Abstract: SET OF NUCLEOTIDE SEQUENCES AND HRCA REACTION METHOD FOR IDENTIFICATION OF A1 AND A2 BOVINE-SAMPLE ABSTRACT A set of nucleotide sequences for HRCA reaction for identification and differentiation of A1 type and A2 type alleles in samples (milk, blood and hair) from bovines is provided. The set of nucleotide sequences includes a set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence. The set of nucleotide sequences also includes a set of primers specific to the set of padlock probes. The set of nucleotide sequences being specific and efficient for identification and differentiation of A1 type and A2 type allele. The set of nucleotide sequences provides rapid and cost-effective detection of the A1 type and A2 type allele in the samples (milk, blood and hair) from bovines. The invention also provides a HRCA reaction method for identification and differentiation of A1 type and A2 type allele. The method provided by the present invention is simple, cost effective, user friendly and field deployable. FIG. 1
1. A set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type of allele in a sample from bovines, comprising: a set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence, wherein the set of padlock probes comprises: a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe, a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe; a set of primers specific to the set of padlock probes selected from a group consisting: a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, and a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer.
2. The set of nucleotide sequences as claimed in claim 1, wherein the sample from bovines comprises milk, blood, and hair or combination thereof.
3. A hyperbranched rolling circle amplification (HRCA) reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in a sample from bovines, comprising: a) subjecting a DNA sample extracted in the sample from bovines and a set of padlock probes to a ligation reaction to form a ligated circular padlock probe, wherein the set of padlock probes being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe; b) providing an exonuclease treatment for screening out the ligated circular padlock probe; and c) carrying the hyperbranched rolling circle amplification (HRCA) reaction using the ligated circular probe and a set of primers, wherein the set of primers being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, and a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer; and d) detecting at least one of A1 type and A2 type alleles from the sample by analysing outcome of the step (c) by agarose gel electrophoresis method, wherein positive signals were visualized as a ladder of bands starting at one unit circle length and extending in discrete increments of 100 bp.
4. The method as claimed in claim 3, wherein the ligation reaction to form the ligated circular padlock probe comprises: denaturation of the DNA sample at 94 °C for a duration of 5 minutes; adding the denatured DNA sample to a reaction mixture along with DNA ligase; performing the ligation reaction by incubation at 37 °C for a duration of 60 minutes; and performing inactivation of T4 DNA ligase at 85 °C for a duration of 10 minutes.
5. The method as claimed in claim 4, wherein the reaction mixture includes padlock probe, 10× T4 DNA ligase buffer and template DNA.
6. The method as claimed in claim 3, wherein the exonuclease treatment for screening out the ligated circular padlock probe comprises: adding 1µL exonuclease I at 20 U/µL to the ligated circular padlock probe to obtain a solution; incubating the solution at 37 °C for a duration of 30 minutes; and performing inactivation of exonuclease I at 94 °C for 1 minute to obtain the screened out ligated circular padlock probe.
7. The method as claimed in claim 3, wherein the carrying of the hyperbranched rolling circle amplification (HRCA) reaction comprises: adding the ligated circular padlock probe to HRCA reaction mixture; incubating the HRCA reaction mixture at 65 °C for a duration of 30 minutes; and performing inactivation at 95 °C for a duration of 10 minutes to obtain HRCA reaction product.
8. The method as claimed in claim 7, wherein the HRCA reaction mixture comprises dNTPs, HRCA primer, Tris HCl, KCl, MgSO4 , (NH4)2SO4, Triton ×-100, ligation product and Bst DNA polymerase.
9. The method as claimed in claim 2, wherein the sample from bovines comprises milk, blood, and hair or combination thereof. Dated this 09th day of March 2021 Vidya Bhaskar Singh Nandiyal Patent Agent (IN/PA-2912) Agent for applicant , Description:FIELD OF INVENTION [1] Embodiments of the present invention relates to technical field of molecular biological detection, and more particularly to the set of nucleotide sequences and HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in samples (milk, blood and hair) from bovines. BACKGROUND [2] Since time immemorial bovine milk has been considered as complete food that contains essential macro and micronutrients. The total milk protein is composed of numerous specific proteins. However, two major categories are caseins and whey proteins which constitutes around 80 % and 20 % of the total protein, respectively. [3] Casein is classified as a-S1- (CSN1-S1, 39-46 %), a-S2- (CSN1-S2, 8-11 %), ß- (CSN2, 25-35 %) and ?- (CSN3, 9-15 %) of total caseins. Among them ß-casein is the second most abundant protein and consists of 209 amino acids residues encoded by polymorphic CSN2 gene. Due to single nucleotide polymorphism (SNP) there are 13 genetic variants of ß-casein: A1, A2, A3, A4, B, C, D, E, F, G, H1, H2 and I. The most frequently observed genetic variants are A1 and A2. [4] A1 and A2 variants are differentiated by change of one nucleotide at 202 position of CSN2 gene from cytosine (201-CCT-203) to adenine (201-CAT-203). This resulted in amino acid change at 67th position of CSN2 gene from proline in A2 to histidine in A1 milk. This SNP in ß -casein gene gave rise to three different genotypes such as CC (A2 homozygous), AC (A1/A2 heterozygous) and AA (A1 homozygous). [5] Consumption of milk of certain breeds of cattle may result in the release and possible absorption of bioactive peptides like beta casomorphins (ß-CMs). ß-CMs are 4 to 11 amino acid peptides present in an inactive form that are released during either in-vivo or in-vitro digestion. These peptides have a unique structural features that impart high and physiologically significant affinity with the binding sites of endogenous opoid receptors. [6] After gastrointestinal digestion of A1 milk, histidine facilitates the release of 7 amino-acid peptide called BCM-7, whereas BCM-7 is less likely to be released from A2 milk. BCM-7 obtained after A1 milk digestion may be associated with increased risk of diseases such as Type 1 diabetes mellitus, autism, schizophrenia and increased gastrointestinal inflammation. No existing reports have found the A2 allele ß casein to be related to adverse health problems. [7] Hence, A2 milk is generally preferred over A1 milk. Routinely A2 milk is blended with A1 milk due to ignorance and sometimes due to commercial exploitation. Hence, there is a dire need to differentiate the genetic breed of the cattle especially SNP in beta-casein gene basis. On the other hand, identification of indigenous A2 breeds is necessary for selective breeding and further preservation of the original breeds. [8] Currently, various PCR based molecular approaches for genotyping milk proteins are available such as PCR-SSR (Simple Sequence Repeat polymorphism or microsatellite markers), PCR-SSCP (Single Strand Conformation Polymorphism), PCR-RFLP (Restriction Fragment Length Polymorphism). [9] Therefore, there is a need for a set of nucleotide sequences, and simple and cost-effective method for identification and differentiation of at least one of A1 and A2 allele from samples of bovines. SUMMARY [10] In accordance with an embodiment of the invention, a set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type alleles in samples (milk, blood and hair) from bovines is provided. The set of nucleotide sequences includes a set of padlock probes comprising complimentary 5’ and 3’ end to a target sequence. The set of padlock probes includes a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. The set of nucleotide sequences also includes a set of primers specific to the set of padlock probes selected consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer. [11] In accordance with another embodiment of the invention, a hyperbranched rolling circle amplification (HRCA) reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in samples from bovines is provided. The method includes subjecting the DNA extracted from the bovine samples and a set of padlock probes to a ligation reaction to form a ligated circular padlock probe. The set of padlock probes being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. The method also includes providing an exonuclease treatment for screening out the ligated circular padlock probe. The method also includes carrying hyperbranched rolling circle amplification (HRCA) reaction using the ligated circular probe and a set of primers. The method further includes detecting at least one of A1 type and A2 type allele from the sample by analysing outcome of the HRCA reaction by agarose gel electrophoresis method. The set of primers being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer. Positive signals were visualized as a ladder of bands starting at one unit circle length and extending in discrete increments of 100 bp. [12] To further clarify the advantages and features of the present disclosure, a more particular description of the disclosure will follow by reference to specific embodiments thereof, which are illustrated in the appended figures. It is to be appreciated that these figures depict only typical embodiments of the disclosure and are therefore not to be considered limiting in scope. The disclosure will be described and explained with additional specificity and detail with the appended figures. BRIEF DESCRIPTION OF THE DRAWINGS The disclosure will be described and explained with additional specificity and detail with the accompanying figures in which: [13] FIG. 1 is a flow diagram (100) representing steps involved in HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles from samples from bovines, in accordance with an embodiment of the present invention; [14] FIG. 2 illustrates an electrophoresis gel image under UV light representing screened out ligated circular padlock probe after exonuclease treatment, in accordance with an embodiment of the present invention; [15] FIG. 3 illustrates an electrophoresis gel image under UV light representing standardization of optimum padlock probe concentration for ligation reaction, in accordance with an embodiment of the present invention; [16] FIG.4 illustrates an electrophoresis gel image under UV light representing standardization of optimum temperature for the HRCA reaction, in accordance with an embodiment of the present invention; [17] FIG. 5 illustrates an electrophoresis gel image under UV light representing standardization of optimum MgSO4 concentration for the HRCA reaction; in accordance with an embodiment of the present invention; [18] FIG. 6 illustrates an electrophoresis gel image under UV light representing results of the HRCA reaction for identification and differentiation of at least one of A1 type and A2 type alleles, in accordance with an embodiment of the present invention; and [19] Further, those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and may not have necessarily been drawn to scale. Furthermore, in terms of the method steps, chemical compounds, and parameters used herein may have been represented in the figures by conventional symbols, and the figures may show only those specific details that are pertinent to understanding the embodiments of the present disclosure so as not to obscure the figures with details that will be readily apparent to those skilled in the art having the benefit of the description herein. DETAILED DESCRIPTION [20] For the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to the embodiment illustrated in the figures and specific language will be used to describe them. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Such alterations and further modifications in the illustrated system, and such further applications of the principles of the disclosure as would normally occur to those skilled in the art are to be construed as being within the scope of the present disclosure. [21] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more components, compounds, and ingredients preceded by "comprises... a" does not, without more constraints, preclude the existence of other components or compounds or ingredients or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment. [22] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting. [23] In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. [24] Embodiments of the present invention relates to a set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type alleles from samples from bovines. The invention mainly focuses on designing padlock probes and padlock probes specific primers for identification and differentiation of the at least one of A1 type and A2 type alleles in milk, blood and hair samples from bovines. The invention also focuses on development of HRCA reaction method for differentiation of A1 type and A2 type alleles. [25] As used herein the term “hyperbranched rolling circle amplification (HRCA)” refers to a technique derived from rolling circle amplification (RCA) in which DNA polymerase replicates circularized oligonucleotide probes under isothermal conditions with either linear or geometric kinetics. [26] In an embodiment, a set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type alleles in samples from bovines is provided. The set of nucleotide sequences includes a set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence. The set of padlock probes includes a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe, and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. The set of nucleotide sequences also includes a set of primers specific to the set of padlock probes selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer. [27] In one embodiment, the sample from bovines to be analysed for presence of A1 type and A2 type alleles is the milk. In another embodiment, the sample from bovines to be analysed for detection of A1 type and A2 type alleles is blood. In yet another embodiment, the sample from bovines to be analysed for detection of A1 type and A2 type alleles is hair. In an embodiment, the sample may include a combination of the milk, blood, and hairs. [28] The set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence is as follows: SEQ ID No. 1 - A1 Padlock probe (PLP) – GGATGGGCCCAGGGAGCTGTGCTCACAGGTGTGTGACGCAGGAGCCGTGACGCTCGACTGCTGTGCTCACAGGTGTGTGACGCGATGTTTTGTGGGAGGCTGTTAT, and SEQ ID No. 2 - A2 Padlock probe (PLP) – GGATGGGCCCAGGGAAGGCGCGTGCGTGCGTGCGAGAGCAGGAGCCGTGACGCTCGACTCGTGCGTGCGTGCGAGAGCGATGTTTTGTGGGAGGCTGTTAG. [29] The set of primers specific to the set of padlock probes are as follows: SEQ ID No. 3 - Common HRCA primer – AGTCGAGCGTCACGGCTCCT, SEQ ID No. 4 - A1 HRCA primer – GCTGTGCTCACAGGTGTGTGACGC, SEQ ID No. 5 - A2 HRCA primer – CGTGCGTGCGTGCGAGAGC, [30] The specific identification sequences of the padlock probe and primers were designed according to the gene sequence of A1 and A2 bovine beta-casein gene. The gene sequences of beta-casein (CSN2) were obtained from Gen bank (accession number: M55158.1). The sequences of beta-casein, which is specific to the A1 and A2 variant were selected as the target for the two ends of the padlock probe. To ensure the efficiency of the padlock probe binding with the target DNA, the 5’ end and 3’ end sequences were designed to bind adjacently head to tail with minimum secondary structure and complete complementary to the appropriate region of A1 and A2 sequences. The primers provided by the present invention to amplify the specific padlock probe signal are also designed targeting the highly specific regions of SNP of CSN2 beta-casein gene. [31] In another embodiment of the present invention, a hyperbranched rolling circle amplification (HRCA) reaction method for identification and differentiation of at least one of A1 type and A2 type alleles from samples from bovines is provided. The method includes application of the padlock probes and primers designed by the present invention into the HRCA reaction for detection of the at least one of A1 type and A2 type alleles in the samples from bovines. [32] FIG. 1 is a flow diagram (100) representing steps involved in HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in the samples from bovines, in accordance with an embodiment of the present invention. [33] The HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles begins with subjecting a DNA sample extracted in the samples from bovines and a set of padlock probes to a ligation reaction to form a ligated circular padlock probe at step 102. The sample from bovines includes milk, blood, and hair or combination thereof. The set of padlock probes being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. [34] The set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence is as follows: SEQ ID No. 1 - A1 Padlock probe (PLP) – GGATGGGCCCAGGGAGCTGTGCTCACAGGTGTGTGACGCAGGAGCCGTGACGCTCGACTGCTGTGCTCACAGGTGTGTGACGCGATGTTTTGTGGGAGGCTGTTAT, and SEQ ID No. 2 - A2 Padlock probe (PLP) – GGATGGGCCCAGGGAAGGCGCGTGCGTGCGTGCGAGAGCAGGAGCCGTGACGCTCGACTCGTGCGTGCGTGCGAGAGCGATGTTTTGTGGGAGGCTGTTAG. [35] Before ligation isolated DNA was denatured at 94 ºC for 5 minutes for breaking down the double strand DNA molecule to single strand. [36] For ligation, the reaction mixture consisted of 1 µl padlock probe, 1 µl 10× T4 DNA ligase buffer and 3 µl template DNA. 1U/µl T4 DNA ligase was then added and adjusted to a final volume of 10 µl with sterile double distilled H2O. The tubes were incubated at 37 °C for 60 minutes, the reaction was then terminated by incubating at 85 °C for 10 minutes to obtain the ligated circular padlock probe. As used herein the term “ligation reaction” refers to joining of two nucleic acid fragments through the action of an enzyme. [37] FIG. 2 illustrates an electrophoresis gel image under UV light representing results of ligation reaction conforming a ligated circular padlock probe, in accordance with an embodiment of the present invention. [38] FIG. 3 illustrates an electrophoresis gel image under UV light representing standardization of optimum padlock probe concentration for ligation reaction, in accordance with an embodiment of the present invention. The optimum padlock probe concentration standardized for the ligation reaction was 2000 pm. [39] In an embodiment, an exonuclease treatment is provided after the ligation reaction for screening out the ligated circular padlock probe at step 104. The exonuclease treatment for removing non circularized padlock probe and excess PCR product includes adding 1 µL exonuclease I at 20 U/µL to the ligated circular padlock probe. The exonuclease treatment also includes incubation at 37 °C for a duration of 30 minutes followed by inactivation of exonuclease I at 94 °C for 1 minute. [40] In an embodiment, the hyperbranched rolling circle amplification (HRCA) reaction is carried using the ligated circular probe and a set of primers at step 106. The set of primers being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer. [41] The set of primers specific to the set of padlock probes is as follows: SEQ ID No. 3 - Common HRCA primer – AGTCGAGCGTCACGGCTCCT, SEQ ID No. 4 - A1 HRCA primer – GCTGTGCTCACAGGTGTGTGACGC, SEQ ID No. 5 - A2 HRCA primer – CGTGCGTGCGTGCGAGAGC, [42] The HRCA reaction mixture contained 0.4 mmol/L of dNTPs, 0.4 µmol/L each of HRCA primer, 20 mmol/L Tris-HCl (pH 8.8), 10 mmol/L KCl, 6.5 mmol/L MgSO4, 10 mmol/L (NH4)2SO4, 0.1 % Triton ×-100, 2 µL ligation product, and 8U Bst DNA polymerase, adjusted to a final volume of 25 µL with double distilled water. HRCA reaction also includes incubation at 65 ºC for 30 minutes followed by incubation at 95 ºC for 10 minutes to terminate the reaction. [43] FIG. 4 illustrates an electrophoresis gel image under UV light representing standardization of optimum temperature for the HRCA reaction, in accordance with an embodiment of the present invention. The standardized optimum temperature for the HRCA reaction is 65 °C. [44] FIG. 5 illustrates an electrophoresis gel image under UV light representing standardization of optimum MgSO4 concentration for the HRCA reaction; in accordance with an embodiment of the present invention. [45] In an embodiment, at least one of A1 type and A2 type alleles in the sample is detected by analysing outcome of the HRCA reaction by agarose gel electrophoresis method at step 108. Positive signals were visualized as a ladder of bands starting at one unit circle length and extending in discrete increments of 100 bp. [46] FIG. 6 illustrates an electrophoresis gel image under UV light representing results of the HRCA reaction for identification and differentiation of the at least one of A1 type and A2 type alleles, in accordance with an embodiment of the present invention. The results of the HRCA reaction are compared with the control ladder for identification of A1 type and A2 type alleles, as the A1 padlock probe is designed with specificity towards the A1 genomic DNA and the A2 padlock probe is designed with specificity towards the A2 genomic DNA. EXAMPLES [47] The present invention is explained further in the following specific examples which are only by way of illustration and are not to be construed as limiting the scope of the invention. [48] Example 1: Isolation of DNA from milk Milk sample was transferred to a sterile eppendorf tube and centrifuged repeatedly at 8000 rpm for 3 minutes. Further, supernatant was removed, and pellet was washed with wash buffer. Somatic cell lysis was carried out using lysis buffer with 10 % sodium dodecyl sulfate (SDS). The debris was removed by centrifugation at 8000 rpm for 3 minutes. 6M NaCl was added to the solution to precipitate the protein and centrifuge at 12,500 rpm for 10 minutes then the supernatant was collected in the sterile eppendorf tube. DNA was precipitated using ethanol followed by centrifugation at 12,500 rpm for 10 minutes and allowed to air-dry for 30 minutes. DNA was dissolved in milli-Q water and stored at -80 °C for later uses. [49] Example 2: Isolation of DNA from blood Non enzymatic salting out method was used for the isolation of DNA from blood. Blood was collected in tubes containing ethylenediaminetetraacetic acid (EDTA). 900 µL of TKM 1 buffer [Tris HCl (10 mM, pH 7.6), KCl (10 mM), MgCl2 (10mM), EDTA (2 mM)] and 50 µL of 1 Triton-× were added to 300 µL of heparinised blood in an autoclaved 1.5 ml Eppendorf tube. It was incubated at 37 ºC for 5 minutes to lyse the red blood cells (RBCs). Cells were centrifuged at 8000 rpm for 3 minutes and the supernatant was discarded. This step was repeated 2-3 times with decreasing amount of 1x Triton-× till RBC lysis was complete and a white pellet of white blood cells (WBCs) was obtained. To the cell pellet, 300 µL of TKM 2 buffer [Tris HCl (10 mM, pH 7.6), KCl (10 mM), MgCl2 (10mM), EDTA (2 mM), NaCl (0.4M)] and 40 µL of 10 % SDS were added, mixed thoroughly and incubated at 37 ºC for 5 minutes. At the end of incubation, 100 µL of 6M NaCl was added and vortexed to precipitate the proteins. The cells were centrifuged at 8000 rpm for a duration of 5 minutes. The supernatant was transferred into a new Eppendorf tube containing 300 µL of isopropanol. DNA was precipitated by inverting the Eppendorf tube slowly. Further, the tubes were centrifuged at 8000 rpm for 10 minutes to pellet down the DNA. Supernatant was discarded, 70 % ethanol was added and mixed slowly to remove any excess salts. Finally, the tubes were centrifuged at 8000 rpm for 5 minutes to pellet down the DNA. Supernatant was discarded and DNA was air dried. After thorough drying, 50 µL of TE buffer was added to dissolve the DNA and stored at -80 ºC for later use. [50] Example 3: Isolation of DNA from hair 500 µL of digestion buffer (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl, 20 % SDS, pH 7.5) was added to 1.5 mL microcentrifuge tube, along with 40 µL of 1 M dithiothreitol (DTT) (to a final concentration of ~80 mM), 240 mM of sodium acetate (pH 5.2) and 15 µL of 10 mg/mL proteinase K (to a final concentration of ~0.3 mg/mL). Hair sample was added to this solution before vortexing and incubating for 2 hours at 56 °C. After incubation, the sample tube was vortexed again, and an additional 40 µL DTT and 15 µL of proteinase K were added, followed by gentle mixing and incubation at 60 °C for 2 more hours or until hair was dissolved completely. DNA was then extracted with an equal volume of phenol: chloroform: isoamyl alcohol solution and mixed gently by inverting the tube for few minutes. The samples were centrifuged for 10 minutes with 10,000 rpm (4 °C), followed by transferring the upper aqueous layer into a fresh, sterilized microcentrifuge tube. RNaseA (10 µL of 10 mg/mL) was added and kept for incubation at 37 °C for 30 minutes. An equal volume of chloroform: isoamyl alcohol was added, and the tube was centrifuged again at 10,000 rpm (4 °C) for 10 minutes. The upper aqueous layer was transferred into a sterilized microcentrifuge tube before double the volume of chilled isopropanol and one-tenth volume of 3 M sodium acetate were added. The sample was chilled at -20 °C for 1 hour for the DNA precipitation to occur. The sample was centrifuged at 10,000 g (4 °C) for 10 minutes. The supernatant was discarded, 250 µL 70 % ethanol was added, and the pellet was tapped gently before further centrifugation at 10,000 rpm for 10 minutes. The supernatant was discarded, and the pellet was air-dried in a laminar air flow, resuspended in 50 µL nuclease-free water or 1× TE buffer and stored at -80 ºC for later uses. [51] The set of nucleotide sequences including the set of padlock probes and the set of primers provided by the present invention being specific and efficient for identification and differentiation of A1 type and A2 type alleles. The set of nucleotide sequences provides rapid and cost-effective detection of the A1 type and A2 type alleles in the samples from bovines. The HRCA reaction method using padlock probes and primers provided by the present invention is simple and cost effective as the method is being carried out in a single tube. [52] While specific language has been used to describe the disclosure, any limitations arising on account of the same are not intended. As would be apparent to a person skilled in the art, various working modifications may be made to the method in order to implement the inventive concept as taught herein. [53] The figures and the foregoing description give examples of embodiments. Those skilled in the art will appreciate that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be split into multiple functional elements. Elements from one embodiment may be added to another embodiment. Moreover, the actions of any flow diagram need not be implemented in the order shown; nor do all of the acts need to be necessarily performed. Also, those acts that are not dependant on other acts may be performed in parallel with the other acts. The scope of embodiments is by no means limited by these specific examples.
Claims:WE CLAIM:
1. A set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type of allele in a sample from bovines, comprising:
a set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence, wherein the set of padlock probes comprises:
a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe,
a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe;
a set of primers specific to the set of padlock probes selected from a group consisting:
a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer,
a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, and
a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer.
2. The set of nucleotide sequences as claimed in claim 1, wherein the sample from bovines comprises milk, blood, and hair or combination thereof.
3. A hyperbranched rolling circle amplification (HRCA) reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in a sample from bovines, comprising:
a) subjecting a DNA sample extracted in the sample from bovines and a set of padlock probes to a ligation reaction to form a ligated circular padlock probe,
wherein the set of padlock probes being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe;
b) providing an exonuclease treatment for screening out the ligated circular padlock probe; and
c) carrying the hyperbranched rolling circle amplification (HRCA) reaction using the ligated circular probe and a set of primers,
wherein the set of primers being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, and a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer; and
d) detecting at least one of A1 type and A2 type alleles from the sample by analysing outcome of the step (c) by agarose gel electrophoresis method, wherein positive signals were visualized as a ladder of bands starting at one unit circle length and extending in discrete increments of 100 bp.
4. The method as claimed in claim 3, wherein the ligation reaction to form the ligated circular padlock probe comprises:
denaturation of the DNA sample at 94 °C for a duration of 5 minutes;
adding the denatured DNA sample to a reaction mixture along with DNA ligase;
performing the ligation reaction by incubation at 37 °C for a duration of 60 minutes; and
performing inactivation of T4 DNA ligase at 85 °C for a duration of 10 minutes.
5. The method as claimed in claim 4, wherein the reaction mixture includes padlock probe, 10× T4 DNA ligase buffer and template DNA.
6. The method as claimed in claim 3, wherein the exonuclease treatment for screening out the ligated circular padlock probe comprises:
adding 1µL exonuclease I at 20 U/µL to the ligated circular padlock probe to obtain a solution;
incubating the solution at 37 °C for a duration of 30 minutes; and
performing inactivation of exonuclease I at 94 °C for 1 minute to obtain the screened out ligated circular padlock probe.
7. The method as claimed in claim 3, wherein the carrying of the hyperbranched rolling circle amplification (HRCA) reaction comprises:
adding the ligated circular padlock probe to HRCA reaction mixture;
incubating the HRCA reaction mixture at 65 °C for a duration of 30 minutes; and
performing inactivation at 95 °C for a duration of 10 minutes to obtain HRCA reaction product.
8. The method as claimed in claim 7, wherein the HRCA reaction mixture comprises dNTPs, HRCA primer, Tris HCl, KCl, MgSO4 , (NH4)2SO4, Triton ×-100, ligation product and Bst DNA polymerase.
9. The method as claimed in claim 2, wherein the sample from bovines comprises milk, blood, and hair or combination thereof.
Dated this 09th day of March 2021
Vidya Bhaskar Singh Nandiyal
Patent Agent (IN/PA-2912)
Agent for applicant
, Description:FIELD OF INVENTION
[1] Embodiments of the present invention relates to technical field of molecular biological detection, and more particularly to the set of nucleotide sequences and HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in samples (milk, blood and hair) from bovines.
BACKGROUND
[2] Since time immemorial bovine milk has been considered as complete food that contains essential macro and micronutrients. The total milk protein is composed of numerous specific proteins. However, two major categories are caseins and whey proteins which constitutes around 80 % and 20 % of the total protein, respectively.
[3] Casein is classified as a-S1- (CSN1-S1, 39-46 %), a-S2- (CSN1-S2, 8-11 %), ß- (CSN2, 25-35 %) and ?- (CSN3, 9-15 %) of total caseins. Among them ß-casein is the second most abundant protein and consists of 209 amino acids residues encoded by polymorphic CSN2 gene. Due to single nucleotide polymorphism (SNP) there are 13 genetic variants of ß-casein: A1, A2, A3, A4, B, C, D, E, F, G, H1, H2 and I. The most frequently observed genetic variants are A1 and A2.
[4] A1 and A2 variants are differentiated by change of one nucleotide at 202 position of CSN2 gene from cytosine (201-CCT-203) to adenine (201-CAT-203). This resulted in amino acid change at 67th position of CSN2 gene from proline in A2 to histidine in A1 milk. This SNP in ß -casein gene gave rise to three different genotypes such as CC (A2 homozygous), AC (A1/A2 heterozygous) and AA (A1 homozygous).
[5] Consumption of milk of certain breeds of cattle may result in the release and possible absorption of bioactive peptides like beta casomorphins (ß-CMs). ß-CMs are 4 to 11 amino acid peptides present in an inactive form that are released during either in-vivo or in-vitro digestion. These peptides have a unique structural features that impart high and physiologically significant affinity with the binding sites of endogenous opoid receptors.
[6] After gastrointestinal digestion of A1 milk, histidine facilitates the release of 7 amino-acid peptide called BCM-7, whereas BCM-7 is less likely to be released from A2 milk. BCM-7 obtained after A1 milk digestion may be associated with increased risk of diseases such as Type 1 diabetes mellitus, autism, schizophrenia and increased gastrointestinal inflammation. No existing reports have found the A2 allele ß casein to be related to adverse health problems.
[7] Hence, A2 milk is generally preferred over A1 milk. Routinely A2 milk is blended with A1 milk due to ignorance and sometimes due to commercial exploitation. Hence, there is a dire need to differentiate the genetic breed of the cattle especially SNP in beta-casein gene basis. On the other hand, identification of indigenous A2 breeds is necessary for selective breeding and further preservation of the original breeds.
[8] Currently, various PCR based molecular approaches for genotyping milk proteins are available such as PCR-SSR (Simple Sequence Repeat polymorphism or microsatellite markers), PCR-SSCP (Single Strand Conformation Polymorphism), PCR-RFLP (Restriction Fragment Length Polymorphism).
[9] Therefore, there is a need for a set of nucleotide sequences, and simple and cost-effective method for identification and differentiation of at least one of A1 and A2 allele from samples of bovines.
SUMMARY
[10] In accordance with an embodiment of the invention, a set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type alleles in samples (milk, blood and hair) from bovines is provided. The set of nucleotide sequences includes a set of padlock probes comprising complimentary 5’ and 3’ end to a target sequence. The set of padlock probes includes a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. The set of nucleotide sequences also includes a set of primers specific to the set of padlock probes selected consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer.
[11] In accordance with another embodiment of the invention, a hyperbranched rolling circle amplification (HRCA) reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in samples from bovines is provided. The method includes subjecting the DNA extracted from the bovine samples and a set of padlock probes to a ligation reaction to form a ligated circular padlock probe. The set of padlock probes being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. The method also includes providing an exonuclease treatment for screening out the ligated circular padlock probe. The method also includes carrying hyperbranched rolling circle amplification (HRCA) reaction using the ligated circular probe and a set of primers. The method further includes detecting at least one of A1 type and A2 type allele from the sample by analysing outcome of the HRCA reaction by agarose gel electrophoresis method. The set of primers being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer. Positive signals were visualized as a ladder of bands starting at one unit circle length and extending in discrete increments of 100 bp.
[12] To further clarify the advantages and features of the present disclosure, a more particular description of the disclosure will follow by reference to specific embodiments thereof, which are illustrated in the appended figures. It is to be appreciated that these figures depict only typical embodiments of the disclosure and are therefore not to be considered limiting in scope. The disclosure will be described and explained with additional specificity and detail with the appended figures.
BRIEF DESCRIPTION OF THE DRAWINGS
The disclosure will be described and explained with additional specificity and detail with the accompanying figures in which:
[13] FIG. 1 is a flow diagram (100) representing steps involved in HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles from samples from bovines, in accordance with an embodiment of the present invention;
[14] FIG. 2 illustrates an electrophoresis gel image under UV light representing screened out ligated circular padlock probe after exonuclease treatment, in accordance with an embodiment of the present invention;
[15] FIG. 3 illustrates an electrophoresis gel image under UV light representing standardization of optimum padlock probe concentration for ligation reaction, in accordance with an embodiment of the present invention;
[16] FIG.4 illustrates an electrophoresis gel image under UV light representing standardization of optimum temperature for the HRCA reaction, in accordance with an embodiment of the present invention;
[17] FIG. 5 illustrates an electrophoresis gel image under UV light representing standardization of optimum MgSO4 concentration for the HRCA reaction; in accordance with an embodiment of the present invention;
[18] FIG. 6 illustrates an electrophoresis gel image under UV light representing results of the HRCA reaction for identification and differentiation of at least one of A1 type and A2 type alleles, in accordance with an embodiment of the present invention; and
[19] Further, those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and may not have necessarily been drawn to scale. Furthermore, in terms of the method steps, chemical compounds, and parameters used herein may have been represented in the figures by conventional symbols, and the figures may show only those specific details that are pertinent to understanding the embodiments of the present disclosure so as not to obscure the figures with details that will be readily apparent to those skilled in the art having the benefit of the description herein.
DETAILED DESCRIPTION
[20] For the purpose of promoting an understanding of the principles of the disclosure, reference will now be made to the embodiment illustrated in the figures and specific language will be used to describe them. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended. Such alterations and further modifications in the illustrated system, and such further applications of the principles of the disclosure as would normally occur to those skilled in the art are to be construed as being within the scope of the present disclosure.
[21] The terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process or method that comprises a list of steps does not include only those steps but may include other steps not expressly listed or inherent to such a process or method. Similarly, one or more components, compounds, and ingredients preceded by "comprises... a" does not, without more constraints, preclude the existence of other components or compounds or ingredients or additional components. Appearances of the phrase "in an embodiment", "in another embodiment" and similar language throughout this specification may, but not necessarily do, all refer to the same embodiment.
[22] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The system, methods, and examples provided herein are only illustrative and not intended to be limiting.
[23] In the following specification and the claims, reference will be made to a number of terms, which shall be defined to have the following meanings. The singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.
[24] Embodiments of the present invention relates to a set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type alleles from samples from bovines. The invention mainly focuses on designing padlock probes and padlock probes specific primers for identification and differentiation of the at least one of A1 type and A2 type alleles in milk, blood and hair samples from bovines. The invention also focuses on development of HRCA reaction method for differentiation of A1 type and A2 type alleles.
[25] As used herein the term “hyperbranched rolling circle amplification (HRCA)” refers to a technique derived from rolling circle amplification (RCA) in which DNA polymerase replicates circularized oligonucleotide probes under isothermal conditions with either linear or geometric kinetics.
[26] In an embodiment, a set of nucleotide sequences for hyperbranched rolling circle amplification (HRCA) reaction for identification and differentiation of at least one of A1 type and A2 type alleles in samples from bovines is provided. The set of nucleotide sequences includes a set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence. The set of padlock probes includes a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe, and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe. The set of nucleotide sequences also includes a set of primers specific to the set of padlock probes selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer.
[27] In one embodiment, the sample from bovines to be analysed for presence of A1 type and A2 type alleles is the milk. In another embodiment, the sample from bovines to be analysed for detection of A1 type and A2 type alleles is blood. In yet another embodiment, the sample from bovines to be analysed for detection of A1 type and A2 type alleles is hair. In an embodiment, the sample may include a combination of the milk, blood, and hairs.
[28] The set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence is as follows:
SEQ ID No. 1 - A1 Padlock probe (PLP) – GGATGGGCCCAGGGAGCTGTGCTCACAGGTGTGTGACGCAGGAGCCGTGACGCTCGACTGCTGTGCTCACAGGTGTGTGACGCGATGTTTTGTGGGAGGCTGTTAT, and
SEQ ID No. 2 - A2 Padlock probe (PLP) – GGATGGGCCCAGGGAAGGCGCGTGCGTGCGTGCGAGAGCAGGAGCCGTGACGCTCGACTCGTGCGTGCGTGCGAGAGCGATGTTTTGTGGGAGGCTGTTAG.
[29] The set of primers specific to the set of padlock probes are as follows:
SEQ ID No. 3 - Common HRCA primer – AGTCGAGCGTCACGGCTCCT,
SEQ ID No. 4 - A1 HRCA primer – GCTGTGCTCACAGGTGTGTGACGC,
SEQ ID No. 5 - A2 HRCA primer – CGTGCGTGCGTGCGAGAGC,
[30] The specific identification sequences of the padlock probe and primers were designed according to the gene sequence of A1 and A2 bovine beta-casein gene. The gene sequences of beta-casein (CSN2) were obtained from Gen bank (accession number: M55158.1). The sequences of beta-casein, which is specific to the A1 and A2 variant were selected as the target for the two ends of the padlock probe. To ensure the efficiency of the padlock probe binding with the target DNA, the 5’ end and 3’ end sequences were designed to bind adjacently head to tail with minimum secondary structure and complete complementary to the appropriate region of A1 and A2 sequences. The primers provided by the present invention to amplify the specific padlock probe signal are also designed targeting the highly specific regions of SNP of CSN2 beta-casein gene.
[31] In another embodiment of the present invention, a hyperbranched rolling circle amplification (HRCA) reaction method for identification and differentiation of at least one of A1 type and A2 type alleles from samples from bovines is provided. The method includes application of the padlock probes and primers designed by the present invention into the HRCA reaction for detection of the at least one of A1 type and A2 type alleles in the samples from bovines.
[32] FIG. 1 is a flow diagram (100) representing steps involved in HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles in the samples from bovines, in accordance with an embodiment of the present invention.
[33] The HRCA reaction method for identification and differentiation of at least one of A1 type and A2 type alleles begins with subjecting a DNA sample extracted in the samples from bovines and a set of padlock probes to a ligation reaction to form a ligated circular padlock probe at step 102. The sample from bovines includes milk, blood, and hair or combination thereof. The set of padlock probes being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 1 with A1 Padlock probe and a nucleotide sequence as set forth in SEQ ID No. 2 with A2 Padlock probe.
[34] The set of padlock probes comprising complimentary 5’ end and 3’ end to a target sequence is as follows:
SEQ ID No. 1 - A1 Padlock probe (PLP) – GGATGGGCCCAGGGAGCTGTGCTCACAGGTGTGTGACGCAGGAGCCGTGACGCTCGACTGCTGTGCTCACAGGTGTGTGACGCGATGTTTTGTGGGAGGCTGTTAT, and
SEQ ID No. 2 - A2 Padlock probe (PLP) – GGATGGGCCCAGGGAAGGCGCGTGCGTGCGTGCGAGAGCAGGAGCCGTGACGCTCGACTCGTGCGTGCGTGCGAGAGCGATGTTTTGTGGGAGGCTGTTAG.
[35] Before ligation isolated DNA was denatured at 94 ºC for 5 minutes for breaking down the double strand DNA molecule to single strand.
[36] For ligation, the reaction mixture consisted of 1 µl padlock probe, 1 µl 10× T4 DNA ligase buffer and 3 µl template DNA. 1U/µl T4 DNA ligase was then added and adjusted to a final volume of 10 µl with sterile double distilled H2O. The tubes were incubated at 37 °C for 60 minutes, the reaction was then terminated by incubating at 85 °C for 10 minutes to obtain the ligated circular padlock probe. As used herein the term “ligation reaction” refers to joining of two nucleic acid fragments through the action of an enzyme.
[37] FIG. 2 illustrates an electrophoresis gel image under UV light representing results of ligation reaction conforming a ligated circular padlock probe, in accordance with an embodiment of the present invention.
[38] FIG. 3 illustrates an electrophoresis gel image under UV light representing standardization of optimum padlock probe concentration for ligation reaction, in accordance with an embodiment of the present invention. The optimum padlock probe concentration standardized for the ligation reaction was 2000 pm.
[39] In an embodiment, an exonuclease treatment is provided after the ligation reaction for screening out the ligated circular padlock probe at step 104. The exonuclease treatment for removing non circularized padlock probe and excess PCR product includes adding 1 µL exonuclease I at 20 U/µL to the ligated circular padlock probe. The exonuclease treatment also includes incubation at 37 °C for a duration of 30 minutes followed by inactivation of exonuclease I at 94 °C for 1 minute.
[40] In an embodiment, the hyperbranched rolling circle amplification (HRCA) reaction is carried using the ligated circular probe and a set of primers at step 106. The set of primers being selected from a group consisting a nucleotide sequence as set forth in SEQ ID No. 3 with Common HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 4 with A1 HRCA primer, a nucleotide sequence as set forth in SEQ ID No. 5 with A2 HRCA primer.
[41] The set of primers specific to the set of padlock probes is as follows:
SEQ ID No. 3 - Common HRCA primer – AGTCGAGCGTCACGGCTCCT,
SEQ ID No. 4 - A1 HRCA primer – GCTGTGCTCACAGGTGTGTGACGC,
SEQ ID No. 5 - A2 HRCA primer – CGTGCGTGCGTGCGAGAGC,
[42] The HRCA reaction mixture contained 0.4 mmol/L of dNTPs, 0.4 µmol/L each of HRCA primer, 20 mmol/L Tris-HCl (pH 8.8), 10 mmol/L KCl, 6.5 mmol/L MgSO4, 10 mmol/L (NH4)2SO4, 0.1 % Triton ×-100, 2 µL ligation product, and 8U Bst DNA polymerase, adjusted to a final volume of 25 µL with double distilled water. HRCA reaction also includes incubation at 65 ºC for 30 minutes followed by incubation at 95 ºC for 10 minutes to terminate the reaction.
[43] FIG. 4 illustrates an electrophoresis gel image under UV light representing standardization of optimum temperature for the HRCA reaction, in accordance with an embodiment of the present invention. The standardized optimum temperature for the HRCA reaction is 65 °C.
[44] FIG. 5 illustrates an electrophoresis gel image under UV light representing standardization of optimum MgSO4 concentration for the HRCA reaction; in accordance with an embodiment of the present invention.
[45] In an embodiment, at least one of A1 type and A2 type alleles in the sample is detected by analysing outcome of the HRCA reaction by agarose gel electrophoresis method at step 108. Positive signals were visualized as a ladder of bands starting at one unit circle length and extending in discrete increments of 100 bp.
[46] FIG. 6 illustrates an electrophoresis gel image under UV light representing results of the HRCA reaction for identification and differentiation of the at least one of A1 type and A2 type alleles, in accordance with an embodiment of the present invention. The results of the HRCA reaction are compared with the control ladder for identification of A1 type and A2 type alleles, as the A1 padlock probe is designed with specificity towards the A1 genomic DNA and the A2 padlock probe is designed with specificity towards the A2 genomic DNA.
EXAMPLES
[47] The present invention is explained further in the following specific examples which are only by way of illustration and are not to be construed as limiting the scope of the invention.
[48] Example 1: Isolation of DNA from milk
Milk sample was transferred to a sterile eppendorf tube and centrifuged repeatedly at 8000 rpm for 3 minutes. Further, supernatant was removed, and pellet was washed with wash buffer. Somatic cell lysis was carried out using lysis buffer with 10 % sodium dodecyl sulfate (SDS). The debris was removed by centrifugation at 8000 rpm for 3 minutes. 6M NaCl was added to the solution to precipitate the protein and centrifuge at 12,500 rpm for 10 minutes then the supernatant was collected in the sterile eppendorf tube. DNA was precipitated using ethanol followed by centrifugation at 12,500 rpm for 10 minutes and allowed to air-dry for 30 minutes. DNA was dissolved in milli-Q water and stored at -80 °C for later uses.
[49] Example 2: Isolation of DNA from blood
Non enzymatic salting out method was used for the isolation of DNA from blood. Blood was collected in tubes containing ethylenediaminetetraacetic acid (EDTA). 900 µL of TKM 1 buffer [Tris HCl (10 mM, pH 7.6), KCl (10 mM), MgCl2 (10mM), EDTA (2 mM)] and 50 µL of 1 Triton-× were added to 300 µL of heparinised blood in an autoclaved 1.5 ml Eppendorf tube. It was incubated at 37 ºC for 5 minutes to lyse the red blood cells (RBCs). Cells were centrifuged at 8000 rpm for 3 minutes and the supernatant was discarded. This step was repeated 2-3 times with decreasing amount of 1x Triton-× till RBC lysis was complete and a white pellet of white blood cells (WBCs) was obtained. To the cell pellet, 300 µL of TKM 2 buffer [Tris HCl (10 mM, pH 7.6), KCl (10 mM), MgCl2 (10mM), EDTA (2 mM), NaCl (0.4M)] and 40 µL of 10 % SDS were added, mixed thoroughly and incubated at 37 ºC for 5 minutes. At the end of incubation, 100 µL of 6M NaCl was added and vortexed to precipitate the proteins. The cells were centrifuged at 8000 rpm for a duration of 5 minutes. The supernatant was transferred into a new Eppendorf tube containing 300 µL of isopropanol. DNA was precipitated by inverting the Eppendorf tube slowly. Further, the tubes were centrifuged at 8000 rpm for 10 minutes to pellet down the DNA. Supernatant was discarded, 70 % ethanol was added and mixed slowly to remove any excess salts. Finally, the tubes were centrifuged at 8000 rpm for 5 minutes to pellet down the DNA. Supernatant was discarded and DNA was air dried. After thorough drying, 50 µL of TE buffer was added to dissolve the DNA and stored at -80 ºC for later use.
[50] Example 3: Isolation of DNA from hair
500 µL of digestion buffer (10 mM Tris-HCl, 10 mM EDTA, 50 mM NaCl, 20 % SDS, pH 7.5) was added to 1.5 mL microcentrifuge tube, along with 40 µL of 1 M dithiothreitol (DTT) (to a final concentration of ~80 mM), 240 mM of sodium acetate (pH 5.2) and 15 µL of 10 mg/mL proteinase K (to a final concentration of ~0.3 mg/mL). Hair sample was added to this solution before vortexing and incubating for 2 hours at 56 °C. After incubation, the sample tube was vortexed again, and an additional 40 µL DTT and 15 µL of proteinase K were added, followed by gentle mixing and incubation at 60 °C for 2 more hours or until hair was dissolved completely.
DNA was then extracted with an equal volume of phenol: chloroform: isoamyl alcohol solution and mixed gently by inverting the tube for few minutes. The samples were centrifuged for 10 minutes with 10,000 rpm (4 °C), followed by transferring the upper aqueous layer into a fresh, sterilized microcentrifuge tube. RNaseA (10 µL of 10 mg/mL) was added and kept for incubation at 37 °C for 30 minutes. An equal volume of chloroform: isoamyl alcohol was added, and the tube was centrifuged again at 10,000 rpm (4 °C) for 10 minutes. The upper aqueous layer was transferred into a sterilized microcentrifuge tube before double the volume of chilled isopropanol and one-tenth volume of 3 M sodium acetate were added. The sample was chilled at -20 °C for 1 hour for the DNA precipitation to occur. The sample was centrifuged at 10,000 g (4 °C) for 10 minutes. The supernatant was discarded, 250 µL 70 % ethanol was added, and the pellet was tapped gently before further centrifugation at 10,000 rpm for 10 minutes. The supernatant was discarded, and the pellet was air-dried in a laminar air flow, resuspended in 50 µL nuclease-free water or 1× TE buffer and stored at -80 ºC for later uses.
[51] The set of nucleotide sequences including the set of padlock probes and the set of primers provided by the present invention being specific and efficient for identification and differentiation of A1 type and A2 type alleles. The set of nucleotide sequences provides rapid and cost-effective detection of the A1 type and A2 type alleles in the samples from bovines. The HRCA reaction method using padlock probes and primers provided by the present invention is simple and cost effective as the method is being carried out in a single tube.
[52] While specific language has been used to describe the disclosure, any limitations arising on account of the same are not intended. As would be apparent to a person skilled in the art, various working modifications may be made to the method in order to implement the inventive concept as taught herein.
[53] The figures and the foregoing description give examples of embodiments. Those skilled in the art will appreciate that one or more of the described elements may well be combined into a single functional element. Alternatively, certain elements may be split into multiple functional elements. Elements from one embodiment may be added to another embodiment. Moreover, the actions of any flow diagram need not be implemented in the order shown; nor do all of the acts need to be necessarily performed. Also, those acts that are not dependant on other acts may be performed in parallel with the other acts. The scope of embodiments is by no means limited by these specific examples.
| # | Name | Date |
|---|---|---|
| 1 | 202141009904-STATEMENT OF UNDERTAKING (FORM 3) [09-03-2021(online)].pdf | 2021-03-09 |
| 2 | 202141009904-SEQUENCE LISTING(PDF) [09-03-2021(online)].pdf | 2021-03-09 |
| 3 | 202141009904-SEQUENCE LISTING [09-03-2021(online)].txt | 2021-03-09 |
| 4 | 202141009904-FORM FOR STARTUP [09-03-2021(online)].pdf | 2021-03-09 |
| 5 | 202141009904-FORM FOR SMALL ENTITY(FORM-28) [09-03-2021(online)].pdf | 2021-03-09 |
| 6 | 202141009904-FORM 1 [09-03-2021(online)].pdf | 2021-03-09 |
| 7 | 202141009904-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [09-03-2021(online)].pdf | 2021-03-09 |
| 8 | 202141009904-EVIDENCE FOR REGISTRATION UNDER SSI [09-03-2021(online)].pdf | 2021-03-09 |
| 9 | 202141009904-DRAWINGS [09-03-2021(online)].pdf | 2021-03-09 |
| 10 | 202141009904-DECLARATION OF INVENTORSHIP (FORM 5) [09-03-2021(online)].pdf | 2021-03-09 |
| 11 | 202141009904-COMPLETE SPECIFICATION [09-03-2021(online)].pdf | 2021-03-09 |
| 12 | 202141009904-Proof of Right [11-03-2021(online)].pdf | 2021-03-11 |
| 13 | 202141009904-FORM-26 [23-03-2021(online)].pdf | 2021-03-23 |