Sign In to Follow Application
View All Documents & Correspondence

Transgenic Plants

Abstract: The invention relates to transgenic plants with improved growth and nitrogen use efficiency expressing nitrate transporter gene methods of making such plants and methods for improving growth and nitrogen use efficiency.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
25 August 2015
Publication Number
04/2016
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2021-11-30
Renewal Date

Applicants

PLANT BIOSCIENCE LIMITED
Norwich Research Park Colney Lane Norwich Norfolk NR4 7UH
NANJING AGRICULTURAL UNIVERSITY
1 Weigang Street Nanjing City Jiangsu 210095

Inventors

1. XU Guohua
c/o Nanjing Agricultural University 1 Weigang Street Nanjing City Jiangsu 210095
2. FAN Xiaorong
c/o Nanjing Agricultural University 1 Weigang Street Nanjing City Jiangsu 210095
3. SHEN Qirong
c/o Nanjing Agricultural University 1 Weigang Street Nanjing City Jiangsu 210095
4. MILLER Anthony
Department of Metabolic Biology John Innes Centre Norwich Research Park Norwich Norfolk NR4 7UH

Claims

1. A method for increasing growth, yield, nitrogen use efficiency, nitrogen transport, nitrogen stress tolerance, pathogen resistance, survival and/or nitrogen acquisition of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1, said plant is not rice.

2. A method according to claim 1 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.

3. A method according to claim 2 wherein said constitutive or strong promoter is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1 .

4. A method according to claim 1 wherein said regulatory sequence is a phloem specific promoter.

5. A method according to claim 4 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.

6. A method for making a transgenic plant having increased growth, yield, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use efficiency comprising a) introducing and expressing in a plant or plant cell a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence wherein if the nucleic acid sequence is as defined in SEQ ID No. 1, said plant is not rice.

7. A method according to any of claims 1 to 6 wherein said plant is a crop plant or a biofuel plant.

8. A method according to claim 7 wherein said crop plant is selected from maize, wheat, tobacco, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.

9. A plant obtained or obtainable from a method as defined in any of claims 6 to 8.

10. A transgenic plant expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence if the nucleic acid sequence is as defined in SEQ ID No. 1, said plant is not rice. 11.A plant according to claim 9 or 10 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.

12. A plant according to claim 11 wherein said constitutive promoter or strong is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1.

13. A plant according to any of claims 9 or 10 wherein said regulatory sequence is a phloem specific promoter.

14. A plant according to claim 13 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.

15. A plant according to any of claims 9 to 14 wherein said plant is a crop plant a biofuel plant.

16. A plant according to claim 15 wherein said crop plant is selected from maize, wheat, oilseed rape, tobacco, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.

17. A method for regulating pH homeostasis comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant.

18. A method for reducing acidification in a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant.

19. A method for altering nitrate transport and pH homeostasis in a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant wherein said nucleic acid comprises a mutation in the pH sensing motif VYEAIHKI (SEQ ID No. 16).

20. The use of a nucleic acid with homology to SEQ ID No. 1, a functional variant or homolog thereof comprising the pH sensing motif VYEAIHKI (SEQ ID No. 16) in regulating pH in altering nitrate transport and pH homeostasis in a plant. 21.A method for increasing growth, yield, nitrogen use efficiency, nitrogen transport, pathogen resistance, survival, nitrogen stress tolerance and/or nitrogen acquisition of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.

22. A method for making a transgenic plant having increased growth, yield, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use efficiency comprising a) introducing and expressing in a plant or plant cell a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.

23. A method according to any of claims 21 to 22 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.

24. A method according to claim 23 wherein said constitutive or strong promoter is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1 .

25. A method according to any of claims 21 to 22 wherein said regulatory sequence is a phloem specific promoter.

26. A method according to claim 25 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.

27. A method according to any of claims 21 to 26 wherein said plant is a crop plant or a biofuel plant.

28. A method according to claim 27 wherein said crop plant is selected from maize, rice, wheat, oilseed rape, tobacco, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.

29. A method according to claim 28 wherein said crop plant is not rice.

30. A plant obtained or obtainable from a method as defined in any of claims 21 to 29.

31. A transgenic plant expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.

32. A plant according to claim 30 or 31 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.

33. A plant according to claim 32 wherein said constitutive promoter or strong is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1 .

34. A plant according to any of claims 30 to 31 wherein said regulatory sequence is a phloem specific promoter.

35. A plant according to claim 34 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.

36. A plant according to any of claims 31 to 35 wherein said plant is a crop plant or biofuel plant.

37. A plant according to claim 36 wherein said crop plant is selected from maize, rice, wheat, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.

38. A plant according to claim 37 wherein said crop plant is not rice.

39. A product derived from a plant as defined in any of claims 9 to 16 or 31 to 38.

Specification

Transgenic plants
Field of the Invention
The invention relates to transgenic plants with improved traits, for example growth and nitrogen use efficiency expressing a nitrate transporter gene, methods of making such plants and methods for improving growth and nitrogen use efficiency.
Introduction
Global crop productivity has increased markedly during the past five decades mainly due to improved crop varieties and massive inputs of chemical fertilizers, especially nitrogen (N)12. However, fertilizer N use efficiency is only about 30-50% for many crops2"4 with large proportions being lost to the environment, resulting in various detrimental impacts such as the degradation of air and water quality and losses of biodiversity56. It has been estimated that excess N in the environment is currently costing the European Union between €70 billion and €320 billion per year7. In China, the increase in grain production during the past 30 years has been accompanied by a dramatic decrease in the N use efficiency (NUE) from 55 to 20 kg grain per kg fertilizer N applied3. In Asia, rice provides more than 70% of the daily calories intake of the population, but with the land available for agriculture diminishing, increasing demand can only be managed by increasing productivity.
It is therefore of major importance to identify the critical steps controlling plant NUE. NUE can be defined as being the yield of grain per unit of available N in the soil (including the residual N present in the soil and the fertilizer). Thus NUE can be divided into two processes: uptake efficiency (NupE; the ability of the plant to remove N from the soil as nitrate and ammonium ions) and the utilization efficiency (NutE; the ability to use N to produce grain yield). This challenge is particularly relevant to cereals for which large amounts of N fertilizers are required to attain maximum yield and for which NUE is estimated to be far less than 50% (Hirel et al).
Nitrogen (N) is fundamental to crop development as it forms the basic component of many organic molecules, nucleic acids and proteins. N nutrition affects all levels of plant function, from metabolism to resource allocation, growth, and development. The most abundant source for N acquisition by plant roots is nitrate (N03-) in natural

aerobic soils, due to intensive nitrification of applied organic and fertilizer N. By contrast, ammonium (NH4+) is the main form of available N in flooded paddy soils due to the anaerobic soil conditions (Sasakawa and Yamamoto, 1978).
Thus, soil inorganic nitrogen (N) is predominantly available for plants as nitrate in aerobic uplands and well-drained soils and as ammonium in poorly drained soils and flooded anaerobic paddy fields. In many plants the nitrate acquired by roots is transported to the shoots before being assimilated (Smirnoff and Stewart, 1985). By contrast, ammonium derived from nitrate reduction or directly from ammonium uptake is preferentially assimilated in the root and then transported in an organic form to the shoot (Xu et al., 2012). To cope with varied concentrations of nitrate in soils, plant roots have developed at least three nitrate uptake systems, two high-affinity transport systems (HATS) and one low-64 affinity transport system (LATS), responsible for the acquisition of nitrate (Crawford and Glass, 1998). The constitutive HATS (cHATS) and nitrate-inducible HATS (iHATS) operate to take up nitrate at low nitrate concentration in external medium with saturation in a range of 0.2-0.5 mM. In contrast, LATS functions in nitrate acquisition at higher external nitrate 68 concentration. The uptake by LATS and HATS is mediated by nitrate transporters belonging to the families of NRT1 and NRT2, respectively (Forde, 2000; Miller et al., 2007). Uptake by roots is regulated by negative feedback, linking the expression and activity of nitrate uptake to the N status of the plant (Miller et al., 2007). Several different N metabolites have been proposed to be cellular sensors of N status, including glutamine (Fan et al., 2006; Miller et al., 2008) and one model has root vacuolar nitrate as the feedback signal as these pools increase with plant N status.
Although higher plants have the capacity to utilize organic N, the major sources for N acquisition by roots are considered to be N03" and NH4. Plants vary substantially in their relative adaptations to these two sources of N. Although NH4 should be the preferred N source, since its metabolism requires less energy than that of N03", only a few species actually perform well when NH4 is provided as the only N source. Among the latter are boreal conifers, ericaceous species, some vegetable crops, and rice (Oryza sativa L.). In contrast to these species, most agricultural species develop at times severe toxicity symptoms on NH4 thus, superior growth in these species is seen on N03". However, when both N sources are provided simultaneously, growth and yield are often enhanced significantly compared with growth on either NH4 or N03" alone (Kronzucker et al., 1999).

Rice, a major crop feeding almost 50% of the world's population therefore differs from other crop plants in that it is capable of growing exclusively on NH4 as the only N source. Rice has been traditionally cultivated under flooded anaerobic soil conditions where ammonium is the main N source. However, the specialized aerenchyma cells in rice roots can transfer oxygen from the shoots to the roots and release it to the rhizosphere, where bacterial conversion of ammonium to nitrate (nitrification) can take place8. Nitrification in the waterlogged paddy rhizosphere can result in 25-40% of the total crop N being taken up in the form of nitrate, mainly through a high affinity transport system (HATS)9. The uptake of nitrate is mediated by cotransport with protons (H+) that can be extruded from the cell by plasma membrane H+-ATPases 1°. The molecular mechanisms of nitrate uptake and translocation in rice are not fully understood. Since the nitrate concentration in the rhizosphere of paddy fields is estimated to be less than 10 |iM (Kirk and Kronzucker, 2005), NRT2 family members play a major role in nitrate uptake in rice (Araki and Hasegawa, 2006; Yan et al., 201 1). In addition, rice roots have abundant aerenchyma for the transportation of oxygen into the rhizosphere, resulting in ammonium nitrification by bacteria on the root surface (Kirk, 2003; Li et al., 2008). Therefore, up to 40% of the total N taken up by rice roots grown under wetland conditions might be in the form of nitrate and the rates of uptake could be comparable with those of ammonium (Kronzucker et al., 2000; Kirk and Kronzucker, 2005).
Both electrophysiological and molecular studies have shown that nitrate uptake through both HATS and LATS is an active process mediated by proton/nitrate co-transporters (Zhou et al., 2000; Miller et al., 2007). In the Arabidopsis genome, there are at least 53 and 7 members belonging to NRT1 and NRT2 families, respectively (Miller et al., 2007; Tsay et al., 2007). Several Arabidopsis NRT1 and NRT2 family members have been characterized for their functions in nitrate uptake and long distance transport. AtNRTH (CHL1) is described as a transceptor playing multiple roles as a dual affinity nitrate transporter and a sensor of external nitrate supply concentration (Liu and Tsay, 2003; Ho et al., 2009; Gojon et al., 201 1), and auxin transport at low nitrate concentrations (Krouk et al., 2010). In contrast, AtNRT1.2 (NTL1) is a constitutively expressed low affinity nitrate transporter (Huang et al., 1999). AtNRTI .4 is a leaf petiole expressed nitrate transporter and plays a critical role in regulating leaf nitrate homeostasis and leaf development (Chiu et al., 2004). AtNRTI .5 is expressed in the root pericycle cells close to the xylem and is responsible for loading of nitrate into the xylem for root-to-shoot nitrate transport (Lin et al., 2008). AtNRTI .6 is expressed only in reproductive tissues and is involved in delivering nitrate from maternal tissue to the early developing

embryo (Almagro et al., 2008). AtNRTI .7 functions in phloem loading of nitrate to allow transport out of older leaves and into younger leaves, indicating that source-to-sink remobilization of nitrate is mediated by the phloem (Fan et al., 2009). AtNRTI .8 is expressed predominantly in xylem parenchyma cells within the vasculature and plays the role in retrieval of nitrate from the xylem sap (Li et al., 2010). AtNRTI .9 facilitates loading of nitrate into the root phloem, enhancing downward transport in roots, and its knockout increases root to shoot xylem transport of nitrate (Wang and Tsay, 201 1).
Among the 7 NRT2 family members in Arabidopsis, both AtNRT2.1 and AtNRT2.2 have been characterized as contributors to iHATS (Filleur et al., 2001). In addition, NRT2.1 transport activity requires a second accessory protein NAR2.1 (or NRT3.1) in Arabidopsis (Okamoto et al., 2006; Orsel et al., 2006; Yong et al., 2010). Knockout of AtNAR2.1 (atnar2.1 mutant) had more severe effects on both nitrate uptake at low nitrate concentrations and growth than knockout of its partner AtNRT2.1 (atnrt2.1 mutant) suggesting other functions for AtNAR2.1 (Orsel et al., 2006). Interestingly, AtNRT2.7 is expressed specifically in the vacuolar membrane of reproductive organs and controls nitrate content in seeds (Chopin et al., 2007). Recently, AtNRT2.4 has been found to be a high affinity plasma membrane nitrate transporter expressed in the epidermis of lateral roots and in or close to the shoot phloem (Kiba et al., 2012). AtNRT2.4 is involved in the uptake of N03" by the root at very low external concentration and in shoot N03" loading into the phloem and is important under N starvation (Kiba et al., 2012).
In the rice genome, five NRT2 genes have been identified (Araki and Hasegawa, 2006; Cai et al., 2008; Feng et al., 201 1). OsNRT2.1 and OsNRT2.2 share an identical coding region sequence with different 5'- and 3'-untranscribed regions (UTRs) and have high similarity to the NRT2 genes of other monocotyledons, while OsNRT2.3 and OsNRT2.4 are more closely related to Arabidopsis NRT2 genes. OsNRT2.3 mRNA is actually spliced into two gene products, OsNRT2.3a (AK1 09776) and OsNRT2.3b (AK072215), with 94.2% similarity in their putative amino acid sequences (Feng et al., 201 1, Yan et al., 201 1). OsNRT2.3a is expressed mainly in roots and this pattern is enhanced by nitrate supply, while OsNRT2.3b is expressed weakly in roots and relatively abundantly in shoots with no effect of the N form and concentration on the amount of transcript (Feng et al., 201 1, Feng 2012).
CN101392257 shows an expression analysis ofOsNRT2.3a and bin rice and Xenopus oocytes and mentions overexpression of the OsNRT2.3 gene in plants. CN101392257

does not disclose separate expression of OsNRT2.3a and OsNRT2.3b in rice nor does it show that expressing OsNRT2.3b in plants other than rice which significantly differ in the use of N sources can have beneficial effects
There is a need to provide more nutrient efficient genotypes for crop plants to ensure sustainable crop production for global food security and to reduce the costs and negative environmental effects of mineral fertiliser input, such as of air and water quality and losses of biodiversity. The present invention is aimed at addressing this need.
Summary of the Invention
The rice transporter OsNRT2.3 has two spliced forms. Some nitrate transporters require two genes for function; the second much smaller component (OsNAR2i) is required for the correct targeting of the transporter protein to the plasma membrane. One of the two spliced forms, OsNRT2.3a, requires this second component for function, while the other form, OsNRT2.3b, does not. We have demonstrated for the first time that expression of both nitrate transporters in Xenopus oocytes showed that only OsNRT2.3b had a pH-sensitive regulatory site on the cytoplasmic face of the protein. This pH sensing site was confirmed by site-directed mutagenesis ofahistidine amino acid residue (H167R) in the pH sensing motif. In rice, OsNRT2.3b was more specifically localised in the vascular tissue, particularly the phloem. We therefore suggest that the protein is specifically involved in long distance transport within the plant and that the phloem is important in whole plant pH regulation.
We have over-expressed, independently, both OsNRT2.3a/b genes and the H167R mutated form of OsNRT2.3b using strong non-specific constitutive promoters (35S and ubiquitin) in several different Chinese cultivars of rice. We have shown that only OsNRT2.3b over-expressing plants showed much improved growth and nitrogen use efficiency and the phenotype was surprising as both nitrate and ammonium uptake was increased in these OsNRT2.3b over-expressing plants. The OsNRT2.3b over-expressing plants showed less photorespiration and generally had better pH regulation (iron and phosphate contents) relative to controls or OsNRT2.3a over-expressing plants. The pH sensing motif of OsNRT2.3b is important for these effects in rice by linking the plant's pH status to nitrate supply.

We have also surprisingly shown that OsNRT2.3b is functional when transgenically expressed in plants other than rice although these plants, such as Arabidopsis, wheat and tobacco, differ fundamentally in their use of nitrogen sources.
As can be seen from the following disclosure, the invention has several aspects, in some aspects, the invention relates to methods, uses and plants where rice is specifically disclaimed. In other aspects, the invention relates to methods, uses and plants where the expression of the OsNRT2.3b nucleic acid is regulated by a phloem specific promoter. In other aspects, the invention relates to methods, uses and plants that do not transgenically express a nucleic acid sequence comprising SEQ ID No. 2 or a functional variant thereof.
Thus, in a first aspect, the invention relates to methods for increasing one or more of growth, yield, nitrogen transport, NUE, nitrogen acquisition, decreasing photorespiration, increasing intercellular C02 levels, increasing photosynthetic efficiency, pathogen resistance, survival and maintaining/improving pH homeostasis comprising introducing and expressing a nucleic acid construct comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant.
In a second aspect, the invention relates to a method for increasing one or more of growth, yield, nitrogen use efficiency, nitrogen transport, nitrogen stress tolerance, pathogen resistance, survival and/or nitrogen acquisition of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1, afunctional variant, part or homolog thereof said plant is not rice.
In a third aspect, the invention relates to a transgenic plant expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, afunctional variant, part or homolog thereof operably linked to a regulatory sequence into a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 said plant is not rice.
In another aspect, the invention relates to a method for regulating pH homeostasis comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant.

In another aspect, the invention relates to a method for reducing acidification in a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant.
In another aspect, the invention relates to a method for altering nitrate transport and pH homeostasis in a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, afunctional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein said nucleic acid comprises a mutation in the pH sensing motif VYEAIHKI (SEQ ID No. 16). In another aspect, the invention relates to a use of a nucleic acid comprising SEQ ID No. 1, a functional variant, part or homolog thereof comprising the pH sensing motif VYEAIHKI (SEQ ID No. 16) in regulating pH, altering nitrate transport and pH homeostasis in a plant.
In a further aspect, the invention relates to a method for increasing one or more of growth, yield, nitrogen use efficiency, nitrogen transport, nitrogen stress tolerance, pathogen resistance and/or nitrogen acquisition of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
In another aspect, the invention relates to a method for making a transgenic plant having increased growth, yield, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use efficiency comprising
a) introducing and expressing in a plant or plant cell a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2. In another aspect, the invention relates to a transgenic plant expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence SEQ ID No. 2.

In another aspect, the invention relates to a transgenic plant expressing a nucleic acid
construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional
variant, part or homolog thereof operably linked to a phloem specific promoter and
related methods.
The invention is further described in the following non-limiting figures.
Figures
Figure i.The Nipponbare phenotype ofOsNRT2.3a and OsNRT2.3b over-expression plants.
(a) The T2 rice plants in paddy soil at vegetative (60 days), (b) Reproductive stages (120 days), (c) RT-PCR with the specific primers . (d) Western blot with mono-antibody to identify protein expression, (e) The RNA in situ hybridization in WT and b-S6 with negative probe control, p: phloem, x: xylem; e, epidermal cells; m; mesophyll cells. Cross sections are the 5-6 cm leaf section from the tip of first leaf of plants in (a). Scale bar= 10 |irp,.
Figure 2. The field experiments of T2 OsNRT2.3b over-expression lines, (a) The growth of OsNRT2.3b over-expression lines b-U1, b-U2, b-S2 and b-S6 at different N fertilizer application rates (May- Oct. 2010, the photographs were taken on 16th Sep. 2010) at Changxing experiment station, Zhejiang University. The N application was shown in the left corner of each picture with the Chinese label given in the middle of the field, (b) The plant grain yield for "a" conditions, (c) The NUE at "a" conditions, (d) Large scale experiment, 1280 seedlings of each type transferred into paddy soil, (e) Grain yield at "d" condition, (f) The NUE for "d" conditions. NUE: nitrogen use efficiency = g-grain yield/g-applied fertilizer N. Values are mean ±S.E (n = 3). * was above bars indicating significant level (*p < 0.05) between the transgenic lines and WT at the same N fertilizer application rate estimated by ANOVA. Figure 3. The effects of OsNRT2.3b over-expression on the influx of 15N0 3 and 15NH4+ by root, xylem NO 3 and NH4+ , xylem pH, phloem pH acidification at 2.5 mM NO 3 or NH4+ condition, (a) The 15N influx rate at nitrate or ammonium, (b) xylem N03 and NH4+ at nitrate or ammonium for 24 h. (c) xylem sap pH at nitrate or ammonium, (d) phloem pH acidification in nitrate or ammonium, phloem sap was collected by EDTA-Na216. (e) Phloem pH acidification in nitrate or ammonium, phloem sap was collected by insects . Values are mean ±S.E (n = 5). * was above bars indicating significant level (*p < 0.05) between the transgenic lines and WT at the same treatment estimated by ANOVA . Bars from left to right in a-d: WT, b-U1 , b-U2, b-S2, b-S6

WO 2014/122452

PCT/GB2014/050327

9
Figure 4. The effects of OsNRT2.3b over-expression on the influx of different forms of
N at pH 4 and 6. Bars from left to right: WT, b-U1 , b-U2, b-S2, b-S6.
(a) The 15N influx in NH415N0 3supply. (b) The 15N influx in 15NH4N0 3supply. (c) The 15N
influx in 15NH415N03 supply. Values are mean ±S.E (n = 5). a, b, c letters were above
5 bars indicating significant difference (p < 0.05) between the transgenic lines and WT at
the same treatment estimated by ANOVA.
Figure 5. The functional analysis ofOsNRT2.3b in Xenopus ooctyes. (a) A double barreled pH electrode recording of cytosolic pH from an OsNRT2.3b injection oocyte, treated with 1 mM nitrate (shaded bar) and pH 8.0 saline (grey bar)
10 washing, (b) The membrane potential to 1 mM nitrate (shaded bar) for an oocyte
expressing H167R mutant of OsNRT2.3b. (c) 15N- nitrate uptake by oocytes injected with water, OsNRT2.3b mRNAs and its H167R mutant, (d) 15N- nitrate uptake by oocytes injected with water and OsNRT2.3b mRNAs at different external pH for over¬night. Values are mean ± S.E (n = 15). Cells were tested by electrophysiology to be
15 alive after incubation experiment. * was above bars indicating significant level (*p <
0.05) estimated by ANOVA.
Figure 6. Plant fresh weight (A) and root length (B) tissue nitrate accumulation (C) data for three Arabidopsis lines over-expressing OsNRT2.3b compared with wild type (wt). Bars from left to right in (C) for root/shoot: 23b. 1, 23b.2, 23b.3, WT
20 Figure 7. Comparison of tobacco plants overexpressing OsNRT2.3b and WT plants.:
phenotype analysis. Growth differences of T1 OsNRT2.3b over-expression lines in sand-filled pots. WT: Nicotiana tabacum cultivar 89, T1 generation grown for 2 months in a complete Hoagland nutrient solution with 10 mM nitrate supply. Figure 8. Comparison of tobacco plants overexpressing OsNRT2.3b and WT plants.:
25 expression analysis. A) Southern blot of OsNRT2.3b overexpression lines Kpn
1, Hindi 11 digested tobacco DNA of Tlgeneration and Hyb probe was used for hybridization Ld: marker, P: positive control, b-20 is a negative control. B) RT-PCR of OsNRT2.3b over-expression lines cDNA of T1 generation and OsNRT2.3b specific primer was used for the PCR.
30 Figure 9. Biomass and NUE of tobacco overexpressing OsNRT2.3b lines grown in
sand-filled pots WT: Nicotiana tabacum cultivar 89, T1 generation grown for 2 months
in a complete Hoagland nutrient solution with 10 mM nitrate supply.
NUE=biomass/total N application).
Figure 10. The gene structure of OsNRT2.3a/b (SEQ ID No. 2 and 1, peptide
35 OsNRT2.3a/b are SEQ ID No. 3 and 4). Analysis of the OsNRT2.3 genomic DNA

WO 2014/122452

PCT/GB2014/050327

10
sequence predicts an intron for OsNRT2.3b located between +190 bp to +280 bpfrom the ATG for translation initiation. For OsNRT2.3a the 5'-UTR is 42 bp and 249 bp 3'-UTR and for OsNRT2.3b the 5'-UTR is 223 bp and 316 bp 3'-UTR. F means the specific forward primer for OsNRT2.3b and R is the reward primer for OsNRT2.3b.
5 Figure 11. T2 OsNRT2.3b over-expression plants in the Nipponbare cultivar
background in Hainan. a:The T2 Nipponbare transgenic plants were grown in Ledong Experimental Station of Nanjing Agricultural University, Hainan Province (Dec. 2009-April 2010). The soil nutrient status before fertilizer addition was total nitrogen (N) 1.0 ±0.2 mg/g, total phosphorus (P) 0.4±0.1 mg/g, total potassium (K) 39.5±2.3 mg/g, 0.5
10 mM NaHC03 extractable P (Olsen P) 23.1 ±4.1 mg/kg, soil pH 4.4±0.5 (sampling
number was 6).The date for this picture was 28th Feb. 2010 and plants were grown for 75 days from germination at 75 kg N/ha N condition, b: plant panicle; c: panicle length; d, e: numbers of primary and second rachis; f: grain yield. Values are mean ± S.E (n = 10), * indicates significance of difference between WT and over-expression plants at 5
15 % levels with One-way ANOVA analysis. Bars from left to right: WT, a-U1 , a-U2, b-U1,
b-U2, b-S2, b-S6
Figure 12. The phenotype of OsNRT2.3b over-expression lines in the WYJ7 cultivar background, a: Pot experiment done in Nanjing 2010. The T1 lines of 396-2, 369-1 , 366-1 and 342-1 were over-expressed with OsNRT2.3b in comparison to its wild type
20 (WT: WYJ7). Seeds were germinated at 20th May and the picture was taken on 20th
Oct before harvest; b: Southern blot of T1 seedlings. Then the 396-2, 369-1 , 366-1 and 342-1 lines were renamed as 396, 369, 366 and 342 for the T2 field experiments; c: RT-PCR with primers, 26 cycles were set for this PCR. d: T2 field experiments at the Experimental Station ofZhejiang University (May 201 1-Oct. 201 1)with two application
25 levels as 110 and 220 kg N/ha. Seeds were put to germinate on 5th May 201 1, then
100 seedlings were transferred to the paddy field as 5 rows *20 plants on 5th June and arranged randomly. Fertilizers were applied as in Fig. 2. The picture was taken on 10th Oct before harvest. The soil nutrient status before fertilizer addition was: total nitrogen (N) 1.68±0.21 mg/g, total phosphorus (P) 0.48±0.18 mg/g, total potassium (K)
30 46.47±2.85 mg/g, 0.5 mM NaHC03-extractable P 38±2.1 mg/kg, soil pH 6.43±0.28 (n=
6); e and f: The grain yield and NUE. Values are mean ±S.E (n = 3), * indicates significance of difference between WT and over-expression plants at 5 % levels with One-way ANOVA analysis. Bars from left to right: WYT, 396, 369, 366, 342

WO 2014/122452

PCT/GB2014/050327

11
Figure 13. The effect of OsNRT2.3b over-expression in the YF47 cultivar background.
a: Plant growth performance of YF47 (wild type) and the transgenic plant with over-
expression of NRT2.3b (YF/NRT2.3b(0)) in field trails at Hainan Experiment Station of
Zhejiang University (Dec. 2011-April 2012). Seeds were put to germinate on 10th Dec
5 and the photograph was taken on 1st April, 15 days before the harvest; b: RT-PCR
analysis of the transcript levels of NRT2.3b in YF47 (wild type) and the transgenic
plants, c: Southern blot analysis of the transgenic plant; d: The grain yield per plant of
YF47 and the transgenic plants. Values are mean ±S.E (n = 50). The soil nutrient
status before fertilizer addition was: total nitrogen (N) 1.5±0.2 mg/g, total phosphorus
10 (P) 0.3±0.1 mg/g, total potassium (K) 3.5±0.3 mg/g, 0.5 mM NaHC0 3-extractable P
24.1 ±4.7 mg/kg, soil pH 6.45 ±0.47 (n= 9). From left to right: WYJ, 296, 269, 266, 342
Figure 14. The T5 phenotype of OsNRT2.3b over-expression lines in the Nipponbare cultivar background, a: The T5 Nipponbare transgenic plants b-S2 and b-S6 were grown in Ledong Experimental Station of Nanjing Agricultural University, Hainan
15 Province (Dec. 201 1-April 2012), 300 seeds were put to germinate on 10th Dec. 200
seedlings were transferred to the paddy field on 5th Jan. The picture was taken on the 13th April before harvest. The experimental plot size was 20 mx25 m, 60 kg P/ha and 110 kg K/ha fertilizer was applied to the paddy before transferring the rice seedlings. Two N fertilizer levels were used 110 and 220 kg N/ha to the paddy. The first N
20 fertilizer was applied as 20% of total N treatment before transplanting on 28th Dec.
Second application at 40% of total was made at 12th Jan. The final application was made at the 20th Jan. b: grain yield.
Figure 15. The F2 generation phenotype of Nipponbare (9) x b-S6 T5($).
Figure 16. The phenotype difference between OsNRT2.3b over-expression plants and
25 WT in pot experiments at late growth stage. This pot experiment was conducted as
described in Table 1 and the growth was recorded at 76 days (a); 84 days (b); 88 days (c); 98 days (d); 120 days (e) and140 days after transplant (f). The grain yield (g) total N (h) and NUtE=grain weight /total N (i) of WT, b-S2 and b-S6 were measured at 120 and 140 days, separately. Values are mean ± S.E (n = 10), * indicates significance of
30 difference between WT and over-expression plants at 5 % levels with One-way ANOVA
analysis. The pictures were taken only with WT and b-S6 because two plants were easily distinguished compared with all three plants in picture. Therefore black cloth was used as background and separated WT and b-S6 from b-S2, which was behind of the cloth in pot.

WO 2014/122452

PCT/GB2014/050327

12
Figure 17. The method for phloem sap sampling from the Brown Plant Hopper
(Nilapavata lugens). Rice seedlings were grown hydroponically in 1.25 mM NH4N03for
8 weeks and then transferred to N treatments (N: 2.5 mM N0 3"; A: 2.5 mM NH 4"). Each
plant was placed in a 250 ml flask of IRRI nutrient solution with six plants kept in the
5 insect cage at 26° C and a 16 h light period. Seven to ten brown plant hopper adults
were transferred on to each plant at the beginning of the N treatments. Rice phloem honey dew secreted by the insects was collected at 24 h, 48 h of the N treatments. Phloem sap pH was measured using a pH selective microelectrode 22; a: phloem pH in nitrate; b: phloem pH in ammonium. Values are mean ±S.E (n = 10), * indicates
10 significance of difference between WT and b-S6 at 5 % levels with One-way ANOVA
analysis.
Figure 18. The root apoplastic pH in the line b-S6 of OsNRT2.3b over-expression and WT after 72 h N treatment. Rice seedlings were grown in full nutrient solution containing 1.25 mM NH4N0 3 for 4 weeks and then transferred to N treatments (N: 2.5
15 mM N0 3"; A: 2.5 mM NH 4") for 72 h. a: the apoplastic pH of rice roots. After 72 h N
treatment, the plant root was washed by dipping into 0.2 mM CaS0 4 for one minute before placement on the agar17. An intact plant was placed on agar (0.9 g/l, containing the pH indicator (0.03 g/L bromocresol purple17). The initial pHwas 5.2-5.3 from 11:00-11:30 am, and roots were kept in darkness covered with a moist paper tissue and
20 under a 0.5x12x12 cm3 Plexiglas plate and picture was taken after 2-4 h in contact with
the pH indicator agar.; b: Agar profile showing apoplastic pH after removing the roots; c: the longer term pH change of the hydroponic growth medium during the N treatments. Figure 19. The total leaf P and Fe in T2 Nipponbare rice over-expressing OsNRT2.3b
25 gr¾wing in 1.25 mM NH4N0 3 hydroponic culture. The total P and Fe was measured by
ICP analysis. The 0.05 g dried crushed plant material powder was digested with 5 ml of 98 % H2S04 and 3 ml of 30 % hydrogen peroxide. After cooling, the digested sample was diluted to 100 ml with distilled water. The ion concentrations in the solution were measured using the ICP- OES (Perkin Elmer Optima 2000 DV). Values are mean ± S.E
30 (n = 4), * indicates significance of difference between WT and over-expression plants
at 5 % levels with One-way ANOVA analysis. Bars from left to right for P and Fe: WT, b-U1 , b-U2, b-S2, b-S6
Figure 20. The total photosynthesis, intercellular C0 2 concentration and photorespiration in plants over-expressing OsNRT2.3b compared with WT. The net
35 photosynthesis, intercellular C0 2 concentration and photorespiration were measured

WO 2014/122452

PCT/GB2014/050327

13
using using a Li-Cor 6400 infrared gas analyzer as described before41, a: total
photosynthesis was calculated by net photosynthesis times the measured leaf area; b:
intercellular C02 concentration; c: The net dark respiration (Rn) was reached during
C0 2 PIB recording at stable recording stage from 100 to 200 seconds after shutting off
5 lights, according to Supplemental Figure 4 of Kebeish etal., 200722. Values are mean ±
S.E (n = 4), * indicates significance of difference between WT and over-expression
plants at 5 % levels with One-way ANOVA analysis
Figure 21. The over-expression of OsNRT2.3b H167R mutant in Nipponbare. a: F1
generation plants of over-expression of OsNRT2.3b H167R mutant lines OvH1, OvH2
10 and WT in pot experiment (May.2012 - Sep 2012) all the planting systems were the
same as in Table 1. The photograph was taken on 10th Sep; b: grain weight. Values are
mean ± S.E (n = 60); c: RT-PCR with the same primers for OsNRT2.3b, which covers
the mutated site; d: southern blot.
Figure 22. 15N-NH4+ uptake by oocytes injected with water or OsNRT2.3b mRNA. 0.5
15 mM 15N-NH4CI (atom% 15N 98%) was added into ND96 solution and the oocytes were
incubated overnight (16 h). Values are mean ± S.E (n = 15).
Figure 23. The field design for the experiments shown in Fig. 2a and Fig. 2d. T2 field
experiments were conducted in Changxing experiment station of Zhejiang University.
For Fig. 2a the plants were transferred to the right blocks with four N application levels:
20 no nitrogen, 75 kg N/ha, 150 kg N/ha and 300 kg N/ha; For Fig. 2d, plants were
transferred to the left blocks with 75 kg N /ha supply. Each experimental block size was
20 mx30 m and 60 kg P/ha and 110 kg K/ ha fertilizer was applied to the paddy before
transferring the rice seedlings; b: the N treatments in each block; c: the plant
arrangement in Fig. 2a with the same row and plant spaces as d; d: the plant
25 arrangement in Fig. 2d. All field experiments were conducted with three replications
randomly arranged.
Figure 24. Table showing putative NRT2 nitrate transporters which have the pH-
sensing motif that was identified in OsNRT2.3b.
*best candidate for OsNRT2.3 orthologs
30 Databases for searches: Blast sequence searches from phytozome 9
http://www.phytozome.net/
Wheat database:
http://www.cerealsdb.uk.net/CerealsDB/Documents/DOC_search_reads.php
Barley database: http://webblast.ipk-gatersleben.de/barley/
35 Membrane protein anion exchanger motifs (containing pH sensor) identified using

WO 2014/122452

PCT/GB2014/050327

14
http://www.bioinf.manchester.ac.uk/cgi-bin/dbbrowser/fingerPRINTScan/FPScan fam.cgi
Figure 25. Overexpression OsNRT2.3b will enhance the phloem pH balancing. WT,
wild type rice plant; b-S6, OsNRT2.3b over expression line; H167R, OsNRT2.3b
5 H167R overexpression line. The phloem pHwas measured by pH selective electrode.
Phloem sap was harvested by the Brown Plant Hopper (Nilapavata lugens) method. Rice seedlings were grown hydroponically in 1.25 mM NH4N03 for 8 weeks and then transferred to N treatments (N: 2.5 mM N03-; A: 2.5 mM NH4+). Each plant was placed in a 250 ml flask of IRRI nutrient solution with six plants kept in the insect cage
10 at 26 0C and a 16 h light period. Seven to ten brown plant hopper adults were
transferred on to each plant at the beginning of the N treatments. Rice phloem honey dew secreted by the insects was collected at 24 h after the N treatments began. The results showed that WT and H167R line of phloem pH were same pattern at different N form however b-S6 was more near to 7 at nitrate treatment, more near neutral in both
15 N conditions.
Figure 26. Survival data for transgenic rice.
Figure 27. The biomass of wheat OsNRT2.3b transgenic lines.
Figure 28. The growth of wheat OsNRT2.3b transgenic lines in low and high N
application.
20 Detailed description
The present invention will now be further described. In the following passages, different
aspects of the invention are defined in more detail. Each aspect so defined may be
combined with any other aspect or aspects unless clearly indicated to the contrary. In
25 particular, any feature indicated as being preferred or advantageous may be combined
with any other feature or features indicated as being preferred or advantageous.
The practice of the present invention will employ, unless otherwise indicated,
conventional techniques of botany, microbiology, tissue culture, molecular biology,
30 chemistry, biochemistry and recombinant DNA technology, bioinformatics which are
within the skill of the art. Such techniques are explained fully in the literature.
As used herein, the words "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" are intended to include DNA molecules

WO 2014/122452

PCT/GB2014/050327

15
(e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), natural occurring,
mutated, synthetic DNA or RNA molecules, and analogs of the DNA or RNA generated
using nucleotide analogs. It can be single-stranded or double-stranded. Such nucleic
acids or polynucleotides include, but are not limited to, coding sequences of structural
5 genes, anti-sense sequences, and non-coding regulatory sequences that do not
encode mRNAs or protein products. These terms also encompass a gene. The term
"gene" or "gene sequence" is used broadly to refer to a DNA nucleic acid associated
with a biological function. Thus, genes may include introns and exons as in the
genomic sequence, or may comprise only a coding sequence as in cDNAs, and/or may
10 include cDNAs in combination with regulatory sequences.
The terms "polypeptide" and "protein" are used interchangeably herein and refer to amino acids in a polymeric form of any length, linked together by peptide bonds.
15 For the purposes of the invention, "transgenic", "transgene" or "recombinant" means
with regard to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all those constructions brought about by recombinant methods in which
20 either
(a) the nucleic acid sequences encoding proteins useful in the methods of the invention, or
(b) genetic control sequence(s) which is operably linked with the nucleic acid sequence according to the invention, for example a promoter, or
25 (c) a) and b)
are not located in their natural genetic environment or have been modified by recombinant methods, it being possible for the modification to take the form of, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. The natural genetic environment is understood as meaning the
30 natural genomic or chromosomal locus in the original plant or the presence in a
genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most
35 preferably at least 5000 bp. A naturally occurring expression cassette - for example the

WO 2014/122452

PCT/GB2014/050327

16
naturally occurring combination of the natural promoter of the nucleic acid sequences
with the corresponding nucleic acid sequence encoding a polypeptide useful in the
methods of the present invention, as defined above - becomes a transgenic
expression cassette when this expression cassette is modified by non-natural,
5 synthetic ("artificial") methods such as, for example, mutagenic treatment. Suitable
methods are described, for example, in US 5,565,350 or WO 00/15815 both incorporated by reference.
A transgenic plant for the purposes of the invention is thus understood as meaning, as
10 above, that the nucleic acids used in the method of the invention are not at their natural
locus in the genome of said plant, it being possible for the nucleic acids to be
expressed homologously or heterologously. However, as mentioned, transgenic also
means that, while the nucleic acids according to the different embodiments of the
invention are at their natural position in the genome of a plant, the sequence has been
15 modified with regard to the natural sequence, and/or that the regulatory sequences of
the natural sequences have been modified. Transgenic is preferably understood as
meaning the expression of the nucleic acids according to the invention at an unnatural
locus in the genome, i.e. homologous or, preferably, heterologous expression of the
nucleic acids takes place.
20
The aspects of the invention involve recombination DNA technology and exclude embodiments that are solely based on generating plants by traditional breeding methods.
25 The OsNRT2.3b peptide expressed according to the aspects of the invention is shown
in SEQ ID No. 3. According to the aspects of the invention, nucleic acid sequence SEQ ID No. 1 (OsNRT2.3b) encodes polypeptide SEQ ID No. 3 (OsNRT2.3b). Nucleic acid sequence SEQ ID No. 2 {OsNRT2.3a) encodes polypeptide SEQ ID No. 4 (OsNRT2.3a). Constructs that comprise SEQ ID No. 67 which corresponds to
30 accession No. AK072215 of OsNRT2.3b according to all embodiments and aspects of
the invention. When referring to a nucleic acid encoding to OsNRT2.3a, this also refers to accession No. AK0109776 of OsNRT2.3a as shown in SEQ ID No. 68 according to all embodiments and aspects of the invention.
The inventors have demonstrated that over-expressing OsNRT2.3b in different rice
35 cultivars increased grain yield by up to 40% and improved NUE under both low and

WO 2014/122452

PCT/GB2014/050327

17
high N inputs in extensive field trials. Photorespiratory gene expression was decreased
in rice over-expressing OsNRT2.3b showing that improved photosynthetic efficiency is
a component of the enhanced yield phenotype. Interestingly, the OsNRT2.3b over-
expression lines, which were confirmed at both transcript and protein levels (Fig. 1c, d),
5 showed more growth compared with wild type (WT) (Fig. 1a, b, Fig. 11). The biomass
and panicle size of over-expression lines was greater than WT (Fig. 11, Table 2-3). The
primary and second rachis size was increased, therefore the total number of seeds per
panicle was greater than WT (Fig. 11, Table 2). By contrast, the OsNRT2.3a over-
expression plants did not show visible difference from WT even though OsNRT2.3a
10 mRNA and protein was increased in the transformed lines (Fig. 1c, d, Fig. 11).
Over-expressing OsNRT2.3b also improved pH homeostasis that resulted in increased total N uptake, shoot P and Fe accumulation. These results demonstrate that linking N uptake to pH homeostasis and photosynthesis is a key consideration for improving NUE and yield.
15 Thus, the inventors have demonstrated that OsNRT2.3b, but not OsNRT2.3a, can be
used to improve growth, yield and nitrogen use efficiency and other traits when expressed in a plant. Accordingly, in some aspects, the invention relates to transgenic plants plants expressing a nucleic acid sequence comprising a nucleic acid as defined as defined in SEQ ID No. 1 (OsNRT2.3b), afunctional variant, part or homolog thereof,
20 but wherein said plant does not express a nucleic acid sequence comprising a nucleic
acid as defined as defined in SEQ ID No. 2 (OsNRT2.3a) and related methods and uses. In particular, the invention therefore relates to methods for increasing growth, yield, nitrogen transport, pathogen resistance, NUE and/or nitrogen acquisition comprising introducing and expressing a nucleic acid construct comprising a nucleic
25 acid sequence as defined in SEQ ID No. 1 (OsNRT2.3b) operably linked to a regulatory
sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2 (OsNRT2.3a).
The invention has a further aspect. As mentioned above, rice differs from all other
30 major crop in its nitrogen metabolism. Surprisingly, the inventors have shown that
expression of OsNRT2.3b from rice, a plant that is, in contrast to all other major crop plants, capable of growing vigorously on NH4, is active when expressed in other plant species that use N03" as their nitrogen source. Moreover, expression of OsNRT2.3b in other plants leads to a beneficial phenotype that shows improved growth, yield and

WO 2014/122452

PCT/GB2014/050327

18
nitrogen use efficiency, not only in rice, but also other plants. Thus, OsNRT2.3b from
rice can be used in methods for improving growth, yield, pathogen resistance and
nitrogen use efficiency in plants according to the invention. For example,
overexpression of OsNRT2.3b in tobacco or in wheat increases biomass as shown in
5 the examples.
Thus, the invention also relates to a transgenic plants expressing a nucleic acid sequence comprising a nucleic acid as defined as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 or a functional
10 variant or part thereof, said plant is not rice and related methods and uses. In one
embodiment, the invention also relates to a transgenic plants expressing a nucleic acid sequence comprising a nucleic acid as defined as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein said plant is not rice. A related method is a method for increasing growth,
15 yield, NUE, nitrogen acquisition, nitrogen stress tolerance, pathogen resistance and/or
nitrogen transport of a plant comprising introducing and expressing a nucleic acid sequence comprising a nucleic acid as defined as defined in SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 or a functional
20 variant or part thereof, said plant is not rice. In a preferred embodiment, the invention
relates to a method for increasing growth, yield, NUE, nitrogen acquisition, nitrogen stress tolerance, pathogen resistance and/or nitrogen transport of a plant that is not rice comprising introducing and expressing a nucleic acid sequence comprising a nucleic acid as defined as defined in SEQ ID No. 1, a functional variant or part thereof
25 operably linked to a regulatory sequence in said plant.
In another aspect, the invention relates to a method for increasing growth, yield, NUE,
nitrogen acquisition, pathogen resistance, nitrogen stress tolerance and/or nitrogen
transport of a plant comprising introducing and expressing a nucleic acid sequence
comprising or as defined in SEQ ID No. 1, a functional variant, part or homolog thereof
30 operably linked to a regulatory sequence in a plant wherein said plant is not rice.
Thus, in one aspect, the invention relates to a method for increasing growth of a plant comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory

WO 2014/122452

PCT/GB2014/050327

19
sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 said plant is not rice.
In yet another aspect, the invention relates to a method for increasing yield of a plant
comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No.
5 1, a functional variant, part or homolog thereof operably linked to a regulatory
sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 said plant is not rice.
The term "yield" includes one or more of the following non-limitative list of features:
10 early flowering time, biomass (vegetative biomass (root and/or shoot biomass) or
seed/grain biomass), seed/grain yield, seed/grain viability and germination efficiency,
seed/grain size, starch content of grain, early vigour, greenness index, increased
growth rate, delayed senescence of green tissue. The term "yield" in general means a
measurable produce of economic value, typically related to a specified crop, to an area,
15 and to a period of time. Individual plant parts directly contribute to yield based on their
number, size and/or weight. The actual yield is the yield per square meter for a crop and year, which is determined by dividing total production (includes both harvested and appraised production) by planted square metres.
20 Thus, according to the invention, yield comprises one or more of and can be measured
by assessing one or more of: increased seed yield per plant, increased seed filling rate, increased number of filled seeds, increased harvest index, increased viability/germination efficiency, increased number or size of seeds/capsules/pods/grain, increased growth or increased branching, for example inflorescences with more
25 branches, increased biomass or grain fill. Preferably, increased yield comprises an
increased number of grain/seed/capsules/pods, increased biomass, increased growth, increased number of floral organs and/or floral increased branching. Yield is increased relative to a control plant.
30 For example, the yield is increased by 2%, 3%, 4%, 5%-50% or more compared to a
control plant, for example by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50%.
In another aspect, the invention relates to a method for increasing NUE of a plant comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No.

WO 2014/122452

PCT/GB2014/050327

20
1, a functional variant, part or homolog thereof operably linked to a regulatory
sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1
said plant is not rice. In another aspect, the invention relates to a method for increasing
NUE of a plant comprising introducing and expressing a nucleic acid sequence
5 comprising SEQ ID No. 1, afunctional variant, part or homolog thereof operably linked
to a regulatory sequence in a plant wherein said plant is not rice.
In one embodiment, the method improves NUE under high N input. In another embodiment, the method improves NUE under low N input.
NUE can be defined as being the yield of grain per unit of available N in the soil
10 (including the residual N present in the soil and the fertilizer). The overall N use
efficiency of plants comprises both uptake and utilization efficiencies and can be calculated as UpE.
For example, the NUE is increased by 5%-50% or more compared to a control plant, for example by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50%.
15 In another aspect, the invention relates to a method for increasing nitrogen acquisition
of a plant comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 said plant is not rice. In another aspect, the invention relates to a method
20 for increasing nitrogen acquisition of a plant comprising introducing and expressing a
nucleic acid sequence comprising SEQ ID No. 1, afunctional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein said plant is not rice.
For example, the nitrogen acquisition is increased by 10%-50% or more compared to a
25 control plant, for example by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or
50%.
In one embodiment of the various methods described herein for increasing NUE, growth, yield, nitrogen acquisition and/or nitrate transport, said traits are increased under stress conditions, for example nitrogen stress.
30 In another aspect, the invention relates to a method for increasing nitrogen stress
tolerance of a plant comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No. 1, afunctional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in

WO 2014/122452

PCT/GB2014/050327

21
SEQ ID No. 1 said plant is not rice. In another aspect, the invention relates to a method
for increasing nitrogen stress tolerance of a plant comprising introducing and
expressing a nucleic acid sequence comprising SEQ ID No. 1, afunctional variant, part
or homolog thereof operably linked to a regulatory sequence in a plant wherein said
5 plant is not rice.
In another aspect, the invention relates to a method for increasing nitrogen transport of
a plant comprising introducing and expressing a nucleic acid sequence comprising
SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a
regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in
10 SEQ ID No. 1 said plant is not rice. In another aspect, the invention relates to a method
for increasing nitrogen transport of a plant comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No. 1, afunctional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein said plant is not rice.
15
In another aspect, the invention relates to a method for increasing pathogen resistance
and/or survival of a plant comprising introducing and expressing a nucleic acid
sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof
operably linked to a regulatory sequence in a plant wherein if the nucleic acid
20 sequence is as defined in SEQ ID No. 1 said plant is not rice. In another aspect, the
invention relates to a method for increasing pathogen resistance and/or survival of a plant comprising introducing and expressing a nucleic acid sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence in a plant wherein said plant is not rice.
25 The pathogen can for example be Fusarium wilt. Other pathogens known to the skilled
persons are also within the scope of the invention.
The terms "regulatory element", "regulatory sequence", "control sequence" and
"promoter" are all used interchangeably herein and are to be taken in a broad context
30 to refer to regulatory nucleic acid sequences capable of effecting expression of the
sequences to which they are ligated. The term "promoter" typically refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and which is involved in recognising and binding of RNA polymerase and other proteins, thereby directing transcription of an operably linked nucleic acid. Encompassed by the

WO 2014/122452

PCT/GB2014/050327

22
aforementioned terms are transcriptional regulatory sequences derived from a classical
eukaryotic genomic gene (including the TATA box which is required for accurate
transcription initiation, with or without a CCAAT box sequence) and additional
regulatory elements (i.e. upstream activating sequences, enhancers and silencers)
5 which alter gene expression in response to developmental and/or external stimuli, or in
a tissue-specific manner. Also included within the term is a transcriptional regulatory sequence of a classical prokaryotic gene, in which case it may include a -35 box sequence and/or -10 box transcriptional regulatory sequences. The term "regulatory element" also encompasses a synthetic fusion molecule or derivative that confers,
10 activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ.
Furthermore, the term "regulatory element" includes downstream transcription terminator sequences. A transcription terminator is a section of nucleic acid sequence that marks the end of a gene or operon in genomic DNA during transcription. Transcription terminator used in construct to express plant genes are well known in the
15 art.
In one embodiment, the constructs described herein have a promoter and a terminator sequence.
20 A "plant promoter" comprises regulatory elements, which mediate the expression of a
coding sequence segment in plant cells. Accordingly, a plant promoter need not be of plant origin, but may originate from viruses or micro-organisms, for example from viruses which attack plant cells. The "plant promoter" can also originate from a plant cell, e.g. from the plant which is transformed with the nucleic acid sequence to be
25 expressed in the inventive process and described herein. This also applies to other
"plant" regulatory signals, such as "plant" terminators. The promoters upstream of the nucleotide sequences useful in the methods of the present invention can be modified by one or more nucleotide substitution(s), insertion(s) and/or deletion(s) without interfering with the functionality or activity of either the promoters, the open reading
30 frame (ORF) or the 3'-regulatory region such as terminators or other 3' regulatory
regions which are located away from the ORF. It is furthermore possible that the activity of the promoters is increased by modification of their sequence, or that they are replaced completely by more active promoters, even promoters from heterologous organisms. For expression in plants, the nucleic acid molecule must, as described
35 above, be linked operably to or comprise a suitable promoter which expresses the

WO 2014/122452

PCT/GB2014/050327

23
gene at the right point in time and with the required spatial expression pattern. The term "operably linked" as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest. 5
The following promoters may be selected according to the aspects of the invention. This list is not limiting.
A "constitutive promoter" refers to a promoter that is transcriptionally active during
10 most, but not necessarily all, phases of growth and development and under most
environmental conditions, in at least one cell, tissue or organ. Examples of constitutive
promoters include but are not limited to actin, HMGP, CaMV19S, GOS2, rice
cyclophilin, maize H3 histone, alfalfa H3 histone, 34S FMV, rubisco small subunit,
OCS, SAD1, SAD2, nos, V-ATPase, super promoter, G-box proteins and synthetic
15 promoters.
A "strong promoter" refers to a promoter that leads to increased or overexpression of
the gene. Examples of strong promoters include, but are not limited to, CaMV-35S,
CaMV-35Somega, Arabidopsis ubiquitin UBQ1 , rice ubiquitin, actin, or Maize alcohol
20 dehydrogenase 1 promoter (Adh-1).
In a preferred embodiment, the promoter is a constitutive promoters that is a strong
promoter and directs overexpression of the gene of interest to which it is operably
linked. Preferred promoters are CaMV-35S, CaMV-35Somega and Arabidopsis
25 ubiquitin UBQ1 .
The term "increased expression" or "overexpression" as used herein means any form of expression that is additional to the control, for example wild-type, expression level.
30 In one embodiment, the promoter is a phloem-specific promoter. Phloem-specific
expression may be important for the function of the OsNRT2.3b, as the vascular tissue is important for pH regulation and it has recently been shown that nitrate transport in the phloem occurs in plants and may be a significant route for nitrogen delivery to the shoot.
35

WO 2014/122452

PCT/GB2014/050327

24
A phloem specific promoter is, for example, from RSS1 P, derived from the rice sucrose synthase gene (corresponding to SEQ ID No. 5 or a functional variant or part thereof, see Saha et al). Other phloem-specific promoters are known in the art.
5 According to the various aspects of the invention, growth, yield, nitrogen transport,
nitrogen acquisition, nitrogen stress tolerance, pathogen resistance and/or nitrogen use
efficiency is increased compared to a control plant. A control plant is a plant which has
not been transformed with a nucleic acid construct comprising SEQ ID No. 1, a
functional variant, part or homolog thereof, preferably a wild type plant. The control
10 plant is preferably of the same species as the transgenic plant. Furthermore, the
control plant may comprise genetic modifications, including expression of other transgenes.
The terms "increase", "improve" or "enhance" as used according to the various aspects
15 of the invention are interchangeable. Growth, yield, nitrogen transport, nitrogen
acquisition, nitrogen stress tolerance and/or nitrogen use efficiency is increased by
about 5-50%, for example at least 5%, 6%, 7%, 8%, 9% or 10%, preferably at least
15% or 20%, more preferably 25%, 30%, 35%, 40%, 45% or 50% or more in
comparison to a control plant. Preferably, growth is measured by measuring hypocotyl
20 or stem length. In one embodiment, yield is increased by at least 40%.
The nucleic acid construct comprising SEQ ID No. 1, a functional variant, part or
homolog thereof may also comprise a selectable marker which facilitates the selection
of transformants, such as a marker that confers resistance to antibiotics, for example
25 kanamycin.
In another aspect, the invention relates to a method for making a transgenic plant having increased yield, growth, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance, pathogen resistance and/or nitrogen use efficiency comprising introducing
30 and expressing in a plant or plant cell a nucleic acid sequence comprising SEQ ID No.
1, a functional variant, part or homolog thereof operably linked to a regulatory sequence wherein if the nucleic acid sequence is as defined in SEQ ID No. 1 said plant is not rice. In another aspect, the invention relates to a method for making a transgenic plant having increased yield, growth, nitrogen transport, nitrogen acquisition, nitrogen
35 stress tolerance and/or nitrogen use efficiency comprising introducing and expressing

WO 2014/122452

PCT/GB2014/050327

25
in a plant or plant cell a nucleic acid sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence wherein said plant is not rice.
5 The method further comprises regenerating a transgenic plant from the plant or plant
cell after step a) wherein the transgenic plant comprises in its genome SEQ ID No. 1, a
functional variant, part or homolog thereof operably linked to a regulatory sequence
and obtaining a progeny plant derived from the transgenic plant wherein said progeny
plant exhibits increased yield, growth, nitrogen transport, nitrogen acquisition, nitrogen
10 stress tolerance and/or nitrogen use efficiency.
In one embodiment of these methods described above which explicitly exclude rice, the nucleic acid sequence comprises or consists of SEQ ID No. 1 or a functional variant or part thereof.
15
Thus, according to the various aspects of the invention, SEQ ID No. 1, a functional variant, part or homolog thereof is introduced into a plant and expressed as a transgene. The nucleic acid sequence is introduced into said plant through a process called transformation. The term "introduction" or "transformation" as referred to herein
20 encompasses the transfer of an exogenous polynucleotide into a host cell, irrespective
of the method used for transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a genetic construct of the present invention and a whole plant regenerated there from. The particular tissue chosen will vary depending on the clonal propagation systems
25 available for, and best suited to, the particular species being transformed. Exemplary
tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem). The polynucleotide may be transiently or stably
30 introduced into a host cell and may be maintained non-integrated, for example, as a
plasmid. Alternatively, it may be integrated into the host genome. The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.
35 The transfer of foreign genes into the genome of a plant is called transformation.

WO 2014/122452

PCT/GB2014/050327

26
Transformation of plants is now a routine technique in many species. Advantageously,
any of several transformation methods may be used to introduce the gene of interest
into a suitable ancestor cell. The methods described for the transformation and
regeneration of plants from plant tissues or plant cells may be utilized for transient or
5 for stable transformation. Transformation methods include the use of liposomes,
electroporation, chemicals that increase free DNA uptake, injection of the DNA directly
into the plant, particle gun bombardment, transformation using viruses or pollen and
microprojection. Methods may be selected from the calcium/polyethylene glycol
method for protoplasts, electroporation of protoplasts, microinjection into plant material,
10 DNA or RNA-coated particle bombardment, infection with (non-integrative) viruses and
the like. Transgenic plants, including transgenic crop plants, are preferably produced via Agrobacterium tumefaciens mediated transformation.
To select transformed plants, the plant material obtained in the transformation is, as a
15 rule, subjected to selective conditions so that transformed plants can be distinguished
from untransformed plants. For example, the seeds obtained in the above-described
manner can be planted and, after an initial growing period, subjected to a suitable
selection by spraying. A further possibility consists in growing the seeds, if appropriate
after sterilization, on agar plates using a suitable selection agent so that only the
20 transformed seeds can grow into plants. Alternatively, the transformed plants are
screened for the presence of a selectable marker such as the ones described above.
Following DNA transfer and regeneration, putatively transformed plants may also be
evaluated, for instance using Southern analysis, for the presence of the gene of
interest, copy number and/or genomic organisation. Alternatively or additionally,
25 expression levels of the newly introduced DNA may be monitored using Northern
and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.
The generated transformed plants may be propagated by a variety of means, such as
30 by clonal propagation or classical breeding techniques. For example, a first generation
(or T1) transformed plant may be selfed and homozygous second-generation (or T2)
transformants selected, and the T2 plants may then further be propagated through
classical breeding techniques. The generated transformed organisms may take a
variety of forms. For example, they may be chimeras of transformed cells and non-
35 transformed cells; clonal transformants (e.g., all cells transformed to contain the

WO 2014/122452

PCT/GB2014/050327

27
expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).
The various aspects of the invention described herein clearly extend to any plant cell or
5 any plant produced, obtained or obtainable by any of the methods described herein,
and to all plant parts and propagules thereof unless otherwise specified. For example, in certain aspects described above, rice is specifically excluded. Thus, the methods exclude embodiments where a nucleic acid comprising or consisting of SEQ ID No. 1 or a functional part of variant thereof are is expressed in rice. The present invention
10 extends further to encompass the progeny of a primary transformed ortransfected cell,
tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement being that progeny exhibit the same genotypic and/or phenotypic characteristic(s) as those produced by the parent in the methods according to the invention.
15
The plant of the various aspects of the invention is characterised in that it shows increased growth, yield, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use efficiency.
20 The invention also extends to harvestable parts of a plant of the invention as described
above such as, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. The invention furthermore relates to products derived, preferably directly derived, from a harvestable part of such a plant, such as dry pellets or powders, oil, fat and fatty acids, starch or proteins.
25
The invention also relates to the use of a sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof in increasing growth, yield, NUE, nitrogen acquisition, nitrogen stress tolerance, pathogen resistance and/or nitrogen transport of a plant wherein if the SEQ comprises SEQ ID No. 1, said plant is not rice. Further, the
30 invention also relates to the use of a sequence comprising SEQ ID No. 1, a functional
variant, part or homolog thereof in increasing growth, yield, NUE, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen transport of a plant wherein said plant is not rice.

WO 2014/122452

PCT/GB2014/050327

28
The invention also relates to a nucleic acid construct comprising nucleic acid sequence SEQ ID No. 1, a functional variant, part or homolog operably linked to a phloem specific promoter, for example a nucleic acid comprising SEQ ID No. 5. Further provided is the use of the construct in the methods described herein. 5
Also provided is an isolated cell, preferably a plant cell or an Agrobacterium tumefaciens cell, expressing a nucleic acid construct comprising nucleic acid sequence SEQ ID No. 1, a functional variant, part or homolog operably linked to a phloem specific promoter. In another aspect, the invention relates to an isolated cell, preferably
10 a plant cell or an Agrobacterium tumefaciens cell expressing a nucleic acid construct
comprising nucleic acid sequence SEQ ID No. 1, afunctional variant, part or homolog operably linked to a constitutive promoter. Furthermore, the invention also relates to a culture medium comprising an isolated plant cell or an Agrobacterium tumefaciens cell expressing a nucleic acid construct of the invention.
15
Unless rice is specifically disclaimed, the transgenic plant according to the various aspects of the invention described herein may be any monocot or a dicot plant provided for the embodiments described herein.
20 A dicot plant may be selected from the families including, but not limited to Asteraceae,
Brassicaceae (eg Brassica napus), Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae), Malvaceae, Rosaceae or Solanaceae. For example, the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage,
25 tomato, potato, yam, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa,
bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species. In one embodiment, the plant is oilseed rape.
Also included are biofuel and bioenergy crops such as rape/canola, sugar cane, sweet
30 sorghum, Panicum virgatum (switchgrass), linseed, lupin and willow, poplar, poplar
hybrids, Miscanthus orgymnosperms, such as loblolly pine. Also included are crops for
silage (maize), grazing or fodder (grasses, clover, sanfoin, alfalfa), fibres (e.g. cotton,
flax), building materials (e.g. pine, oak), pulping (e.g. poplar), feeder stocks for the
chemical industry (e.g. high erucic acid oil seed rape, linseed) and for amenity
35 purposes (e.g. turf grasses for golf courses), ornamentals for public and private

WO 2014/122452

PCT/GB2014/050327

29
gardens (e.g. snapdragon, petunia, roses, geranium, Nicotiana sp.) and plants and cut flowers for the home (African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant).
5 A monocot plant may, for example, be selected from the families Arecaceae,
Amaryllidaceae or Poaceae. For example, the plant may be a cereal crop, such as wheat, barley, maize, oat, sorghum, rye, millet, buckwheat, turf grass, Italian rye grass, sugarcane or Festuca species, or a crop such as onion, leek, yam or banana. In one embodiment of the methods and plants described above, the plant is not rice. 10
Preferably, the plant is a crop plant. By crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use.
Most preferred plants are maize, wheat, oilseed rape, sorghum, soybean, potato,
15 tobacco tomato, tobacco, grape, barley, pea, bean, field bean, lettuce, cotton, sugar
cane, sugar beet, broccoli or other vegetable brassicas or poplar.
In one embodiment, the plant is wheat. In one embodiment, the plant is tobacco. Preferably, the promoter is a phloem specific promoter as described herein.
20
The term "plant" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, fruit, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest. The term "plant" also encompasses plant cells,
25 suspension cultures, callus tissue, embryos, meristematic regions, gametophytes,
sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the gene/nucleic acid of interest.
Plants or parts thereof obtained or obtainable by the method for making a transgenic
30 plant as described above are also within the scope of the invention.
In another aspect, the invention relates to a transgenic plant expressing a nucleic acid
sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof
operably linked to a regulatory sequence into a plant wherein if the nucleic acid
35 sequence is as defined in SEQ ID No. 1 said plant is not rice. Thus, this aspect of the

WO 2014/122452

PCT/GB2014/050327

30
invention excludes transgenic rice expressing a nucleic acid comprising or consisting of SEQ ID No. 1. In one embodiment, other plants that are capable of growing on NH4 as the sole nitrogen source are also excluded.
5 In another aspect, the invention relates to a transgenic plant expressing a nucleic acid
sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a phloem specific promoter in a plant. The plant may be any monocot ordicot plant, including rice. In one embodiment, said plant is not rice
10 In another aspect, the invention relates to a transgenic plant expressing a nucleic acid
sequence comprising SEQ ID No. 1, a functional variant, part or homolog thereof operably linked to a regulatory sequence into a plant wherein said plant is not rice. In one embodiment, the transgenic plant expresses a nucleic acid sequence comprising or consisting of SEQ ID No. 1.
15
The plant is characterised in that it shows increased yield, growth, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance, pathogen resistance and/or nitrogen use efficiency.
20 The term "functional variant of a nucleic acid sequence" as used herein with reference
to SEQ ID No. 1 or another sequence refers to a variant gene sequence or part of the gene sequence which retains the biological function of the full non-variant sequence, for example confers increased growth or yield when expressed in a transgenic plant. A functional variant also comprises a variant of the gene of interest which has sequence
25 alterations that do not affect function, for example in non- conserved residues. Also
encompassed is a variant that is substantially identical, i.e. has only some sequence variations, for example in non-conserved residues, compared to the wild type sequences as shown herein and is biologically active.
30 Thus, specifically included in the scope is a functional part of a nucleic acid sequence
as used herein with reference to SEQ ID No. 1 or another sequence which retains the biological function of the full non-variant sequence, for example confers increased growth or yield when expressed in a transgenic plant.

WO 2014/122452

PCT/GB2014/050327

31
Thus, it is understood, as those skilled in the art will appreciate, that the aspects of the
invention, including the methods and uses, encompasses not only a nucleic acid
sequence comprising or consisting or SEQ ID No. 1, but also functional variants or
parts of SEQ ID No. 1 that do not affect the biological activity and function of the
5 resulting protein. Alterations in a nucleic acid sequence which result in the production
of a different amino acid at a given site that do however not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic
10 residue, such as valine, leucine, or isoleucine. Similarly, changes which result in
substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide
15 molecule would also not be expected to alter the activity of the polypeptide. Each of the
proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.
A functional variant of SEQ ID No. 1 has at least 90%, 91%, 92%, 93%, 94%, 95%,
20 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by
SEQ ID NO: 1. A functional variant of SEQ ID NO. 3 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID No: 3. A functional variant retains the pH sensing motif.
25 A functional homolog of SEQ ID No. 1 is a nucleic acid encoding a NRT2.3b peptide
which is biologically active in the same way as SEQ ID No. 1, in other words, for example it confers increased yield or growth. The term functional homolog includes OsNRT2.3b orthologs in other plant species.
30 The homolog of a OsNRT2.3b polypeptide has, in increasing order of preference, at
least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,
35 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,

WO 2014/122452

PCT/GB2014/050327

32
or 99% overall sequence identity to the amino acid represented by SEQ ID No: 3.
Preferably, overall sequence identity is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, or 99%. In another embodiment, the OsNRT2.3b nucleic acid sequence has, in
increasing order of preference, at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%,
5 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%,
48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%,
63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the nucleic acid
10 represented by SEQ ID No: 1. Preferably, overall sequence identity is 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, or 99%. The overall sequence identity is determined using a global alignment algorithm known in the art, such as the Needleman Wunsch algorithm in the program GAP (GCG Wisconsin Package, Accelrys).
15 Preferably, the OsNRT2.3b homolog/ortholog has the pH sensing motif VYEAIHKI on
the cytoplasmic side. In one embodiment, the homolog of a OsNRT2.3b polypeptide has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% overall sequence identity to the amino acid represented by SEQ ID No: 3 and comprises the pH sensing motif VYEAIHKI (SEQ ID No. 16). Functional variants or parts of the homologs, for
20 examples as shown in SEQ ID No. 6-15, are also included in the scope of the
invention.
Figure 24 shows examples of homologs/orthologs which have the pH sensing motif identified in OsNRT2.3b. Thus, preferred orthologous genes or peptides used
25 according to the various aspects of the invention are selected from the orthologous
listed in Figure 24, including barley, maize, soybean, Brachypodium (SEQ ID Nos. 6-15) and wheat. Variants of these sequences that have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to the sequences listed in SEQ ID NO. 6-15 are also within the scope of the invention.
30
Suitable homologs or orthologs can be identified by sequence comparisons and identifications of conserved domains. The function of the homolog or ortholog can be identified as described herein and a skilled person would thus be able to confirm the function when expressed in a plant.
35

WO 2014/122452

PCT/GB2014/050327

33
For example, according to the various aspects of the invention, a nucleic acid encoding
an endogenous NRT2.3 peptide may be expressed in any plant as defined herein
unless otherwise specified by recombinant methods. As described above, in certain
aspects of the invention, in particular when the nucleic acid construct comprises or
5 consists of SEQ ID No. 1, the plant is not rice. For example, rice OsNRT2.3b may be
expressed in rice and a wheat NRT2.3b may be expressed in wheat.
In another embodiment, a nucleic acid encoding a plant NRT2.3b that is endogenous to
a first plant species may be expressed in a second plant using recombinant methods.
10 For example, a OsNRT2.3b homolog from another plant may be expressed in rice.
In one preferred embodiment of the various aspects of the invention, OsNRT2.3b
comprising SEQ ID No. 1 or a functional variant thereof is expressed in another plant
that is not rice. As the inventors have surprisingly shown, expression of OsNRT2.3b
does lead to beneficial phenotypes in other plants that use a different N source. For
15 example, expression may be in a monocot or dicot plant as described herein. In one
embodiment, the plant is wheat or tobacco.
Thus, the invention specifically relates to a method for increasing one or more of growth, yield, nitrogen transport, NUE, nitrogen acquisition, decreasing photorespiration, increasing intercellular C0 2 levels, increasing photosynthetic
20 efficiency, pathogen resistance and maintaining/improving pH homeostasis comprising
introducing and expressing a nucleic acid sequence comprising SEQ ID No. 1, or a functional variant thereof in another plant that is not rice. Transgenic non-rice plants expressing a nucleic acid sequence comprising SEQ ID No. 1, or a functional variant, part thereof are also encompassed in the scope of the invention, for example wheat or
25 tobacco.
Plants and their endogenous NRT2.3b may be selected from any plant, such as from one of the families or species listed herein.
Arabidopsis does not have a close relative to OsNRT2.3, the closest is AtNRT2.5, but
30 this does not have a similar pH-sensing motif. A key aspect of the improved NUE
associated with OsNRT2.3b is pH sensitivity of the nitrate transport function. The cytoplasmic pH sensing motif in OsNRT2.3b, that is absent from OsNRT2.3a, provides a link between nitrogen nutrition and pH regulation. The presence of a pH sensing motif is therefore important for homologs/orthologs in other species.

WO 2014/122452

PCT/GB2014/050327

34
Homologs/orthologs of OsNRT2.3b can therefore be identified by the presence of a
cytoplasmic pH sensing motif. In one aspect, the invention relates to a method for
identifying OsNRT2.3b homologs/orthologs in other species comprising identifying
5 peptides which comprise the cytoplasmic pH sensing motif.
As explained in the examples, when over-expressing OsNRT2.3b in rice, xylem pH was 7 and 7.3 in WT treated respectively with nitrate and ammonium, while it was 7.5 and 7.6-7.8 in the OsNRT2.3b over-expressing lines, significantly higher than WT. After 24h
10 N treatments, phloem sap was collected. The phloem sap pH was measured and less
acidification was found in OsNRT2.3b over-expression lines. The difference between WT and over-expression lines was about 0.2 pH units in nitrate and about 0.1 pH units in ammonium. WT phloem pH decreased from 7.8 to 6.1 and b-S6 from 6.7 to 6.0 in nitrate supply from 24 to 48 h treatments; while in ammonium treatment WT phloem pH
15 decreased from 7.4 to 6.3 and b-S6 from 6.6 to 5.9 from 24 to 48 h. The difference
between WT and b-S6 under nitrate supply was remarkably high at 24 h, however no significant difference was found by 48 h. In ammonium supply, although the pH in WT sap was higher than in b-S6 the difference was not significant. The acidification of WT phloem pH in nitrate was about 1.7 pH units however it was only 0.7 of a pH unit in the
20 b-S6 plants. By 48 h the collected phloem pH sap had adjusted to give more similar
values for WT and b-S6 plants (Fig. 17b). Furthermore the root apoplastic pH in WT and b-S6 roots was tested with bromocresol purple indicator17 after 72 h of differing N treatments. Overexpressing line b-S6 showed alkalinization in nitrate and acidification in ammonium relative to WT, while the pH in hydroponic medium did not show a
25 significant difference between WT and b-S6 over the same time scale (Fig. 18c) as the
bulk solution was large enough to buffer any pH changes occurring at the root surface.
The N supply form for plants is well known for influencing plant pH balance24. The assimilation of ammonium produces at least one H+per NH4+; while N03" assimilation produces almost one OH" per N03" 4. Either H+ or OH" produced in excess of that
30 required to maintain cytoplasmic pH are exported from the cell in an energy requiring
step (e.g. plasma membrane H+ pumping ATPase)410. We compared the pH of phloem sap from N-starved rice plants resupplied with nitrate or ammonium. Nitrate and ammonium supply acidified the phloem pH of WT and transgenic plants (Fig. 3d, e). Interestingly, the phloem acidification was significantly lower in the four transgenic lines
35 when compared with WT (Fig. 3d, e) although no significant difference in nitrate

WO 2014/122452

PCT/GB2014/050327

35
concentration could be detected in phloem (data not shown). These data show that
transgenic plants are better able to regulate phloem pH. Furthermore the phloem pH
difference between WT and transgenics (Fig. 17a, b) could explain the enhanced P and
Fe accumulation in leaves of the OsNRT2.3b over-expressing plants (Fig. 19). The
5 more acidic phloem sap (Fig. 17) will benefit P and Fe translocation to the leaf25.
Together with enhanced N acquisition this was also an important factor for the plant growth and yield increase.
It has been reported that cytosolic pH acidification inactivated transport of aquaporin in
oocytes26. Furthermore as nitrate assimilation depends on photorespi ration27, the
10 relationship428 between the assimilation of nitrate, ammonium and photorespiration is
closely coupled to the shuttling of malate between the cytoplasm and chloroplast to balance pH29.
In plants, the regulation of pH is a requirement that arises for a variety of reasons. The most basic reason is that water spontaneously ionizes with the consequence that
15 protons cannot be removed entirely from a given solution. Unlike other ions, protons
can be consumed or are produced in certain chemical reactions, with the result that the kind of nutrition determines to what extent protons may become a problem, or even a hazard, to the organism. The exact regulatory determinants and causalities are difficult to analyse (at a given moment) for any situation because pH influences a great variety
20 of processes in a plant tissues and cells and intracellular compartments, and at the
same time H+ activity may be changed by the same processes. The ability to reverse a pH perturbation, as well as the extent and the velocity at which this is accomplished, defines the quality of pH regulation.
The homeostatic maintenance of cytoplasmic pH is important for energizing the cellular
25 uptake and storage of nutrients and secondary metabolites because proton-coupled
transport systems mediate these cellular processes. The pH gradients between cellular
compartments and the external environment provide an energy source for these
important processes. Many key cellular processes are therefore enhanced by the
improved pH homeostasis associated with a mixed nitrate and ammonium nitrogen
30 supply.
We have shown that the OsNRT2.3b comprises a pH sensing motif on the cytosolic side of the plasma membrane which is not present in OsNRT2.3a on the cytosolic side. The pH-sensing motif VYEAIHKI (SEQ ID No. 16) around histidine residue 167 of OsNRT2.3b which faces the cytosolic side of the plasma membrane is a characteristic

WO 2014/122452

PCT/GB2014/050327

36
of the anion exchanger family, which is found in many different organisms including
mammals and may therefore be of more general biological significance. As
demonstrated in the examples, we have shown that after a single amino acid mutation
(H167R), OsNRT2.3b lost this function of cytosolic pH regulation, even after repeated
5 cycles of nitrate treatment (Fig. 5b).
The OsNRT2.3b sensing motif regulates the cytosolic pH in the plant.
We have also shown that the pH sensing motif of OsNRT2.3b is important for these effects in rice by linking the plant's pH status to nitrate supply.
In yet another aspect, the invention therefore relates to a method for regulating pH
10 homeostasis comprising introducing and expressing a nucleic acid construct
comprising a nucleic acid sequence comprising SEQ ID No. 1 operably linked to a regulatory sequence in a plant. In one embodiment, the plant is not rice.
In a further aspect, the invention relates to a method for reducing acidification in a plant
comprising introducing and expressing a nucleic acid construct comprising a nucleic
15 acid sequence comprising SEQ ID No. 1 operably linked to a regulatory sequence in a
plant. In one aspect, the plant is not rice.
Acidification may be reduced by at least about 0.1 pH units, for example 0.1 , 0.2. 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 or more.
In a further aspect, the invention relates to a method for altering nitrate transport and
20 pH homeostasis in a plant comprising introducing and expressing a nucleic acid
construct comprising a nucleic acid sequence comprising SEQ ID No. 1 operably linked to a regulatory sequence in a plant wherein said nucleic acid comprises a mutation in the pH sensing motif VYEAIHKI (SEQ ID No. 16). The mutation renders the pH sensing motif non-functional. 25
As set out elsewhere herein, the regulatory sequence may be a constitutive promoter as described herein or a tissue specific promoter. In one embodiment, the promoter is a phloem specific promoter as described herein.
30 The term plant is also defined elsewhere herein. Preferably, the plant is a crop plant.
Most preferred plants are maize, rice, wheat, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet,

WO 2014/122452

PCT/GB2014/050327

37
tobacco, broccoli or other vegetable brassicas or poplar. In one embodiment, the plant is not rice.
The invention also relates to the use of a nucleic acid comprising SEQ ID No. 1, a
functional variant, part or homolog thereof encoding SEQ ID No 3, afunctional variant,
5 part or homolog thereof comprising the pH sensing motif VYEAIHKI (SEQ ID No. 16) in
regulating pH in a transgenic plant.
In another aspect, the invention relates to a method for increasing growth of a plant
comprising introducing and expressing a nucleic acid construct comprising a nucleic
10 acid sequence as defined in SEQ ID No. 1 operably linked to a regulatory sequence
into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
15 In another aspect, the invention relates to a method for increasing nitrogen use
efficiency of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1 operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a
20 nucleic acid sequence comprising SEQ ID No. 2.
In another aspect, the invention relates to a method for improving yield of a plant
comprising introducing and expressing a nucleic acid construct comprising a nucleic
acid sequence comprising SEQ ID No. 1 operably linked to a regulatory sequence into
25 a plant wherein said regulatory sequence is a constitutive promoter or a phloem
specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
In another aspect, the invention relates to a method for increasing nitrate transport in a
30 plant comprising introducing and expressing a nucleic acid construct comprising a
nucleic acid sequence comprising SEQ ID No. 1 operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2. 35

WO 2014/122452

PCT/GB2014/050327

38
In another aspect, the invention relates to a method for increasing nitrogen acquisition
of a plant comprising introducing and expressing a nucleic acid construct comprising a
nucleic acid sequence comprising SEQ ID No. 1 operably linked to a regulatory
sequence into a plant wherein said regulatory sequence is a constitutive promoter or a
5 phloem specific promoter and wherein said plant does not overexpress a nucleic acid
sequence comprising SEQ ID No. 2.
In one embodiment of the various methods described herein for increasing NUE,
growth, yield, nitrogen acquisition and/or nitrate transport, said traits are increased
10 under stress conditions, for example nitrogen stress.
Thus, in another aspect, the invention relates to a method for conferring tolerance to
nitrogen stress to a plant comprising introducing and expressing nucleic acid construct
comprising a nucleic acid sequence comprising SEQ ID No. 1 operably linked to a
15 regulatory sequence into a plant wherein said regulatory sequence is a constitutive
promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
Thus, in another aspect, the invention relates to a method for conferring pathogen
20 resistance to a plant comprising introducing and expressing nucleic acid construct
comprising a nucleic acid sequence comprising SEQ ID No. 1 operably linked to a
regulatory sequence into a plant wherein said regulatory sequence is a constitutive
promoter or a phloem specific promoter and wherein said plant does not overexpress a
nucleic acid sequence comprising SEQ ID No. 2. If the plant is rice, then the pathogen
25 may be Fusarium wilt, Leaf blight and Stripe rust.
According to the methods above, the regulatory sequence according to the method and plants above is as described herein and may therefore be a constitutive promoter as described herein, an inducible promoter or a tissue specific promoter. In one
30 embodiment, the promoter is a phloem specific promoter as described herein. Phloem-
specific expression may be important for the function of the OsNRT2.3b, as the vascular tissue is important for pH regulation and it has recently been shown that nitrate transport in the phloem occurs in plants and may be a significant route for nitrogen delivery to the shoot.
35

WO 2014/122452

PCT/GB2014/050327

39
The term plant is also defined elsewhere herein. Preferably, the plant is a crop plant.
Most preferred plants are maize, rice, wheat, oilseed rape, sorghum, soybean, potato,
tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet,
broccoli or other vegetable brassicas or poplar. In one embodiment, the plant is not
5 rice.
In another aspect, the invention relates to a method for increasing nitrogen use, yield, NUE, nitrogen efficiency, tolerance to nitrogen stress, pathogen resistance, nitrogen acquisition and/or nitrate transport of a plant comprising introducing and expressing
10 nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a
functional part or variant thereof operably linked to a phloem specific promoter in a plant. The term plant is also defined elsewhere herein. Preferably, the plant is a crop plant. Most preferred plants are maize, rice, wheat, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar
15 beet, broccoli or other vegetable brassicas or poplar. In one embodiment, the plant is
not rice.
In another aspect, the invention relates to a method for making a transgenic plant
having increased yield, growth and/or nitrogen use efficiency comprising introducing
20 and expressing in a plant or plant cell a nucleic acid construct comprising a nucleic acid
sequence as defined in SEQ ID No. 1 operably linked to a regulatory sequence wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
25 The method further comprises regenerating a transgenic plant from the plant or plant
cell after step a) wherein the transgenic plant comprises in its genome SEQ ID No. 1 operably linked to a regulatory sequence and obtaining a progeny plant derived from the transgenic plant wherein said progeny plant exhibits increased yield, growth and/or nitrogen use efficiency. These methods are carried out as described elsewhere herein.
30
Plants or parts thereof obtained or obtainable by the method for making a transgenic plant as described above are also within the scope of the invention.

WO 2014/122452

PCT/GB2014/050327

40
In another aspect, the invention relates to a transgenic plant expressing a nucleic acid
construct comprising a nucleic acid sequence as defined in SEQ ID No. 1 operably
linked to a regulatory sequence into a plant wherein said regulatory sequence is a
constitutive promoter or a phloem specific promoter and wherein said plant does not
5 overexpress a nucleic acid sequence SEQ ID No. 2.
Plants that can be used according to these methods of the invention are specifically listed elsewhere herein but also include rice. Preferably, the plant is a crop plant or biofuel plant as defined elsewhere herein. 10
Most preferred plants are rice, maize, wheat, oilseed rape, sorghum, soybean, potato, tomato, tobacco, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
15 In one embodiment, the plant is wheat and the promoter is a phloem specific promoter
as described herein. In one embodiment, the plant is tobacco and the promoter is a phloem specific promoter as described herein.
The plant is characterised in that it shows having increased yield, growth, nitrogen
20 transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use efficiency.
Other objects and advantages of this invention will be appreciated from a review of the complete disclosure provided herein and the appended claims.
25 While the foregoing disclosure provides a general description of the subject matter
encompassed within the scope of the present invention, including methods, as well as the best mode thereof, of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will
30 appreciate that the specifics of these examples should not be read as limiting on the
invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure. The specifics of these examples should not be treated as limiting.
35

WO 2014/122452

PCT/GB2014/050327

41
All documents mentioned in this specification, including references to databases for gene or protein sequences, are incorporated herein by reference in their entirety.
"and/or" where used herein is to be taken as specific disclosure of each of the two
5 specified features or components with orwithout the other. For example "A and/or B" is
to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.
Unless context dictates otherwise, the descriptions and definitions of the features set
10 out above are not limited to any particular aspect or embodiment of the invention and
apply equally to all aspects and embodiments which are described.
Examples
The invention is further described in the following non-limiting examples 15
1. Expression of OsNRT2.3a and OsNRT2.3b in rice
Materials and methods
Over-expression vector construction and transgenic plants
20 The open reading frames of OsNRT2.3a and OsNRT2.3b were amplified by gene
specific primers. The fragment was treated with restriction enzymes and inserted in vectors and sequenced before transformation. Rice (Oryza sativa) embryonic calli were transformed using Agrobacterium-mediated methods33. One copy insertion TO plants were harvested and grown to generate T1 plants . Homozygous T1 plants were taken
25 for T2 generation. Two lines ofT2 OsNRT2.3a over-expression plants, a-U1 and a-U2
and four lines of T2 OsNRT2.3b over-expression plants, b-U1, b-U2, b-S2 and b-S6 were used for further experiments. T2 field experiments were conducted in Changxing experiment station of Zhejiang University (May-Oct. 2010) in four N application N as urea levels as 0, 75, 150 and 300 kg N/ha. Seeds were germinated on 5th May and
30 seedlings of each type were planted at 3 rows and 33 plants with 25 cm (row space) x
20 cm (plant space) on 5th June. Plants were grown in blocks (Fig. 23a, b) with a random order for each N application. For the large scale experiments at 75 kg N/ha, the plants were transplanted as 10 rows x 128 plants (Fig. 23d). Three replications

WO 2014/122452

PCT/GB2014/050327

42
were used for all field experiments and the plots were finally harvested on the 10th
October. The soil nutrient status in this experiment station was total nitrogen (N): 1.00 ±
0.18 mg/g, total phosphorus (P) 0.38±0.08 mg/g, total potassium (K) 39 ± 2.3 mg/g,
Olsen P (0.5 mM NaHC0 3-extractable P) 23 ± 4.1 mg/kg and soil pH was 6.3 ± 0.47 (n
5 = 6). 60 kg P (as Ca(H2P0 4)2) /ha and 110 kg K (as K2S0 4)/ ha fertilizer was applied to
the paddy before transferring the rice seedlings. The first N application was carried out before transferring on 3th June and 20% total N fertilizer was mixed into soil. Second application was 40% on 12 June when the rice was at the beginning of tilling stage. The final application was 40% on 20 June. The rice growth period at Changxing was
10 120 ± 3 days for WT, a-U1 and a-U2 lines, and 130 ± 2 days at 0-75 kg N/ha level, 135
± 2 days at 150 kg N/ha level and 140 ± 2 days at 300kg N/ha level for b-U1, b-U2, b-S2 and b-S6 lines. The grain yield was measured at harvest and NUE was defined as grain yield per fertilizer N applied. For the 15N uptake, xylem and phloem sap collection experiments, hydroponic growth conditions were used as described previously34 in IRRI
15 culture medium at pH 5.5 with 1.25 mM NH4N03 as the N supply unless stated
otherwise. Roots RNAwas abstracted for RT-PCR analysis.
Antibody production and western blot
The full cDNA sequences of OsNRT2.3a/b genes were amplified from plasmids of OsNRT2.3a (AK109776) and OsNRT2.3b (AK072215) by primers, F:
20 GGAATTCTCACACCCCGGCCGG (SEQ ID No. 17), R: CGGGATCCATGTGGGGC
GGCATGCTC (SEQ ID No. 18). The plasmids were kindly provided by Dr.Kikuchi (KOME). The PCR fragment was sub-cloned into the bacterial expression vector pGSX (Amersham) at BamH I and EcoR I sites. The amino acid products were purified and their monoclonal-antibodies were synthesized35. The monoclonal-antibody was
25 selected from 192 individual cell specific reactions to OsNRT2.3a (516 aa) or
OsNRT2.3b (486 aa) protein. Plasma membrane protein abstraction from roots and western blot was done as previously described1014 and repeated twice.
RNA in situ hybridization
RNA in situ hybridization was performed as previously described36. For OsNRT2.3b
30 probe, the binding site is in OsNRT2.3b specific 5' UTR with its sequence
CGATGGTTGGGTGCGGCGAGA (SEQ ID No. 19). The nonsense sequence is GCTACCAACCCACGCCGCTCT (SEQ ID No. 20). All probes were labeled at 5' end with DIG.
Determination of root 15N accumulation

WO 2014/122452

PCT/GB2014/050327

43
Rice seedlings of WT and over-expression plants were grown in IRRI nutrient solution
containing 1.25 mM NH4N03fortwo months in greenhouse and then deprived of N for
3 days. The plants were rinsed in 0.1 mM CaS0 4 for 1 min, then transferred to the
solution containing either 1.25 mM Ca(N03)2 (atom% 15N: 99.27%) or (15NH4)2S04
5 (atom% 15N: 95.7%) or 15NH 4 N0 3 (atom% 15N: 45%) or NH 415N0 3 (atom% 15N: 45.25%)
or 15NH415N0 3 (atom% 15N: 95.5%) for 5 min and finally rinsed again in 0.1 mM CaS0 4
for 1 min. Roots were separated from the shoots immediately after the final transfer to
CaS0 4, and frozen in liquid N. After grounding, an aliquot of the powder was dried to a
constant weight at 70°C. 10 mg powder of each sample was analyzed using the
10 MAT253-Flash EA1 112-MS system (Thermo Fisher Scientific, Inc., USA). The whole
experiment was repeated twice and each time with five replicates.
Xylem and phloem sap collection
Rice seedlings were grown in 1.25 mM NH4N03for 8 weeks and then transferred to N
treatments (nitrate: 1.25 mM Ca(N0 3)2; ammonium: 1.25 mM (NH4)2S04) for 24 h and
15 then cut at 4 cm above root. The below in N solutions was for xylem sap collection34
and the top was for phloem sap collection 16.
For phloem sap collection, briefly each shoot was put into a 50 ml glass tubes with 15
ml 25 mM EDTA-Na2 covered with Parafilm. The shoot was inserted through the
Parafilm and phloem sap was collected for 24h. Phloem pH changes were measured
20 using a pH meter (model 868, Thermo Orion, USA) and by calculation of the pH
difference in samples at the start and end of the phloem sap collection period. The experiment was conducted with 5 replicate samples and was repeated twice.
Phloem sap was also collected using an insect feeding method with the same plants as
above. Each plant was set in a 250 ml bottle of IRRI nutrient solution with six plants
25 kept in the insect cage at 26 C and a 16 h light period. Seven to ten adult brown plant
hopper adults were transferred on to each plant at the beginning of the N treatments. Rice phloem honey dew secreted by the insects was collected at 24 h, 48 h duration of N treatments (Fig. 17).
Oocyte preparation, mRNA injection, 15N uptake and electrophysiology
30 Oocytes preparation, mRNA injection, 15N-nitrate uptake and electrophysiology have
been described previously37"39. 0.5 mM Na15N-N0 3or 15N-NH4CI in ND96 was used for 15N uptake experiment for 16 h38.The pH selective microelectrode method was used to measure cytosolic pH18.

WO 2014/122452

PCT/GB2014/050327

44
Single site mutation of OsNRT2.3b and mRNA synthesis
A point mutation (H167R) of OsNRT2.3b was generated using a PCR method. The
point mutant was processed by PCR two fragments of OsNRT2.3b with the mutant site
and new restriction site in the primers. OsNRT2.3b cDNA in pT7Ts was used as a DNA
5 template and the first PCR fragment (H167RB) was sub-cloned into Hindlll and Xbal of
pT7Ts. New plasmid and second PCR fragment (H167R) were digested by Csp45 I and Xba I and ligated into the final plasmid with H167R site mutated OsNRT2.3b cDNA (pH167R). The mRNA synthesis of pH167R was described as above.
10 RNA preparation and DNA microarray hybridization
Three replicates each of WT (Nipponbare), a-U1 and b-S6 shoots were harvested from
150 Kg N/ha treatment in field of Changxing experiment station at 10:00 am of the 1th
Aug. i.e. the maximum tillering stage for all plants. Shoot tissues samples taken for
RNA extraction were flash frozen at -80 °C in liquid nitrogen immediately on
15 harvesting. RNA extraction, hybridization with Affymetrix rice GeneChip arrays (Santa
Clara, CA, USA), data analyses and annotation were as described in previous reports40.
Quantitative real-time RT-PCR
20 Total RNA from three biological representatives, specifically from the roots and shoots
of WT and transgenic plants, was isolated using the TRIzol reagent according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA, USA)13.
Gas exchange and postillumination C0 2 burst measurements
The rate of light-saturated photosynthesis of flag leaves was measured from 9:00 h to
25 15:00 h using a Li-Cor 6400 portable photosynthesis open system at the plants in 150
Kg N /ha treatment in field of Changxing experiment on the same day as microarray
sampling. Leaf temperature during measurements was maintained at 27.0± 0.1 °C with
a photosynthetic photon flux intensity (PPFD) of 1500 |ir|ioi photons m"2.s"1 as
described before41. The ambient C0 2 concentration in the cuvette (Ca-c) was adjusted
30 as atmospheric C0 2 concentration (Ca) (417±1 .0 |ir|ioi C0 2 mol"1), and the relative
humidity was maintained at 20%. Data were recorded after equilibration to a steady state (10 min).The measured leaves were labelled, and leaf areas were calculated based on the labelled area. The postillumination C02 burst (PIB) was measured at the same labelled leaf under photorespiratory conditions (saturating PPFD of 1,500 |irioi

WO 2014/122452

PCT/GB2014/050327

45
photons m"2 .s"1 , Ca-c C0 2 concentration of 100 urnoi C0 2 mol"1, relative humidity of 60%-70%) as described before22.
Results
Over-expression of OsNRT2.3b increased rice growth
5 We generated rice (Oryza sativa L ssp. Japonica, cv. Nipponbare) plants that over-
express OsNRT2.3a and OsNRT2.3b byAgrobacterium-mediated transformation, using either ubiquitin or35S promoters (Fig. 1a, b). The over-expression lines were named a-U1 and a-U2 for OsNRT2.3a, b-U1, b-U2, b-S2 and b-S6 for OsNRT2.3b, respectively with one copy insertion. Interestingly, the OsNRT2.3b over-expression lines, which
10 were confirmed at both transcript and protein levels (Fig. 1cd), showed more growth
compared with wild type (WT) (Fig. 1a, b). The biomass and panicle size of over-expression lines was greater than WT (Fig. 11; Table 2-3). The primary and second rachis size was increased therefore the total number of seeds per panicle was greater than WT (Fig. 11, Table 2). By contrast, the OsNRT2.3a over-expression plants did not
15 show visible difference from WT even though OsNRT2.3a mRNA and protein was
increased in the transformed lines (Fig. 1c, d, Fig. 11). The in situ hybridization results showed that OsNRT2.3b mRNA in b-S6 leaf was over-expressed in the epidermal, phloem and mesophyll cells when compared with wild type (Fig. 1e). Furthermore, when OsNRT2.3b was over-expressed in other high yielding and high NUE rice
20 cultivars, WYJ7 from southern China and YF47 from northern China, their grain yield
and NUE (grain yield divided by the N fertilizer applied) were also significantly increased (Figs. 12, 13).
Field trials of over-expression lines show increased grain yield and NUE in both
25 subtropical and tropical climates at a range of N fertilization rates
Encouraged by the strong phenotypes of the OsNRT2.3b over-expressing plants in hydroponics and soil pots, we grew selected Nipponbare, WYJ7 and YF47 transgenic lines and their wild types in 4 field trials to evaluate their performance under different fertilizer N rates.
30 Four Nipponbare T2 transgenic lines and WTwere grown with four levels of N fertilizer
application in a paddy field (soil pH 6.3) located at Changxing in the subtropical climate region (Fig. 2). Compared with WT, biomass, seed numbers per panicle, ripening rate, grain yield and NUE of the transgenic lines were significantly increased at all levels of

WO 2014/122452

PCT/GB2014/050327

46
N application (Fig. 2a-c, Table 5). The average increase in grain yield ranged from 33%
at 75 kg N/ha to 25% at 300 kg N/ha. The grain yield of the over-expression lines
supplied with 150 kg N/ha was 6% to 13% higher than that of WT yield fertilized with
300 kg N/ha (Fig. 2b). Remarkably the best performing transgenic line, b-S6 produced
5 similar grain yield at 75 kg N/ha to WT at 300 kg N/ha (Fig. 2b, Table 5). The NUE of
the OsNRT2.3b over-expressing lines reached 68-79 g/g N at the 75 kg N/ha application level, compared with 55 g/g N in WT (Fig. 2c). In a large scale field experiment supplied with 75 kg N/ha, the yield and NUE of the line b-U2 were 30.5% more than WT; while for line b-S6 the values were even greater at 40.5% (Figs. 2d,e,f).
10 In a second field trial, the T5 generations of b-S2 and b-S6 were grown in tropical
Hainan (Fig. 14a). Significant increases in grain yield and NUE were again obtained. The largest difference between the transgenic lines and Nipponbare WT was found in the 110 kg N/ ha supply (Fig. 14b). Furthermore, crossing b-S6 T5 plants with WT confirmed that the b-S6 phenotype was completely contributed by OsNRT2.3b over-
15 expression as in F2 generation plants the aa genotype returned to WT and AA
genotype was like b-S6 (Fig. 15).
The third field trial tested the OsNRT2.3b over-expressing lines in the WYJ7
background with three N supplies (110 and 220 kg N/ha) in Changxing. Among the four
transformed lines (T2 generation), grain yield was 35-51% larger than WT at 110 kg
20 N/ha and 38-42% larger at 220 kg N/ha. On average, the NUE was 43% higher than
WT (Fig. 12f).
The fourth field trial tested the OsNRT2.3b over-expressing lines in the YF47 cultivar
background in Hainan (Fig. 15). Similar to the results obtained with the other two
backgrounds, OsNRT2.3b over-expression in YF47 generated more biomass and 39%
25 more grain yield than WT at a usual N fertilizer supply (150 kg/ha) (Fig. 13a, d). Taken
together, OsNRT2.3b over-expression produced consistent effects on grain yield and NUE across different cultivar backgrounds, climates, and N application rates.
In the Nipponbare background, OsNRT2.3b over-expression resulted in a delay in
flowering compared with WT, by 15 ±2 days at 150 kg/ha and 20 ±2 days at 300 kg/ha
30 (Figs. 2a, d, Fig. 16, Table 1). In pot experiments with these plants, at 120 days after
germination the grain yield of b-S2 and b-S6 was 37% and 40% higher than WT (Fig. 16g). At 140 days the grain yield of b-S2 and b-S6 was 55% and 49% higher than WT (Fig. 16g). The extra 20 days increased their yield by only 18% and 9% compared with the data at the first 120 days. It was clear that the greatest contribution of OsNRT2.3b

WO 2014/122452

PCT/GB2014/050327

47
over-expression to grain yield occurred at 120 days. Furthermore the 20 days growth
delay did not significantly increase the total N uptake for OsNRT2.3b over-expression
plants (Fig. 16h). However 20 days delay increased the ratio of biomass and N transfer
to the grain (Tables 3-4) and the N utilization (assimilation) efficiency (NUtE) from 33 g-
5 grains/g-N at 120 days (no significant difference from WT) to 39.1-40.2 g-grains/g-N at
140 days (a significant increase relative to WT for b-S2 and b-S6 (Fig. 16i). In fact relative to WT there was no flowering delay of OsNRT2.3b over-expressers in WYJ7 and YF47 background.
OsNRT2.3b over-expression increased nitrate influx, transport to shoot, xylem
10 pH, phloem pH homeostasis, P and Fe accumulation in leaves.
We measured the effect of OsNRT2.3b over-expression on 15N-nitrate influx in four
Nipponbare transformed lines hydroponically grown at pH 6 (Fig. 3a). The nitrate influx
rate was increased significantly in all the transgenic lines compared with WT (Fig. 3a),
demonstrating increased activities of OsNRT2.3b in these plants. By contrast,
15 OsNRT2.3b over-expression had no significant effect on the short-term 15N-ammonium
uptake (Fig. 3a).
More nitrate and less ammonium were detected in the xylem of b-U1, b-U2, b-S2 and b-S6 in compared with WT under nitrate supply (Fig. 3b). Xylem pH was 7 and 7.3 in WT treated respectively with nitrate and ammonium, while it was 7.5 and 7.6-7.8 in the
20 OsNRT2.3b over-expressing lines, significantly higher than WT. After 24h N
treatments, phloem sap was collected. The phloem sap pH was measured using the EDTA-Na2 collection method16 and less acidification was found in OsNRT2.3b over-expression lines. The difference between WT and over-expression lines was about 0.2 pH units in nitrate and about 0.1 pH units in ammonium. To check the phloem pH using
25 a different method, the sap was collected from phloem-feeding insects (described in
Fig. 9). WT phloem pH decreased from 7.8 to 6.1 and b-S6 from 6.7 to 6.0 in nitrate supply from 24 to 48 h treatments (Fig. 9a); while in ammonium treatment WT phloem pH decreased from 7.4 to 6.3 and b-S6 from 6.6 to 5.9 from 24 to 48 h (Fig. 9b).The difference between WT and b-S6 under nitrate supply was remarkably high at 24 h,
30 however no significant difference was found by 48 h. In ammonium supply, although
the pH in WT sap was higher than in b-S6 the difference was not significant (Fig. 9b). The acidification of WT phloem pH in nitrate was about 1.7 pH units however it was only 0.7 of a pH unit in the b-S6 plants (Fig. 3e). By 48 h the collected phloem pH sap had adjusted to give more similar values for WT and b-S6 plants (Fig. 9b). Furthermore

WO 2014/122452

PCT/GB2014/050327

48
the root apoplastic pH in WT and b-S6 roots was tested with bromocresol purple
indicator17 after 72 h of differing N treatments. Overexpressing line b-S6 showed
alkalinization in nitrate and acidification in ammonium relative to WT (Fig. 18a, b), while
the pH in hydroponic medium did not show a significant difference between WT and b-
5 S6 over the same time scale (Fig. 18c) as the bulk solution was large enough to buffer
any pH changes occurring at the root surface.
Under ammonium nitrate supply the total P and Fe in the plants were also measured. Both total P and Fe were increased in the leaves of the over-expressing lines compared with WT (Fig. 19), especially for total Fe, it was 3-6 times more than WT.
10
OsNRT2.3b over-expression increased total N uptake in mixture supply of ammonium and nitrate at pH 4 and 6.
N-starved plants were resupplied with NH415N03 or 15NH4N03 or 15NH415N03 in pH 4, and 6 for 5 min to measure N uptake by root (Fig. 4). These results clearly showed as
15 the pH increased, the 15N03" influx was decreased, 15NH4+ and total 15N was increased
dramatically for both WT and all the OsNRT2.3b transgenic lines (comparing Figs. 4a, b, c). The OsNRT2.3b over-expression lines showed more 15NH4N03 and total N uptake at pH 4 and 6. In the field experiments, soil pH ranged from 4.4 to 6.4 (Figs. 1, 2, 13-14), the phenotype of the field grown transgenic lines can be explained by the
20 enhanced total N acquisition (nitrate and ammonium) of these plants.
Transport function of OsNRT2.3b regulated by cytosolic pH
As over-expression of OsNRT2.3b has such a major impact on NUE and growth of rice and this effect was related to plant pH homeostasis, we investigated the transporter
25 function in more detail at the molecular level. In heterologous expression experiments
the nitrate-elicited changes in membrane potential of Xenopus oocytes expressing OsNRT2.3b could not respond to sequential nitrate treatments (Fig. 5a). It was necessary for an oocyte to rest for at least 30 min between nitrate treatments to recover the electrical response or it could respond to nitrate immediately after washing
30 with pH 8.0 saline (Fig. 5a). Double-barrelled pH electrode measurements showed that
a 0.2 pH acidification of cytosolic pH prevented the second nitrate response of OsNRT2.3b injected oocytes (Fig. 5a). A slight delay of cytosolic pH response was observed compared with membrane potential shift to external nitrate treatment (Fig.

WO 2014/122452

PCT/GB2014/050327

49
5a). This cytosolic pH delay from membrane potential response was presented by other authors18'19.
The consensus transmembrane (TM) secondary structure of OsNRT2.3b was predicted
using software packages. 14 software packages predicted that OsNRT2.3 has 11 TM
5 with the N terminus on the cytosolic side and the first 5 TM are presented in table
below. H 167 amino acid was predicted in the cytosolic side in both table and figure, which was shown with the single site mutagenesis target ringed in prediction secondary structure below, predicted by http://bioinfo.si.hirosaki-u.ac.ip/~ConPred2/. ). The pH-sensing motif VYEAIHKI is around residue 167 on the cytosolic side.
10 Interestingly, bioinformatics analysis of the predicted OsNRT2.3b protein structure
revealed a pH-sensing motif VYEAIHKI20 around a histidine (H) residue of OsNRT2.3b which faces the cytosolic side of the plasma membrane After a single site mutation (H167R), OsNRT2.3b lost this function of cytosolic pH regulation, even after repeated cycles of nitrate treatment (Fig. 5b). The results show that endogenous oocyte cellular
15 pH homeostatic mechanisms were able to restore cytosolic pH above the threshold for
OsNRT2.3b transport activity. When oocytes were incubated in 15N-nitrate for only 4 hours, the regulatory effect of cytosolic pH on nitrate transport was clear, as the comparison of H167R and wild type forms of OsNRT2.3b showed that the mutation resulted in a much larger nitrate accumulation (Fig. 5c). However, after an 8 h
20 incubation the differences in activity of the two forms of the transporter had
disappeared; suggesting that after the longer incubation the accumulation of nitrate had reached a maximum in the oocytes.
Decreased photo respiratory gene expression and photorespiration
25 Some genes are known to be specifically associated with plant photorespiratory
activity21. Microarray and confirmatory qPCRs showed a gene expression pattern that indicates that photorespiration was altered in rice over-expressing OsNRT2.3b, when compared with WT and lines with increased OsNRT2.3a transcripts .
The total photosynthesis in b-S2 and b-S6 increased compared with WT, but b-U1 and
30 b-U2 did not significantly increase. However intercellular C0 2 concentration was
increased and the photorespiratory rate was decreased in all over-expression lines
compared with WT (Fig. 20). The reduced photorespiration and enhanced
photosynthesis in transgenic plants could contribute more biomass22. These data

WO 2014/122452

PCT/GB2014/050327

50
suggested that increased photosynthetic efficiency in plants overexpressing OsNRT2.3b contributes to the strong phenotype.
Discussion
The pH sensing activity switch of OsNRT2.3b is one of the key factors providing an
5 explanation for the phenotype of the transgenic plants, since transforming OsNRT2.3b
H167R mutant gene into Nipponbare plants did not increase height, yield and did not delay reproductive stage (Fig. 21). The pH-sensing motif VYEAIHKI (SEQ ID No. 16) around residue 167 is a characteristic of the anion exchanger family, which is found in many different organisms including mammals and may therefore be of more general
10 biological significance20. Increasing the external pH decreased nitrate accumulation in
the OsNRT2.3b expressing oocytes (Fig. 5d), supporting the idea that OsNRT2.3b is a proton-nitrate co-transporter14. Increasing the external pH decreases the proton gradient driving nitrate transport, but on the other hand it restores the nitrate transport function of OsNRT2.3b by making the cytosol more alkaline. Both effects occur via pH
15 changes, but each happens on different sides of the plasma membrane. In planta the
simultaneous influx of nitrate and ammonium counters the cytosolic pH regulatory effect of the OsNRT2.3b sensing motif. The proton-cotransport mechanism for the entry of nitrate into cells provides a cytosolic acidification, while ammonium transport can cause an alkalinization 23 that may enhances proton-coupled nitrate transport. This
20 short-term synergism between ammonium and nitrate transport to maintain cytosolic
pH can explain the measured increase in 15N-ammonium uptake when the plant was supplied with a mixed N source (Fig. 4), with the exclusion of the possibility that OsNRT2.3b protein itself might uptake ammonium in oocytes (Fig. 22). In WT plants, OsNRT2.3b expression was low13 and mainly localized in the phloem of leaves but not
25 roots (Fig. 1d). The transgenic plants with OsNRT2.3b over-expression driven by
strong promoters had more general tissue expression (Fig. 1d). The synergism between ammonium and nitrate transport was enhanced by over-expression of the pH sensing transporter OsNRT2.3b more generally in root cells.
The N supply form for plants is well known for influencing plant pH balance24. The
30 assimilation of ammonium produces at least one H+per NH4+; while N03" assimilation
produces almost one OH" per N03" 4. Either H+ or OH" produced in excess of that required to maintain cytoplasmic pH are exported from the cell in an energy requiring step (e.g. plasma membrane H+ pumping ATPase)410. The vascular specific expression of OsNRT2.3b in WT plants suggests a possible specific role in long distance transport

WO 2014/122452

PCT/GB2014/050327

51
within plants. To test this idea we compared the pH of phloem sap from N-starved rice
plants resupplied with nitrate or ammonium. Nitrate and ammonium supply acidified the
phloem pH of WT and transgenic plants (Fig. 3d, e). Interestingly, the phloem
acidification was significantly lower in the four transgenic lines when compared with WT
5 (Fig. 3d, e) although no significant difference in nitrate concentration could be detected
in phloem (data not shown). These data show that transgenic plants are better able to
regulate phloem pH, indicating that this is an important factor for the improved NUE.
Furthermore the phloem pH difference between WT and transgenics (Fig. 17a, b) could
explain the enhanced P and Fe accumulation in leaves of the OsNRT2.3b over-
10 expressing plants (Fig. 19). The more acidic phloem sap (Fig. 17) will benefit P and Fe
translocation to the leaf25. Together with enhanced N acquisition this was also an important factor for the plant growth and yield increase.
It has been reported that cytosolic pH acidification inactivated transport of
aquaporin in oocytes26. As discussed by these and other authors26, it suggested
15 cytosolic pH could be a key regulation for both aquaporin and nitrate transporter in
plants. Furthermore as nitrate assimilation depends on photorespiration27, the relationship428 between the assimilation of nitrate, ammonium and photorespiration is closely coupled to the shuttling of malate between the cytoplasm and chloroplast to balance pH29.
20 Many important crop traits like NUE are well known to be complex multi-gene
traits4. However, a few reports show that changing expression of a single trans-gene can significantly improve crop NUE30"32. The dramatic enhanced performance of the OsNRT2.3b transformed plants under different field conditions shows the prospects for improving rice NUE through single trans-gene approaches. The coupling of pH balance
25 and NUE is likely to have more general relevance to crops and offers a promising way
of improving NUE.
2. Expression of OsNRT2.3b in Arabidopsis
30 We have obtained data with 35S-driven expression ofOsNRT2.3b in Arabidopsis. The
Arabidopsis plants were transformed using standard floral-dipping Agrobacterium-mediated transformation techniques (Clough & Bent 1998). In Petri dish growth experiments Arabidopsis plants were supplied with either 0.2 or 6 mM nitrate supplies. Three independent lines of Arabidopsis plants overexpressing the OsNRT2.3b

WO 2014/122452

PCT/GB2014/050327

52
(checked at the mRNA level, using RT-PCR) were tested and compared with wild type
control plants (see Figure 6). The data in Figure 6 show that three independent
Arabidopsis lines overexpressing the rice transporter growing on 6 mM nitrate had
significantly more shoot biomass (Fig A) and had shorter roots on 0.2 mM supply (Fig
5 B) relative to wild type plants. Furthermore, two of these lines accumulated more tissue
nitrate.
These plants were grown a very simple culture system on agar Petri dishes with plant nutrients added to the agar (see Orsel et al. 2006 for details). We will repeat these experiments in hydroponic culture and soil pots to determine and compare NUE
10 between wild types and lines over-expressing OsNRT2.3b. 15N-enriched nitrate will be
used in Petri dish and hydroponic experiments to measure and compare nitrate influx rates between wild types and overexpressing lines (see Orsel et al. 2006 for methods). Plants will be grown and compared in mixed nitrogen supplies, that include ammonium nitrate or nitrate as the only nitrogen source.
15
3. Expression of OsNRT2.3b in tobacco
Method and Materials:
20 Over-expression vector construction and transgenic plants
The open reading frames of OsNRT2.3b were amplified by gene specific primers
(Table 1). The fragment was treated with restriction enzymes, inserted into vectors and
sequenced before transformation. Nicotiana tabacum cultivar 89 embryonic calli were
transformed using Agrobacterium-mediated methods (Ai et al. 2009. One copy
25 insertion TO plants were harvested and grown to generate T1 plants (Fig. 1).
Homozygous T1 plants were taken for T2 production.
Southern-Blot
The independent transgenic lines with gene knockdown of OsNRT2.3a, namely r1 and
30 r2, were determined by Southern-blot analysis following the procedures described
previously (Jia et al., 201 1).
Semi-quantitative RT-PCR
Total RNA was isolated from 100 mg of plant material with Trizol reagent (Invitrogen,
35 Carlsbad, CA, USA). Total RNA concentrations were determined by UV

spectrophotometry (Eppendorf, Biophotometer, Germany) 2 |jg of total RNA from each sample was used as template for the first-strand cDNA synthesis, which was performed using M-MLV reverse transcriptase (Fermentas, Foster City, CA, USA) according to the manufacturer's manual. The PCR amplification was performed using Taq DNA polymerase (Fermentas, Foster City, CA, USA) for target genes with specific primers shown below.
4. Expression of OsNRT2.3b in wheat
The phloem localised expression of NRT2.3b, and recent findings that significant amounts of nitrate are transported in the phloem e.g. Fan et al. 2009 (previously it was generally assumed that nitrate is transported from the root to the shoot in the xylem), together with the important role of the phloem in pH homeostasis suggest that phloem specific expression of OsNRT2.3b may be important for the results reported (e.g. improved NUE). For these reasons, we used both ubiquitin and a phloem-specific promoters to drive expression of OsNRT2.3b in wheat. The ubiquitin promoter was used for the transformation as shown in Figs. 27 and 28. The construction of 35S-OsNRT2.3b vector was described in rice transformation and wheat were produced by particle bombardment of calli cultured from immature embryos of susceptible variety Yangmai158 as described (by Cao et al). The transgenic plant showed increased yield compared towt plants, see Figs. 27 and 28.
5. Pathogen resistance of transgenic rice
Transgenic rice plants expressing OsNRT2.3b generated as described above were analysed in field trails in Hainan for pathogen resistance. The main rice diseases in Hainan, Fusarium wilt, Leaf blight and Stripe rust. For each plot, the survival rates were counted by the rice plants number at harvest/rice plants transferred at the beginning of January. Transgenic plants showed better survival rates compared to wt plants (Figure 26).
The primers used for RT-PCR of OsNRT2.3b gene
Genes primers
OsA/R72.3Jb(AK072215)
F:5'- CGTTCGCCGTGTT -3'(SEQ ID No. 21)
R:5'- TCGAAGCGGTCGTAG AAG -3' (SEQ ID No. 22)
Actin

F:5'-TTATGGTTGGGATGGGACA-3'(SEQ ID No. 23) R:5'-AGCACGGCTTGAATAGCG-3'(SEQ ID No. 24)
The primers used for over-expression constructs

PROMOTER

VECTOR

PRIMERS

ENZYMES

CaMV-35S PCAMBIA1 302 F atCCATGGAGATCTCAGGGCACAGCGGATG Bglll
(SEQ ID No. 25)
R atCCATGGAGATCT ACACCCCGGCCGG Bglll
(SEQ ID No. 26)
Ubiquitin PTCK303 F caACTAGTGCTACCACGTGTTGGAGATG Spel
(SEQ ID No. 27)
R GaACTAGTGAGCAAACCACCAACAAGC Spel
(SEQ ID No. 28)
The primers used for subcloning of OsNRT2 genes and OsNAR2 genes into pT7Ts

Gene

Clone vector

Subcloning primers

Plasmid Promoter
linearization for RNA
sites synthesis


OsNRT2.3b pLambda F: AATCAGATCTTTG GAGCTCCACCGC
(AK07221 5) -FLC I (SEQ ID No. 29)
R: CAGAACTAGTCCCCCCCTCGAAGG
(SEQ ID No. 30)

Xba I

T7

CLAIMS:
1. A method for increasing growth, yield, nitrogen use efficiency, nitrogen transport, nitrogen stress tolerance, pathogen resistance, survival and/or nitrogen acquisition of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant wherein if the nucleic acid sequence is as defined in SEQ ID No. 1, said plant is not rice.
2. A method according to claim 1 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.
3. A method according to claim 2 wherein said constitutive or strong promoter is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1 .
4. A method according to claim 1 wherein said regulatory sequence is a phloem specific promoter.
5. A method according to claim 4 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.
6. A method for making a transgenic plant having increased growth, yield, nitrogen transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use efficiency comprising
a) introducing and expressing in a plant or plant cell a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence wherein if the nucleic acid sequence is as defined in SEQ ID No. 1, said plant is not rice.
7. A method according to any of claims 1 to 6 wherein said plant is a crop plant or a biofuel plant.
8. A method according to claim 7 wherein said crop plant is selected from maize, wheat, tobacco, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
9. A plant obtained or obtainable from a method as defined in any of claims 6 to 8.
10. A transgenic plant expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence if the nucleic acid sequence is as defined in SEQ ID No. 1, said plant is not rice.

11.A plant according to claim 9 or 10 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.
12. A plant according to claim 11 wherein said constitutive promoter or strong is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1.
13. A plant according to any of claims 9 or 10 wherein said regulatory sequence is a phloem specific promoter.
14. A plant according to claim 13 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.
15. A plant according to any of claims 9 to 14 wherein said plant is a crop plant a biofuel plant.
16. A plant according to claim 15 wherein said crop plant is selected from maize, wheat, oilseed rape, tobacco, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
17. A method for regulating pH homeostasis comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant.
18. A method for reducing acidification in a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant.
19. A method for altering nitrate transport and pH homeostasis in a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence comprising SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence in a plant wherein said nucleic acid comprises a mutation in the pH sensing motif VYEAIHKI (SEQ ID No. 16).
20. The use of a nucleic acid with homology to SEQ ID No. 1, a functional variant or homolog thereof comprising the pH sensing motif VYEAIHKI (SEQ ID No. 16) in regulating pH in altering nitrate transport and pH homeostasis in a plant.
21.A method for increasing growth, yield, nitrogen use efficiency, nitrogen transport, pathogen resistance, survival, nitrogen stress tolerance and/or nitrogen acquisition of a plant comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence into a plant

wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
22. A method for making a transgenic plant having increased growth, yield, nitrogen
transport, nitrogen acquisition, nitrogen stress tolerance and/or nitrogen use
efficiency comprising
a) introducing and expressing in a plant or plant cell a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
23. A method according to any of claims 21 to 22 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.
24. A method according to claim 23 wherein said constitutive or strong promoter is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1 .
25. A method according to any of claims 21 to 22 wherein said regulatory sequence is a phloem specific promoter.
26. A method according to claim 25 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.
27. A method according to any of claims 21 to 26 wherein said plant is a crop plant or a biofuel plant.
28. A method according to claim 27 wherein said crop plant is selected from maize, rice, wheat, oilseed rape, tobacco, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
29. A method according to claim 28 wherein said crop plant is not rice.
30. A plant obtained or obtainable from a method as defined in any of claims 21 to 29.
31. A transgenic plant expressing a nucleic acid construct comprising a nucleic acid sequence as defined in SEQ ID No. 1, a functional variant or homolog thereof operably linked to a regulatory sequence into a plant wherein said regulatory sequence is a constitutive promoter or a phloem specific promoter and wherein said plant does not overexpress a nucleic acid sequence comprising SEQ ID No. 2.
32. A plant according to claim 30 or 31 wherein said regulatory sequence is a constitutive or strong promoter directing overexpression of said nucleic acid.

33. A plant according to claim 32 wherein said constitutive promoter or strong is selected from CaMV-35S, CaMV-35Somega, Arabidopsis ubiquitin UBQ1 .
34. A plant according to any of claims 30 to 31 wherein said regulatory sequence is a phloem specific promoter.
35. A plant according to claim 34 wherein said phloem specific promoter comprises a nucleic acid comprising SEQ ID No. 5.
36. A plant according to any of claims 31 to 35 wherein said plant is a crop plant or biofuel plant.
37. A plant according to claim 36 wherein said crop plant is selected from maize, rice, wheat, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
38. A plant according to claim 37 wherein said crop plant is not rice.
39. A product derived from a plant as defined in any of claims 9 to 16 or 31 to 38.

Documents

Orders

Section Controller Decision Date

Application Documents

# Name Date
1 Sequence listing [25-08-2015(online)].pdf 2015-08-25
2 Form 5 [25-08-2015(online)].pdf 2015-08-25
3 Form 3 [25-08-2015(online)].pdf 2015-08-25
4 Drawing [25-08-2015(online)].pdf 2015-08-25
5 Description(Complete) [25-08-2015(online)].pdf 2015-08-25
6 7602-DELNP-2015.pdf 2015-08-29
7 7602-delnp-2015-GPA-(07-10-2015).pdf 2015-10-07
8 7602-delnp-2015-Form-1-(07-10-2015).pdf 2015-10-07
9 7602-delnp-2015-Correspondence Others-(07-10-2015).pdf 2015-10-07
10 7602-delnp-2015-Form-3-(09-02-2016).pdf 2016-02-09
11 7602-delnp-2015-Correspondence Others-(09-02-2016).pdf 2016-02-09
12 Form 3 [14-07-2016(online)].pdf 2016-07-14
13 Form 18 [11-01-2017(online)].pdf 2017-01-11
14 7602-DELNP-2015-FORM 3 [26-07-2017(online)].pdf 2017-07-26
15 7602-DELNP-2015-FORM 3 [12-01-2018(online)].pdf 2018-01-12
16 7602-DELNP-2015-FORM 3 [09-07-2018(online)].pdf 2018-07-09
17 7602-DELNP-2015-FORM 3 [31-12-2018(online)].pdf 2018-12-31
18 7602-DELNP-2015-FER.pdf 2019-07-01
19 7602-DELNP-2015-FORM 3 [19-07-2019(online)].pdf 2019-07-19
20 7602-DELNP-2015-OTHERS [31-12-2019(online)].pdf 2019-12-31
21 7602-DELNP-2015-FER_SER_REPLY [31-12-2019(online)].pdf 2019-12-31
22 7602-DELNP-2015-DRAWING [31-12-2019(online)].pdf 2019-12-31
23 7602-DELNP-2015-CLAIMS [31-12-2019(online)].pdf 2019-12-31
24 7602-DELNP-2015-ABSTRACT [31-12-2019(online)].pdf 2019-12-31
25 7602-DELNP-2015-FORM 3 [10-02-2020(online)].pdf 2020-02-10
26 7602-DELNP-2015-FORM 3 [04-08-2020(online)].pdf 2020-08-04
27 7602-DELNP-2015-PETITION UNDER RULE 137 [19-08-2020(online)].pdf 2020-08-19
28 7602-DELNP-2015-FORM 3 [21-01-2021(online)].pdf 2021-01-21
29 7602-DELNP-2015-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [20-07-2021(online)].pdf 2021-07-20
30 7602-DELNP-2015-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [16-08-2021(online)].pdf 2021-08-16
31 7602-DELNP-2015-Correspondence to notify the Controller [17-09-2021(online)].pdf 2021-09-17
32 7602-DELNP-2015-Written submissions and relevant documents [07-10-2021(online)].pdf 2021-10-07
33 7602-DELNP-2015-US(14)-HearingNotice-(HearingDate-23-07-2021).pdf 2021-10-17
34 7602-DELNP-2015-US(14)-ExtendedHearingNotice-(HearingDate-23-09-2021).pdf 2021-10-17
35 7602-DELNP-2015-US(14)-ExtendedHearingNotice-(HearingDate-23-08-2021).pdf 2021-10-17
36 7602-DELNP-2015-PatentCertificate30-11-2021.pdf 2021-11-30
37 7602-DELNP-2015-IntimationOfGrant30-11-2021.pdf 2021-11-30
38 7602-DELNP-2015-RELEVANT DOCUMENTS [04-09-2023(online)].pdf 2023-09-04

Search Strategy

1 strategy_7602_30-06-2019.pdf

ERegister / Renewals

3rd: 09 Feb 2022

From 05/02/2016 - To 05/02/2017

4th: 09 Feb 2022

From 05/02/2017 - To 05/02/2018

5th: 09 Feb 2022

From 05/02/2018 - To 05/02/2019

6th: 09 Feb 2022

From 05/02/2019 - To 05/02/2020

7th: 09 Feb 2022

From 05/02/2020 - To 05/02/2021

8th: 09 Feb 2022

From 05/02/2021 - To 05/02/2022

9th: 09 Feb 2022

From 05/02/2022 - To 05/02/2023

10th: 19 Jan 2023

From 05/02/2023 - To 05/02/2024

11th: 25 Jan 2024

From 05/02/2024 - To 05/02/2025

12th: 24 Jan 2025

From 05/02/2025 - To 05/02/2026