TRANSGENIC NON-HUMAN ANIMAL AND USES THEREOF FIELD OF THE INVENTION The present Invention relates generally to transgene constructs, transgenic non-human animals comprising transgene constructs, methods of making and methods of using the transgenic non-human animals comprising transgene constructs. An embodiment of the invention relates to methods of assaying for GPCR ligands non-invasively in whole animals, tissue slices, or in native cells using a transgenic model containing a bioluminescent transgene reporter system that is responsive to pathway modulation following ligand binding to GPCR receptors. BACKGROUND OF THE INVENTION In drug development, attrition rates are high with only one in five compounds making it through development to Food and Drug Administration approval (FDA) (DiMasi, JA, et al, J Health Econ 22,151-185, 2003). Moreover, despite dramatically increased investment, the rate of introduction of novel drugs has remained relatively constant over the past 30 years, with only two to three advances in new drug classes per year eventually making it to market (Lindsay MA, Nature Rev Drug Discovery, 2, 831-838, 2003). Molecular and functional imaging applied to the initial stages of drug development can provide evidence of biological activity and confinn the putative drug having an effect on its intended target. Thus, there is considerable expectation that investment in molecular imaging technology will enhance drug development (Rudin M, Progress in Drug Res vol 62). The advantage of molecular imaging techniques over more conventional readouts is that they can be performed in the intact organism with sufficient spatial and temporal resolution for studying biological processes in vivo. Furthermore, it allows a repetitive, non-invasive, uniform and relatively automated study of the same biological model at different time points, thus increasing the statistical power of longitudinal studies plus reducing tlie number of animals required and thereby reducing cost of drug development. Molecular Imaging Molecular imaging refers to the convergence of approaches from various disciplines (cell and molecular biology, chemistry, medicine, phannacoiogy, physics, bioinformatics and engineering) to exploit and integrate imaging techniques in the evaluation of specific molecular processes at the cellular and sub-cellular levels in living organism. (Massoud T.F., Genes Dev. 17:545-580, 2003) The advent of genetic engineering has brought about major changes to applied science, including for example the drug discovery pipeline. In the same way, the development and exploitation of animal imaging procedures is providing new means for pre-clinical studies (Maggie A. and Ciana P., Nat.Rev.Drug Discov. 4, 249-255, 2005). Animal models traditionally have been cumbersome because of the difficulty in quantifying physiological events in real-time. Over the years new imaging methods have been developed to overcome this difficulty, such as magnetic resonance imaging (MRI) and positron emission tomography (PET). More recently bioluminescence imaging based on in vivo expression of luciferase, the light-emitting enzyme of the firefly, has been used for non-invasive detection. Molecular Imaging: Bioluminescence In vivo bioluminescent imaging (BLI) is a sensitive tool that is based on detection of light emission from cells or tissues. The utility of reporter gene technology makes it possible to analyze specific cellular and biological processes in a living animal through in vivo imaging methods. Bioluminescence, the enzymatic generation of visible light by a living organism, is a naturally occurring phenomenon in many non-mammalian species (Contag, C.H., etal, Mol. Microbiol. 18:593-603,1995). Luciferases are enzymes that catalyze the oxidation of a substrate to release photons of light (Greer L.F., III, Luminescence 17:43-74, 2002). Bioluminescence from the North American firefly is the most widely studied. The firefly luciferase gene (luc) expression produces the enzyme luciferase which converts the substrate D-luciferin to non-reactive oxyluciferin, resulting in green light emission at 562 nm. Because mammalian tissues do not naturally emit bioluminescence, in vivo BLI has considerable appeal because images can be generated with very little background signal. BLI requires genetic engineering of cells or tissues with an expression cassette consisting of the bioluminescent reporter gene under the control of a selected gene promoter constitutively driving the light reporter (Figure 3). In order to induce light production, the substrates such as luciferin are administered by intracerebroventricular (icv), intravenous (iv), intraperitoneal (ip) or subcutaneous (sq) injection. The light emitted by luciferase is able to penetrate tissue depths of several millimeters to centimeters; however photon intensity decreases 10 fold for each centimeter of tissue depth (Contag, C.H., et al, Mol. Microbiol. 18:593-603,1995). Sensitive light-detecting instruments must be used to detect bioluminescence in vivo. The detectors measure the number of photons emitted per unit area. Low levels of light at wavelengths between 400 and 1000 nm can be detected with charge coupled device cameras that convert the light photons that strike silicon wafers into electrons (Spibey CP et al electrophoresis 22:829-836, 2001). The software is able to convert electron signals into a two-dimensional image. The software is also able to quantify the intensity of the emitted light (number of emitted photons striking the detectors) and convert these numerical values into a pseudocolor graphic or grayscale image (Figure 2A and 2B). The actual data is measured in photons, but the pseudocolor graphic enables rapid visual interpretation. Quantitative measurements within a region of interest may be necessary for more subtle differences. The use of cooled charge coupled device (CCD) cameras reduces the thermal noise and a light-tight box allows luciferase-produced light to be optimally visualized and quantified (Contag C.H. and Bachmann, M.H., Annu. Rev. Biomed. Eng. 4:235-260, 2002). It is useful to have the luciferase Image superimposed on another type of image such as an autograph or radiograph for anatomical location of the emission signal (Figure 2B). The software superimposes images for visualization and interpretation. By combining animal engineering with molecular imaging techniques, it has become possible to conduct dynamic studies on specific molecular processes in living animals. This approach could potentially impact on pre-clinical protocols thus widely changing all aspects of medicine (Maggie A. Trends Pharmacolo. Sci 25, 337-342, 2004) G-protein coupled receptors (GPCRs) - GPCRs as drug targets GPCRs constitute a large super family of cell surface receptors that are classified into more than 100 subfamilies on the basis of their shared topological structure; GPCRs are also referred to as seven transmembrane (7TM) receptors. GPCRs are the most frequently addressed drug targets in the pharmaceutical industry. Approximately 30% of all marketed prescription drugs target GPCRs, which makes this protein family pharmaceutically the most successful target class (Jacoby, E; Chem. Med. Chem., 1:761-782.2006). The interaction between GPCRs and their extracellular ligands has proven to be an attractive point of interference for therapeutic agents. For this reason, the phamiaceutical industry has developed biochemical drug discovery assays to investigate these ligand-GPCR interactions. Interaction of an activated GPCR with a heterotrimeric G-protein catalyzes the exchange of guanosine diphosphate (GDP) by guanosine triphosphate (GTP) enabling the interaction with several downstream effectors (Cabrera-Vera T.M., Endocr. Rev. 24:765-781, 2003). Signaling downstream is dependent on the G-alpha isofomi that is preferred by the GPCR of interest. Proteins of the G-alphaq/n family stimulate phospholipase C (PLC), while representatives of the G-alphai/o and G-alphas families mostly modulate adenylate cyclase (AC) activity. If the GPCR of interest signals via PLC, then the most broadly applied reporter based technique to measure GPCR activation is a calcium (Ca*^) release assay, either measured in a fluorescent fomiat using Ca-sensitive fluorophores (Sullivan E, Methods Mol. Biol. 114:125-133,1999) or in a luminescent format using aequorin and a chemiluminescent substrate (Dupriez V.J., Receptors Channels 8: 319-330, 2002). If the GPCR of interest signals via AC, then cytosolic cyclic adenosine monophosphate (cAMP) content may be determined using various detection technologies (Gabriel D. Assay Drug Dev.Technol. 1:291-303, 2003) GPCR reporter based assays have been extensively used in current dmg discovery programs. Typically, GPCR reporters have been introduced into cell based systems to support in vitro high-throughput screening (HTS) of large pharmaceutical libraries to identify ligands or compounds that activate or module the specific GPCR. Secondary and follow-up cell based assays confirm and refine any "hits" indentified in HTS against a specific GPCR; but again, these assays rely on recombinant DMA methods to introduce a cloned GPCR into a transfonned cell type. While transformed cell types have excellent proliferative capacity to support large screening programs, they often display aben'ant genetic and functional characteristics and consequently significant attrition of putative "hits" from HTS is encountered using this paradigm. For several years, bioluminescence-based reporter gene assays have been employed to measure functional activity of GPCRs (Hill, S.J. Curr.Opin.Phamriacol.l: 526-532, 2001). This assay format is very sensitive owing to the low signal background of the bioluminescent readout and the signal amplifications steps between GPCR activation and the cumulative reporter gene expression. A cAMP response element (CRE) in the promoter of the reporter gene enables the specific monitoring of G protein dependent signaling. When a ligand binds to the GPCR it causes a confomriational change in the GPCR which allows it to activate an associated G-protein. The enzyme adenylate cyclase is a cellular protein that can be regulated by G-proteins. Adenylate cyclase activity is either activated or inhibited when it binds to a subunit of the activated G protein. Signal transduction depends on the type of G protein. Adenylate cyclase acts to either increase or decrease cAMP production in the cell. The cAMP produced is a second messenger in cellular metabolism and is an allosteric activator to protein kinase A (PKA). When there is no cAMP, the PKA complex is inactive. When cAMP binds to the regulatory subunits of PKA, their conformation is altered, causing tiie dissociation of the regulatory subunits, which activates protein kinase A and allows further biological effects. PKA then phosphorylates and activates the transcription factor CREB. CREB binds to certain DNA sequences called cAMP response elements (CRE) and thereby increases or decreases transcription, and thus the expression, of certain genes, such as the luciferase reporter gene. The CreLuc transgene is designed to assay activation of all three major GPCRs either directly through the cAMP intracellular signaling pathway or indirectly through signaling via PLC. Because any one cell type contains many different types of GPCRs on their cell surface, (thus any cell would have GPCRs signaling via G-alphaq/ii,G-alphai/o and G-alphas occurring simultaneously within a cell) conventional wisdom would suggest that it would be improbable that a transgene such as CreLuc would be specific enough to discriminate any one specific GPCR ligand. However, we demonstrate here the CreLuc transgene is able to discriminate GPCR ligands. We predict that the bioluminescent signal for the luciferase reporter in cells, tissues slices, or the whole animal will be increased with forskolin and be modulated by ligands for Gs, Gq or Gi receptors. Table 1 shows the anticipated effect that GPCR activation/inhibition will have on the CreLuc reporter system upon binding to a GPCR ligand. Further, we show data that our novel CreLuc reporter system can discriminate different classes of GPCR ligands and that such a reporter system is applicable for identifying novel GPCR ligands when used in cells, tissue slices and the whole animal. Table 1. Predicted change in bioluminescent signal from the CreLuc reporter upon ligand binding to specific GPCRs Receptor Type Agonist Antagonist; Inverse Agonist Gs; Gq Increase Decrease Gi Decrease Increase A GPCR Bioimaging Reporter Transgenic Model Significant attrition of potential drug candidates in the current drug discovery paradigm is encountered in the please transition from cell-based reporter assays to in vivo models. Numerous in vivo models are available that recapitulate either all or part of a particular human disease. Demonstrating lead compound activity in these models is a significant milestone for progression of new chemical GPCR drugs. Animal disease models typically require a large number of animals and time to allow for the development of their phenotype and an accurate assay of the candidate compound's impact on altering the disease outcome. Following in vitro testing, the next level of testing a drug candidate in a complex system is using in vivo testing or in vivo models of disease states which are mechanistic based. Failures to alter the induced disease outcomes are poorly understood but yet result in the large attrition rates of candidate compounds in the drug development pipeline. A transgenic model containing a GPCR ligand binding and activation reporter assay would be a significant improvement in the current drug discovery paradigm for GPCRs. For instance, an embodiment of this invention describes a transgene containing the cAMP reporter assay based on a luciferase reporter (CreLuc) that is combined with molecular imaging in whole animals, tissues, or cells which would significantly accelerate GPCR ligand drug discovery (Bhaumik, S. and Gambhir, S.S., Proc. Natl. Acad. Sci. USA, 99:377-382 2002; Hasan M.T., et al.. Genesis 29:116-122, 2001). As described herein, embodiments of the transgenic non-human animal of the instant invention offer the following non-limiting advantages: 1. Tissues or cell based assays have the same reporter system as in the transgenic in vivo model assay thus reducing the number of unknowns in complex intact biological systems. 2. Non-invasive imaging allows quantitative analysis of ligand or compound activity in a time-course assay in the same animal. 3. Non-invasive imaging reduces the number of animals per study and leads to greater statistical power by each animal being its own control wherein the control would be the animal assayed at time zero. 4. The transgenic animal would be a source of cells and tissues to support parallel assays done in vitro or ex vivo. 5. The assay of the transgenic animal would support the assay of ligand activity in native cell types which leads to a more realistic profile of ligand: receptor interaction. 6. The transgenic animal allows for simultaneous assessment of phamriacodynamics and pharmacokinetics of GPCR ligands. 7. The transgenic animal allows for simultaneously identification of tissue and cell-type specificity at either the organ or whole animal level. 8. The transgenic animal allows for cross breeding with other genetically altered models to reveal novel signaling pathways and their response to specific ligands. Many transgenic animals engineered with different reporters are being employed in the study of molecular processes such as drug metabolism (Zhang W., et al. Drug Metab. Dispos. 31:1054-1064, 2003), genotoxicity (Gossen J.A., et al., Proc. Natl. Acad. Sci. USA 86:7971-7975, 1989) and the effects of toxic compounds (Sacco M.G. et al., Nat. Biotechnol. 15:1392-1397, 1997). To achieve their design goals, a GPCR reporter animal suitable for molecular imagining studies has to incorporate several elements arranged to allow both high levels of reporter expression to support a large window of bioluminescent detection as well as expression in every cell type to support broad acute in vivo assays on biodistribution of the ligand or compound under study. The complexity and diversity of the mechanisms involved in gene expression will never allow researchers to construct genes capable in all cases of being expressed in transgenic animals in a fully predictable manner (Pinkert, C. A. (ed.) 1994. Transgenic animal technology: A laboratory handbook. Academic Press, Inc., San Diedo, Calif.; Monastersky G. M. and RobI, J. M. (ed.) (1995) Strategies in Transgenic Animal Science. ASM Press. Washington D.C). Only through extensive trial and error can unique combinations of transgene structures be arrived at to deliver model design goals as required for bioimaging of GPCR reporters. utility of a Transgenic GPCR Reporter over Recombinant Cell Assays As screening technology advances to the point of understanding the behaviors of individual GPCRs, it is clear that rather than being on-off switches, these receptors are acting more as microprocessors of information. This has introduced the phenomenon of functional selectivity, whereby certain ligands initiate only portions of the signaling mechanism mediated by a given receptor, which has opened new horizons for drug discovery. The need to discover new GPCR ligand relationships and quantify the effect of the drug on these complex systems to guide medicinal chemistry puts significantly higher demands on any pharmacological reporter assay. This concept drives the return to whole-system assays from the reductionist recombinant cell based screening systems. Profiling a ligand's activity with a specific GPCR or set of GPCRs in a native cellular environment is expected to improve the success rate of identifying new drugs against a key class of pharmaceutically important receptors (Kenakin TP, Nat. Rev. Drug Discov. 8,617-625, 2009) An animal model containing a bioluminescent GPCR reporter transgene is a highly desirable molecular imaging strategy to define GPCR ligand activity in an intact biologically complex system with the goal of improving drug discovery to fight human diseases. Because activation of CRE/CREB is involved many varied biological processes, there has been considerable interest in studying the activation of CRE by using a CRE/CREB reporter expression system. Cyclic adenosine monophosphate (cAMP) is a second messenger in intracellular signal transduction following receptor activation and subsequent activation of protein kinase, thereby being involved in the regulation of many biological processes. CREB (cAMP responsive element binding protein), phosphorylated by kinase activated by cAMP, binds to the cAMP responsive element (CRE) in the promoter region of many genes and activates transcription (Shaywitz and Greenberg, Annul. Rev. Biochem., 68:821-861, 1999). Transgenic mice carrying six tandem CREs with a minimal herpes simplex virus (HSV) promoter driving beta-galactosidase expression were used to study CRE-mediated gene expression in brain slices in response to chronic antidepressant treatment (Thome J., et al., J. Neurosci. 20:4030-4036, 2000). Similarly, transgenic mice carrying four copies of rat somatostatin gene promoter CRE fused to a thymidine kinase promoter and the luciferase gene have been used to study CRE activation in histological brain slices or homogenates (Boer et al, PloS One, May 9; 2(5):e431, 2007). However, studies to date have been hampered by the need to screen large numbers of transgenic lines to find a suitable animal model. Further, after the appropriate line has been identified, relatively low reporter expression levels require the transgenic animal be euthanized in order to measure the reporter gene, thus requiring large number of animals be used to in a single experimental paradigm. An embodiment of the invention is the development of a transgene comprising insulator elements, response elements, promoter elements, reporter genes, and functional elements. The transgene can be quickly introduced into non-human animals because of its high rate of integration and high level of reporter gene expression, thus transgenic animals can be easily developed as models to study regulatory element activation in vivo (i.e., in the living animal), in situ (e.g., brain slices, intact whole organ) or in vitro (e.g., primary cells cultured from the transgenic animal, tissue homogenates). An embodiment of the invention is a transgene comprising a CRE Luc reporter system used in transgenic non-human animals as models to quantify GPCR ligand activities through the regulation of intracellular cAMP levels in vivo. As a non-limiting example, we have demonstrated changes in the luciferase reporter via bioluminescence in isolated primary cells and in whole animals using general cAMP regulators. In another embodiment, activation of the reporter has been assayed and confirmed in tissue extracts using luciferase assays ex vivo. The response of the CRE Luc transgene has been documented in multiple mouse lines and exhibits either single or multiple tissue activation profiles. Furthermore, as non-limiting examples, we demonstrate that specific GPCR ligands activated the CRE Luc transgene in whole animals, tissue slices, and primary cells. BRIEF SUMMARY OF THE INVENTION In general, the invention provides transgene oonstmcts, transgenic non-human animals comprising transgene constructs, methods of making and methods of using the transgenic non-human animals comprising transgene constructs. An embodiment of the invention provides a transgene construct comprising the CRE Luc reporter system. An embodiment of the invention is the introduction of the transgene construct comprising the CRE Luc reporter system into a non-human animal. Since cAMP modulation is a key activation pathway for GPCRs, the invention serves as a platform for quantifying in whole animals, tissue slices, or cells the activation of a GPCR by a ligand or compound through the activation of a reporter gene wherein the reporter gene provides for a measurable bioluminescent signal, for example, metabolism of luciferin by luciferase. This invention supplies tools to improve the transition of new drug discovery entities such as ligands or compounds from cell based assays to whole animals. An embodiment of the invention uses the same reporter system in native cells which will reduce the attrition rate for new GPCR ligands while simultaneously supplying bioavailability data. An embodiment of the invention is a transgenic non-human animal having a genome comprising a transgene comprising a first insulator element, a response element, a promoter, a bioluminescent reporter, a functional element and a second insular element. An embodiment of the invention is a transgenic non-human animal wherein the first insulator element is selected from the group consisting of matrix attachment regions (MAR), DNase l-hypersensitive site (HS4) and inverted temiinal repeats (ITR). A further embodiment of the invention is a transgenic non-human animal wherein the second insulator element is selected from the group consisting of matrix attachment element (MAR), HS4 and ITR. A further embodiment of the invention is a transgenic non-human animal wherein the first insulator element is the same as the second insulator element. An embodiment of the invention encompasses a transgenic non-human animal wherein the response element is selected from the group consisting of cAMP response element (CRE), activator protein 1 (ASP1), glucocorticoid response element (GRE), heat shock response element (HSE), serum response element (SRE), thyroid response element (TRE) and estrogen response element (ERE). A further embodiment of the invention is a transgenic non-human animal wherein the response element is repeated in tandem two to twenty-four times. A further embodiment of the invention is a transgenic non-human animal wherein the response element is repeated in tandem six times. A further embodiment of the invention is a transgenic non-human animal wherein the response element is CRE, further wherein the CRE response element may be a single element or repeated two to twenty-four times. An embodiment of the invention is a transgenic non-human animal wherein the promoter is herpes simplex virus thymidine kinase minimal (HSV TK min). An embodiment of the invention is a transgenic non-human animal wherein the bioluminescent reporter is selected from the group consisting of luciferase, chloramphenicol acetyltransferase (CAT), beta-galactosidase, secreted alkaline phosphatase (SEAP), human growth hormone (HGH) and green fluorescent protein (GFP). An embodiment of the invention is a transgenic non-human wherein the functional element is human growth hormone (hGH) gene. An embodiment of the invention is a transgenic non-human wherein the transgene comprises SEQ ID NO: 18. An embodiment of the invention is a transgenic non-human wherein the transgene comprises SEQ ID NO: 19. An embodiment of the invention is a cell isolated from the transgenic non-human animal or a tissue slice isolated from the transgenic non-human animal of claim 1. An embodiment of the invention is a method of identifying a G protein-coupled receptor (GPCR) ligand, the method comprising (a) measuring an amount of bioluminescence in the transgenic non-human animal disclosed herein; (b) administering a test agent to the transgenic non-human animal; (c) measuring an amount of bioluminescence of the transgenic non-human animal at one or more time points following administration of the test agent; and (d) comparing the amount of bioluminescence measured in (a) to the amount of bioluminescence measured in (c) wherein a difference in the amount of bioluminescence in (a) compared to (c) identifies the test agent as a GPCR ligand. An embodiment of the invention is a method of identifying a G protein-coupled receptor (GPCR) ligand, the method comprising (a) preparing a tissue slice from the transgenic non-human animal disclosed herein; (b) measuring an amount of bioluminescence in the tissue slice; (c) administering a test agent to the tissue slice; (d) measuring an amount of bioluminescence of the tissue slice at one or more time points following administration of the test agent; and (e) comparing the amount of bioluminescence measured in (b) to the amount of bioluminescence measured in (d) wherein a difference in the amount of bioluminescence In (b) compared to (d) identifies the test agent as a GPCR ligand. An embodiment of the invention is a method of identifying a G protein-coupled receptor (GPCR) ligand, the method comprising (a) preparing a cell isolated from the transgenic non-human animal disclosed herein; (b) measuring an amount of bioluminescence in the cell; (c) administering a test agent to the cell; (d) measuring an amount of bioluminescence in the cell at one or more time points following administration of the test agent; and (e) comparing the amount of bioluminescence measured in (b) to the amount of bioluminescence measured in (d) wherein a difference in the amount of bioluminescence in (b) compared to (d) identifies the test agent as a GPCR ligand. An embodiment of the invention is a method of monitoring GPCR function in a non-human animal, the method comprising (a) transgenically modifying a non-human animal to express a transgene comprising a first insulator element, a response element, a promoter, a bioluminescent reporter, a functional element and a second insular element; (b) monitoring bioluminescence from the non-human animal; and (c) correlating said bioluminescence to GPCR function. An embodiment of the invention is a method of monitoring GPCR function in a non-human animal, the method comprising (a) transgenically modifying a non-human animal to express a transgene comprising a first insulator element, a response element, a promoter, a bioluminescent reporter, a functional element and a second insular element; (b) monitoring luciferase from the non-human animal; and (c) correlating said bioluminescence to GPCR function. An embodiment of the invention is a method of monitoring GPCR function in a non-human animal, the method comprising (a) transgenically modifying a non-human animal to express a transgene comprising a first insulator element, a response element, a promoter, a bioluminescent reporter, a functional element and a second insular element; (b) manipulating the non-human animal to mimic an aspect of a disease state; (c) monitoring bioluminescence from the non-human animal; and (d) correlating said bioluminescence to GPCR function. An embodiment of the invention is a method of monitoring GPCR function in a non-human animal, the method comprising (a) transgenically modifying a non-human animal to express a transgene comprising a first insulator element, a response element, a promoter, a bioluminescent reporter, a functional element and a second insular element; (b) manipulating the non-human animal to mimic an aspect of a disease state; (c) monitoring luciferase from the non-human animal; and (d) correlating said bioluminescence to GPCR function. An embodiment of the invention is a method of making a non-human transgenic animal for use in monitoring GPCR function, the method comprising (a) transgenically modifying a non-human animal to express a transgene comprising a first insulator element, a response element, a promoter, a bioluminescent reporter, a functional element and a second insular element; (b) measuring an amount of bioluminescence in the transgenic non-human animal of (a); (c) administering a GPCR ligand to the transgenic non-human animal; (d) measuring an amount of bioluminescence of the transgenic non-human animal at one or more time points following administration of the GPCR ligand; and (e) comparing the amount of bioluminescence measured in (b) to the amount of bioluminescence measured in (d) wherein a difference in the amount of bioluminescence in (b) compared to (d) identifies the non-human transgenic animal for use in monitoring GPCR function. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) preparing a cell isolated from the transgenic non-human animal disclosed herein; (b) measuring an amount of bioluminescence in the cell; (c) administering a test agent to the cell; (d) measuring an amount of bioluminescence in the cell at one or more time points following administration of the test agent; and (e) comparing the amount of bioluminescence measured in (b) to the amount of bioluminescence measured in (d) wherein a difference in the amount of bioluminescence in (b) compared to (d) identifies the test agent as a GPCR ligand. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing cells isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a control to one or more receptacles; (c) administering a test agent to one or more receptacles; and (d) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle(s) comprising control compared to the amount of luciferase in the receptacle(s) comprising test agent indicates the compound as modulating a GPCR. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing cells isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a general cAMP modulator to one or more receptacles; (c) administering a test agent to one or more receptacles; and (d) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle(s) comprising only the general cAMP modulator is compared to the amount of luciferase in the receptacle(s) comprising the general cAMP modulator and the test agent indicates the compound as modulating a GPCR. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing tissue slices isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a control to one or more receptacles; (c) administering a test agent to one or more receptacles; and (d) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle(s) comprising control compared to the amount of luciferase in the receptacle(s) comprising test agent indicates the compound as modulating a GPCR. An embodiment of the invention is a method of Identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing tissue slices isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a general cAMP modulator to one or more receptacles; (c) administering a test agent to one or more receptacles; and (d) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle(s) comprising only the general cAMP modulator is compared to the amount of luciferase In the receptacle(s) comprising the general cAMP modulator and the test agent indicates the compound as modulating a GPCR. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing cells isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a cell stimulator to one or more receptacles; (c) administering a test agent to one or more receptacles; and (e) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured In the receptacle(s) comprising cell stimulator compared to the amount of luciferase in the receptacle(s) comprising test agent and cell stimulator indicates the compound as modulating a GPCR. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing cells isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a cell stimulator to one or more receptacles; (c) administering a general cAMP modulator to one or more receptacles; (d) administering a test agent to one or more receptacles; and (e) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle comprising the cell stimulator and general cAMP modulator is compared to the amount of luciferase in the receptacle(s) comprising the cell stimulator and general cAMP modulator and the test agent indicates the compound as modulating a GPCR. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing tissue slices isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a cell stimulator to one or more receptacles; (c) administering a test agent to one or more receptacles; and (d) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle(s) comprising cell stimulator compared to the amount of luciferase In the receptacle(s) comprising test agent and cell stimulator Indicates the compound as modulating a GPCR. An embodiment of the invention is a method of identifying a compound that modulates a G protein-coupled receptor (GPCR), the method comprising (a) providing tissue slices isolated from the transgenic non-human animal disclosed herein into one or more receptacles; (b) administering a cell stimulator to one or more receptacles; (c) administering a general cAMP modulator to one or more receptacles; (d) administering a test agent to one or more receptacles; and (e) measuring an amount of luciferase in the receptacles, wherein a difference in the amount of luciferase measured in the receptacle comprising the cell stimulator and general cAMP modulator is compared to the amount of luciferase in the receptacle(s) comprising the cell stimulator and general cAMP modulator and the test agent indicates the compound as modulating a GPCR. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the CreLuc bioimaging mouse model. This figure illustrates the intracellular activation of the CRE Luc reporter transgene by all three types of GPCRs (Gi, Gs, and Gq) either directly through the cAMP pathway or indirectly through the PLC pathway (panel A). The change in the bioluminescence of the luciferase reporter in response to forskolin induction is illustrated for the three types of GPCRs (panel B). Forskolin will increase Gs and Gq signaling and thus CreLuc bioluminescence will increase, while Gi induction will decrease the signal from the reporter. Gas activates the cAMP dependent pathway by direct stimulation of AC, Gas inhibits the production of cAMP and Gaq stimulates PLC resulting in the generation of the two second messengers IPS and DAG. Abbreviations: a, a-subunit of the G protein; p, p-subunit of the G protein; y, y-subunit of the G-protein; AC, adenylate cyclase; PLC, phospholipase C; PKA, protein kinase A; PKC, protein kinase C; DAG, diacylglycerol; IP3, inositol triphosphate; Ca*^, calcium; CaMK, calcium/calmodulin protein kinase; cAMP, cyclic adenosine monophosphate CRE, cAMP response element; CREB, cAMP responsive element binding protein. Figure 2A shows real-time in vivo bioluminescence imaging and describes the benefits of using the system. The MS 100 (Xenogen) bioimaging instrument with a computer analyzer system allows real-time in vivo imaging utilizing the light emitted by a bioluminescent reporter gene, for instance luciferase, expressed in vivo. The software supports quantification of the signal non-invasively and longitudinally. Real¬time in vivo imaging has many advantages over traditional in vivo compound testing. Traditional animal studies require individual mice at multiple treatment points while studies utilizing bioimaging models allow the same animals to be sampled at multiple time points and reused for multiple treatments. As shown in this figure, a time course of 0 hours, 2 hours, 4 hours and 8 hours would require 24 animals (n=6 per time point) using current methodology whereas only 6 animals would be required using bioimaging technology. This results in several benefits which include: higher throughput because fewer test animals are required allowing more compounds to be tested for efTicacy; greater data content and quality since temporal and spatial data can be collected from the same animal; and decreases in statistical error which improves the quality of decisions made about individual compounds. Figure 2B shows a typical visual image of compound induction in a CreLuc transgenic mouse. Administration of isoproterenol (right panel) increases spinal cord expression of the CRE Luc reporter compared to basal levels (left panel). The bioluminescent detection is represented visually on a white-light image of the animal as a pseudocolor representation in grayscale. Figure 3 shows a schematic representation of a transgene stmcture comprising multiple DNA elements to enhance expression. The schematic transgene structure comprises the following elements: an insulator element shown in this figure as matrix attachment regions (MAR) to generate position independent expression; a response element represented by CRE-cAMP repeated six times (6X CRE); a promoter element shown as a herpes simplex virus thymidine kinase minimal promoter (HSV TK min); a reporter element which is represented by a luciferase gene optimized for mammalian expression (LUC2); and a functional element depicted by human growth hormone gene with poly A tail (hGH poly A) to enhance transgene expression. Figure 4: In vitro validation of CreLuc transgene vectors. Hybrid or synthetic (synth) vectors at 30,100 or 199ng DNA were transfected into CHO cells (along with a renilla luciferase positive control vector) with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, cat #11668-019). Two days later, the cells were stimulated with SpM forskolin (Sigma, St Louis, MO, cat #F6886) for 4 hours and then luciferase activity was measured with Dual Glo Luciferase Assay System (Promega, Madison, Wl, cat# E2920). Results show a dose dependant increase in the luciferase signal with both vectors. Higher levels of induction were achieved with the hybrid vector. Figure 5A shows the effects of PDE inhibitors on cAMP levels in normal mice, (reproduced from Cheng JB, JPET, 280, 621-626). Balb/c mice were dosed with either vehicle or drugs as listed on the x-axis, the blood was harvested after 20 minutes and assayed for cAMP by cAMP radioimmunoassay. Both CP-80,633 and rolipram significantly increase plasma cAMP levels at lOmg/kg. Figure 5B shows in vivo stimulation of cAMP in plasma. FVB/Tac females were dosed with either vehicle (1% DMSO) or drugs i.p., then 30 minutes later, blood samples were collected and assayed for cAMP by ELISA (Assay Designs, Ann Arbor, Ml, cat#900-163). The drugs used are as follows: 5mg/kg forskolin (F) (Sigma F6886), 5mg/kg water soluble forskolin (H20F) (Calbiochem 344273), lOmg/kg rolipram (R) (Sigma R6520) or combinations of either forskolin plus rolipram (F/R). Statistically significant increases, 14 fold, were observed with treatment of water soluble forskolin in combination with rolipram as detennined by t-test. Forskolin increases cAMP levels by activating adencylate cyclase while inhibitors of PDE4, such as rolipram, raise plasma cAMP by preventing hydrolysis of cAMP. A combination of rolipram and water soluble forskolin increases cAMP levels in vivo 14 fold. This combination was used to provide a large window of induction for founder screening by bioimaging, a representative study is shown in Figure 6. Figure 6 shows the results of the initial founder induction and line selection for the CreLuc reporter mouse model. Multiple transgenic lines were screened for luciferase induction with forskolin and rolipram in vivo and then tissues were isolated and assayed for luciferase enzymes. Transgenic mice were bioimaged pre-dosing (basal expression levels), then the same mouse was dosed i.p. with lOmg/kg rolipram and 5mg/kg water soluble forskolin and bioimaged 4 hours post-dosing (induced expression). A (subline #90): forskolin/rolipram administration increased basal expression of CreLuc reporter transgene in the lungs and other tissues; B (subline #219): induction of basal expression is mainly in the gut; C(subline #44): undetectable basal expression and reporter is induced in brain plus other tissues; D (subline #28): undetectable basal expression that is increased in thymus and liver; E (subline #187): undetectable basal expression that is induced in the brain and spinal cord. As expected for a randomly integrated transgene, there was variation between lines in basal expression, tissue distribution, and response to induction. Twenty lines were identified to have greater than 5X induction in one or more tissues. Variation in tissue profile demonstrates that single tissue (i.e. lung, liver, brain) allows imaging devoid of background tissue response while multiple tissues allows a broad compound response profile to be generated. Figure 7 shows a general schematic of CreLuc screening assays in vivo or ex vivo. Figure 8A shows the effects of isoproterenol (ISO) and AMN082 (AMN) on luminescence in whole brain slices from CreLuc mice (line 187). Figure 8B shows the effects of forskolin on luminescence in whole brain slices from CreLuc mice (line 44) over time. Time is represented on the X-axis in minutes. Forskolin at 50uM or vehicle (DMSO) was added at time = 2880 marked by an arrow in the bottom panel. Figure 9 shows a schematic representing the isolation and compound treatment of primary neuronal cells from the CreLuc mice. Figure 10 shows Gs modulation via p-adrenergic receptor (ADpR) activation and D1 dopamine receptor (DRD1) activation. Neurons were isolated from the cortices of line 187 E18 embryos. On day three in culture, test copmpounds were added Forskolin 5|JM (F), rolipram at 10|JM (R), forskoline and rolipram in combination (F/R) isoproterenol at lOpM, isoproterenol and rolipram in combination (l/R); SKF82958 at 10|JM, and SKF82958 and rolipram in combination (S/R). Data is shown as counts per second (cps) Figure 11 shows the effects of prokineticin 2 (PR0K2) peptide on luciferase expression in primary cortical neurons. Primary cortical neurons were harvested from line 187 (inducible luciferase in brain and spinal cord) on E18. The assay was run on day 3 in culture for 4 hours or 8 hours. The PR0K2 peptide is added as an aqueous solution at 1 nM and lOOnM. Data is shown as counts per second (cps) Figure 12 shows the effects of prokineticin 2 (PR0K2) peptide on luciferase expression in primary cortical neurons from different CreLuc lines. Primary cortical neurons were harvested from four different CreLuc lines at E18. The assays were run in triplicate at day three in culture with either 1nM or lOOnM PROK2 peptide at two timepoints, 4 hours and 24 hours. BrightGlo was used for the assay and read on a TopCount. Data is shown as counts per second (cps) Figure 13A shows the effects of the mGluR7 agonist, AMN082 on luciferase expression in primary cortical neurons. Cortical neurons were harvested from E18 embryos (line 187). The assay was run at day 3 in culture. Forskolin was used at 10pM. The agonist, AMN082 was used in combination with forskolin at 1nM, 10nM, lOOnM and 1pM. The assay was read on a TopCount with Bright Glo (Promega) at 4 hours, and 8 hours. Data is shown as counts per second (cps) Figure 13B shows the results of screening unknown compounds for the ability to modulate Gi activity in primary cortical neurons. Cortical neurons were harvested from E18 embryos (line 187). The assay was run at day 3 in culture. Forskolin was used at IOJJM. AMN082 or unknown compounds A, B or C was tested in combination with forskolin at different concentration and EC50 values were calculated. The assay was read on a TopCount with Bright Glo (Promega) at 4 hours. Data is shown as counts per second (cps) Figure 14 shows the effects of the mGluR7 agonist, AMN082 on luciferase expression in primary cortical neurons. Primary cortical neurons were isolated from El 8 embryos from line 187. The assay, in triplicates, was run at day 7 in culture for 6 hours. A concentration curve for AMN082 was run in combination with SOpM forskolin and 10|JM rolipram. The assay was read on a TopCount luminometer with Bright Glo substrate (Promega). Data is shown as counts per second (cps) Figure 15A shows Gi modulation of luciferase expression in primary cortical neurons from different CreLuc lines by the CB1 agonist, CP 55,940. Primary cortical neurons were harvested from four different CreLuc lines at El 8. The assays were run on day three in culture. The CB1 agonist was used at lOpM, forskolin at 5pM and rolipram at 10 |JM. TWO timepoints were run, four hours and twenty-four hours. Bright Glo luciferase assay substrate was then added, and the assay read on a Topcount luminometer. Data shown is the average of the triplicates. Data is shown as counts per second (cps). Figure 15B shows Gi modulation of luciferase in primary cortical neurons from CreLuc mice by the CB1 agonist, CP 55,940. Cortical neurons were isolated from E18 embryos (line 187). The assay was mn on day 3 in culture. Forskolin (F) and rolipram (R) were used at lOpM. The agonist was added at concentrations of 10|JM, 1 pM and lOOnM. The assay was read on a TopCount with BrightGlo (Promega) at 8 hours. Data is shown as counts per second (cps). Figure 16 shows induced luciferase expression in CreLuc striatal neurons by forskolin and rolipram, and Gs agonists DRD1 and ADPR. Striatum neurons were isolated from E14 embryos (line 187). The assays were run at day 4 in culture. Forskolin (F) was used at 5[M, rolipram (R) at 10pM. The Gs agonists isoproterenol (iso), dopamine (dopa) and SKF82958 (chloro) were used at 10|JM, 3 pM and 1 pM. The assay was read at 5 hours with a TopCount luminometer and Bright Glo luciferase reagent (Promega). Data is shown as counts per second (cps). Figure 17 shows the effects of general cAMP inducers such as forskolin (F) and rolipram (R), as well as Gs agonists on luciferase expression in whole splenocyte preps isolated from CreLuc mice. Line 64 splenocytes were stimulated for 24 hours with anti-CD3 antibody (CD), the other half were untreated (unstim). At 24 hours, compounds were added to the plates for an additional 4 hours. The co-treatment of forskolin and rolipram (F/R) was 5uM forskolin and 10um rolipram. The Gs agonists used are: EX00000173A (173A) as an EP2 agonist, BW245C as a DPI agonist and isoproterenol as an ADpR agonist. All Gs agonists were used at lOuM. The assay is run as triplicates. After 4 hours, lOOul of BrightGlo was added and the assay was read on a TopCount luminometer. Data is shown as counts per second (cps). Figure 18 shows the effects of general cAMP activation by rolipram and forskolin in T cells isolated from five different sublines of CreLuc mice. The cells were stimulated with anti CDS antibodies (1ug/ml). After 18 hours, 10|JM rolipram and 5|JM forskolin were added to the plates for an additional 4 hours. BrightGlo was added and the assay was read on the TopCount. Data is shown as luminescence (counts per second) in the top panel, and as fold increase over media only controls in the bottom panel. Figure 19 shows the effects of Gs agonists on luciferase levels in anti CD3 stimulated CD4+ T cells isolated from CreLuc mice (line 64). The cells, 1.5x10^ per well, were plated on 96 well white opaque plates and then stimulated with anti CDS antibodies (1 ug/ml). After 24 hours, compounds were added for an additional 4 hours. Gs agonists BW245C, EX0000017SA (1734A) and isoproterenol (iso) were all used at 10pM. Forskolin (F) was added at 5uM and rolipram (R) at 10uM. BrightGlo was added and the assay was read on the TopCount. Data is shown as counts per second (cps). Figure 20 shows the effects of general cAMP activation by rolipram and forskolin in B cells isolated from two different sublines of CreLuc mice. Cells were plated 2.0x10^ per well on 96 well white opaque plates and stimulated with 10ng/ml lipopolysaccaride (LPS). After 18 hours, lOpM rolipram and 5pM forskolin were added to the plates for an additional 4 hours. BrightGlo was added and the assay was read on the TopCount. Data is shown as luminescence (counts per second), and as fold increase over media only controls. Figure 21 shows the effects of Gs agonists on luciferase levels in LPS stimulated B220+ B cells isolated from CreLuc mice. The cells were plated, 2.0x10^ per well on 96 well white opaque plates and then stimulated with lOng/ml lipopolysaccaride (LPS). After 24 hours, compounds were added for an additional 4 hours. Gs agonists BW245C, EX0000017SA (17S4A) and isoproterenol (iso) were all used at 10pM. Forskolin (F) was added at 5uM and rolipram (R) at 10uM. BrightGlo (Promega, Madison, Wl, cat#E2610) was added and the assay was read on the TopCount. Data is shown as counts per second (cps). Figure 22 shows the Induced luciferase expression in isolated microglia (line 64) by the general cAMP activators, forskolin (F) and rolipram (R), and an agonist for the DP receptor, BW245C. Primary microglia were isolated from the cortices from P2 mice and plated in 96 well format on Poly-D-Lysine-coated plates. Cells were either left untreated or stimulated for 2 hours with 100 ng/ml LPS. Compounds were then added for an additional 4 hours before the Bright Glo assay was run. The compounds used were 5|JM forskolin, lOpM rolipram or the combination of the two, or the Gs agonist for the DPI receptor, BW245C at 10 |JM. Data is shown as counts per second (cps). Figure 23 shows the effects of intrathecally injected forskolin (F) and rolipram (R) on the induction of luciferase expression in the brain and spinal cord of CreLuc mice (line 187). N=3-4 mice per group, 3 month old males. Group A: DMSO control. Group B: lug forskolin/ lOug rolipram. Group C: lOug forskolin/ 10ug rolipram. Group D: 40ug forskolin/ lOug rolipram. The animals were dosed via intrathecal injection, lumbar region, and volume of Spl per mouse. They were imaged at 4 hours post dosing. The data for both spinal cord and brain is shown as the average peak radiance, photons per second per cm2. Figure 24 shows the effects of the EP2 agonist, EX00000173A on luciferase expression in the brain and spinal cord of CreLuc mice. Mice (line 187) were injected i.p. with either vehicle (5% DMSO, 0.05% tween 80, PBS) or 10 mg/kg EX00000173A. Animals were bioimaged at 4 hours post doing. Data shown as photons per second per cm2. Figure 25 shows the effects of the EP2 agonist, EX00000173A on luciferase expression in CreLuc mice. Mice were dosed with either vehicle control or varying doses of the EP2 agonist EX0000173A. Mice were dosed by intrathecal injection (5|jl per mouse) and were bioimaged 4 hours later on the MS bioimager. Data is shown as the mean of the five mice, average peak radiance, photons per second per cm^. Figure 26 shows induction of luciferase in different tissues by the adrenoceptor beta3 (Adrb3) agonist, CL316,243 (1 mg/kg, ip) in CRE-Luc mice. The luciferase assay was performed in tissue homogenates. Figure 27A shows induction of luciferase by the Adrb3 agonist CL316,243 (1 mg/kg, ip) in lines 11 (n=2) and 115 (n=3) of CRE-Luc mice. BLIs were taken before and 4-5 hours after treatment. Luciferase activities in tissue homogenates is shown below the pictures. Figure 27B shows induction of luciferase by the Adrb3 agonist CL316,243 (1 mg/kg, ip) in lines 31 (n=2) and 175 (n=3) of CRE-Luc mice. BLIs were taken before and 4-5 hours after treatment. Luciferase activities in tissue homogenates is shown below the pictures. Figure 28 shows induction of luciferase reporter by the glucagon-like peptide 1 receptor (GLP-1R) agonist, AVE0010, in three independent lines of CRE-Luc mice. Baseline images were acquired on day 1. On day 2, mice were treated with AVE0010 (0.1 mg/kg, sc) and imaged after 4 hours. Fold induction over baseline at indicated at the bottom. Figure 29 shows induction of luciferase reporter by the glucagon-like peptide 1 receptor (GLP-1R) agonist, AVE0010, in three independent lines of CRE-Luc mice. Mice were treated with AVE0010 (0.1 mg/kg, sc) for 4 hours. Luciferase activities in 8 different tissues were measured. Figure 30 shows the effects of the beta-cell toxin streptozotocin (STZ) on the induction of CRE-Luc by AVE0010. Male CRE-luc mice (line 11) were imaged before ("uninduced"; top panel) and after AVE0010 was given at 0.1 mg/kg, sc ("induction by AVE0010", middle panel). All mice were responsive to AVE0010 (middle panel). Then, the animals were treated with vehicle (control) or STZ (200 mpk, ip). Four days later, they were imaged again after AVEO010 treatment (bottom panel). Figure 31 shows that the induction of CRE-Luc by AVE0010 is likely beta-cell-specific. Animals were treated as described in Figure 30. Blood glucose levels were measured by tail vein nicking on unfasted mice. Glucose levels were read on a Bayer glucometer. Glucose levels are shown as mg glucose/ml. Fold induction is the iuciferase bioimaging levels of AVE10 closing versus the baseline signals. Blood glucose levels (BG) were increased by STZ (upper left panel). Non-fasting BG levels were reduced by AVE0010 (0.1 mg/kg, sc). BLI data shown In Figure 30 were quantified. Figure 32 shows CreLuc bone marrow engraftments into NOD scid gamma (NSG) mice. Bone marrow cells were harvested from lines 44 heterozygotes and line 64 homozygotes. The cells were then engrafted via tail vein injections of cells into irradiated NSG mice at 1 million or 5 million cells per mouse. For line 44: mouse 1 and 2 received 5 million cells, mouse 3 and 4 received 1 million cells; for line 64: mouse 1 received 5 million cells, mouse 2, 3, and 4 received 1 million cells. (4 NSG mice per CreLuc line). The animals were bioimaged at 4 weeks (data not shown) and then again at 8 weeks (data shown). Prior to imaging, the line 64 mice were induced for 5 hours with 5mg/kg forskolin and 10mg/kg rolipram. Figure 33 shows the effects of forskolin, rolipram and isoproterenol on Iuciferase expression in mouse embryonic fibroblasts. Mouse embryonic fibroblasts were cultured from E12 embryos from six independent CreLuc lines and plated at 20,000 cells per well. Compounds tested include 10pM forskolin (F), 5 |JM rolipram (R) and lOpM isoproterenol (iso). Data is shown as counts per second (cps). Figure 34 show the effects of zymosan treatment on Iuciferase levels in CreLuc mice (line 187). Animals in the treated group were injected s.c in both rear paws with zymosan (zymo) to induce a pain response. The animals were then bioimaged daily for 4 days (denoted as d1, d2, d3 and d4). Figure 35 shows the effects of forskolin and rolipram and isoproterenol on Iuciferase levels in cardiomyocytes. Cardiomyocytes were isolated from P3 pups (line 229). The cells were cultured in a 96 well plate. Compounds tested include lOpM forskolin (F), 5 IJM rolipram (R) and 10|JM isoproterenol (iso). Data is shown as counts per second (cps). DETAILED DESCRIPTION OF THE INVENTION Unless othenvise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety to the extent that it is not inconsistent with this present disclosure. It is noted here that, as used in this specification and the appended claims, the singular fonns "a," "an," and "the" include plural reference unless the context clearly dictates othenvise. Furthermore, in accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein "Sambrook et a!., 1989"); DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis {M.J. Gaited. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J.Higgins eds. (1985)]; Transcription And Translation [B.D. Hames & S.J. Higgins, eds. (1984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [\Rl Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.), Cunent Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994). A "test agent" is interpreted broadly to include any material such as a compound or chemical compounds, e.g., organic chemical entities, inorganic chemical entities, biologic compounds or biological materials, e.g., antibodies and antigen recognizing fragments and constructs, nucleic acids, e.g., RNAi, etc. A test agent encompasses a single agent or multiple agents applied together. As used herein, a 'Iransgenic animal" is a non-human animal, a non-limiting example being a mammal, in that one or more of the cells of the animal includes a genetic modification as defined herein. Further non-limiting examples includes rodents such as a rat or mouse. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians etc. The choice of transgenic animal is only limited by the ability of light generated from the reporter to cross tissues and reach the surface where detection can occur. As used herein, a "genetic modification" is one or more alterations in the non-human animal's gene sequences. A non-limiting example is insertion of a transgene into the genome of the transgenic animal. As used herein, the tenn "transgene" refers to exogenous DNA containing a promoter, reporter gene, poly adenlyation signal and other elements to enhance expression (insulators, introns). This exogenous DNA integrates into the genome of a 1-cell embryo from which a transgenic animal develops and the transgene remains in the genome of the mature animal. The integrated transgene DNA can occur at single or multiple places in the genome of the egg or mouse and also single to multiple (several hundred) tandem copies of the transgene can integrate at each genomic location. The term "general cAMP modulator" refers to chemical compounds, e.g., organic chemical entities, inorganic chemical entities, biologic compounds or biological materials, e.g., antibodies and antigen recognizing fragments and constructs, nucleic acids, e.g., RNAi, etc capable of increasing or maintaining cAMP levels. Non-limiting examples include forskolin and rolipram. A general cAMP modulator encompasses a single cAMP modulator or multiple cAMP modulators applied together. The temn "cell stimulator" refers to chemical compounds, e.g., organic chemical entities, inorganic chemical entities, biologic compounds or biological materials, e.g., antibodies and antigen recognizing fragments and constructs, nucleic acids, e.g., RNAi, etc capable of activating the cell or causing the cell to be in a more activated state. Non-limiting examples include lipopolysaccharide and anti CD3. An embodiment of the invention uses a control. A control is a term of art well understood by skilled artisans. An appropriate control may be dependent on the assay parameters utilized or the experimental question under investigation. Typically, a control is a vehicle control in which the control is the same buffer or solvent used to dissolve test agent or compounds. A non-limiting example is if phosphate-buffered saline is used to dissolve compound then the vehicle control would be phosphate buffered saline. Similarily, if DMSO is used to dissolve test agents, then the control is DMSO. Often, more than one control must be used per experiment or assay because more than one diluent is used for the compounds tested. As used herein, "luciferase" refers not only to luciferase enzyme activity but also to actual amounts of luciferase protein. In accordance with the present invention there may be employed conventional techniques known to those skilled in the art to generate transgenic non-human animals. For instance, Pinkert, C. A. (ed.) 1994. Transgenic animal technology: A laboratory handbook. Academic Press, Inc., San Diedo, Calif.; Monastersky G. M. and Robl, J. M. (ed.) (1995) Strategies in transgenic animal science. ASM Press. Washington D.C.. and Nagy A, Gertsenstein, M, Vintersten, K, Behringer R 2003. Manipulating the Mouse Embryo; A laboratory Manual 3"^ edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Transgene Elements An embodiment of the invention relates to a transgene. The transgene may comprise insulator elements, response elements, promoter elements, reporter elements, and functional elements. Response elements are palindromic DNA sequences that respond to cellular signals such as hormones, enzymes, or other key signaling proteins within a cell. Non-limiting examples of response elements include CRE (cAMP response element), estrogen response elements and others listed in Table 2. Response elements may be incorporated into the transgene as a single DNA sequence or in tandem repeats. For instance, CRE response elements repeated four times or six times have been used in transgene construction and validated in vitro (Deutsch P.J., et al., J. Biol. Chem., 263:18466-18472, 1988; Oetjen E JBC 269;27036-27044, 1994). Cre response elements have also been compared in vivo and the increase in multimers has correlated with an increase transcriptional response to cAMP pathway activators (Montoliu, L et al., Proc. Natl. Acad. Sci. USA 92;4244, 1995; Boer et al, PloS One, May 9; 2(5):e431, 2007). An embodiment of the invention may utilize any known response element, either as a single sequence or in multiple tandem repeats, for instance, tandem six repeat of CRE (6X CRE). Table 2: Cis acting response elements DNA promoter elements are regions of DNA that facilitate the transcription of a particular gene. Promoters are typically located near the genes they regulate, on the same strand and upstream (towards the 5' region of the sense strand). Promoters contain specific DNA sequences and response elements which provide a binding site for RNA polymerase and for proteins called transcription factors that recruit RNA polymerase. DNA promoters are highly variable in their size and internal substructures that contribute to the regulation of a particular gene's expression in time and space. In a non-limiting example of promoter elements, the herpes simplex virus thymidine kinase minimal promoter (HSV TK min) is designed to allow expression of the reporter gene in every cell type. Only its core expression elements are retained to impart ubiquitous expression either in vitro or in vivo (Park, J., et al., DNA Cell Bio., 12:1147-1149, 1994). An embodiment of the invention may utilize any known promoter element. As a non-limiting example, any known promoter element may be used such that the promoter element when combined with the CRE cis-activating response element allows gene expression of the reporter to be responsive to cAMP pathway modulation. Since the response elements such as CRE and the promoter element HSV TK min are small in size, a transgene promoter containing these elements regulating the transcription of a reporter element will be very sensitive to position effects and lead to poor expression responses to ligands especially at low ligand concentrations in vivo. Thus, an embodiment of the invention is to include to additional elements to be added to the transgene to achieve high levels of expression and wide distribution of a functioning transgene throughout all the cellular compartments. These elements include insulator elements and functional elements (Sun F.L and Elgin S.C, Cell 99:459-462, 1999). An embodiment of the invention utilizes functional elements or functional enhancer elements within the transgene. A nonlimiting example of a functional element is the human growth hormone (hGH) gene. The hGH sequence used in the CreLuc transgene contains several design elements that contribute and interact with the insulator element to achieve the bioimaging model design goals. The hGH sequence contains all the hGH genomic structure and thus supplies several important elements, but is not transcribed or translated into a protein. The critical influence of the hGH sequence to improve the production of a functioning transgene has been demonstrated since 1990 for several transgenic models Erickson 1_A, Nature 346: 74-76, 1990. While there is not a comparative analysis of its importance, the hGH structure does contain several important and critical DNA elements: a. Intron splicing: Initially transcribed mRNA contains both intronic and exon sequences which then are exported from the nucleus and further processed to remove intronic sequence resulting in a mature mRNA containing only exon sequences. This transport and trimming process connect the maturing mRNA strand to additional translational machinery for the final production of a protein. Including introns in transgene cDNA structure has been shown to improve the expression level of the transgene cDNA (Palmiter, R.D., et a!., Proc. Natl. Acad. Sci. USA 88:478-482, 1988) b. Genomic structure with intact 3'UTR: In an embodiment of the invention, the hGH sequence in the transgene contains an intact 3'UTR which imparts a high degree of mRNA stability and thus higher levels of transgene expression c. Genomic structure with poly A (PA+) structures The hGH sequence contains its native PA+ structure imbedded in the nature 3' UTR. Typically PA+ signals are from viral sequences (SV40, RSV etc.) and are minimal structures added to the end of unrelated 3'UTRs. In an embodiment of the invention, the entire 3'UTR structure with the nature PA+ signal is preserved in the even wider genomic context of the full hGH gene. Insulator elements are sequences of DNA that generate position independent expression (Giraldo et al, Transgenic Research 12: 751-755, 2003). Insulator sequences were described in the 1980s for the globulin locus (Sun F.L. and Elgin, S.C, Cell 99;459-462, 1999) and were reported to increase the chance of obtaining correct and responsive transgenic expression in selected tissues to support the model design goals for bioimaging. (Pinkert, C. A. (ed.) 1994. Transgenic animal technology: A laboratory handbook. Academic Press, Inc., San Diego, Calif.; Monastersky G. M. and RobI, J. M. (ed.) (1995) Strategies in transgenic animal science. ASM Press. Washington D.C) Insulators are DNA elements that create open chromatin domains pemiissive to gene expression and constitute a bamer against the influence of distal silencer/enhancer sequences and against acetylation and methylation events. They should significantly increase the number of independent transgenic founder lines that have the reporter gene expressed at detectable levels for bioimaging. Insulator elements have been shown to increase the number of luciferase expressing clones in a transient transfection assay from 40 to 70% thus enhancing the inducibility of luciferase expression in an ERE-luci transgene. (Ottobrini L., Mol Cell Endo 246, 69-75). However a full review of the application of insulators to transgene reporter expression leads to the conclusion that in practical terms, it remains difficult to utilize insulators. Their mechanism of action is only partly known and their effect is not fully predictable. Non-limiting examples of insulator elements are included in Table 3. Table 3: Examples of known insulator elements to Improve transgene DNA expression Insulator Gene or origin References DNase l-hypersensitive site (HS4) Human beta-globin Chung etal 1993 Matrix attachment regions (MAR) Chicken lysozyme Stiefetal1989 Inverted terminal repeats (ITR) Adeno-associated virus Fuetal, 1998 In an embodiment of the Cre-Luc transgene, the inclusion of insulator elements significantly increased the frequency of generating lines with a functional reporter as detected by bioimaging. For an analysis of the contribution of insulator elements to luciferase expression in our CreLuc transgenic mouse lines, see section VI of "Examples" below. An embodiment of the invention relates to a transgene comprising a reporter element or gene. A reporter gene includes any gene that expresses a detectable gene product, which may be an RNA or a protein. Many reporter genes are known in the art, including, but not limited to beta-galactosidase and alkaline phosphatase. In another embodiment, the transgene comprises a bioluminescent reporter gene. Many bioluminescent reporter genes are known in the art, including, but not limited to luciferase. There are many sources of luciferase, nonlimiting examples include firefly luciferase and bacterial luciferase. An embodiment of the invention may utilize any known bioluminescent reporter, for instance, luciferase. Other non-limiting examples of reporter elements are shown in Table 5. TABLE 4. Genetic reporter systems other embodiments of the invention can incorporate modified versions of the luciferase enzyme, luciferase enzyme from different species or any other protein that can produce light able to cross animal tissues or any enzyme that can emit light able to cross animal tissues when provided with a suitable substrate. The reporter protein of the present invention is only limited by the fact that signal attenuation depends on the wavelength of the light being emitted and the tissue properties surrounding the emitting cells. Generally, blue-green light (400 590 nm) is strongly attenuated while red to near-infrared light (590 800 nm) suffers much less attenuation. Most types of luciferase have peak emission at blue to yellow-green wavelengths, the emission spectrum is broad such that there is significant emission at red wavelengths (>600 nm) that penetrate quite deeply into tissue. For small rodents such as mice, this allows detection of signals throughout the entire animal. The limits of light detection in vivo depend on the type of bioluminescent reporter, the surrounding physiology of the animal and on the source depth. Typically, bioluminescent cells in animals can be observed from 1 3 cm deep with sensitive CCD cameras, depending on the number and location of the cells. Scattering of photons as they propagate through tissue limits the spatial resolution of images detected on the animal surface. In general, spot size or resolution on the surface is approximately equal to the depth of the source below the surface. Using physics based diffusion models, improvements in spatial resolution approaching the millimeter level can be achieved. Using cooled scientific grade CCD arrays, the limit in signal detection is detennined by the read noise associated with reading CCD pixels after an image is taken, which is on the order of a few photons per pixel (Honigman et al., Mol. Ther. 4:239-249, 2001). There may be additional background light coming from the animal due to phosphorescence of the fur, skin, or perhaps contaminants on the animal. Typically, background light is at a low level and only has a deleterious effect on images of deep low-level bioluminescent sources. However, background light can be eliminated by using use of an appropriate optical filter. An embodiment of the invention utilizes CCD cameras such as the MS (Xenogen Corporation, 860 Atlantic Avenue, Alameda, Calif. 94501, USA). The IVIS.RTM. Imaging System includes a sensitive CCD camera, a dark imaging chamber to minimize incident light, and specialized software to quantify and analyze the results. MS is a registered trademark of Xenogen Corporation. However, any such bioluminescence imaging system can be applied to the instant invention. Real-time in vivo imaging allows the quantification of the bioluminescent reporter gene non-invasively, i.e., the animal does not need to be euthanized, and longitudinally, i.e., the measurements can continuous or repeated over a prolonged time course. Real-time In vivo imaging requires fewer test animals (e.g., because the same animal can be used over a specified time period) and less time (e.g., because fewer animals need to be handled) than conventional protocols allowing more test compounds to be tested for efficacy, real-time in vivo imaging provides for a higher data content and higher data quality for many reasons. For instance, temporal and spatial data can be collected from the same animal and data can be collected without need for time-consuming histological assessment. Higher data quality decreases statistical error and improves the quality of test compound assessment and decision making. An embodiment of the invention is use in high throughput screening (HTS) methods. HTS is the automated, simultaneous testing of thousands of distinct chemical compounds in assays designed to model biological mechanisms or aspects of disease pathologies. More than one compound, e.g., a plurality of compounds, can be tested simultaneously, e.g., in one batch. In one embodiment, the term HTS screening method refers to assays which test the ability of one compound or a plurality of compounds to influence the readout of choice. Liquid handling systems, analytical equipment such as fluorescence readers or scintillation counters and robotics for cell culture and sample manipulation are well known in the art. Mechanical systems such as robotic amis or "cherry-picking" devices are available to the skilled artisan. Commercial plate readers are available to analyze conventional 96- well or 384-well plates. Single sample, multiple sample or plate sample readers are available that analyze predetermined wells and generate raw data reports. The raw data can be transfomried and presented in a variety of ways. An embodiment of the invention comprises an array of receptacles that can receive ceils, tissue slices and other materials such as culture media. An array of receptacles can be any number of receptacles from at least one or more than one receptacle suitable for holding cells or tissue slices within the scope of the invention. Examples include but are not limited to flasks, culture dishes, tubes such as 1.5 ml tubes, 12 well plates, 96 well plates, 384 well plates and miniaturized microtiter plates with perhaps 4000 receptacles (U.S. Patent Application 20050255580). The an-ay of receptacles may be amendable to the addition of a protective covering thus preventing against entry of contaminants or evaporation of contents. A further characteristic of the receptacles is that the receptacle may allow for analysis, non-limiting examples include, spectrophotometric analysis, scintillation counting and fluorescence measurements. However, this is not a limitation to receptacles that can be used within the scope of the invention given that samples can be transferred to a suitable container amendable for further analysis. A non limiting example is to modify the method such that the method further comprises providing a second array of receptacles wherein the step of lysing the cells further comprises separating supernatant from cell debris and the next step further comprises adding a detectable compound capable of intercalating into DNA fragments to at least one receptacle of said second array of receptacles containing a sample of said separated supernatant. Additional aspects and details of the invention will be apparent from the following examples, which are intended to be illustrative and are not meant to limit the scope of the invention in any way. All experimental woi1< involving animals was performed in accordance with federal guidelines and protocols were prior reviewed and approved by the sanofi-aventis site Institutional Animal Care and Use Committee (lACUC). EXAMPLES I. Vector Backbone for the MultiSite Gateway Pro Plus Cloning System (Fig. 3) A destination vector, pDest2XMARS was designed and cloned specifically for use with the MultiSite Gateway Pro Plus Cloning System (Invitrogen Carlsbad, CA, cat #12537-100). All elements inserted into the vector were either PCR (polymerase chain reaction) cloned or synthetically generated. For all PCR cloning steps, the fragments were amplified from the specified vector thrpugh the use of PCR SuperMIx Hi Fidelity (Invitrogen, Carlsbad, CA, cat# 10790-020) and fragment specific primers. The PCR products were then subcloned into pCR2.1 vectors by TOPO cloning. TOPO Cloning is a molecular biology technique in which DNA fragments amplified by either Taq or Pfu polymerases are cloned into specific vectors without the requirement for DNA ligases. First, insulator elements were cloned by polymerases chain reaction (PCR) from the vector pCpG-LacZ (InvivoGen San Diego, CA, cat#pcpg-lacz), sequence verified and then subcloned into restriction sites of pNEB193 (New England Biolabs Ipswich, MA, cat#N3051S). The insulator elements were used to reduce variability in expression of the transgene due to integration site dependant posifion effects. The PCR primers used to clone the fragments are the following: a. Human IFN-p MAR primer sequences (primers have EcoRV sites for subcloning) SEQ ID NO: 1, IFN fonrt/ard primer: 5'-GGGGGATATCAGTCAATATGTTCACCCCA-3' SEQ ID NO: 2, IFN reverse primer: 5'-GGGGGATATCCTACTGTTTTAATTAAGC-3' b. Human p-globin MAR primer sequences SEQ ID NO: 3, p-globin fonward primer: 5'-AAGGATCCTTAATTAAAATTATCTCTAAGGC-3" SEQ ID NO: 4, (3-globin reverse primer: S'-GGATCCCTGCAGGAATTCCTTTTAAT-S' The p-globin PCR fragment was topo cloned using pCR2.1 (Invitrogen, Carlsbad, CA, cat#K2030-01). After sequence confinnation, the fragment was cut out with BamHI and then subcloned into the BamHI site of pNEB193 (PgloMAR-pNEB193). The IFN-[3 PCR fragment was also topo cloned with pCR2.1, sequenced, and then cut out with EcoRv and subcloned into the Hindi site of |3gloMAR-pNEB193 (2XMARS-pNEB193). For the final Gateway destination vector, a linker containing Xbal ends and an internal EcoRV site was subcloned into Xbal site of 2XMARs-pNEB193. The blunt ended Gateway conversion cassette, RfA was then inserted into the EcoRV site of 2XMARs-pNEB193 (2XMARSpDest). The final vector, 2XMARSpDest was the final destination vector used to generate the transgenes. SEQ ID NO: 5 TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAG ACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGG CGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAG AGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCG TAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTT GGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGG GGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCAC GACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGGCGCGCC GGGATCCTTAATTAAAATTATCTCTAAGGCATGTGAACTGGCTGTCTTGGTTTTC ATCTGTACTTCATCTGCTACCTCTGTGACCTGAAACATATTTATAATTCCATTAAG CTGTGCATATGATAGATTTATCATATGTATTTTCCTTAAAGGAI I I I IGTAAGAAC TAATTGAATTGATACCTGTAAAGTCTTTATCACACTACCCAATAAATAATAAATCT CTTTGTTCAGCTCTCTGTTTCTATAAATATGTACCAGTTTTATTGI I I I lAGTGGTA GTGATTTTATTCTCTTTCTATATATATACACACACATGTGTGCATTCATAAATATAT ACAATTTTTATGAATAAAAAATTATTAGCAATCAATATTGAAAACCACTGATTTTTG TTTATGTGAGCAAACAGCAGATTAAAAGGAATTCCTGCAGGATCCTTAATTAAGT TCTAGATCACAAGTTTGTACAAAAAAGCTGAACGAGAAACGTAAAATGATATAAA TATCAATATATTAAATTAGATTTTGCATAAAAAACAGACTACATAATACTGTAAAAC ACAACATATCCAGTCACTATGGCGGCCGCATTAGGCACCCCAGGCTTTACACTT TATGCTTCCGGCTCGTATAATGTGTGGATTTTGAGTTAGGATCCGTCGAGATTTT CAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTG ATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCA ATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTA AAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGA TGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATAT GGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTC ATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTGTACACATATATTCG CAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATT GAGAATATGI I I I ICGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATT TAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATA TTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGC CGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGC GATGAGTGGGAGGGCGGGGCGTAAACGCGTGGATCCGGCTTACTAAAAGCCAG ATAACAGTATGCGTATTTGCGCGCTGATTTTTGGGGTATAAGAATATATACTGAT ATGTATACCCGAAGTATGTCAAAAAGAGGTATGCTATGAAGCAGCGTATTACAGT GACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATGATGTCAATATCT CCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTGTGCGTGCGGAA CGCTGGAAAGCGGAAAATCAGGAAGGGATGGCTGAGGTCGCCCGGTTTATTGA AATGAACGGCTCTTTTGCTGACGAGAACAGGGGCTGGTGAAATGCAGTTTAAGG TTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGA TATTATTGACACGCCCGGGCGACGGATGGTGATGCCCCTGGCCAGTGCACGTC TGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGGATG AAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTCTCCGTTATC GGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCATT AACCTGATGTTCTGGGGAATATAAATGTCAGGCTCCCTTATACACAGCCAGTCTG CAGGTCGACCATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTT TTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTC AGCTTTCTTGTACAAAGTGGTGATCTAGACTAGAGTCATCAGTCAATATGTTCAC CCCAAAAAAGCTGTTTGTTAACTTGTCAACCTCATTCTAAAATGTATATAGAAGCC CAAAAGACAATAACAAAAATATTCTTGTAGAACAAAATGGGAAAGAATGTTCCAC TAAATATCAAGATTTAGAGCAAAGCATGAGATGTGTGGGGATAGACAGTGAGGC TGATAAAATAGAGTAGAGCTCAGAAACAGACCCATTGATATATGTAAGTGACCTA TGAAAAAAATATGGCATTTTACAATGGGAAAATGATGATCI I I I ICI I I I I lAGAA AAACAGGGAAATATATTTATATGTAAAAAATAAAAGGGAACCCATATGTCATACCA TACACACAAAAAAATTCCAGTGAATTATAAGTCTAAATGGAGAAGGCAAAACTTT AAATCTTTTAGAAAATAATATAGAAGCATGCCATCAAGACTTCAGTGTAGAGAAA AATTTCTTATGACTCAAAGTCCTAACCACAAAGAAAAGATTGTTAATTAGATTGCA TGAATATTAAGACTTATTTTTAAAATTAAAAAACCATTAAGAAAAGTCAGGCCATA GAATGACAGAAAATATTTGCAACACCCCAGTAAAGAGAATTGTAATATGCAGATT ATAAAAAGAAGTCTTACAAATCAGTAAAAAATAAAACTAGACAAAAATTTGAACAG ATGAAAGAGAAACTCTAAATAATCATTACACATGAGAAACTCAATCTCAGAAATCA GAGAACTATCATTGCATATACACTAAATTAGAGAAATATTAAAAGGCTAAGTAACA TCTGTGGCTTAATTAAAACAGTAGGATGACTGTTTAAACCTGCAGGCATGCAAGC TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAA TTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAAT GAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGG GAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGC GGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCG GTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTT ATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCC GCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCG CTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTC GGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTA GGTCGTTCGCTCCAAGCTGGGCTGTGTGCAGGAACCCCCCGTTCAGCCCGACC GCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCGGGTAAGACACGACT TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTA GGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA ACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTT GGTAGCTCTTGATCCGGCAAACAAAGCACCGCTGGTAGCGGTGGI I I I I I IGTT TGCAAGCAGGAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATC TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATnTG GTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAG TTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCT TAATCAGTGAGGGACCTATGTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGC CTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCC CAGTGCTGCAATGATACCGCGAGACGCACGCTCACCGGCTCCAGATTTATCAGC AATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTAT CCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGC CAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCAC GCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCGCAACGATCAAGGCGAG TTACATGATCGCCCATGTTGTGCAAAAAAGCGGTTAGCTGCTTCGGTCCTCCGAT CGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATGACTCATGGTTATGGCAGCACT GCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAG TACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGC CCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGGTG ATCATTGGAAAACGTTCTTGGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTG AGATCCAGTTGGATGTAAGGCACTCGTGCAGCCAACTGATCTTCAGCATCTTTTA CTTTGACCAGGGTTTCTGGGTGAGGAAAAAGAGGAAGGCAAAATGCCGCAAAAA AGGGAATAAGGGCGACAGGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATA TTATTGAAGGATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTA TTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCGCCGAAAAGTGCGAC CTGACGTCTAAGAAACCATTATTATGATGACATTAACGTATAAAAATAGGCGTATG ACGAGGCCCTTTCGTC II. Transgene components A. CREs: Two different 6XCRE elements were used in the generation of the transgenes. The first is a synthetic CRE element (noted as "synthetic") which was synthetically generated at DNA2.0, MenIo Park, CA. The synthetic sequence has attL1 and attR5 sites for 4-fragment Gateway cloning. Multiple attempts were made to PCR clone out the 6X CRE from different vectors; however this was not possible due to a hairpin structure in the middle of the CREs. This fragment was then cloned synthetically. The second 6X CRE element used is a hybrid version generated by PCR cloning the CRE elements from a Clontech vector (Mountainview, CA, cat#PT3336-5). Clontech claims that there are 2x CREs in the vector but sequence analysis indicated that there were actually three present. Two different PCR reactions were used to clone the fragment. Att sites for Gateway cloning as well as an EcoR1 site were introduced in the primers to enable the two fragments to be "glued" together and then recombined into the Invitrogen Gateway pDONR P1-P5r vector (Carlsbad, CA, cat #12537-100). 1. Synthetic CRE element SEQ ID NO: 6: 5'AAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATT GATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTTA CTGTCGACAATTGCGTCATACTGTGACGTCTTTCAGACACCCCATTGACG TCAATGGGATTGACGTCAATGGGGTGTCTGAAAGACGTCACAGTATGACC CGGGCTCGAGCCTCCTTGGCTGACGTCAGAGAGAGAGGCCGGCCCCTT ACGTCAGAGGCGAGAATTCGACAACTTTGTATACAAAAGTTGAACGAGAA ACGTAAAATGATATAAATATCAATATATTAAATTAGATTTTGCATAAAAAAC AGACTACATAATACTGTAAAACACAACATATCCAGTCACTATG3' 2. Hybrid CRE: Standard cloning, PCR amplified the CRE element from the Clontech pCreLuc vector which contains 3XCREs, PCR primers have an EcoR1 restriction site at one end (CRE3X-B, CRE3X-C), and an att site, either attBI or attBSr for Gateway cloning at the other end (CRE3X-A, CRE3X-D). The two fragments were then combined to create one fragment with 6XCREs. The fragment gets recombined into the Gateway pDONR P1-P5r vector. SEQ ID NO: 7: CRE fonward primer A 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGCACCAGACAGTGA-3' SEQ ID NO: 8: CRE reverse primer B 5'-GGGAATTCGTTCTCCCATTGACGTCA-3' SEQ ID NO: 9: CRE forward primer C 5'-GGGAATTCGCACCAGACAGTGACGTC-3' SEQ ID NO: 10: CRE reverse primer D 5'-GGGGACAACTTTTGTATACAAAGTTGTGTTCTCCCATTGACGTCA-3' SEQ ID NO: 11: Hybrid CRE sequence: GCTTAGCACCAGACAGTGACGTCAGCTGCCAGATCCCATGGCCGTCATA CTGTGACGTCTTTCAGACACCCCATTGACGTCAATGGGAGAACGAATTCG CACCAGACAGTGACGTCAGCTGCCAGATCCCATGGCCGTCATACTGTGA CGTCTTTCAGACACCCCATTGACGTCAATGGGAGAACA B. Human Growth Hormone Poly A Tail: Human growth hormone poly A tail was PCR cloned from the vector pOGH (Nichols Institute Diagnostics (San Juan Capistrano.CA, Cat # 40-2205). Primer sequences have an attB3 site on the forward primer and an attB2 site on the reverse primer for recombination into the Gateway pDONR P3-P2 vector. SEQ ID NO: 12: hGH forward primer: 5'-GGGGACAACTTTGTATAATAAAGTTGGATCCCAAGGCCCAACTCC-3' SEQ ID NO: 13: hGH reverse primer 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTACAACAGGCATCTACT-3' C. HSV TK Minimal Promoter: HSV TK Minimal Promoter was PCR cloned from an in house vector called "661 CreLuc". Primer sequences have an attB5 site on the forward primer and an attB4 site on the reverse primer for recombination into the Gateway pDONR P5-P4 vector. SEQ ID NO: 14: TK forward primer 5'- GGGGACAACTTTGTATACAAAAGTTGTGGAACACGCAGATGCAGT-3' SEQ ID NO: 15: TK reverse primer 5'- GGGACAACTTTGTATAGAAAAGTTGGGTGGATCTGCGGCACGCT-3' D. Luciferase cDNA: Luciferase cDNA was PCR cloned from the vector pGL4.10 (Promega Madison, Wl Cat #E6651). Luc primer sequences have an attB4r site on the fonrt/ard primer and an attB3r site on the reverse primer for recombination into the Gateway pDONR P4r-P3r vector. SEQ ID NO: 16: luci forward primer 5'GGGGACAACTTTTCTATACAAAGTTGATGGAAGATGCCAAAAACA3' SEQ ID NO: 17: luci reverse primer 5'GGGGACAACTTTATTATACAAAGTTGTTTACACGGCGATCTTGCC3' III. Final Vector Construction The four components of the transgene, CRE (either synthetic or hybrid version), HSVTK min, luciferase cDNA, and the hGH poly A tail in the pDONR vectors were recombined with the pDest2XMARs destination vector according to the standard Invitrogen protocol. The two transgenes were then sequenced, and transfected into CH0K1 to test for function. Both transgenes are functional in vitro as shown in Figure 5. Figure 5 shows the in vitro analysis of CreLuc vectors by forsl