
SEQ ID No. 1 – N_F3– AGATCACATTGGCACCCG,
SEQ ID No. 2 - N_B3– CCATTGCCAGCCATTCTAGC,
SEQ ID No. 3 - N_F1C – GCCTCTGCTCCCTTCTGCGTA,
SEQ ID No. 4 - N_F2 – GCTAACAATGCTGCAATCGT,
SEQ ID No. 5 - N_B1C – GCAGTCAAGCCTCTTCTCGT, and
SEQ ID No. 6 - N_B2 – CCTACTGCTGCCTGGAGTT.
[0043] The set of primer specific to S-gene of SARS CoV-2 comprising nucleotide sequences from 5’ end to 3’end is as follows:
SEQ ID No. 7 – S_F3– TGTTTTATTGCCACTAGTCTCT,
SEQ ID No. 8 - S_B3– GGTCCCAGAGACATGTATAGC,
SEQ ID No. 9 - S_F1C – ACCACGTGTGAAAGAATTAGTGTAT,
SEQ ID No. 10 - S_F2 – ACAACCAGAACTCAATTACCCCC,
SEQ ID No. 11 - S_B1C – AGTTTTCAGATCCTCAGTTTTACA, and
SEQ ID No. 12- S_B2 – GTAACATTGGAAAAGAAAGGTAAG.
[0044] The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed with 23 to 25 bases. The nucleotide sequences as set forth in SEQ ID No. 1 to SEQ ID No. 12 being designed using the conserved region of N-gene and S-gene. The amplicon region for the RT-LAMP reaction is <250 base pair, which is highly conserved for COVID-19 virus that decreases primer susceptibility towards cross-reactivity, thereby leading to specific amplification and subsequent detection of all possible COVID-19 strains and not the other related group of viruses.
[0045] In an embodiment, 2 µl RNA sample is assed to obtain a RT-LAMP reaction solution at step 104. The RNA is extracted from a clinical sample obtained from suspected COVID-19 patient using RNA extraction method. The RNA extraction method includes extraction of RNA from the clinical sample using conventional RNA extraction kit or magnetic beads method or conventional Trizol method as per manufacturer’s guidelines.
[0046] In an embodiment, the RT-LAMP reaction is carried by incubating the RT-LAMP reaction solution for a duration of 60minutes at 63? followed by enzyme inactivation at 80°C for a duration of 10 minutes at step 106. The incubating of the RT-LAMP reaction solution is carried using at least one of a Heat block and a water bath. In the RT-LAMP reaction mRNA molecules from the RNA sample being converted into cDNA and LAMP is immediately performed in a same vial without shifting into different reaction vials. This step reduces the time taken for achieving results and saves material resources, thereby making the entire method cost-effective. The unique combination of primers used in the RT-LAMP reaction leads to more efficient polymerization which is evident in the formation of a precipitation of a large amount of nucleic acid and magnesium pyrophosphate in the product of modified RT-LAMP reaction.
[0047] In such an embodiment, the coronavirus disease (COVID-19) is detected in the clinical sample by analysing outcome of step 106 by at least one of colorimetric detection method, and a conventional agarose gel electrophoresis method at step 108. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the colorimetric detection method comprises observing a visible change in colour of product of step (c) resulting due to formation of DNA-dye complex, wherein occurrence of blue colour indicates presence of COVID-19 virus in the clinical sample contains. The detecting of the coronavirus disease (COVID-19) in the clinical sample by the conventional agarose gel electrophoresis provide qualitative results depicting presence or absence of COVID-19 virus in the clinical sample. The detecting of the coronavirus disease (COVID-19) in the sample by the colorimetric detection method comprises using at least one developer comprising HNB (Hydroxy Napthol Blue) imparting blue colour.
[0048] In one embodiment, the coronavirus disease (COVID-19) is detected in the clinical sample by monitoring outcome of step 106 in real-time with the fluorescent dye, enabling quantification if needed in a laboratory setup. In one embodiment, the detection may be achieved using a conventional EtBr based gel electrophoresis under UV-transilluminator or fluorometer.
[0049] The RT-LAMP reaction specificity and sensitivity carried using the primer mix provided by the present invention being evaluated against suspected COVID-19 clinical samples w.r.t. to real time PCR technique approved by World Health Organization (WHO) for detection of coronavirus disease. The sensitivity of the RT-LAMP reaction carried using the primer mix provided by the present invention is also analyzed using various concentrations of RNA copy number.
[0050] FIG. 2 illustrate specificity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with embodiment of the present invention.
[0051] FIG. 3 illustrate specificity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with embodiment of the present invention.
[0052] The specificity of the RT-LAMP reaction is interpretated by analysing results of RT-LAMP reaction using both the colorimetric detection method and the conventional agarose gel electrophoresis method. In the colorimetric detection method, positive results i.e. presence of COVID-19 virus in the clinical samples are indicated by occurrence of blue color and negative results i.e. absence of COVID-19 virus in the clinical samples are indicated by occurrence of deep violet color. In the conventional agarose gel electrophoresis method, positive results i.e. presence of COVID-19 virus in the clinical samples are indicated by distinctive scalariform band and negative results i.e. absence of COVID-19 virus in the clinical samples are indicated by absence of band.
[0053] FIG. 4 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to N-gene, in accordance with embodiment of the present invention.
[0054] FIG. 5 illustrate sensitivity of the RT-LAMP reaction using the set of primer specific to S-gene, in accordance with embodiment of the present invention.
[0055] The RT-LAMP reaction sensitivity is pressed with the respective synthesized RNA templates (1,00,000copies/µl, 10,000copies/µl, 1,000copies/µl, 100copies/µl, 10copies/µl, and 1copy/µl). The test finds that along with an increased dilution the color intensity decreases and both the set of primer specific to N-gene and the set of primer specific to S-gene are able to detect 10 copies/µl.
[0056] The present invention provides the primer mix containing 23 to 25 bases in the nucleotide sequence which ensure better specific annealing with complementary target region in short duration and minimize the formation of secondary structures and motifs and also improve specificity. The present invention also provides the reverse transcription loop mediated isothermal amplification (RT-LAMP) detection kit for coronavirus disease (COVID-19). The detection kit being cost-effective and enables specific, sensitive, and rapid detection of coronavirus disease. Moreover, the detection kit enables acquiring diagnosis results within an hour or even a shorter time, thereby initiating highly effective response mechanisms to check spread of the coronavirus disease. The invention also provides the reverse transcription loop mediated isothermal amplification (RT-LAMP) method for coronavirus disease (COVID-19). The method enables cost-effective, specific and rapid diagnosis of coronavirus disease. The method being highly sensitive and may enable detection between 10 to 50 fg RNA from non-invasive clinical samples obtained from suspected COVID-19 patient. The RT-LAMP method having simplified operation step and performed in a single tube for cDNA conversion and amplification.
[0057] While specific language has been used to describe the disclosure, any limitations arising on account of the same are not intended. As would be apparent to a person skilled in the art, various working modifications may be made to the method in order to implement the inventive concept as taught herein.

[0058] The figures and the foregoing description give examples of embodiments. Those skilled in the art will appreciate that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be split into multiple functional elements. Elements from one embodiment may be added to another embodiment. Moreover, the actions of any flow diagram need not be implemented in the order shown; nor do all of the acts need to be necessarily performed. Also, those acts that are not dependant on other acts may be performed in parallel with the other acts. The scope of embodiments is by no means limited by these specific examples.

Documents

Application Documents

# Name Date
1 202141010641-STATEMENT OF UNDERTAKING (FORM 3) [13-03-2021(online)].pdf 2021-03-13
2 202141010641-SEQUENCE LISTING(PDF) [13-03-2021(online)].pdf 2021-03-13
3 202141010641-SEQUENCE LISTING [13-03-2021(online)].txt 2021-03-13
4 202141010641-FORM FOR STARTUP [13-03-2021(online)].pdf 2021-03-13
5 202141010641-FORM FOR SMALL ENTITY(FORM-28) [13-03-2021(online)].pdf 2021-03-13
6 202141010641-FORM 1 [13-03-2021(online)].pdf 2021-03-13
7 202141010641-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [13-03-2021(online)].pdf 2021-03-13
8 202141010641-EVIDENCE FOR REGISTRATION UNDER SSI [13-03-2021(online)].pdf 2021-03-13
9 202141010641-DRAWINGS [13-03-2021(online)].pdf 2021-03-13
10 202141010641-DECLARATION OF INVENTORSHIP (FORM 5) [13-03-2021(online)].pdf 2021-03-13
11 202141010641-COMPLETE SPECIFICATION [13-03-2021(online)].pdf 2021-03-13
12 202141010641-Proof of Right [23-03-2021(online)].pdf 2021-03-23
13 202141010641-FORM-26 [23-03-2021(online)].pdf 2021-03-23
14 202141010641-FORM 18 [13-03-2025(online)].pdf 2025-03-13