Abstract: The present invention provides synthetic thermostable helix-hairpin peptides inhibiting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The synthetic thermostable helix-hairpin peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-9. The synthetic peptide is a truncated peptide by 18 amino acid residues at the C-terminus of a peptide having amino acid sequence of SEQ ID NO: 1. The synthetic peptide comprises an amino acid change from the peptide having amino acid sequence of SEQ ID NO: 1 at one or more amino acid residue(s) at positions selected from the group consisting of 10, 20, 21, 22 and 35 by canonical or noncanonical amino acid residue(s). These first-in-class peptides inhibit the virus through dual mechanism, i) targeting the ACE2 binding interface on RBD, and ii) through dimerization of the spike protein.
DESC:TECHNICAL FIELD
[0001] The present disclosure relates to the field of biomedical engineering for the design and engineering of synthetic helix-hairpin peptides incorporating natural and non-natural amino acids in the peptide chain. More particularly, the invention relates to synthetic helix-hairpin peptides that competes with the human cellular receptor angiotensin-converting enzyme 2 (ACE2) in binding to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) receptor binding domain (RBD) and preventing the virus from attacking human cells, and prophylactic and therapeutic agents comprising the same.
BACKGROUND OF THE DISCLOSURE
[0002] The ACE2 plays a critical role in mediating entry of SARS-CoV-2 into target cells wherein the SARS-CoV-2 RBD binds to ACE2 receptor and has been demonstrated as the main cellular entry pathway for SARS-CoV-2.
[0003] Human angiotensin converting enzyme 2 (ACE2) and the cellular transmembrane protease serine 2 (TMPRSS2) have been identified as major actors of the virus entry into human cells. The viral spike SARS-CoV utilizes cell serine proteases TMPRSS2 for the priming of the viral protein spike. Each stage of the SARS-CoV-2 coronavirus life cycle represents a potential target for drug therapy.
[0004] The family of coronaviruses has now been the cause of multiple pandemic outbreaks of zoonotic disease. Medical regulatory authorities have been increasing global regulatory harmonization, thus enabling a robust and timely approval of vaccines against coronavirus diseases (COVID). New pathways and frameworks have allowed for rapid vaccine authorization in specific circumstances. The regulatory authorities do acknowledge the need for more data regarding safety and efficacy to permit full approval of such COVID vaccines.
[0005] The development of a vaccine against SARS-CoV-2 will contribute to the creation of herd immunity, but concomitantly there is also a growing importance for the development of drugs effective against COVID.
[0006] While vaccinations against SARS-CoV-2 have been developed, the emergence of new strains of SARS-CoV-2 continue to render the available vaccinations insufficient for protection against the evolving virus. Lack of a universal coronavirus vaccine that is protective against all families of coronaviruses and not just all strains of SARS-CoV-2 makes the need for alternative medicaments a pressing concern to protect against all current and future strains of SARS-CoV-2. The healthcare system will need to be prepared with multiple alternatives to deal with the genetic diversity and variants of the virus that emerge.
[0007] The breakthrough infections of Covid-19 are a further concern. The ongoing vaccination is playing crucial role in reducing severity of the disease and mortality. However only 13 % of the eligible population has been fully vaccinated so far, indicating that the major population is still susceptible. In addition, the recent reports highlight that the transmission of SARS-CoV-2 virus cannot be fully controlled through vaccination. The similar viral load has been observed in nasal swabs of vaccinated and unvaccinated persons post-infection up to 6 days. This highlights the urgent need for alternative medicaments to control the virus spread.
[0008] With the increasing challenges that new variants of SARS-CoV-2 bring, variants will continue to evolve that have the potential to avoid vaccine immunity while spurring vaccine efficacy concerns. In order to meet the continuing challenges brought by the global pandemics, there is a need for the healthcare system to be prepare multiple alternative medicaments to deal with the genetic diversity and variants of the evolving virus.
[0009] Additionally, people with underlying health issues may have concerns about the safety and effectiveness of COVID vaccines, particularly if they have autoimmune disorders and are on immunosuppressive medication. Such groups may prefer an alternative medicament that is safer and poses a lesser risk of side effects.
[0010] Vaccine hesitancy is yet another concern wherein there is a delay in acceptance or refusal of vaccines despite the availability of vaccination services. Reasons for such vaccine hesitancy are rather complex and often imbued in social, cultural, and historical contexts. Many groups that display such hesitancy and refusal to be vaccinated are often more accepting of alternative medicaments.
[0011] Under these circumstances, the development of alternative therapeutic strategies that could be rapidly adopted to tackle the emerging mutants is of paramount importance.
[0012] Among the alternative therapeutic strategies, peptides are an innovative treatment option. Short synthetic peptides or polypeptide complexes have practically no side effects and contraindications. The peptide drugs are effective in low concentrations and can be used in patients with multiple chronic diseases. Peptides are compounds that display high affinity and selectivity to various biological targets with low toxicity. In addition, they can be synthesized rapidly and modified easily for optimization purposes.
[0013] The short peptides, as a potential drug for prophylactic and / or therapeutic application, can be designed for each stage of the SARS-CoV-2 coronavirus life cycle.
[0014] All the peptides developed so far, have a single helical structure that either target the fusion machinery of the SARS-CoV-2 or target the receptor binding domain (RBD). Although several of these peptides are quite efficient in binding to their target in vitro, only a few of them have shown potential to neutralize the SARS-CoV-2 in vivo. While structural or biophysical evidence for a single helical structure of these peptides have been shown, none of these reports demonstrate the thermostability of these peptides, which is an important concern for their storage and use in a clinical setting.
[0015] Therefore, there is a need to develop new peptides that have one or more of the advantages of demonstrated thermostability, ability to retain their structure at elevated temperatures, have low toxicity, are highly selective, and potently target the SARS-CoV-2 and other family of coronaviruses.
SUMMARY
[0016] In light of the foregoing, one objective of the present disclosure is to remedy at least part of and / or one or more of the aforementioned drawbacks.
[0017] In certain aspects of the present disclosure, the design and engineering of stable synthetic helix-hairpin peptides is provided through optimization of the loop residues connecting the two-helices through canonical and noncanonical amino acid substitutions. Such substitutions, in the loop residues to enable targeting the protein of interest, may be so selected as to facilitate forming stable dimers of the synthetic helix-hairpin peptides. These substitutions are further chosen to modulate the solubility of the synthetic helix-hairpin peptides, optimize the binding efficiency between the synthetic helix-hairpin peptides and receptor binding domain (RBD) of SARS-CoV-2, and regulate the efficacy in inhibiting the binding of RBD to ACE2 in a competition assay.
[0018] In yet another aspect of the present disclosure, the synthetic helix-hairpin peptides designed to target proteins, such as the spike proteins of coronavirus, may not be constrained with disulfide bonds. Such amino acid residue substituted and / or modified designs that forbid one or more of the disulfide bridges in the synthetic helix-hairpin peptides facilitates the synthetic helix-hairpin peptides to oligomerize and allow relative motion of the helices for efficient binding to the RBD. The present disclosure also teaches harnessing of the various oligomeric states of the synthetic helix-hairpin peptides.
[0019] Accordingly, a general aspect of the present disclosure is directed to the design and optimization of short and stable synthetically amenable helix-hairpin peptides. These synthetic helix-hairpin peptides, referred to herein also as SARS-Inhibitory-Hairpin (SIH), inhibit the binding of SARS-CoV-2 to human ACE2 receptors by tightly binding to the receptor-binding domain of the SARS-CoV-2 spike protein leading to its dimerization and consequently neutralizing the virus.
[0020] In an aspect the present disclosure provides a synthetic peptide to prevent the development of the pathological process with COVID-19 by inhibiting the virus protein and thereby preventing virus replication. In one aspect of the present disclosure provides a synthetic peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-9.
[0021] In one aspect the synthetic helix-hairpin of the present disclosure is truncated by 18 amino acid residues at the C-terminus of a peptide having amino acid sequence of SEQ ID NO.: 1.
[0022] In one aspect of the present disclosure, the synthetic peptide comprises an amino acid change of one or more amino acid residue(s) at positions selected from the group consisting of 10, 20, 21, 22 and 35 of the peptide having amino acid sequence of SEQ ID NO: 1.
[0023] In one aspect of the present disclosure, the one or more amino acid residue(s) is selected from but not limited to canonical or noncanonical amino acid residue(s).
[0024] In one aspect of the present disclosure the canonical amino acid residue is selected from the group consisting of D-alanine, asparagine or aspartic acid.
[0025] In one aspect of the present disclosure the noncanonical amino acid residue is selected from the group consisting of 3,4 difluorophenylalanine, isobutyric acid or cyclohexylalanine.
[0026] In one aspect of the present disclosure the synthetic peptide comprises an amino acid change from the SEQ ID NO: 1 at one or more amino acid residue(s) selected from the group consisting of substitution of tyrosine at position 10 by 3,4 difluorophenylalanine, glycine at position 20 by D-alanine, histidine at position 21 by asparagine or aspartic acid, alanine at position 22 by isobutyric acid and phenylalanine at position 35 by cyclohexylalanine.
[0027] In an aspect the present disclosure provides a synthetic peptide having a double helical structure.
[0028] In a specific aspect of the present disclosure, the synthetic peptides have a molecular weight ranging from about 4642 Da to about 4670 Da.
[0029] The synthetic helix-hairpin peptides presented in this disclosure are capable of stabilizing the entire spike protein of SARS-CoV-2 by dimerizing it in a head-to-head fashion forming a sandwich complex. The binding mode of the dimeric four-helix bundle of the synthetic helix-hairpin peptides to the spike protein reveal the hydrophobic interface and the critical residues responsible for dimerization of the helix-hairpin.
[0030] In some aspects of the invention, the different synthetic helix-hairpin peptides display different oligomeric states in solution. In one aspect, the synthetic peptide of the present disclosure binds to receptor binding domain (RBD) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or variants thereof forming a dimeric complex with 2:2 binding stoichiometry.
[0031] In another aspect, the present disclosure provides a pharmaceutical composition comprising the synthetic peptide of the present disclosure and one or more pharmaceutically acceptable excipient(s).
[0032] In one more aspect, the present disclosure provides a nasal spray comprising the synthetic peptide of the present disclosure and one or more pharmaceutically acceptable excipient(s).
[0033] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.
BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
[0034] In order that the present disclosure may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying figures. The figures together with detailed description below, are incorporated in and form part of the specification, and serve to further illustrate the embodiments and explain various principles and advantages, where:
[0035] Figure 1A shows the amino acid sequence of the 56-amino acid, lead antiviral miniprotein candidate (LCB1) having amino acid sequence (SEQ ID NO: 1). Figure 1B depicts the structure of this three-helix bundle protein used as a template.
[0036] Figure 2A shows the exemplary structure of the synthetic helix-hairpin peptides in accordance with the exemplary embodiments of the present disclosure that are designed to target the receptor binding domain (RBD) of SARS-CoV-2. Figure 2B shows a listing of the amino acid sequences (SEQ ID NO: 2 - 9) that constitute the synthetic peptides. Figure 2C lists some of the non-natural amino acids used in design of the synthetic peptides wherein X is the 2-Aminoisobutyric acid, U is 3,4 difluorophenylalanine, and Z is cyclohexylalanine.
[0037] Figure 3 illustrates the circular dichroism (CD) spectra of the synthetic helix-hairpin peptides SIH-1 – SIH-8 (SEQ ID NO: 2 - 9) in accordance with the exemplary embodiments of the present disclosure at wavelengths ranging from 260 to 190 nm at 20 °C before and after melt at 95 °C.
[0038] Figure 4 illustrates the thermal stability of the synthetic helix-hairpin peptides SIH-1 – SIH-8 (SEQ ID NO: 2 - 9) in accordance with the exemplary embodiments of the present disclosure monitored at 222 nm.
[0039] Figure 5 depicts the surface plasmon resonance (SPR) competitive assay of specific binding affinities of SARS-CoV-2 RBD to the immobilized ACE2 in the presence of varying concentrations of the synthetic peptides SIH-1 – SIH-8 (SEQ ID NO: 2 - 9) in accordance with the exemplary embodiments of the present disclosure.
[0040] Figure 6 illustrates the binding affinity of the exemplary synthetic peptides of present disclosure SIH-3, SIH-5, SIH-6, SIH-7 and SIH-8 to RBD through direct binding of synthetic peptide to SARS-CoV-2-RBD as was assessed using SPR.
[0041] Figure 7 illustrates the stability of synthetic peptide-RBD complexes and shows the binding-induced thermal shift changes of RBD in the presence of inhibitors (synthetic peptides SIH-3, SIH-5, SIH-6, SIH-7 and SIH-8) under equilibrium condition by nanoscale differential scanning fluorimetry (nanoDSF),
[0042] Figure 8 illustrates the stoichiometry of interaction each of the synthetic peptides SIH-3, SIH-5, SIH-6, SIH-7 and SIH-8 with SARS-CoV-2-RBD and shows the profile of the combination of size-exclusion chromatography with multi-angle light scattering (SEC-MALS profile)
[0043] Figure 9A depicts the negative staining analysis of the exemplary synthetic peptide of the present disclosure SIH-5 in complex with SARS-CoV-2 spike protein (1:3). Figure 9B depicts cryo-EM raw micrograph. Figure 9C depicts cryo-EM model and dimeric structure of synthetic helix-hairpin peptide SIH-5.
[0044] Figure 10 depicts the prophylactic efficacy of the exemplary synthetic peptide of the present disclosure SIH-5 in the Hamster model (n=5 for each group). Figure 10A depicts overview of experimental design. Figure 10B depicts the body weight of hamsters compared with SARS-CoV-2 challenged hamsters and SIH-5 treated hamsters. Error bars indicate the standard deviation. Figure 10C depicts the viral load analysis at 4 days post infection. Figure 10D depicts the images of histopathology in lungs. Figure 10E depicts the histopathological semi-quantitative lung inflammation scoring. The score from 0 to 4 was assigned based on severity of inflammation. Statistical significance was measured by Mann-Whitney test with control group. *P<0.05, **P<0.01.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0045] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
[0046] Unless otherwise defined, all terms used in the disclosure, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included for a better understanding of the present disclosure.
[0047] As used herein, the singular forms ‘a’, ‘an’ and ‘the’ include both singular and plural referents unless the context clearly dictates otherwise.
[0048] The term ‘comprising’, ‘comprises’ or ‘comprised of’ as used herein are synonymous with ‘including’, ‘includes’, ‘containing’ or ‘contains’ and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps.
[0049] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
[0050] The term ‘about’ as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of ±10% or less, preferably ±5% or less, more preferably ±1% or less and still more preferably ±0.1% or less of and from the specified value, insofar such variations are appropriate to perform the present disclosure. It is to be understood that the value to which the modifier ‘about’ refers is itself also specifically, and preferably disclosed.
[0051] As regards the embodiments characterized in this specification, it is intended that each embodiment be read independently as well as in combination with another embodiment. For example, in case of an embodiment 1 reciting 3 alternatives A, B and C, an embodiment 2 reciting 3 alternatives D, E and F and an embodiment 3 reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.
[0052] Any discussion of documents, acts, materials, devices, articles and the like that has been included in this specification is solely for the purpose of providing a context for the disclosure. It is not to be taken as an admission that any or all of these matters form a part of the prior art base or were common general knowledge in the field relevant to the disclosure as it existed anywhere before the priority date of this application.
[0053] The term “coronavirus” refers to a group of related RNA viruses that cause respiratory tract infections ranging from mild to lethal. Coronaviruses constitute the subfamily Orthocoronavirinae, in the family Coronaviridae, order Nidovirales, and realm Riboviria.
[0054] The phrase “canonical amino acids” as used herein refers to the 20 amino acids that are encoded directly by the codons of the universal genetic code called standard amino acids, in other words canonical amnio acids.
[0055] The phrase “non-canonical amino acids” as used herein refers to a nonstandard amnio acids, which may also be non-proteinogenic that is they cannot be incorporated into proteins during translation or proteinogenic that is they can be incorporated translationally into proteins by exploiting information not encoded in the universal genetic code.
[0056] The present disclosure relates to the design and optimization of short and stable synthetically amenable helix-hairpin peptides. These synthetic helix-hairpin peptides, referred to herein also as SARS-Inhibitory-Hairpin (SIH), inhibit the binding of SARS-CoV-2 to human ACE2 receptors by tightly binding to the receptor-binding domain of the SARS-CoV-2 spike protein leading to its dimerization and consequently neutralizing the virus.
[0057] In an embodiment, the present disclosure provides a synthetic peptide to prevent the development of the pathological process with COVID-19 by inhibiting the virus protein and thereby preventing virus replication.
[0058] In certain embodiments of the present disclosure, the design and engineering of stable synthetic helix-hairpin peptides is provided through optimization of the loop residues connecting the two-helices through canonical and noncanonical amino acid substitutions. Such substitutions, in the loop residues to enable targeting the protein of interest, may be so selected as to facilitate forming stable dimers of the synthetic helix-hairpin peptides. These substitutions are further chosen to modulate the solubility of the synthetic helix-hairpin peptides, optimize the binding efficiency between the synthetic helix-hairpin peptides and receptor binding domain (RBD) of SARS-CoV-2, and regulate the efficacy in inhibiting the binding of RBD to ACE2 in a competition assay.
[0059] In certain embodiments of the present disclosure, the synthetic helix-hairpin peptides designed to target proteins, such as the spike proteins of coronavirus, may not be constrained with disulfide bonds. Such amino acid residue substituted and / or modified designs that forbid one or more of the disulfide bridges in the synthetic helix-hairpin peptides facilitates the synthetic helix-hairpin peptides to oligomerize and allow relative motion of the helices for efficient binding to the RBD. The present disclosure also teaches harnessing of the various oligomeric states of the synthetic helix-hairpin peptides.
[0060] A 56-amino acid miniprotein LCB1 (SEQ ID NO: 1) is a computationally designed protein that binds to SARS-CoV-2 RBD with high-affinity. In the present invention, LCB1 served as a starting point for design and engineering of synthetic peptides with a stable helix-hairpin structure.
[0061] In one embodiment, the present disclosure provides synthetic helix-hairpin peptide being truncated by 18 amino acid residues at the C-terminus of a peptide having amino acid sequence of SEQ ID NO: 1.
[0062] In one embodiment, the present disclosure provides synthetic helix-hairpin peptide being devoid of helix-3 from the peptide having amino acid sequence of SEQ ID NO: 1.
[0063] In one embodiment, the present disclosure provides a synthetic peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-9.
[0064] In one embodiment of the present disclosure, the synthetic peptide comprises an amino acid change of one or more amino acid residue(s) at positions selected from the group consisting of 10, 20, 21, 22 and 35 of the peptide having amino acid sequence of SEQ ID NO: 1.
[0065] In one embodiment of the present disclosure, the one or more amino acid residue(s) is selected from but not limited to canonical or noncanonical amino acid residue(s).
[0066] In one embodiment of the present disclosure the canonical amino acid residue is selected from the group consisting of D-alanine, asparagine or aspartic acid.
[0067] In one embodiment of the present disclosure the noncanonical amino acid residue is selected from the group consisting of 3,4 difluorophenylalanine, isobutyric acid or cyclohexylalanine.
[0068] In one embodiment of the present disclosure the synthetic peptide comprises an amino acid change from the SEQ ID NO: 1 at one or more amino acid residue(s) selected from the group consisting of substitution of tyrosine at position 10 by 3,4 difluorophenylalanine, glycine at position 20 by D-alanine, histidine at position 21 by asparagine or aspartic acid, alanine at position 22 by isobutyric acid and phenylalanine at position 35 by cyclohexylalanine.
[0069] The synthetic peptide in accordance with the present disclosure is thermostable.
[0070] The synthetic peptide in accordance with the present disclosure has a double helical structure.
[0071] In one embodiment, the synthetic peptides of the present disclosure have high helical folding propensity.
[0072] In one embodiment, the synthetic peptides of the present disclosure have molecular weight ranging from about 4642 Da to about 4670 Da.
[0073] In one embodiment, the synthetic helix-hairpin peptides in accordance with the present disclosure comprising amino acid sequence of 38 amino acid residues long.
[0074] The synthetic helix-hairpin peptide can be produced by the liquid-phase synthesis, the solid-phase peptide synthesis, or combination thereof.
[0075] A preferred method to produce the synthetic peptides of the present disclosure is the solid-phase peptide synthesis.
[0076] The synthetic helix-hairpin peptides presented in this disclosure are capable of stabilizing the entire spike protein of SARS-CoV-2 by dimerizing it in a head-to-head fashion forming a sandwich complex. The binding mode of the dimeric four-helix bundle of the synthetic helix-hairpin peptides to the spike protein reveal the hydrophobic interface and the critical residues responsible for dimerization of the helix-hairpin.
[0077] The synthetic peptides of the present disclosure are thermally stable.
[0078] The different synthetic helix-hairpin peptides of the present disclosure display different oligomeric states in solution.
[0079] In one embodiment, the synthetic peptide of the present disclosure binds to receptor binding domain (RBD) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or variants thereof forming a dimeric complex with 2:2 binding stoichiometry. These first-in-class peptides inhibit the virus through dual mechanism, i) targeting the ACE2 binding interface on RBD, and ii) through dimerization of the spike protein.
[0080] In another embodiment, the present disclosure provides a pharmaceutical composition comprising the synthetic peptide of the present disclosure and one or more pharmaceutically acceptable excipient(s).
[0081] The pharmaceutically acceptable excipient(s) refers to additional component(s) that is non-toxic, and inert, which does not have undesirable effects on a subject to whom the same is administered and is suitable for delivering a therapeutically active agent to the target site without affecting the therapeutic activity of the said agent.
[0082] Suitable pharmaceutically acceptable excipients for the production of solutions, for example injection solutions, or of emulsions or syrups can include, for example, water, physiological sodium chloride solution or alcohols, for example, ethanol, propanol or glycerol, sugar solutions, such as glucose solutions or mannitol solutions, or a mixture of the said solvents.
[0083] Methods of preparing various pharmaceutical compositions with a certain amount of peptide(s) of the present disclosure, optionally in combination with other active agents will be apparent in light of this disclosure, to those skilled in this art from the disclosure in various known publications and literatures relevant to the art for example Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., 19th Edition (1995).
[0084] In certain embodiments, the pharmaceutical compositions described herein are formulated in a manner such that said compositions will be delivered to a patient in a therapeutically effective amount, as part of a prophylactic or therapeutic treatment.
[0085] The pharmaceutical composition can be administered orally, for example in the form of pills, tablets, coated tablets, capsules, granules or elixirs. Administration, however, can also be carried out parenterally, for example, intravenously, intramuscularly or subcutaneously, in the form of injectable sterile solutions or suspensions; or topically including buccal and sublingual, rectal, vaginal, for example in the form of ointments or creams or transdermally, in the form of patches, films, or in other ways, for example in the form of aerosols or nasal sprays.
[0086] In one more embodiment, the present disclosure provides a nasal spray comprising the synthetic peptide of the present disclosure and one or more pharmaceutically acceptable excipient(s).
[0087] Nasal spray formulations comprising the peptide of the present disclosure may be aqueous, hydroalcoholic, or nonaqueous-based solution, suspension, or emulsion systems. Depending on the type of system, the formulation may comprise pharmaceutically acceptable excipient(s) such as those selected from but not limited to solvents and cosolvents, preservatives, suspending agents, emulsifiers, or buffering agents, antioxidants, osmolality and tonicity agents, penetration enhancers, suspending agents, and surfactants.
[0088] High target affinity and specificity achievable by synthetic peptides through chemical modification and conformational control, coupled with synthetic ease and low production cost, make them an attractive class of therapeutics. Furthermore, chemical synthesis allows for the modification of the polypeptide backbone and side chains with unnatural amino acid substitutions, which reduces the proteolytic susceptibility of the synthetic peptide and improves its pharmacokinetic properties in vivo. The present disclosure thus teaches the design and engineering of conformationally rigid and high-affinity synthetic peptides that could be used to inhibit the interaction between the spike receptor binding domain and the human angiotensin-converting enzyme 2.
[0089] In certain embodiments, the present teachings can be extended to design novel helix-hairpin motifs to target and dimerize the receptor binding domain of the pathogenic human coronaviruses. Furthermore, the helix-hairpin peptides reported here could be utilized as a scaffold, and with appropriate substitutions at the solvent exposed site, these oligomeric assemblies could be used to target protein-protein interaction interfaces that may not be efficiently targeted by a single helix-mimetic.
[0090] The synthetic helix-hairpin peptides and optimization presented in this disclosure will enable any person skilled in the art to make and use the embodiments provided in the context of a particular application and its requirements. Additionally, various modifications to the disclosed embodiments will be readily apparent to those skilled in the art.
[0091] While the foregoing describes various embodiments of the disclosure, other and further embodiments of the disclosure may be devised without departing from the basic scope thereof. The scope of the invention is determined by the claims that follow. The invention is not limited to the described embodiments, versions or examples, which are included to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art.
EXAMPLES
[0092] The present invention is further explained in the form of following examples. However, it is to be understood that the following examples are merely illustrative and are not to be taken as limitations upon the scope of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary.
Example 1
Peptide design
[0093] For the design of stable helix-hairpins, the computationally designed 56-residue lead antiviral miniprotein candidate (LCB1) shown to bind to SARS-CoV-2 receptor binding domain (RBD) with picomolar affinity was used as a starting point, it was synthesized following the method as per Baker and coworkers (Cao, L. et al. De novo design of picomolar SARS-CoV-2 miniprotein inhibitors. Science 370, 426–431 (2020)). Figure 1 shows the structure (Figure 1B) of a 56-amino acid miniprotein LCB1 (SEQ ID NO: 1) and the amino acid sequence (Figure 1A) of this three-helix bundle. LCB1 served as a starting point for further design and engineering of synthetic peptides with a stable helix-hairpin structure. As seen in Figure 1, the LCB1 has a compact three-helix bundle structure which offers it high thermostability, where the helix 1 and helix 2 present the residues that interact with the RBD.
[0094] To engineer the stable helix-hairpin motifs (Figure 2), a conformationally constrained loop was designed to enforce the proximity of the helices 1 and 2 for optimal hydrophobic packing. Based on the dihedral angles (f, y) of the residues -Leu19-Gly-His21- determined from the structure of LCB1, the loop can be categorized into the g aLb - turn (Figure 2A), which occurs with high abundance between a-helices in natural proteins.
[0095] To allow relative motion of the helices for efficient binding to the RBD, the disupfide bridges were excluded from the design. Truncation of 18-residues from the C-terminus of LCB1 (Figure 1) led to the deletion of helix 3, resulting into peptide, referred to herein as SARS-Inhibitory-Hairpin - 1 (SIH-1).
[0096] The loop residues connecting the two helices were systematically substituted enforcing a compact helix-hairpin structures of the resultant peptides SIH-2 to SIH-8 (Figure 2B). The initial substitution was the Ala22 at the N-terminus of helix 2 with the helix-promoting aminoisobutyric acid (X in Figure 2C, top), which modestly increased the thermal stability of SIH-2. SIH-2 was found to be a better competitor of ACE2 than SIH-1, however, with lower efficiency.
[0097] The loop residues connecting the two helices were systematically substituted to provide SIH-2 to SIH-8 ((Figure 2B) to enforce a compact helix-hairpin structure. The N-terminus of helix 2 at Ala22 was substituted with the helix-promoting 2-aminoisobutyric acid (Aib) (X in Figure 2C, top) to obtain SIH-2, which stabilized the C-term helix. Further, to introduce conformationally constrained loop the Gly20 in SIH-2 was substituted with D-Ala, to obtain SIH-3, which enforced a rigid left-handed a-helical conformation thereby increased helical folding propensity and stabilized helix hairpin (Tm > 95 ?C) with marked improvement in its solubility. Next, optimization of ß-position was done by substituting His21 with asparagine and aspartic acid to obtain SIH-4 and SIH-5 respectively, which improved N-term helix capping. The hairpin loop of SIH-5 (-D-Ala20-Asp-Aib22-) was kept constant for the subsequent amino acid engineering in the N-term and the C-term helices to provide SIH-7 (Tyr10 to 3,4difPhe), SIH-11 (Phe35 to Cha), and SIH-13 (Tyr10 to 3,4difPhe; Phe35 to Cha).
Example 2
Peptide synthesis
[0098] The protein (LCB1) and the peptides (SIH-1 to SIH-8) were synthesized on Rink Amide Am resin (0.8 mmolg-1) on 150 mg scale using standard Fmoc-based strategy. Coupling reactions were performed by using standard coupling reagents (2.5 equiv HOBt, 2.5 equiv DIC) and Fmoc-amino acid (2.5 equiv) in DMF. Following a two-minute preactivation, the activated amino acid was added to the resin and vortexed for 2 h. Deprotection reactions were carried out twice with 20% piperidine in DMF (5 min + 15 min). The resin was washed two times with 3 ml of DMF for 60 sec between each cycle. After the final deprotection step, the resin was washed with 3 ml of dichloromethane (DCM) followed by 3 ml of methanol. The global deprotection of protected proteins were carried out with 95% TFA, 2.5% triisopropylsilane, (TIPS) and 2.5% water for 2 h. Deprotected crude protein/peptide was precipitated in chilled ether. The white solid was pelleted by centrifugation and dissolved in 20% ACN/H2O for purification.
[0099] Purifications were performed on a Shimadzu UFLC system equipped with Prominence Diode Array (PDA) detector using a reversed-phase Phenomenex Jupiter C18 100 Å semi-prep column (250 mm x 4.6 mm I.D., 5 µm) at a flow rate of 4 mL min-1.
Example 3
Conformation and thermal stability
[0100] The solution conformation and the thermal stability of the peptides of the present invention were assessed using far UV circular dichroism spectroscopy (Figure 3). The helix-hairpin structure of SIH-1 with - Leu19-Gly-His21 - in the loop was confirmed by its comparable helicity to LCB1 and the ratio between 222 and 208 nm ellipticities, where a value >1 indicates the presence of coiled coils. CD spectra of SIH-1 and SIH-2 were obtained at lower concentration 15 µM due to low solubility of these peptides in a phosphate buffer. Far-UV CD spectra of the synthetic helix-hairpin peptides (SIH-3 to SIH-8) were recorded at 50 µM concentration in buffer such as a 20 mM sodium phosphate buffer, pH 7.4. Figure 3 illustrates the circular dichroism (CD) spectra of the synthetic helix-hairpin peptides SIH-1 – SIH-8 (SEQ ID NO: 2 - 9) at wavelengths ranging from 260 to 190 nm at 20 °C before and after melt at 95 °C.
[0101] Data were recorded at 15 µM concentration for SIH-1 and SIH-2 due to low solubility of these peptides in phosphate buffer. Temperature-dependent CD data were recorded at 50 µM concentration for SIH-3 to SIH-8 peptides in 20 mM sodium phosphate buffer, pH 7.4. Data were fit to a two-state unfolding model to obtain melting temperature (TM). The Figure 4 shows the CD signal monitored at 222 nm as a function of temperature. This illustrates the transition temperature of the secondary structure conversion. From 20 to 95 ºC, as illustrated in the Figure 4, the CD intensity decreases with a drastic decrease between 60 and 95 ºC. The melting temperatures (Tm) of the synthetic helix-hairpin peptides SIH-1 – SIH-8 was calculated and the corresponding values shown in Figure 4. The synthetic peptides of the invention showed the presence of alpha-helices and even after heating to 95 ?C, the helical signatures persist, albeit with lower ellipticity. In addition, cooling the solution to 20 ?C, after the thermal melt, the helical signature of the peptides is regained, suggesting structural reversibility. This data strongly points towards the stability of the peptides against thermal stress.
Example 4
Competition with ACE2 binding
[0102] The potency of the peptides obtained in Example 1 to bind SARS-CoV-2 RBD in the presence of ACE2 was investigated. Figure 5 depicts the surface plasmon resonance (SPR) competitive assay of specific binding affinities of SARS-CoV-2 RBD to the immobilized ACE2 in the presence of varying concentrations of the synthetic peptides SIH-1 – SIH-8 (SEQ ID NO: 2 - 9).
[0103] ACE2-hFc (ACE2 protein with a fusion hFc Tag) (sigma Aldrich) was immobilized ~800 RU at a flow rate of 30 µl/min for 100 seconds, excluding a single blank channel that acts as the reference channel. Synthetic peptide titrated-RBD complexes were assayed for competitive binding to ACE2-hFc by monitoring binding for 200 s association time and 600 s dissociation phase. The channels were preequilibrated for ~200-250 seconds prior to binding experiments.
[0104] As the synthetic helix- hairpin peptides were injected, there was concomitant increase in response units (RU) upon its binding or association to the ACE2-RBD protein. Once this reached a steady state, the dissociation followed and the kinetics were measured.
[0105] SIH-3, 4, and 5 efficiently compete out ACE2 in a dose-dependent manner, where SIH-5 completely inhibits the RBD-ACE2 binding at 250 nM, comparable to LCB1 (Figure 5). To assess the utility of SIH-5 as a scaffold for targeting SARS-CoV-2 with mutations in the receptor-binding domain, the structural and functional tolerance of SIH-5 on amino acid substitution was determined. Isosteric unnatural amino acids may be incorporated at least six different sites on SIH-5 that includes residues at the RBD binding interface, buried residues between helix 1 and helix 2, and solvent-exposed residues. All the tested substitutions retained the helix-hairpin structure and efficiently inhibited the RBD-ACE2 interaction, however, in particular three analogs SIH-7 (Tyr10 to 3,4difPhe), SIH-11 (Phe35 to Cha), and SIH-13 (Tyr10 to 3,4difPhe; Phe35 to Cha) were potent inhibitors of SARS-CoV-2 wild-type RBD.
[0106] As can be seen from Figure 5 the SPR experiments demonstrated that all these peptides were able to compete with immobilized ACE2. A reduction in ACE2-RBD binding with increasing concentration of the peptide is seen though SIH-1 (SEQ ID NO: 2) and SIH-2 (SEQ ID NO: 3) were less potent. Among these peptides, SIH-5 (SEQ ID NO: 6), SIH-6 (SEQ ID NO: 7), and SIH-8 (SEQ ID NO: 9) showed significant binding to SARS-CoV-2 RBD, no ACE2-RBD binding was detected even in the presence of 250 nM concentration of peptides. Thus, given the small size of these peptides, they possibly act through direct binding to the receptor binding motif (RBM) on the RBD to prevent the binding of SARS-CoV-2 to ACE2 receptors.
Example 5
Binding affinity with RBD
[0107] The direct binding affinity of the peptides to RBD was determined by surface plasmon resonance (SPR). Figure 6 illustrates the binding affinity of the SIH peptides to RBD through direct binding of the synthetic peptide to SARS-CoV-2-RBD as was assessed using SPR.
[0108] RBD was immobilized ~2500 RU at a flow rate of 30 µl/min for 100 seconds, excluding a single blank channel that acts as the reference channel. The binding of synthetic peptides to RBD were assayed by monitoring binding for 200 s association time and 600 s dissociation phase. The channels were preequilibrated for ~200-250 seconds prior to binding experiments. The kinetic traces were obtained and analysed on Proteon Manager.
[0109] Five SIH peptides (SIH-3, SIH-5, SIH-6, SIH-7, and SIH-8) were selected for further studies. The direct binding affinity of the peptides to RBD was determined by SPR. The binding constants were obtained by determining the on- and off- rates of the analyte peptide passed over immobilized RBD, over a range of concentrations. As can be seen from Figure 5, most of the peptides have affinity (KD) ranging from 1-3 nM, which is better than the KD of ACE2 in binding to RBD (~14 nM).
Example 6
Stability of the peptide-RBD complex
[0110] The stability of synthetic peptide-RBD complex was monitored in terms of the binding-induced thermal shift changes of RBD in the presence of inhibitors (synthetic peptides). Figure 7 illustrates the stability of synthetic peptide-RBD complex and shows the binding-induced thermal shift changes of RBD in the presence of inhibitors (synthetic peptides) under equilibrium condition by nanoscale differential scanning fluorimetry (nanoDSF).
[0111] The RBD was incubated with different synthetic peptides (1:1 stoichiometry) for at least 10 minutes at room temperature prior to analysis.
[0112] The binding-induced thermal shift changes of RBD in the presence of inhibitors (1:1 mixture) under equilibrium condition using nanoscale differential scanning fluorimetry (nanoDSF), can be seen from Figure 7, where the change in thermal stability (TM) indicates the tight binding and stability of RBD-inhibitor complex. Multiple thermal unfolding events for the RBD-SIH complexes were seen. The comparable TM of RBD and TM1 of the RBD-SIH complexes indicate that the overall structure of RBD was unaltered on binding to the peptides. The TM2 indicates the stability of the RBD-SIH complex. Interestingly, a single thermal unfolding event was observed for SIH-5 and SIH-8, and the melting temperature of RBD increased by more than 10 ?C, indicating the tight binding of SIH-5 and SIH-8 to RBD. It is worth noting that the thermal stability of the RBD-SIH-5 complex is higher than the stability of the complex formed by RBD and a high-affinity synthetic nanobody Sb23 (positive control). Interestingly, the TM2 of RBD-SIH-7 complex also indicates high stability of the RBD-SIH complexes.
Example 7
SEC-MALS with RBD
[0113] The stability and structural integrity of the RBD in complex with the SIH peptides were assesses prior to the structural studies. Figure 8 illustrates the stoichiometry of synthetic peptide and SARS-CoV-2-RBD interaction and shows the profile of the combination of size-exclusion chromatography with multi-angle light scattering (SEC-MALS profile).
[0114] The RBD was incubated with different synthetic peptides (1:1 stoichiometry) for at least 1 hour at 4 °C prior to analysis. A Superdex-200 10/300GL analytical gel-filtration column (GE healthcare) equilibrated in 1× PBS (pH 7.4) buffer was used. SEC profiles were obtained using a Biorad NGC chromatography system.
[0115] Size-exclusion chromatography coupled with multiangle light scattering (SEC-MALS) were done. As can be seen from Figure 8, the RBD predominantly eluted as a peak and the molecular mass was calculated to be ~33 kDa as can be seen from the graph depicting SIH-7-RBD complex showing a smaller second peak of RBD. The incubation of SIH-3 with RBD resulted in the elution of two peaks, in which the larger fraction with a molecular weight of 40 kDa correspond to the SIH-3-RBD complex. Surprisingly, the early eluting smaller fraction had a molecular weight of 75 kDa, suggesting the formation of a dimeric SIH-3-RBD complex. The incubation of RBD with SIH-5, SIH-6, and SIH-8 resulted in the exclusive formation of the peptide-RBD dimeric complex (binding stoichiometry 2:2). All the stable inhibitor peptides that are potent competitors of ACE2, effectively dimerized RBD in solution.
Example 8
Negative stain and Cryo-EM structure
[0116] The detailed structural studies were performed to obtain insights into the structure alteration of RBD on binding to the SIH peptides. Figure 9 shows the structure alteration of RBD on binding to the SIH peptides. SIH-5 was selected based on competitive binding data and it forms a stable structure with RBD in a 2:2 binding stoichiometry.
[0117] SARS-CoV-2 spike protein and SIH-5 were mixed in a 1:3 molar ratio and incubated on ice for 15 minutes prior analysis.
[0118] Room temperature negative staining transmission electron microscopy (TEM) was used to visualize the conformational rigidity of spike protein in the presence of the SIH-5 peptide.
[0119] For visualization by transmission electron microscope, sample was prepared by conventional negative staining method. Briefly, carbon-coated Cu grids were glow discharged for 30 s, and 3.5µl of sample (0.1 mg/ml) was incubated on the grid for 1 min. The extra sample and buffer solution was blotted out, and negative staining was performed using 1% Uranyl Acetate solution for 30 s. Freshly prepared grids were air-dried for 30 min. The negatively stained sample was visualized at room temperature using a Tecnai T12 electron microscope equipped with a LaB6filament operated at 120 kV using a low electron dose. Images were recorded using a side-mounted Olympus VELITA (2KX2K) CCD camera using defocus ranging from-1.3 to-1.5 and a calibrated pixel size 2.54 Å/pixel at specimen level.
[0120] The evaluation of micrographs was done with EMAN 2.1. Around 2500 particles projections were picked manually and extracted using e2boxer.py in EMAN2.1 software. 2D particle projections were binned by 2 using e2proc2d.py. Reference-free 2D classification of different projections of particle was performed using simple_prime2D of SIMPLE 2.1 software.
[0121] Room temperature negative staining transmission electron microscopy (TEM) was used to visualize the conformational rigidity of spike protein in the presence of the SIH-5 peptide. TEM images and 2D class averages indicate no aggregation of spike protein in the presence of peptide. However, this is the direct visualization of the dimerization of spike-protein in presence of SIH peptide, and the dimerization interface is S1 region (RBD region). The negatively stained 2D reference-free class average is the direct evidence that SIH-5 tightly binds with RBD and SIH-5 is capable of forming dimeric spike-protein (Figure 9A). Furthermore, 2D class average at cryogenic condition also indicates that trimeric spike-protein adopts a stable dimer assemble in the presence of SIH-5 (Figure 9B). To gain atomic insights into the binding mode of SIH peptides to RBD and the unusual dimerization, electron cryomicroscopy (cryo-EM) was performed to determine the atomic and near-atomic resolution structure of the SIH-5-spike complex. Thus, the cryo-EM structures of SIH-5 bound to the SARS-CoV-2 protein ectodomain trimer at a global 6.5 Å resolution at 0.143 FSC could be resolved. These structural studies strongly supported negative staining TEM observation that the SIH-5-spike complex forms a dimer of spike trimer protein. More surprisingly, all the RBDs of spike-protein are in a 3-up open conformation in the presence of peptide. Additionally, three RBDs of two spike trimers firmly binding with dimeric SIH-5 peptide, where the dimeric peptide is parallelly oriented (Figure 9C). This structural study successfully elucidates the interacting amino acid residues between RBD and peptide.
Example 9
Helix-hairpin peptides potent inhibitor of SARS-CoV-2 entry
[0122] Surrogate viruses have been used to evaluate the ability of the helix-hairpins to block the interaction of SARS-CoV-2 spike with the cellular receptor ACE-2 and thereby inhibit the viral entry. The spike protein is in the pre-fusion state on the surface of free virions and undergo molecular breathing. This dynamic state of spike exposes the RBDs over time to enable interaction with the cellular receptor. To assess the kinetics of pseudovirus neutralization, the viruses were incubated with the most potent peptides for different time points to estimate the inhibition of viral entry. The entry inhibition by SIH-5 and LCB1 where the compounds are not incubated with the virus (0 min) or incubated for 10 min prior to the infection, correlated well with their respective binding affinities to RBD. At these time points, LCB1 was ~ 60 to 75 folds more potent than SIH-5 in neutralizing the virus. However, SIH-5 is equipotent to LCB1 in neutralizing the virus when incubated for 30 min, and at 2 h, LCB1 is ~ ten (10) fold more potent than SIH-5. The significant enhancement (> 450 folds) in the neutralization potency of SIH-5 at 30 min against 0 min, as opposed to LCB1 (> 10 folds) is presumably indicative of the large structural re-organization necessary for the dimerization of the spike proteins on the surface of viruses in the presence of SIH-5. Since LCB1 neutralizes the virus through binding to the RBD without inducing spike dimerization, it shows rapid neutralization kinetics than SIH-5.
[0123] An identical trend in neutralizing the virus is also observed for SIH-11.
[0124] In the standard pseudovirus neutralization assay format, SIH-5 and SIH-11 were found to be very potent with IC50 of 326 pM and 337 pM, respectively, approaching the potency of LCB-1 (86 pM). SIH-3 and SIH-13 were less potent compared to the other peptides.
[0125] Despite the high affinity of SIH-13 towards RBD leading to the formation of a dimeric assembly, the poor performance of SIH-13 (IC50 - 5.96 nM) in inhibiting the viral entry may be associated with the formation of higher oligomeric species as observed in AUC. This result directly points towards the necessity in controlling the oligomerization state of helix-hairpin peptides to achieve potent entry inhibitors.
[0126] With the potency of SIH-5 and SIH-11 established in neutralizing the virus, evaluation of the cytotoxicity of these peptides is performed on Vero-E6 cells (monkey kidney) by using MTT assay. At the highest concentration of the peptides tested (20 mM), both SIH-5 and SIH-11 showed >75% cell-viability at 48 h. A selectivity index (calculated by dividing the 50% cytotoxic concentration with IC50) of >50,000 was observed for both the peptides, suggesting their potential as antivirals.
Example 10
Prevention of SARS-CoV-2 infection by SIH-5
[0127] In view of the high selectivity index of SIH-5 Therapeutic potential of SIH-5 peptide in preventing SARS-CoV-2 infection in vivo was evaluated.
[0128] The well-established hamster model was used on a single-dose prophylactic experiment.
Details of Animal experiments:
[0129] Ethics - All animal experimental works were performed in Virus BSL-3 laboratory at Centre for Infectious Disease Research, Indian Institute of Science, Bangalore, India, following CPCSEA (The Committee for the Purpose of Control and Supervision of Experiments on Animals) guidelines. Required number of Syrian golden hamsters (Mesorectums auratus) of both sex (80-100 gm of weight) was procured from CPCSEA registered, Biogen Laboratory Animal Facility (Bangalore, India). Hamsters were housed in individually ventilated cages (IVC), maintained at 23±1 °C and 50±5% temperature and relative humidity, respectively.
[0130] Prophylactic treatment of Peptide - After acclimatization of seven days in IVC cages at virus BSL-3 laboratory, the hamsters were randomly grouped into 1. PBS treated unchallenged group; 2. SIH-5 was administered with virus challenge group and 3. Virus Challenge control group. After taking the basal weight of all groups, hamsters were anaesthetized with xylazine (10mg/kg/b. wt.) and ketamine ((150g/kg/b.wt.) cocktail intraperitoneally and were administered intranasally with SIH-5 at 2.5 mg/kg. body weight in 100 ml of PBS in both the nostrils of SIH-5 group and 100 ml PBS intranasally in PBS treated unchallenged and virus challenged groups, respectively.
[0131] SARS-Cov-2 challenge - After 8 hour of post administration of peptide, the Hamsters were challenged with 106 PFU of SARS-Cov-2 US strain (USA-WA1/2020 obtained from BEI resources) intranasally in 100ul of DMEM, by sedating/anaesthetizing the hamsters with xylazine (10mg/kg/b. wt.) and ketamine (150g/kg/b. wt.) cocktail intraperitoneally. The health of hamsters, body temperatures, body weights, and clinical signs were monitored daily by expert veterinarian. Clinical sign scoring systems was developed following the previous studies with some modifications. In the present experiment considering fourteen clinical signs, the average clinical scores are measured on the points basis as follows, lethargy (1 point), rough coat (1 point), Sneezing-(1 point), mucus discharge from nose or eyes (1 point), Half close eyes/ watery eyes (1 point), huddling in the corner (1 point), ear laid back (1 point) hunched back (1 point), head tilt ( 1 point) , moderate dyspnoea (2 points), and body weight loss 2-5% (1 point ), 5-10% (2-point ) and 10-20% (3 point), Shaking or shivering (1 point).
[0132] On the fourth day of post challenge, all the hamsters were humanely euthanized by overdose of xylazine through intraperitoneal injection. The left lobe of lung was harvested and fixed in 4% paraformaldehyde (PFA) for histopathological examination of lungs. The right lobes were freeze in -80ºC for determining the virus copy number by qRT-PCR.
[0133] Histopathological Examination - After necropsy, left lobe of lung of each hamster was fixed in 4% of paraformaldehyde and next day were processed, embedded in paraffin, and cut into 4um section by microtome for haematoxylin and eosin staining. The lung sections were microscopically examined and evaluated for different pathological scores by veterinary immunologist. Four different histopathological scores were evaluated as follows 1. Percent of infected part of lung tissues considering the consolidation of lung; 2. Lung inflammation scores, considering the severity of alveolar and bronchial inflammation.3. Immune cell influx score, considering the infiltration of lung tissue with the numbers of neutrophils, macrophages, and lymphocytes; 4. edema score, considering the alveolar and perivascular edema. The Scores and parameters were graded as absent (0), minimal (1), mild (2), moderate (3), or severe (4) (Nikolaus Osterrieder et al. 2020)
RNA Extractions and q-RT-PCR to quantitate sub genomic virus copy in lungs:
[0134] The freeze thawed right lower lobe of each hamster was homogenized in 1ml of RNAiso Plus Reagent (Takara) and total RNA was isolated as per manufacturer’s protocol. The quantity and quality (260/280 ratios) of RNA extracted was measured by Nanodrop. The extracted RNA was further diluted to 27 ng/ul in nuclease free water. The viral sub genomic copy number was quantified by using 100ng of RNA/well for 10ul of reaction mixture using AgPath-ID™ One-Step RT-PCR kit (AM1005, Applied Biosystems) The following primers and probes were used 2019-nCoV_N1-Fwd- 5’GACCCCAAAATCAGCGAAAT3’ (SEQ ID NO:10); 2019-nCoV_N1-Rev- 5’TCTGGTTACTGCCAGTTGAATCTG3’ (SEQ ID NO:11); 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO:12) (sigma Aldrich) for targeting SARS CoV-2 N-1 gene. The sub genomic virus copy number per 100ng of RNA was estimated by generating a standard curve from serial dilution of SARS-CoV-2 genomic RNA standard.
In-vivo efficacy of the synthetic peptide (SIH-5) in Hamster model:
[0135] Figure 10 depicts the prophylactic efficacy of the synthetic peptide (SIH-5) in the hamster model (n=5 for each group).
[0136] An intranasal dose of 2.5 mg/kg of SIH-5 was administrated to the hamsters 8 hours prior to the viral challenge with 5x106 PFU/ml of SARS-CoV-2 US strain (USA-WA1/2020) (Figure 10A). SIH-5 was efficient in preventing the weight loss in hamsters from the 2nd day post infection (dpi) and it was accompanied by reduced viral load in the lungs of the SIH-5 treated animals at the end of the study. Clinical signs of disease progression in the three groups (five animals in each group) were studied. Histopathology (Figure 10D) of the lung tissues after 4 dpi showed that the virus challenged hamsters had a large percentage area of lungs affected than the prophylactic and the unchallenged group. The virus challenged group showed moderate to severe pulmonary inflammation, bronchitis, and bronchial and alveolar necrosis. This was accompanied by infiltration of lung tissues by immune cells (neutrophils, macrophages, and lymphocytes). Although these were observed in the prophylactic group, however there was a significant reduction in both the severity and incidence on treatment with a single dose of SIH-5.
[0137] The result of the mean clinical scores for the hamsters (n=5 for each group) are presented in Table 1.
Table 1: Mean clinical scores for the hamsters (n=5 for each group)
[0138] The scoring system for evaluating clinical symptoms is: lethargy (1 point), rough coat (1 point), sneezing (1 point), mucus discharge (1 point), huddling in the corner (1 point), ears laid back (1 point), half closed eyes/watery eyes (1 point), head tilt (1 point), moderate dyspnoea (1 point), hunched back (1 point), weight loss 3-5% (1 point), weight loss 6-10% (2 points), weight loss 11-20% (3 points), and shaking or shivering (1 point).
[0139] Overall, our results demonstrate that the small helix-hairpin peptide can lower the infection in the animal model, as measure by reduced viral load and no weight loss in the peptide treated hamsters.
[0140] In Summary, the designed and engineered short and stable synthetic helix-hairpin peptides inhibits the binding of SARS-CoV-2 to human ACE2 receptors by tightly binding to the receptor-binding domain of the SARS-CoV-2 spike protein leading to its dimerization and consequently neutralizing the virus. Single intranasal administration of the peptide in hamsters effectively reduce the SARS-CoV-2 infection in lungs and significantly reduce the clinical outcomes of infection.
[0141] The foregoing description of the specific embodiments reveal the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments in this disclosure have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the scope of the embodiments as described herein and should not be construed so as to limit the scope of the invention or the appended claims in any way.
,CLAIMS:1. A synthetic thermostable helix-hairpin peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-9.
2. The synthetic peptide as claimed in claim 1, wherein the peptide is engineered to be devoid of disulfide bridges.
3. The synthetic peptide as claimed in claim 1, wherein the synthetic peptide comprises an amino acid change of one or more amino acid residue(s) at positions selected from the group consisting of 10, 20, 21, 22 and 35 of a peptide having amino acid sequence of SEQ ID NO: 1.
4. The synthetic peptide as claimed in claim 3, wherein the one or more amino acid residue(s) is selected from canonical and noncanonical amino acid residue(s).
5. The synthetic peptide as claimed in claim 4, wherein the canonical amino acid residue is selected from the group consisting of D-alanine, asparagine or aspartic acid; and the noncanonical amino acid residue is selected from the group consisting of 3,4 difluorophenylalanine, isobutyric acid or cyclohexylalanine.
6. The synthetic peptide as claimed in claim 5, wherein the one or more amino acid residue(s) is selected from the group consisting of substitution of tyrosine at position 10 by 3,4 difluorophenylalanine, glycine at position 20 by D-alanine, histidine at position 21 by asparagine or aspartic acid, alanine at position 22 by isobutyric acid and phenylalanine at position 35 by cyclohexylalanine.
7. The synthetic peptide as claimed in any of claims 1-6, wherein the synthetic peptide has a double helical structure.
8. The synthetic peptide as claimed in any of claims 1-7, wherein the synthetic peptide has a high helical folding propensity.
9. The synthetic peptide as claimed in any of the claims 1-8, wherein the synthetic peptide has a molecular weight ranging from 4642 Da to 4670 Da.
10. The synthetic peptide as claimed in any of the claims 1-9, wherein the synthetic peptide binds to receptor binding domain (RBD) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or variants thereof forming a dimeric complex with 2:2 binding stoichiometry.
11. A pharmaceutical composition comprising the synthetic peptide as claimed in any of the claims 1-10 and pharmaceutically acceptable excipient(s).
12. A nasal spray comprising the synthetic peptide as claimed in any of the claims 1-10 and pharmaceutically acceptable excipient(s).
| # | Name | Date |
|---|---|---|
| 1 | 202141040960-STATEMENT OF UNDERTAKING (FORM 3) [09-09-2021(online)].pdf | 2021-09-09 |
| 2 | 202141040960-PROVISIONAL SPECIFICATION [09-09-2021(online)].pdf | 2021-09-09 |
| 3 | 202141040960-POWER OF AUTHORITY [09-09-2021(online)].pdf | 2021-09-09 |
| 4 | 202141040960-FORM 1 [09-09-2021(online)].pdf | 2021-09-09 |
| 5 | 202141040960-DRAWINGS [09-09-2021(online)].pdf | 2021-09-09 |
| 6 | 202141040960-DECLARATION OF INVENTORSHIP (FORM 5) [09-09-2021(online)].pdf | 2021-09-09 |
| 7 | 202141040960-PostDating-(09-09-2022)-(E-6-234-2022-CHE).pdf | 2022-09-09 |
| 8 | 202141040960-OTHERS [09-09-2022(online)].pdf | 2022-09-09 |
| 9 | 202141040960-EDUCATIONAL INSTITUTION(S) [09-09-2022(online)].pdf | 2022-09-09 |
| 10 | 202141040960-APPLICATIONFORPOSTDATING [09-09-2022(online)].pdf | 2022-09-09 |
| 12 | 202141040960-ENDORSEMENT BY INVENTORS [23-09-2022(online)].pdf | 2022-09-23 |
| 13 | 202141040960-DRAWING [23-09-2022(online)].pdf | 2022-09-23 |
| 14 | 202141040960-CORRESPONDENCE-OTHERS [23-09-2022(online)].pdf | 2022-09-23 |
| 15 | 202141040960-COMPLETE SPECIFICATION [23-09-2022(online)].pdf | 2022-09-23 |
| 16 | 202141040960-FORM-9 [26-09-2022(online)].pdf | 2022-09-26 |
| 17 | 202141040960-FORM 18A [27-09-2022(online)].pdf | 2022-09-27 |
| 18 | 202141040960-EVIDENCE OF ELIGIBILTY RULE 24C1f [27-09-2022(online)].pdf | 2022-09-27 |
| 19 | 202141040960-FER.pdf | 2022-10-31 |
| 20 | 202141040960-FER_SER_REPLY [24-04-2023(online)].pdf | 2023-04-24 |
| 21 | 202141040960-CORRESPONDENCE [24-04-2023(online)].pdf | 2023-04-24 |
| 22 | 202141040960-CLAIMS [24-04-2023(online)].pdf | 2023-04-24 |
| 23 | 202141040960-US(14)-HearingNotice-(HearingDate-13-11-2023).pdf | 2023-10-13 |
| 24 | 202141040960-FORM-26 [09-11-2023(online)].pdf | 2023-11-09 |
| 25 | 202141040960-Correspondence to notify the Controller [09-11-2023(online)].pdf | 2023-11-09 |
| 26 | 202141040960-Written submissions and relevant documents [28-11-2023(online)].pdf | 2023-11-28 |
| 27 | 202141040960-PatentCertificate28-11-2023.pdf | 2023-11-28 |
| 28 | 202141040960-IntimationOfGrant28-11-2023.pdf | 2023-11-28 |
| 29 | 202141040960-Annexure [28-11-2023(online)].pdf | 2023-11-28 |
| 1 | SearchHistory(71)E_28-10-2022.pdf |