Abstract: The present invention relates to the development of a novel vaccine candidate comprising of a conjugate vaccine alone or in combination with plasmid DNA or inactivated or live attenuated whole Brucella organism which can be used as a prophylactic or a therapeutic vaccine in target species such as cattle and buffaloes and as a differentiator between infected and vaccinated animals.
1. A glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprises lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier.
2. The vaccine as claimed in claim 1, wherein the lipopolysaccharide is selected from a group consisting of SI9, Rev 1, 544,2308.
3. The vaccine as claimed in claim 1, wherein the protein carrier is selected from a group consisting of outer membrane protein complex (OMP), exo-protein A of Pseudomonas Aeruginosa, epsilon toxin of Clostridium perfringens protein and a CTB fragment from cholera toxin.
4. The vaccine as claimed in claim 1, wherein the protein carrier is a recombinant protein.
5. The vaccine as claimed in claim 1 further comprises plasmid DNA encoding OMP 25 fragment of Brucella species, ribosomal L7/L12 gene, or a periplasmic protein Cu, Zn Superoxide dismutase (SOD) of Brucella Species.
6. The vaccine as claimed in claim 1 further comprises inactivated or live attenuated Brucella species.
FIELD OF INVENTION
The present invention relates to the field of immunology particularly to vaccine composition against Brucellosis.
BACKGROUND OF THE INVENTION
Brucellosis is one of the five common bacterial zoonoses in the world caused by organisms belonging to the genus Brucella, a gram negative, non-sporing, facultative intracellular bacterium. The genus Brucella consist of seven species according to antigenic variation and primary host: Brucella melitensis (sheep and goats), B. suis (hogs), B. abortus (cattle), B. ovis (sheep), B. canis (dogs), B. neotomae (wood rats) and B. manis (marine mammals). B. abotrus induces spontaneous abortion in cattle and causes serious economic loss to dairy farms. Smooth and rough strains of Brucellae are used as live attenuated vaccines. B. abortus SI9, B. abortus RB51 and B. melitensis REV1 are examples of the live vaccines currently in use (Schurig, GG, N. Sriranganathan and MJ Corbel, Brucellosis vaccines: Past, present and future. Vet. Microbiol 90 (2002): 479-496.). No other vaccines are available for other animals. In human beings the disease causes flu like symptoms, undulant fever and chills in between episodes of pyrexia.
Live attenuated vaccines
Live, attenuated vaccines have been used for the control of brucellosis. The smooth strain S19 was used for several decades to control brucellosis in many countries. Some advantage has been offered through the availability of rough vaccine strain RB51. This is an attenuated rough mutant of B. abortus that has been shown to be effective for vaccination of cattle. However results from vaccination of wildlife have given less encouraging results with failure to protect species including sheep, bison, reindeer or elk (Schurig, GG, N. Sriranganathan and MJ Corbel, Brucellosis vaccines: Past, present and future. Vet. Microbiol 90 (2002): 479-496.)
Glyco conjugate vaccines
Glyco conjugate vaccines have been developed for immunity against pathogens whose polysaccharide capsule protect them from phagocytosis, Haemophilius influenzae type B (HiB), Streptococcus pneumoniae, and Neisseria meningitides are some examples of bacterial pathogens, against which use of glyco-conjugate vaccines have been reported. By covalently linking the polysaccharide to protein carriers, they are converted into T-dependent antigens and protective immunity is induced. In case of Brucella, lipo-polysaccharide may induce antibodies at the site of infection to prevent bacterial entry. To provide long lasting immune responses lipo-polysaccharide may be conjugated to carrier protein such as Brucella outer membrane protein.
Subunit and DNA vaccines
Cell mediated immunity is the dominant immune response required for protection against Brucellosis. Thus, the concept of subunit vaccine in Brucellosis is based on the generation of memory Thl cells by immunization with T-cell antigen. The Thl dependent responses are vital to induce strong cell mediated immune responses including cytotoxic T cells. These cells are needed to clear Brucella infections. The initial requirement for a subunit vaccine approach is to identify T-cell antigens. So far P39, bacterioferritin and L7/L12 proteins have been purified and tested as subunit vaccines with adjuvants (Al-Mariri, A, Tibor, A, Mertens, P., De Bolle, X, Michel, P., Godfroid, J, Walravens,K and Letesson,JJ. Protection of Balb/c mice against Brucella abortus 544 challenge by bacteriferritin or P39 recombinant proteins with CpG oligodeoxynucleotides as adjuvant. Infect. Immun (2001) 69:4816-4822). Mice immunized with these proteins had a certain level of protection when challenged. Alternatively, DNA vaccination has been tried using genes encoding the L7/L12 proteins and this method conferred some degree of protection (Oliveira, SC, GA Splitter, Immunization of mice with recombinant L7/L12 ribosomal protein confers protection against Brucella abortus infection. Vaccine (1996), 14:959-962). The injection of recombinant proteins made with many T-cell epitopes or DNA encoding recombinant T-cell epitopes may provide better protection than a single-epitope subunit vaccine. However, it is not clear whether such vaccination approaches will be effective for long -term protection.
SUMMARY OF THE INVENTION
An aspect of the present invention is to provide a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, wherein the vaccine comprises lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a glyco-conjugate vaccine for Brucellosis, wherein the vaccine comprises lipo-polysaccharide of Brucella species conjugated to a protein carrier. The carrier protein may be outer membrane protein (OMP) complex isolated from Brucella species or other heterologous proteins such as recombinant Exo-protein A of Pseudomonas Aeruginosa, recombinant epsilon toxin of Clostridium perfringens protein or recombinant CTB fragment from cholera toxin.
The glyco-conjugate vaccines for Brucellosis disclosed in the present invention is useful as a prophylactic and therapeutic vaccine candidate either alone or in combination with DNA vaccines coding for outer membrane protein OMP25 of Brucella species or ribosomal L7/L12 gene or a periplasmic protein Cu, Zn Superoxide dismutase (SOD ) of Brucella Species.
The present invention provides a novel prophylactic and/or therapeutic vaccine for Brucellosis comprising a glyco-conjugate vaccine disclosed in the present invention alone or in combination with DNA vaccine or other suitable antigens such as live attenuated or killed whole organisms of Brucella species.
The present invention also provides a means for differentiating between a vaccinated and an infected animal.
In accordance with the present invention, in one embodiment there is provided a novel vaccine for brucellosis that confers both cell mediated immune response and humoral response in a subject. The vaccine composition eliciting both type of immune response is effective in protecting the animals against Brucella infection and for clearance in the infected animals as a therapeutic vaccine.
Another embodiment of the present invention provides a glyco-conjugate vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier such as outer membrane protein complex (OMP) or a suitable protein carrier such as exo-protein A of Pseudomonas Aeruginosa or a epsilon toxin of Clostridium perfringens protein or a CTB fragment from cholera toxin.
In one embodiment of the present invention there is provided a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier.
In another embodiment of the present invention there is provided a a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier, wherein the lipopolysaccharide is selected from a group consisting of SI9, Rev 1, 544, 2308.
In another embodiment of the present invention there is provided a a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier, wherein the protein carrier is selected from a group consisting of outer membrane protein complex (OMP), exo-protein A of Pseudomonas Aeruginosa, epsilon toxin of Clostridium perfringens protein and a CTB fragment from cholera toxin.
In another embodiment of the present invention there is provided a a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier, wherein the protein carrier is a recombinant protein.
In another embodiment of the present invention there is provided a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier; and plasmid DNA encoding OMP 25 fragment of Brucella species, ribosomal L7/L12 gene, or a periplasmic protein Cu, Zn Superoxide dismutase (SOD) of Brucella species.
In another embodiment of the present invention there is provided a glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, the vaccine comprising lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier and inactivated or live attenuated Brucella species.
Yet another embodiment of the present invention provides a glycoconjugate vaccine comprising Lipopolysaccharide (LPS) from smooth or rough strains of Brucella abortus such as S19 conjugated to an outer membrane protein complex (OMP).
Yet another embodiment of the present invention provides a glycoconjugate vaccine comprising Lipopolysaccharide (LPS) from smooth or rough strains of Brucella abortus such as S19 conjugated to Exo-protein A of Pseudomonas Aeruginosa.
Yet another embodiment of the present invention provides a glycoconjugate vaccine comprising Lipopolysaccharide (LPS) from smooth or rough strains of Brucella abortus such as S19 conjugated to epsilon toxin of Clostridium perfringens protein
Yet another embodiment of the present invention provides a glycoconjugate vaccine comprising Lipopolysaccharide (LPS) from smooth or rough strains of Brucella abortus such as S19 conjugated to a CTB fragment from cholera toxin.
Yet another embodiment of the present invention provides a glycoconjugate vaccine for Brucellosis comprising the Lipopolysaccharide (LPS) from Brucella and a carrier protein, wherein the protein carrier is a recombinant protein.
Yet another embodiment of the present invention provides lipopolysaccharide from smooth and rough strains of B. abortus such as SI9, Rev 1, 544, 2308. The glycol-conjugate can be prepared using lipo-poysaccharide or capsular polysaccharide of the Brucella species such as melitensis, ovis, canis and suis.
Yet another embodiment of the present invention provides a protein carrier selected from a group consisting of an outer membrane protein complex (OMP), Exo-protein A of Pseudomonas Aeruginosa, an epsilon toxin of Clostridium perfringens protein and a CTB fragment from cholera toxin.
Yet another embodiment of the present invention provides a safe and efficacious vaccine for Brucellosis useful as prophylactic vaccine where protective titres are conferred for a prolonged duration leading to reduced frequency of immunization.
Like other facultative intracellular bacterial pathogens, resistance to B. abortus depends on cell-mediated immunity (CMI). Live, attenuated vaccines that can stimulate strong CMI responses are usually very effective against Brucellosis.
Another embodiment of the present invention provides a novel vaccine which can stimulate strong CMI response and confer protection for extended period of immunity.
The glycoconjugate vaccine for Brucellosis disclosed in the present invention can be used alone or in combination with Plasmid DNA coding for OMP 25 fragment of Brucella species or ribosomal L7/L12 gene or a periplasmic protein Cu, Zn Superoxide dismutase (SOD) of Brucella Species.
Yet another embodiment of the present invention provides a process for preparation of glycoconjugate vaccine for Brucellosis, the process comprises isolating lipopolysaccharides and conjugating the isolated lipopolysaccharide to protein carriers such as Omp, EPA, ET and CTB by using conventional method.
In another embodiment there is provided a vaccine formulation consisting of glycoconjugate alone or in combination with plasmid DNA coding for Brucella outer membrane protein complex OMP25, ribosomal L7/L12 gene, or a periplasmic protein Cu, Zn Superoxide dismutase (SOD) of Brucella Species.
Yet another embodiment is use of a glyco-conjugate vaccine for immune prophylaxis against brucellosis in animals and human beings.
In another embodiment the invention also provides for method of vaccination against brucellosis in which the plasmid DNA vaccine and the glyco-conjugate vaccine can be used in a prime-boost schedule. In one example, the plasmid DNA vaccine can be used to boost the immunogenicity of the LPS glyco-conjugate vaccine.
Novel Vaccine for Brucellosis offers following advantages
(1) Differentiates between infected and vaccinated animals
(2) Elicits good CMI response, useful for clearance of intracellular pathogens like Brucella
(3) Prolonged duration of immunity - lesser inoculations
(4) Can be used as both Prophylactic and therapeutic vaccine candidate
(5) Safe and efficacious vaccine.
Although the foregoing invention has been described in detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and the description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all and only experiments performed.
Example 1
Preparation of Plasmid DNA constructs comprising the polynucleotide coding for Omp 25
The Brucella OMP-25 coding gene was amplified from genomic DNA extracted from Brucella abortus S-19 strain, using gene specific primers (Forward Primer- 5' CTAGTCTAGAACCGCCATGGCGCGCACTCTTAAGTCTCTCGTA3' SEQ ID NO: 1 and Reverse Primer- 5' GGAAGATCTTTAGAACTTGTAGCCGATGCC 3' SEQ ID NO: 2) synthesized as per the published sequence (X79284) (de Wergiforsee, P Lintermanns, JN Limet, A Cloeckaert. Cloning and nucleotide sequence of the gene coding for the major 25 kilodalton outer membrane protein of Brucella abortus. J. Bacteriol (1995), 1911-1914). The plasmid vector DNA expressing the Brucellar OMP-25 protein (pOMP) was constructed by cloning the 750 bp PCR product of the OMP-25 coding sequence into the BamHI site of the pVR1012 (Hartikka, J., Sawdey, M., Cornefert-Jensen, F., Margalith, M., Barnhart, K., Nolasco, M., Vahlsing, H.L., Meek, J., Marquet, M., Hobart, P., Norman, J. and Manthorpe, M. An improved plasmid DNA expression vector for direct injection into skeletal muscle. Human Gene Therapy, 7(10) (1996) PP: 1205-1217) downstream of cytomegalovirus immediate early promoter and intron sequences. Figure 1 illustrates the plasmid vector comprising the DNA sequence of OMP-25 protein (pOMP). Large-scale plasmid isolation and purification was carried out essentially as described earlier (Sambrook, J and DW Russell, Molecular cloning, A laboratory Manual (2001)). The purified plasmid was dissolved in saline and stored at -80°C until further use in aliquots of a concentration of 1 mg/vial. The resultant recombinant vector was designated as pOMP25 and it is used either alone or in Combination vaccine containing DNA Vaccine pOMP25 and glycoconjugate vaccine.
Example 2
Extraction and purification of OMP
Extraction and purification of outer membrane proteins was done from physically disrupted Brucellas whole cell (Outer membrane proteins of Brucella abortus: isolation and characterization. D R Verstreate, M T Creasy, N T Caveney, C L Baldwin, M W Blab and A J Winter; Infect Immun. 1982 March; 35(3): 979-989). Cells were suspended at 1 g (wet weight) per 20 ml of 10 mM Tris-hydrochloride buffer (pH 7.5) and 1 mg each of DNase and RNase (Sigma Chemical Co., St. Louis, Mo.) was added per 100 ml. Disruption was accomplished by two passages through a high-pressure cell disruptor system. The disrupted suspension was centrifuged at 3,000 x g for 20 min at 4°C and the supernatant was centrifuged at 150,000 x g (average) for 60 min at 4°C to pellet the crude membranes, which were re suspended at 10 to 20 mg of protein per ml in Tris buffer. In some cases, outer membranes were separated from cytoplasmic membranes by density gradient centrifugation.
Detergent extraction of cytoplasmic membranes was performed by using either Triton X-100 (Sigma, USA) or sodium N-lauroylsarcosinate (Sigma, USA). The resultant insoluble material was dialyzed against Tris buffer at 4°C for 72 hours with repeated changes. The outer membrane-rich fraction, unless otherwise noted, was subjected to digestion overnight at 37°C with egg white lysozyme (Mann Laboratories, New York, N.Y.) (lmg/50mg of membrane protein). Solubilization was then performed by using Triton X-100 with 50mM EDTA or 25 mM sodium deoxycholate , except that the protein concentrations used were 1 mg/ml and the extraction was performed at 37°C for 1 hour. Zwittergent 3-14 (Calbiochem, La Jolla, Calif.) (0.2%) in Tris buffer containing 0.25 M NaCl was used under the same conditions for this purpose. After extraction, the samples were centrifuged at 100,000 x g (average) for 20 min at 4°C and the supernatants were held at 4°C. The supernatant were concentrated using tangential flow filtration using lOOKDa cassette (Pall, India) and then diafiltration was done with 10 mM Tris buffer (pH 7.5). Finally the materials were filtered through a 0.2 \i filter and stored at 4°C.
Example 3
Extraction of Lipopolysaccharide (LPS) from Brucella abortus S 19
LPS from whole bacterial cells was extracted using the procedure described by Yi and Hackett,(Rapid isolation method for lipopolysaccharide and lipid A from Gram-negative bacteria; Eugene C. Yi and Murray Hackett; Analyst, 2000, 125, 651-656) with slight modifications. Bacterial cells (lg) were suspended in 2 ml of 4M Guanidine Isothiocyanate buffer and then 3 ml of water saturated phenol and 200 ul of Sodium acetate. The cell suspension was vortexed and then incubated at room temperature for about 10 to 15 min for complete cell homogenization. After incubation, 20 ml of chloroform per g of cells was added to create a phase separation. The mixture was then vigorously vortexed and incubated at room temperature for an additional 10 min. The resulting mixture was centrifuged at 1200g for 10 min to separate the aqueous and organic phases. The aqueous phase was transferred into a new 15 ml centrifuge tube. 10 ml distilled water was added to the organic phase. The mixture was vortexed, incubated at room temperature for 10 min, and centrifuged at 12000g for 10 min. The upper aqueous phases from both steps were combined. Two additional water extraction steps were repeated to ensure complete removal of LPS from the organic phase. To the combined aqueous phase, 0.01 mg/ml of DNase and RNase was added and incubated for 18 hours at 37°C. Later O.Olmg /ml of proteinase K was added and further incubated for 18 hours at 37°C. The solution was then centrifuged at 5000 RPM for one hour. The supernatant was dialyzed (12000 KDa) against water with 6 to 7 changes of water. After dialysis the solution was centrifuged at 5000 RPM for 1 hr. The supernatant was harvested and LPS was precipitated using cold ethanol (95%) and 0.375 M Magnesium chloride as described by Darveau and Hancock (Darveau, R.P. and Hancock, R.E. Procedure for isolation of bacterial lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa and Salmonella typhimurium strains. Journal of Bacteriology, 155 (1983) PP: 831-838). The pellet was re-suspended in 2 ml of distilled water to obtain whitish slurry.
Example 4
Preparation of Glyco-Conjugates by conjugating LPS of Brucella species with OMP
Equal volumes of LPS and OMP (5 mg/ml each) were mixed and pH was adjusted to 5 .0 with 0.1 N HCI. To this l-ethyl-3-(3-dimethylaminopropyl) carbo-di-imide (EDAC) (Sigma, USA) was added to a final concentration of 0.1 M. The pH was maintained at 5.0 by addition of 0.1 N HCI for 3 hours at room temperature. The reaction mixture was stirred at 3°C to 8°C for an additional 24 hours, dialyzed against water for 48 hours (6-7 buffer changes). The dialyzed mixture was taken up for direct blending with 2% Aluminium Hydroxide gel for preparation of vaccine containing 25 ug of LPS per dose.
Example 5
Immunogenecity and potency of Brucella S(GC) and combination vaccine in mice
A DNA vaccine from Brucella abortus strain S19 is prepared. Also a glyco-conjugate vaccine using the lipo-polysaccharide (LPS) and the outer membrane protein (OMP) of Brucella abortus S19 strain was prepared. The vaccine was administered in mice subcutaneously (10 and 25 ug LPS per dose). Test were conducted using a S(GC) and combination vaccine using S(GC) +pOMP. Separate groups of mice were also vaccinated with pOMP (lOOug), pVR (lOOug) and live, attenuated S19 vaccine. Mice were challenged 30 days post vaccination with B. abortus 544 strain. The DNA vaccine alone was not able to protect the mice against challenge. The LPS-OMP glyco-conjugate vaccinated mice and combination of S(GC)+pOMP were protected against the challenge. Table 1 shows the potency results of Brucella abortus LPS-OMP glyco-conjugate vaccine with or without pOMP-25 DNA vaccine in CD1 mice. The percentage of animals protected with combination of the glyco-conjugate vaccines were comparable with the live, attenuated vaccine. The glyco-conjugate in combination was able to induce strong antibody immune responses against both components (LPS and OMP) and the IgGl, IgG2a and IgG3 subtypes were prominent in the antibody response (Tables 2-4) Table 2 shows Anti-B. abortus IgG ELISA titers in mouse sera after subcutaneous immunization with the B.abortus LPS-OMP glycoconjugate vaccines with or without pOMP-25 DNA vaccine. Table 3 shows Anti-B. abortus IgG isotype ELISA titers in mouse sera against LPS after subcutaneous immunization with the different vaccine groups. Table 4 shows Anti-B. abortus IgG isotype ELISA titers in mouse sera against OMP after subcutaneous immunization with the different vaccine groups. In addition, both conjugate and combination vaccine was able to induce a cell mediated immune response as indicated by the expression of IFNy and TNFa by splenocytes (Tables 5 - 6). Table 5 shows quantitative measurement of IFNy secreted by lymphocytes after in vitro stimulation with different vaccine groups (antigens). Table 6 shows quantitative measurement of TNFa secreted by lymphocytes after in vitro stimulation with different vaccine groups (antigens).
In these aspects the combination vaccine was similar to the live, attenuated S19
vaccine.
Table 1: Potency results of B. abortus LPS-OMP glyco-conjugate vaccine with or
without pOMP-25 DNA vaccine in CD1 mice.
§ Log colony forming units of B. abortus in spleens of challenged mice. The numbers indicate average of each experimental group. fProtective index was calculated by subtracting the mean Log cfu/ml of the vaccine groups from the controls.
Table 2: Anti-B. abortus IgG ELISA titers in mouse sera after subcutaneous immunization with the B.abortus LPS-OMP glycoconjugate vaccines with or without pOMP-25 DNA vaccine.
The numbers indicate average end point titres. Sera were collected from five mice of each group at 30, 60 and 90 days post vaccination. The titer of each serum was calculated as the reciprocal of the highest serum dilution yielding a specific optical density higher than the cut-off value.
Table 3:Anti-B. abortus IgG isotype ELISA titers in mouse sera against LPS after subcutaneous immunization with the different vaccine groups.
The numbers indicate average end point titres. Sera were collected from five mice of each group at 30, 60 and 90 days post vaccination. The titer of each serum was calculated as the reciprocal of the highest serum dilution yielding a specific optical density higher than the cut-off value
Table 4: Anti-B. abortus IgG isotype ELISA titers in mouse sera against OMP after subcutaneous immunization with the different vaccine groups.
The numbers indicate average end point titres. Sera were collected from five mice of each group at 30, 60 and 90 days post vaccination. The titer of each serum was calculated as the reciprocal of the highest serum dilution yielding a specific optical density higher than the cut-off value
Table 5: Quantitative measurement of IFNy secreted by lymphocytes after in vitro stimulation with different vaccine groups (antigens)
The IFNy was estimated using a sandwich ELISA and expressed as pg/ml. Spleen cells 2 x 106 from mice inoculated with different candidate vaccines were stimulated with RPMI, OMP, B.abortus S19 whole cell antigen (heat killed) for 72 hours. Poke Weed Mitogen was used as positive control. * Statistically significant difference when compared to RPMI (PO.05)
Table 6: Quantitative measurement of TNFa secreted by lymphocytes after in vitro stimulation with different vaccine groups (antigens)
The TNFa was estimated using a sandwich ELISA and expressed as pg/ml. Spleen cells 2 x 106 from mice inoculated with different candidate vaccines were stimulated with RPMI, OMP, B.abortus S19 whole cell antigen (heat killed) for 72 hours. Poke Weed Mitogen was used as positive control. * Statistically significant difference when compared to RPMI (P<0.05).
Example 6
Immunogenecity of Brucella S(GC) and combination vaccine in Cattle
The glycoconjugate vaccine was administered in cattle subcutaneously (50 ug LPS-OMP conjugate per dose). Separate groups of cattle were also vaccinated with live, attenuated S19 vaccine. The immune response in cattle was assessed by serum antibody assay on days 0, 7, 14, 21, 35, 60, 90, 105 and 120 post-vaccination. The glyco-conjugate vaccine was able to induce strong and comparable immune response against both components like the live, attenuated S19 vaccine (Tables 7-8) Table 7 shows mean antibody titres against purified lipo-polysaccharide of B. abortus S19 in i-ELISA in cattle calves vaccinated with B. abortus S19 glyco-conjugate vaccines and controls. Table 8 shows mean antibody titres against purified outer membrane protein complex of B. abortus S19 in i-ELISA in cattle calves vaccinated with B. abortus S19 glyco-conjugate vaccines and controls.
The IgGl and IgG2 subtypes were prominent in the antibody response (Tables 9-10). Table 9 shows Isotype specific immune response against purified lipo-polysaccharide of B. abortus S19 in cattle calves vaccinated with B. abortus S19 glyco-conjugate vaccines and controls. Table 10 shows Isotype specific immune response against purified outer membrane protein complex of B. abortus S19 in cattle calves vaccinated with B.abortus S19 glyco-conjugate vaccines and controls.
In addition, the glyco-conjugate vaccine was able to induce a cell mediated immune response as indicated by the expression of IFNy in a whole blood stimulation assay using inactivated whole bacterial antigen or OMP (Table 11). Table 11 shows Interferon gamma response as a measure of cell mediated immune response in cattle calves vaccinated with B.abortus S19 glyco-conjugate vaccines and controls against purified outer membrane protein complex (OMP) of B. abortus S19 and acetone killed whole cell antigen (WCA) from stimulated bovine lymphocytes.
In these aspects the glyco-conjugate vaccine was similar to the live, attenuated S19 vaccine. Results of the study indicate that the glyco-conjugate vaccine may be a useful vaccine for inducing potent immune responses in cattle.
Table 7: Mean antibody titres against purified lipo-polysaccharide of B. abortus S19 in i-ELISA in cattle calves vaccinated with B. abortus S19 glyco-conjugate vaccines and controls.
(f - the vaccinated groups did not differ significantly in the antibody response (P>0.05) whereas there as a highly significant difference when compared with the unvaccinated controls (P<0.01).
Table 8: Mean antibody titres against purified outer membrane protein complex of B. abortus S19 in i-ELISA in cattle calves vaccinated wiihB.abortus S19 glyco-conjugate vaccines and controls.
(f - the vaccinated groups did not differ significantly in the antibody response (P>0.05) whereas there as a highly significant difference when compared with the unvaccinated controls (PO.01).
Table 9: Isotype specific immune response against purified lipo-polysaccharide of B. abortus S19 in cattle calves vaccinated with B. abortus S19 glyco-conjugate vaccines and controls.
Numbers indicate mean antibody titers. (| - the vaccinated groups did not differ significantly in the antibody response (P>0.05) whereas there as a highly significant difference when compared with the unvaccinated controls (PO.01).
Table 10: Isotype specific immune response against purified outer membrane protein complex of B.abortus S19 in cattle calves vaccinated with B.abortus S19 glyco-conjugate vaccines and controls.
Numbers indicate mean titers, (f - the vaccinated groups did not differ significantly in the antibody response (P>0.05) whereas there as a highly significant difference when compared with the unvaccinated controls (PO.01).
Table 11: Interferon gamma response as a measure of cell mediated immune response in cattle calves vaccinated with B. abortus S19 glyco-conjugate vaccines and controls against purified outer membrane protein complex (OMP) of B. abortus S19 and acetone killed whole cell antigen (WCA) from stimulated bovine lymphocytes.
Numbers indicate mean quantity of interferon gamma secreted after stimulation (pg/ml).
Example 7
Preparation of Glyco-Conjugates by conjugating LPS of Brucella species with rET
Equal volumes of LPS and rET (5 mg/ml each) were mixed and pH was adjusted to 5.0 with 0.1 N HCI. To this, l-ethyl-3-(3-dimethylaminopropyl) carbo-di-imide (EDAC) (Sigma, USA) was added to a final concentration of 0.1 M. The pH was maintained at 5.0 by addition of 0.1 N HCI for 3 hours at room temperature. The reaction mixture was stirred at 3°C to 8°C for an additional 24 hours, dialyzed against water for 48 hours (6-7 buffer changes). The dialyzed mixture was taken up for direct blending with 2% Aluminium Hydroxide gel for preparation of vaccine containing 25 ugofLPS per dose.
Example 8
Potency of S 19LPS-rET conjugate vaccine in mice
A DNA vaccine from Brucella abortus strain S19 is prepared. Also a glyco-conjugate vaccine using the lipo-polysaccharide (LPS) of Brucella abortus and rET was prepared. The vaccine was administered in mice subcutaneously (25 jj,g S19 LPS-rET per dose). Test were conducted using a S19 LPS -rET and combination vaccine using S19 LPS -rET + pOMP. Separate groups of mice were also vaccinated with live, attenuated S19 vaccine. Mice were challenged 30 days post vaccination with B. abortus 544 strain. The S19 LPS-rET glyco-conjugate vaccinated mice and combination of S19 LPS -rET + pOMP were protected against the challenge. The combination vaccine containing S19 LPS -rET + pOMP and the conjugate vaccine S19 LPS -rET alone have given 100 % protection as compared to S19 live attenuated vaccine which has given 80 % protection. Table 12 shows the potency results of B. abortus S 19 LPS-rET glyco-conjugate vaccine with or without pOMP-25 DNA vaccine in CD1 mice.
Table 12 Potency results of B. abortus S 19 LPS-rET glyco-conjugate vaccine with or without pOMP-25 DNA vaccine in CD1 mice.
§ Log colony forming units of B. abortus in spleens of challenged mice. The numbers indicate average of each experimental group. fProtective index was calculated by subtracting the mean Log cfu/ml of the vaccine groups from the controls.
Although the subject matter has been described in considerable detail with reference to certain preferred embodiments thereof, other embodiments are possible. As such, the spirit and scope of the appended claims should not be limited to the description of the preferred embodiment contained therein.
I/We Claim:
1. A glyco-conjugate vaccine against brucellosis that confers both cell mediated immune response and humoral response in a subject, said vaccine comprises lipo-polysaccharide (LPS) from smooth or rough strains of Brucella abortus conjugated to a protein carrier.
2. The vaccine as claimed in claim 1, wherein the lipopolysaccharide is selected from a group consisting of SI9, Rev 1, 544,2308.
3. The vaccine as claimed in claim 1, wherein the protein carrier is selected from a group consisting of outer membrane protein complex (OMP), exo-protein A of Pseudomonas Aeruginosa, epsilon toxin of Clostridium perfringens protein and a CTB fragment from cholera toxin.
4. The vaccine as claimed in claim 1, wherein the protein carrier is a recombinant protein.
5. The vaccine as claimed in claim 1 further comprises plasmid DNA encoding OMP 25 fragment of Brucella species, ribosomal L7/L12 gene, or a periplasmic protein Cu, Zn Superoxide dismutase (SOD) of Brucella Species.
6. The vaccine as claimed in claim 1 further comprises inactivated or live attenuated Brucella species.
| # | Name | Date |
|---|---|---|
| 1 | 533-CHE-2009 CORRESPONDENCE OTHERS 09-03-2009.pdf | 2009-03-09 |
| 2 | 533-CHE-2009 FORM-3 09-03-2009.pdf | 2009-03-09 |
| 3 | 533-CHE-2009 FORM-1 09-03-2009.pdf | 2009-03-09 |
| 4 | 533-CHE-2009 DESCRIPTION (PROVISIONAL) 09-03-2009.pdf | 2009-03-09 |
| 5 | 533-CHE-2009 POWER OF ATTORNEY 27-04-2009.pdf | 2009-04-27 |
| 6 | 533-CHE-2009 FORM-1 27-04-2009.pdf | 2009-04-27 |
| 7 | 533-CHE-2009 REQUEST FOR POSTDATING 04-03-2010.pdf | 2010-03-04 |
| 8 | 533-CHE-2009 CORRESPONDENCE 09-09-2010.pdf | 2010-09-09 |
| 9 | 533-CHE-2009 FORM-5 09-09-2010.pdf | 2010-09-09 |
| 10 | 533-CHE-2009 FORM-3 09-09-2010.pdf | 2010-09-09 |
| 11 | 533-CHE-2009 FORM-2 09-09-2010.pdf | 2010-09-09 |
| 12 | 533-CHE-2009 FORM-1 09-09-2010.pdf | 2010-09-09 |
| 13 | 533-CHE-2009 DRAWINGS 09-09-2010.pdf | 2010-09-09 |
| 14 | 533-CHE-2009 DESCRIPTION (COMPLETE) 09-09-2010.pdf | 2010-09-09 |
| 15 | 533-CHE-2009 CLAIMS 09-09-2010.pdf | 2010-09-09 |
| 16 | 533-CHE-2009 ABSTRACT 09-09-2010.pdf | 2010-09-09 |
| 17 | 533-che-2009 form-5 12-11-2010.pdf | 2010-11-12 |
| 18 | 533-che-2009 form-1 12-11-2010.pdf | 2010-11-12 |
| 19 | 533-CHE-2009-FER.pdf | 2018-01-24 |
| 20 | 533-CHE-2009-FER_SER_REPLY [24-07-2018(online)].pdf | 2018-07-24 |
| 21 | 533-CHE-2009-CORRESPONDENCE [24-07-2018(online)].pdf | 2018-07-24 |
| 22 | 533-CHE-2009-COMPLETE SPECIFICATION [24-07-2018(online)].pdf | 2018-07-24 |
| 23 | 533-CHE-2009-Correspondence to notify the Controller (Mandatory) [10-10-2019(online)].pdf | 2019-10-10 |
| 24 | 533-CHE-2009-HearingNoticeLetter12-10-2019.pdf | 2019-10-12 |
| 25 | 533-CHE-2009-HearingNoticeLetter14-10-2019.pdf | 2019-10-14 |
| 26 | 533-CHE-2009-Written submissions and relevant documents (MANDATORY) [21-10-2019(online)].pdf | 2019-10-21 |
| 27 | Marked up Claims_Granted 323610_24-10-2019.pdf | 2019-10-24 |
| 28 | Drawings_Granted 323610_24-10-2019.pdf | 2019-10-24 |
| 29 | Description_Granted 323610_24-10-2019.pdf | 2019-10-24 |
| 30 | Claims_Granted 323610_24-10-2019.pdf | 2019-10-24 |
| 31 | Abstract_Granted 323610_24-10-2019.pdf | 2019-10-24 |
| 32 | 533-CHE-2009-PatentCertificate24-10-2019.pdf | 2019-10-24 |
| 33 | 533-CHE-2009-IntimationOfGrant24-10-2019.pdf | 2019-10-24 |
| 34 | 533-CHE-2009-RELEVANT DOCUMENTS [13-03-2020(online)].pdf | 2020-03-13 |
| 35 | 533-CHE-2009-RELEVANT DOCUMENTS [15-09-2021(online)].pdf | 2021-09-15 |
| 36 | 533-CHE-2009-RELEVANT DOCUMENTS [28-09-2022(online)].pdf | 2022-09-28 |
| 37 | 533-CHE-2009-RELEVANT DOCUMENTS [14-08-2023(online)].pdf | 2023-08-14 |
| 1 | 533CHE2009Patseersearchstrategy_05-01-2018.pdf |