Sign In to Follow Application
View All Documents & Correspondence

Vaccine For Chikungunya Virus Infection

Abstract: The present invention relates to a pharmaceutical formulation capable of eliciting protective immune response against Chikungunya virus infection in humans and other mammalian hosts. The immunogenic formulation comprises purified inactivated Chikungunya virus in a stable formulation. Methods of propagation and purification of the virus are discussed. The inactivated virus formulation is non-infectious, immunogenic and elicits protective immune response in mammalian host. The immunogenic composition is formulated for in vivo administration to humans. The immunogenic preparation may also find use in diagnosing for the presence of the virus.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
01 September 2006
Publication Number
18/2008
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

BHARAT BIOTECH INTERNATIONAL LIMITED
BHARAT BIOTECH INTERNATIONAL LIMITED GENOME VALLEY, TURKAPALLY, SHAMEERPET MANDAL, RANGAREDDY, HYDERABAD-500078,

Inventors

1. KANDASWAMY SUMATHY
BHARAT BIOTECH INTERNATIONAL LIMITED GENOME VALLEY, TURKAPALLY, SHAMEERPET MANDAL, HYDERABAD-500078,
2. ELLA KRISHNA MURTHY
BHARAT BIOTECH INTERNATIONAL LIMITED GENOME VALLEY, TURKAPALLY, SHAMEERPET MANDAL, HYDERABAD-500078,

Specification

This invention relates to a Vaccine for Chikungunya virus infection FIELD OF THE INVENTION:
The present invention relates to vaccine formulation capable of eliciting protective immune response against Chikungunya virus (CHIKV) infection in humans and other mammalian hosts. The immunogenic formulation comprises purified inactivated Chikungunya virus in a stable formulation. The method of adaptation and propagation of the virus in vitro in continuous cell culture in vaccine quality cell lines such as Vero and MRC-5 cells that are approved by FDA/National Regulatory Authority is provided. Purification and methods of inactivation of the virus are discussed. The method of preparation and administration of liquid and lyophilized formulations of the virus with added stabilizers is discussed. The inactivated virus preparation is non-infectious, immunogenic and elicits protective immune response in mammalian host. The immunogenic composition is formulated for in vivo administration to humans. Within the scope of the present invention is the strategy of developing a subunit vaccine using the recombinant virus proteins as antigens capable of eliciting protective immune response against Chikungunya virus infection in mammalian hosts. The recombinant antigens could potentially find use in diagnosing for the presence of the virus.
BACKGROUND OF THE INVENTION:
Disease and epidemiology: Chikungunya is a physically debilitating disease of humans mainly in Africa and Asia. The symptoms include abrupt onset of high fever, rash or hemorrhages, arthralgia and occasional involvement of the nervous system, heart and liver. The incapacitation is due to arthralgia, which can persist for years (Sarkar et al., 1965; Rao et al., 1965; Nimmannitya et al., 1969; Schuffenecker et al., 2006). The disease is caused by Chikungunya virus (CHIKV), and is spread by Aedes spp. mosquitoes, either through other forest-dwelling vertebrate hosts (in Africa) or by a human-mosquito-human cycle (in Asia) (Powers et al., 2000). There have been several major outbreaks of the disease, including the recent ones in the Indian Ocean, Malaysia and India, with several thousands of people afflicted. In India, the major outbreaks appear to have occurred once in the 1960s and then in 2005-2006 (Shah et al., 1964; Rao et al., 1965; Chaturvedi et al., 1970; Ravi, 2006). In the recent outbreak, several districts in Karnataka, Andhra Pradesh, Tamil Nadu, Maharashtra, and possibly Orissa have been affected. The disease can be diagnosed by various serological tests, but definitive identification requires verification of the genetic material since many closely related arboviruses cause similar disease. Treatment is only palliative and there is no commercially available vaccine.
The virus harbors a single-stranded, positive sense RNA genome, and belongs to group A arboviruses along with Sindbis and Semliki Forest disease viruses in the alphavirus genus of Togaviridae family (Fauquet et al., 2005). The virion is 50-60 nm in size and is inactivated by 70% ethanol, 1% sodium hypochlorite, 2% glutaraldehyde, lipid solvents, moist or dry heat > 58° C, as well as drying.
Genotyping suggests the existence of three clades: West African, East-Central-South- African and Asian. The Asian and African strains form closely-related clades that differ from each other in sequence, antigenicity and virus properties. The Asian isolates appear to be more conserved than either of the African clades (Powers et al., 2000; Schuffenecker et al., 2006). The recent Indian Ocean outbreak isolates show a characteristic change from Alanine to Valine in position 226 of the envelope glycopriten El from early to later phase of the disease, respectively (Schuffenecker et al., 2006). While the importance of this is not understood, an evolutionary advantage for the virus can be surmised.
Not much is known about the viral proteins, their function or pathogenicity. The genome consists of -12 kilobases, with a 5' 7mG cap and the 3' poly(A) region, and a base composition of 30% A, 25% C and G, and 20% U. The genome has the sequence of 5'- nsPl-nsP2-nsP3-nsP4-(junction region)-C-E3-E2-6K-El-polyA-3'. The non-structural proteins are translated directly from the 5' two-thirds of the genome, and the structural proteins are produced from the 26S subgenomic RNA which is collinear with the 3' one- third of the genome. The genome contains conserved repeat sequences as well as an internal poly(A) tract within the 3' non-translated region (Khan et al., 2002; Schuffenecker et al., 2006).
Based on sequence information, it has been deduced that nsPl, nsP2, nsP3, nsP4, C, E3, E2, 6K and El proteins contain 535, 798, 530, 611, 261, 64, 423 and 61 amino acids (Khan et al., 2002; Schuffenecker et al., 2006). The envelope proteins can be observed on SDS gels as 62 kD E2/E3, which is cleaved into E2 and E3 within 90 mins, and 45-50 kD El and E2 that migrate closely together. El and E2 associate tightly with each other rapidly. The 11 kD E3 protein is not associated with the virion, and is released into the medium (Simizu et al., 1984; Ranadive and Banerjee, 1990).
The viral El glycoprotein agglutinates erythrocytes, and hemagglutination (HA) and ht nagglutination inhibition (HI) tests can be performed routinely on goose erythrocytes for diagnostic purposes. HA activity of the virus is not susceptible to trypsin, and is enhanced by tween-ether treatment (Hannoun, 1968). Serum with HI titers of >40 generally shows neutralization capacity (Bedekar and Pavri, 1969b). Isolation of virus can be performed in newborn rats or mice, or in animal or insect cell cultures. Vero, African green monkey kidney, BHK21, BSC-1, chick embryo fibroblasts and C6/36 cells have been used for in vitro virus isolation and expansion. The virus replicates fairly rapidly in cell culture. Depending on dose and on the cell line, cytopathic effect can be observed in 12-48 hrs. At multiplicities of 1-5, following a 5-6 hr eclipse period, the intracellular virus titer rises sharply and reaches peak by 12 hrs. Extracellular virus can be observed at 8 hrs post-infection and peaks at 12-24 hrs depending on the cell system and dose of the inoculum (Chain et al., 1966; Higashi et al., 1967; Hahon and Hankins, 1970; Eckels et al., 1970). Spread of infection through the monolayer differs in different cell types, involving both extracellular and cell-to-cell transmission in BHK21 cells, but only the former in L929 and guinea pig lung cells (Hahon and Zimmerman, 1970). Titers in supernatants can reach as high as that observed with mouse brain preparations (Shah et al., 1964; Paul and Singh, 1968; Umrigar and Kadam, 1974).
The virus can be concentrated from cell culture supernatant by ultracentrifugation, or precipitation with ammonium sulphate, alum, or polyethylene glycol (Eckels et al., 1970; Klein et al., 1970; Baneijee and Ranadive, 1988; Killington et al., 1996). The virus can be further purified by using rate zonal centrifugation, equilibrium density gradient or gel filtration (Eckels et al., 1970; Simizu et al., 1984; Baneijee and Ranadive, 1988). Titration of the virus can be performed by immunofluorescence, ELISA, complement fixation, agar gel immunodiffusion, hemagglutination and inhibition, plaque assays, or neutralization.
It is unknown how CHIKV or other alphaviruses cause arthritis. Suggested mechanisms include replication leading to cell death and tissue damage, immune-mediated attack on the joints, or immune-complex-mediated inflammation. While Semliki forest virus and Ross River virus have been shown to known to replicate in bone-associated connective tissue in neonates as well as skin and muscle in adult mice (Heise et al., 2000), no such study has been done with CHIKV.
In contrast to Dengue virus, which requires adaptation fi infection of animals, CHIKV shows rapid and high fatality on primary inoculation of clinical samples (Myers et al., 1965). However, newborn mice and rats are the only species that show disease (Chakravarthy and Sarkar, 1969). In a dose-dependent manner, rat/mouse pups show illness and high mortality following intracerebral, intraperitoneal or subcutaneous inoculation of patient sera in 3-10 days, yielding 105 5-107 0 mouse-LD50 of virus per mL of serum (Shah et al., 1964). Animals rapidly manifest sluggishness, severe inappetence, cyanosis, dermal hypothermia, and death. Pathologically, they show cardiac enlargement, hemorrhages in gastrointestinal tract, alveoli, bladder, joints and skin, skeletal muscle and fat pad necrosis, and diffuse intestinal dysfunction (Nimmannitya et al., 1969; Weiss et al., 1965). Survivors (injected lower doses) show stunted growth, but develop HI antibodies and are protected from challenge after intracerebral or intraperitoneal challenge (Shah et al., 1964; Giovarelli et al., 1977). Newborn bunnies and guinea pigs are moderately susceptible with some virus recovery, and one-day kitten are less susceptible. Adult mice, rats, guinea pigs, hamsters, hare and rabbits show viremia, but not disease, and develop HI and neutralizing antibodies, whereas adult cats and fowl don't. Low titers of HI antibodies without viremia or neutralizing antibodies can be seen in cows, sheep, goats and horses (Mcintosh et al., 1963; Bedekar and Pavri, 1969a; Chakravarthy and Sarkar, 1969). The susceptibility of birds is controversial. In one study, white leghorn chicks have been shown to succumb to virus inoculation, and recovered birds develop neutralization antibodies (Bedekar and Pavri, 1969a). This and other studies involving chicken, sparrows, pigeons and bats have shown seroconversion without viremia or nothing (Shah et al., 1964; Bedekar and Pavri, 1969a).
Adult monkeys belonging to various species show viremia, can transmit virus to mosquitoes, and develop long lasting neutralizing antibodies (Paul and Singh, 1968). Wild monkeys and baboons in Aftica circulate high titres of the virus without any apparent sickness as a result of infection, and can transmit the virus to through mosquitoes (Mcintosh et al., 1963). However, serological evidence of natural infection of monkeys does not exist in India (Bedekar and Pavri, 1969b).
CHIKV infection (whether clinical or silent) is thought to confer life-long immunity. Because of close antigenic relationship, cross-protection between different strains (Casals, 1957; Porterfield, 1961; Shah et al., 1964) as well as reciprocal cross-protection among other alphaviruses (Parks and Price, 1958; Hearn and Rainey, 1963) can be hypothesized, and is demonstrated in animal models. However, there is some evidence that live attenuated alphavirus vaccines may interfere with a subsequent, related vaccine (McClain et al., 1998).
As a prelude to vaccines, initial CHIKV preparations involved either formalin inactivation (Harrison et al., 1967) or tween-ether extraction of virus grown in vitro (Eckels et al., 1970). While formalin kills HA activity, the latter treatment retains the HA activity completely, although both lose infectivity drastically. However, they both elicit similar HA and complement-fixing and neutralization antibodies and also show similar levels of protection in lethal challenge studies (Eckels et al., 1970).
US Army Medical Institute of Infectious Diseases in Fort Detrick, Maryland made a candidate vaccine for CHIKV. CHIKV strain 15561 from Thailand (1962 outbreak) was used to develop a small lot of green monkey passaged, formalin- inactivated preparation that was administered to 16 volunteers who showed high immune responses and no adverse effects (Harrison et al., 1971). The GMK-passaged virus was further serially passaged by plaquing 18 times in MRC-5 cells (Levitt et al., 1986), and found to be safe and immunogenic in phase I trial with 15 alphavirus-na'ive individuals, viremia occurring on day 2-4 post-inoculation (McClain et al., 1988). In a randomized, double-blind, placebo-controlled, phase II trial, 73 alphavirus-na'ive volunteers of 18-40 years were injected with 0.5 mL dose containing either ~105 PFU of virus (59 subjects) or placebo (14 subjects) subcutaneously. Serological evaluation involved plaque reduction neutralization titer (PRNT), and a 50% reduction titer of >20 was considered positive. Local and systemic reactions were limited to vaccine take whereas 8% of CHIKV vaccinees (and none of placebo group) showed arthralgia. 98.3% of vaccinates seroconverted by day 28, achieving peak PRNT50 titers of 1:10240 at 28-42 days. Although antibody levels declined somewhat over time, 85% of the vaccinees were still seropositive at one year, with titers of 1:1280 at 180-360 days (Edelman et al., 2000).
BRIEF DESCRIPTION OF THE FIGURES:
Fig.l: A- Control uninfected Vero cells B- CHIK infected Vero cells C- Control MRC-5 cells
D- CHIKV infected MRC-5 Ceils E- BHK21 Control cells F- CHIKV infected BHK21 cells
Fig.2: SDS-PAGE of purified CHIKV preparation depicting the EI and E2 proteins that appears to be more predominant than the virus antigens. The virus sample was run in 12% denaturing SDS-PAGE gel and visualized by silver staining. The two proteins appear to be approximately 46 - 50 kD in size.
Fig.3: In vivo toxicity of the purified Chikungunya virus isolate CHK/03/06 after intracerebral injection in mice. 2- day old mice were injected purified Chikungunya virus isolate CHK/03/06 intracerebrally and the control animals were injected with equal volume of PBS.
Panel A- control mice 7 days after injection of PBS
Panel B- mice injected with purified virus were found dead on the 6th day after
intracerebral injection of the purified virus preparation, tli
Panel C - On the 9 day after intracerebral injection in 2-day old mice, the PBS injected control animal shows normal growth (left) and the mice injected with 1:64 dilution of the purified virus preparation shows severe growth retardation.
Fig.4: Transmission Electron Micrograph (TEM) of the CHK/03/06 isolate at 200 K magnification
Fig.5 Ethidium bromide stained photograph of RT-PCR products of CHK/01/06 and CHK/03/06 virus isolates amplified with gene specific primers for the CHIK virus. Lane 1 - CHK/01/06 amplified with CHK SP FP1 and CHK SP RP5; ~ 550 bp Lane 2 - CHK/03/06 amplified with CHK SP FP1 and CHK SP RP5; ~ 550 bp M- Molecular size marker; 1 kb ladder; (N3232S; New England Biolabs) Lane 4 - CHK/01/06 amplified with CHK SP FP3 and CHK SP RP4; ~ 686 bp Lane 5 - CHK/03/06 amplified with CHK SP FP3 and CHK SP RP4; ~ 686 bp Lane 6 - CHK/01/06 amplified with CHK SP FP1 and CHK SP RP 5; ~ 637 bp Lane 7 - CHK/03/06 amplified with CHK SP FP1 and CHK SP RP 5; ~ 637 bp
Fig.6 Haemagglutination (HA) of the CHK/03/06 virus using fresh goose erythrocytes. The first two rows ls the HA titer of the virus harvest from Vero cells in serial dilut on. The last two rows is the HA titer of the serially diluted purified CHIK virus preparation showing an increase in the HA titer.
Fig.7. RT-PCR of the viral structural proteins.
Panel A - Lane 1- Capsid PCR product; Lane 2- 100 bp ladder; Lane 3 - E2 PCR product
Panel B - Lane 1 - El PCR product; Lane 2 - 1 Kb ladder Panel C - Lane 1-100 bp ladder; Lane 2 - E3 PCR product
Fig.8 SDS-PAGE of induction of cloned El protein in E.coli expressed cells. Lane 1 - uninduced cells; Lane 2 - protein molecular size marker; Lane 3 - E.coli cells 4 hours after induction with IPTG showing the induction of ~ 47 kD El protein.
Fig.9 SDS-PAGE of the induced ~ 30 kD Capsid protein in Pichia pastoris; Lane 1 - protein expression at 0 hours after induction with methanol; Lane 2- at 72 hours after induction with methanol; Lane 3 - protein molecular size marker.
SUMMARY OF THE INVENTION:
The scope of the present invention includes the procedure for isolation of Chikungunya (CHIK) virus from infected human serum samples, methods for adaptation and propagation of the virus in a continuous culture to a high titer in an FDA/National Regulatory Approved cell lines such as Vero and MRC-5 and harvesting the virus from the infected cells in culture. The methods described in the present invention are applicable to any genotype/strains/genetic variants of Chikungunya virus and is known to those skilled in the art. The scope of the current invention includes methods used for the purification of the virus from the infected cells substantially free of cellular and serum components. One of the methods used in the current invention includes the use of proprietary Himax™ technology for purification of the virus. The purified virus is inactivated either by heat or chemically inactivated with one of the inactivating agents that includes but is not limited to the following agents: formalin, beta-propiolactone, glutaraldehye, non-ionic detergents, ascorbic acid etc. The vaccine formulation comprises a pharmaceutical^ accepted buffer such as phosphate or phosphate-citrate ouffer in the pH range 6.4 - 7.5 with added stabilizing agents t at includes one or more of the following but is not limited to: human serum albumin, gelatin, reducing and non- reducing sugars, amino acids, polyols such as sorbitol and mannitol, glycerol organic and inorganic salts, polyvinyl pyrrolidone etc. The stable formulation in a liquid form is suitable for intramuscular/intradermal/subcutaneous/intravenous administration in a human host. The stable formulation in a dry lyophilized form can be reconstituted with a suitable solvent before administration. The formulations are suitable for oral and intranasal administration in humans. The efficacy of the vaccine formulation has been established by various methods such as virus neutralization test and hemagglutination inhibition assay. The estimation of the antigenic protein is by using standard protein estimation methods and by ELISA. Potency of the vaccine has been tested in animal models. The potency of the vaccine formulation has been tested in doses ranging from 1 (ig upto 200 jxg of the antigen where the inactivated virus is the active ingredient in the formulation. A high rate of seroconversion and protective antibodies against the virus has been observed in rabbits that have been administered the formulation.
The adaptation and growth of the virus in a continuous cell culture in a cell line such as Vero/MRC-5 that is approved by FDA and National Regulatory Authorities offers an affordable, reproducible and an easy to be validated method of propagation of Chikungunya virus in continuous cell culture suitable in industrial scale production of a stable formulation of the virus that can be used as a vaccine. The stable formulation of the inactivated Chikungunya virus with added stabilizers is immunogenic eliciting protective immune response against Chikungunya virus strains.
The present invention also describes a strategy for developing a subunit vaccine using recombinant virus proteins as antigens. The viral proteins can be expressed as recombinant proteins either in prokaryotic or eukaryotic host cells. As known to those skilled in the art, the methods of cloning and expression described herein are applicable to any genetic variants/mutants of the virus proteins.
DETAILED DESCRIPTION OF THE INVENTION:
The properties of the Chikungunya virus particles as an immunogen, adaptation and propagation of the virus in host cell lines to a high titer, determination of the identity of
the virus by RT-PCR, electron microscopy; methods of purification and inactivation of the virus, preparation of stable liquid and tyophil .zed vaccine formulation(s) in a pharmaceutically acceptable carrier suitable for administration in human, viral methods and tests for vaccine potency in animal model have been discussed.
The active ingredient or immunogen, of the vaccine described in the current invention is inactivated virus particles of Chikungunya virus. The methods described in the current invention are applicable to any genotype/strains of Chikungunya virus. The virus particles obtained from the clinical isolates from patients' serum have been adapted and propagated in vitro in cell monolayers for several passages. In alternative protocol, the virus particles have been passaged once through 2 day old suckling mice and the virus re-isolated and passaged in cell monolayers in vitro.
The Chikungunya (CHIK) virus vaccine according to the present invention refers to an active ingredient (immunogen) of an inactivated Chikungunya virus that is produced under cGMP conditions by infecting in a monolayer of Vero cells or MRC-5 cells in continuous cell culture where the cells are used as host cells for culturing the Chikungunya virus. The cell line is qualified through various quality control tests and is approved by FDA/National Regulatory Authority as a vaccine quality cell line. The virus is propagated in large quantities by growing to a high titer (~109) in cell culture and purified from infected cells. The virus is inactivated either by heat or with an inactivating agent.
A neutralizing antibody titer of the anti-serum obtained by immunization with the above particles in a stable formulation, as measured by in vitro neutralization assay offers protective immunization in animals.
The immunogen of a Chikungunya virus vaccine is a representative example of an immunogen of a vaccine against infectious diseases caused by Chikungunya viruses of any strain or genotypic variants of the Chikungunya virus. The vaccine of the present invention is provided in a sealed vial or ampoule in a liquid or lyophilized form. In the case of liquid formulation, it can either be subcutaneously / intramuscularly / intradermally/intravenously injected or orally / intranasally administered to a subject to be vaccinated in an amount of about 0.05ml to 5 ml per person. In the case of a dry
lyophilized formulation, it is injected after being re-solubilized with a suitable solubilizing solution.
According to the present invention, the method that is applicable to strains of Chikungunya virus being used in the current invention is applicable to any Chikungunya virus strain with a broad antigenic spectrum. The broad spectrum antigenic response would offer a satisfactory immune protection against plural strains of CHIK virus in addition to the virus strain used in production of the vaccine. As known to those skilled in the art, a divalent or polyvalent vaccine may be prepared by mixing vaccines produced from two or more CHIK virus strains that have been genetically confirmed as CHIK viruses and is mixed in a suitable ratio based on the antigenic protein content. Such mixing would provide a vaccine preparation having a broader antigenic spectrum for protection against the infection.
According to the current invention, inoculating an appropriate host cell line such as Vero cells/MRC-5 cells with the virus, and maintaining the infected cells in continuous culture A culturing method involves infecting the host cell monolayer with the virus and harvesting the virus in sufficient quantities from the infected host cells. The virus grown in cell layers could include a population of the extracellular virus that is obtained in the supernatant of the infected cell culture that can be harvested by centrifiigation, and harvesting the virus that is cell associated by sonication and centrifiigation.
A cell line that can be propagated in vitro in culture can be used as a host for virus culture. For example, diploid cell lines such as MRC-5 and WI-38 and serially passaged cell lines such as Vero, BHK-21, CHO cells etc. can be used. For propagating Chikungunya virus strains, preferably permissive cells are selected which allow the virus to grow well. For example Vero (ATCC No. CCL-81), BHK-21 (ATCC No. CCL-10), C6/C3 (ATCC No. CRL-1660) etc. are preferably used. One such cell line used in the current invention is Vero cells which have been validated for use as a host cell for vaccine production. The validated Vero cell lines conforms to the Requirements for Biological Substances No.50 regarding requirements for use of cells for the production of biologicals recommended by the World Health Organization (WHO) thereby confirming these cell lines as qualified for producing a vaccine (WHO Technical report Series, No. 878, pp 19-52, 1998). Furthermore CV-1, BSC-1, MAI 04, MDCK, CaCO-2 etch and DBS-FLC-1, DBS-FLC-2, DBS-FRhl-2, ESK-4, HEL, IMR-90, WRL68, etc. conventionally used for producing a virus vaccine can also be used ("ATCC Microbes and Cell at Work", 2nd Edition., ppl44, American Type Culture Collection (ATCC) 1991, USA).
For maintenance in cell culture of the above-mentioned cell lines, stationary culture in monolayers, perfusion system culture, shake flasks, roller tube/bottle culture, suspension culture, microcarrier culture, cell factories and cell stacks and the like can be adopted. For example commercially available Cytodex (Pharmacia Biotech, Sweden) of various types are used as a microcarrier, and other commercially available animal cell culture devices can be used.
An inactivating agent such as formalin, beta-propiolactone, and glutaraldehyde is added to a virus suspension to inactivate the virus. For example when using formalin and beta- propiolactone, the amount to be added is about 0.001% to 0.4% (v/v), the inactivation temperature is about 2-8 DEG C to about 40 DEG C and the inactivation duration mainly depends upon the inactivation temperature. For e.g. it could range between 2 hours to72 hours at 37 DEG C and about 12 hours to 250 hours at 2 - 8 DEG C. Inactivation is also effective at intermediate temperatures of around 22 DEG C for a period of 2-120 hours. Inactivation of the virus can also be carried out by non-ionic detergents and ascorbic acid. Heat inactivation is effective for Chikungunya virus at temperatures at around 56- 58 DEG C for one hour.
Purification of the virus is conducted by physical means or chemical means and preferably by a combination of both. Physical methods utilize the physical properties of the virus such as density, size, mass, sedimentation coefficient etc. and includes any of the following techniques but is not limited to: zonal ultra-centrifugation, density gradient centrifugation, ultrafiltration with membranes with size cut offs ranging from 50 - 1000 kDa to remove serum and cellular components. Purification through chemical means employs methods such as adsorption/desorption through chemical or physiochemical reactions and includes for example purification by ultracentrifugation, density gradient centrifugation, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography, salting with inorganic salts one such example being ammonium sulphate, and by the use of proprietary Himax™ technology, organic salts, organic solvents, aluminium phosphate, aluminium hydroxide and organic compounds such as polyethylene glycol. Purification of the virus is achieved by either one c; a combination of two or more of the above mentioned methods.
Concentration of the virus is achieved by low - speed centrifugation with ultrafiltration membrane, precipitation with salts or purification with Himax™ Technology Inactivation of the virus particles can be achieved either before or after purification of the virus.
The virus can be visualized by a negative staining method using 2% (w/v) uranyl acetate can be observed under an electron microscope at a magnification of about 20,000 to about 200,000.
The genetic identity of the CHIK virus was confirmed by sequencing the cDNA complementary to the genomic RNA of the strains. More specifically, genomic RNA was extracted from virus infected cells or from the purified CHIKV after pelleting by ultracentrifligation or isolation on a density gradient. Thereafter, a region encoding an envelope protein or non-structural protein was further amplified by reverse transcriptase polymerase chain reaction (RT-PCR) using a pair of primers and the base sequence of the resultant cDNA is determined by dideoxy chain termination method. The amino acid sequence encoded by the base sequence was decoded using universal codes and the genetic identity of the virus was confirmed as Chikungunya virus.
An inactivated virus particle of the present invention is diluted with any suitable diluent that is pharmaceutically acceptable so as to obtain the desired titer. The buffer used in the formulation may be phosphate or phosphate-citrate buffer. A vaccine may optionally contain preservative(s), stabilizer(s) etc. Reducing and non-reducing sugars, sugar alcohols such sorbitol and mannitol, glycerol, amino acids, human serum albumin is added in the range of 0.01% to 10% for the liquid formulation and upto 60% of the total solids for a lyophilized formulation. Such a stable fqrmulation of the immunogen either in a liquid or in a lyophilized form and after reconstitution in a pharmaceutically acceptable buffer or water is suitable for administration intradermally/subcutaneously/intramuscularly/intravenously in human host and is also suitable for oral and intranasal administration.
The vaccine for Chikungunya virus alternatively could be a subunit vaccine prepared with the structural proteins such as, Capsid, El and E2 md E3 glycoproteins of the Chikungunya virus strains either cloned and expressed individually and purified for constituting a vaccine formulation, or by expressing the entire structural polyprotein consisting of the Capsid, E3, E2, 6K polypeptide and El proteins that is cloned as a single polypeptide with a potential to assemble into a Virus Like Particle (VLP) in eukaryotic host cells such as yeast, in insect cells via baculovirus mediated expression, and in mammalian cells after being processed by host signal peptidases. The VLPs are highly immunogenic as they mimic the native virus particle in structure when processed correctly for assembly by the host signal peptidases. They contain multiple copies of the antigenic proteins in their assembled structure. The viral proteins either expressed in prokaryotic or eukaryotic host cells are purified free of host cell proteins. The purified structural proteins can be administered in a formulation and by the methods described above. The addition of Histidine residues to either end of the recombinant proteins while cloning facilitates purification of the recombinant proteins.
In another aspect of the invention, virus particles obtained according to the present invention, as well the recombinant viral proteins can be used as a reagent (as an antigen) in the diagnostic tests e.g. as an antigen in an immunoprecipitation method, a hemagglutination inhibition (HI) test, complement fixation (CF) reaction, ELISA, radioimmunoassay, immunofluorescence, Western Blot and the like. More specifically using the entire or a part of an inactivated virus particle of the present invention, a diagnostic assay with high sensitivity and specificity for detecting infection by different strains of the Chikungunya virus can be provided. As used herein the term "a part" of an inactivated virus particle refers to a fraction of the virus which retains desired antigenicity and is derived from the virus particles including for example, structural protein solubilized during the purification step described in the given examples or expressed in a recombinant expression system. Polyclonal antibodies or monoclonal antibodies specific for the virus can be used in a diagnostic assay for Chikungunya virus infection.
For potency testing of the vaccine, the vaccine formulations were tested in Balb/c mice and rabbits. The animals in each group were injected intraperitoneally with about 0.2 to 0.5ml /mouse of serially diluted vaccine preparation ranging in dose from 1 ng to about 500 jig for the different test groups. A booster dose was given 7-14 days after the first administration of the antigen. A formulation of the inactivated virus preparation formulated in aluminium hydroxide in combination with oligonucleotides gave a higher immune response. The resultant serum was assayed by in vitro neutralization tests and the antibody titer was determined by ELISA. Seroconversion was observed in the animals immunized with the vaccine formulation.
The following examples are included solely to aid in a more complete understanding of the invention described and claimed herein. The examples do not limit the scope of the claimed invention in any fashion it should not construe the scope of the protection of the claims. However, one of the ordinary skilled in the art appreciates the modifications and changes can be made without departing from the scope of the present invention as set forth in the claims below.The benefits, advantages, solutions to problems, and any element(s) that may cause any benefit, advantage, or a solution to occur or become more pronounced are not to be construed as critical, required, or essential features or elements of any or all the claims. The invention is defined solely by the appended claims including any amendments made during the dependency of this application and all equivalents of those claims as issued.
EXAMPLE 1:
Proliferation in a cell line for virus culture: Vero cell line (ATCC No. CCL-81), BHK-21 cells and MRC-5 cells were used as candidate cell lines for Chikungunya virus (CHIKV) culture and good viral propagation in each cell line was observed. Vero cells and BHK- 21 cells were each prepared in a growth medium consisting of DMEM (Dulbecco's Modified Eagle Medium; Sigma-Aldrich Catalog # D5523 and used per the manufacturer's instructions) containing 5% fetal bovine serum (FBS). They were statically incubated at 37° C until reaching 80 - 100 % confluence of the monolayer. Thereafter the number of cells was counted. MRC-5 cells were prepared in growth medium consisting of MEM (Minimal Eagle's Medium) buffered to neutral pH with Hepes buffer and consisting of 5% FBS, was statically incubated at 37°C for 6 days and thereafter the cells were counted. In an alternate procedure, Vero cells and MRC-5 cells were cultured in serum free medium. For scaling the production of cells for virus infection, one cryo vial containing 5 x 106 viable Vero cells from working cell bank were used for seeding one T175 Cell culture grade flask. DMEM containing 5 % FBS and 50 (ig/ml of neomycin sulfate was used for revival and replenishing the cells. After 90 % of the confluence of the cell monolayer in T175 flasks, the cells were trypsinized and propagated further in cell factories / cell stacks (CF10). The same DMEM medium is used for propagation 2.0 L/ CF10).
EXAMPLE 2. Isolation of the virus:
Chikungunya virus (CHIKV) was isolated from serum of infected patients who had the classical clinical symptoms of Chikungunya virus infection. The Indian isolate(s) of the virus were used in the development of the vaccine formulation. Of the many isolates obtained, two isolates namely, CHK/03/06 and CHK/01/06 were characterized. The blood sample drawn from the patient was transported at 4°C and the serum was separated. The serum was diluted 1:1 with phosphate buffered saline (PBS) and 0.5 ml of the diluted serum was used for infection of Vero cells (ATCC No. CCL-81) in 252cm flask and incubated at 34°C to 37°C in serum free medium. The control flask of Vero cells was treated with equal volume of Ix PBS. Post-infection, the medium for propagation of Vero cells was DMEM containing 1% fetal bovine serum (FBS) In an alternate method, the cell and virus culture were carried out in serum free medium. The virus was harvested 30 - 48 hours after infection. The cytopathic effect (cpe) of Chikungunya virus isolate CHK/03/06 in infected Vero cells was as observed in Fig. 1 B, and 1A is the uninfected control. The virus was also cultured under similar conditions in MRC-5 cells and the cytopathic effect of CHK/03/06 observed in MRC-5 cells is depicted in Fig. 1 D. 1C is the uninfected control MRC-5 cells. The cpe of the virus in BHK21 cells is observed in Fig.l F and that of the control uninfected BHK-21 cells is depicted in Fig. 1 E. In one of the alternate methods tried, Vero and MRC-5 cells were treated with chemical agents such as trypsin at low concentrations ranging from 0.01% to 1% and with or without divalent ions such as calcium and magnesium before infection.
EXAMPLE 3:
Propagation of the CHK/01/06 and CHK/03/06 virus isolates: The CHK/01/06 and CHK/03/06 virus isolates were propagated in continuous cell culture in Vero cells (ATCC No. CCL-81) and in BHK-21 cells and MRC-5 cells. The medium for the infection was DMEM containing 0% - 1% FBS. At the end of 48 hours of infection, the cytopathic effect was near total in Vero and BHK21 cells and the virus was present largely in the extracellular medium. A TCID50 of the virus upto 109/ml was obtained. The virus isolates were passaged serially 23 times in Vero cells and were found to be stable in continuous cell culture. The virus titer significantly enhanced after passaging through mouse brain. Virus infection and propagation were also alternately tested in a serum free medium.
EXAMPLE 4:
Purification of the virus: The two virus isolates were purified from the infected Vero cell monolayers by methods that include but not is limited to: low-speed centrifiigation to remove much of the cellular debris and serum components, ultracentrifugation, sucrose density gradient centrifiigation, and ultrafiltration through 100 - 1000 kDa membrane. The virus was further purified by ion exchange column chromatography and by gel filtration in Sepharose CL 4B or a matrix of similar property. The fractions containing the virus were pooled and precipitated with salts that included one of the following: PEG in the presence of 0.020M - 0.20 M NaCl, precipitation using Himax™ technology, ammonium sulphate, alum etc. The infectivity of the virions was checked by re-infection of the Vero, BHK 21 and MRC-5 cells and was found to be infectious. The concentrated virus was resuspended in phosphate buffer, pH 7.2 for checking in 7.5 % - 12% SDS- PAGE and virus proteins were visualized by silver staining. High purification of the virus was achieved also by ion exchange chromatography and hydrophobic interaction column chromatography and by the use of Monolith™ columns with salt elution. The purity of the virus preparation was checked by silver staining of SDS-PAGE gel and by Western blot using anti-CHIKV antisera raised in rabbit. Purification on the Monolith anion exchange columns gave a higher recovery of infectivity. Infectivity of the virus was also monitored during different steps of a pilot scale purification that eliminates serum and host cell contamination of the virus and TCID50 of 105 to 107/ml could be routinely obtained and is being further optimized.
EXAMPLE 5:
The purity ot the virus preparation was checked by SDS-PAGE was found to t>e of good purity. The .1 and E2 envelope glycoproteins could be easily detected. See Fig 2. The purified virus was had infectivity as determined by determining the infectious count of the virus and by intracerebral injection of the purified virus fraction in 2-day old mice, at various dilutions. Neat purified virus and several serial dilutions resulted in death when injected intracerebrally. The mice showed severe retarded growth when compared to PBS injected control mice as observed in Fig.3
EXAMPLE 6:
Electron microscopy of the virus: The Transmission Electron microscopy (Hitachi H- 7500) of the CHIK virus after ultracentrifugation was carried out by negative staining method using 2% uranyl acetate is depicted in Fig.4.
EXAMPLE 7:
The genetic identity of the CHK/01/06 and CHK/03/06 Chikungunya virus isolates grown in Vero cells was confirmed by Reverse-Transcription-Polymerase Chain Reaction (RT-PCR) of the viral genomic RNA of the CHIK virus isolates. The virus genomic RNA was extracted from the virus culture in Vero cells using standard protocols. The total RNA was reverse transcribed in different reactions using oligodT (18 mer) and by primers specific for Chikungunya virus sequences. Alternatively, the PCR was carried out on the reverse transcribed product using gene specific forward and reverse primers as given below. The PCR was carried out using Vent DNA polymerase (New England Biolabs). A few examples of the RT-PCR of the cDNA of CHIK virus isolates are depicted in Fig. 5. The sequence of few of the forward primers and reverse primers used in the some of the PCR reactions are as follows:
CHK SP FP1: 5'CTAAATAGGTACGCACTACAGC 3'; CHK SP FP2: 5' TGGACTCCGCGCCCTACTATC 3'; CHK SP FP3: 5' TACTCAGGAGGCCGGTTCAC 3'. CHK SP RP4: 5' GTGTCCCATTGTTCCAG 3' CHK SP RP5: 5' GTGAACCGGCCTCCTGAGTA 3'
The RT-PCR amplified cDNA fragments were sequenced by dideoxy chain termination method. The deduced protein sequences were determinec using universal genetic codes. Additional regions of the Chikungunya virus genome sequences were amplified with other gene specific primers, and sequences of the amplified DNA were determined by dideoxy chain termination method. The sequence of the RT-PCR products confirmed the identity of the Chikungunya virus isolates.
EXAMPLE 8:
Heat inactivation of the virus:
The purified virions of CHK/03/06 isolates were heat inactivated at temperatures ranging from 50°C - 60°C for 30 - 60 min. The infectivity of the virions was checked by re¬infection of the Vero cells. No re-infection was observed.
EXAMPLE 9:
Chemical inactivation of the virus:
The purified virions of CHK/03/06 isolate were inactivated by chemical methods that includes but is not limited to one of the following methods: inactivation at concentrations ranging from 0.01% to 0.5% formalin (formaldehyde) for 2 hours at 37°C followed by incubation at 4°C for a period of 48-96 hours. The virions inactivated at the various concentrations of formalin were found to be non-infectious when re-infected in Vero cells after atleast three serial passages. In an alternative inactivation method, the purified virions were inactivated with beta-propiolactone (BPL) at various concentrations ranging from 1: 500 to 1:3000 of the BPL: virus and for two hours at 37 DEG C, followed by incubation at varying time intervals of 48 - 200 hours at 4°C. No re-infection of the virus was observed after three serial passages of the virus at a ratio of BPL: virus at 1:500 dilution to 1: 1000 dilution. Inactivation of the virus could also be successfully carried out 22 DEG C for varying number of hours ranging from 48 -96 hrs. No infectivity was observed with the formalin and beta-propiolactone inactivated virions at the range of concentrations and for the various time periods tested.
EXAMPLE 10:
Measurement of the virus infectious titer: The virus infection titer of CHK/03/06 isolate was counted in PFUs (plaque-forming units/ml) by a plaque-counting method using Vero cells and by determining the TCID50 (Tissue culture infectious dose) by standard protocols. The plaques could be ready by 36-48 hours and the titers could be determined by 30- 48 hours. In Vero cells, various passages of the Vero-adapted virus yielded titers
* 8 5
ranging upto 10 TCID50/ml. An increase in titer was observed after passaging the virus through 2-day old mouse brain. The virus was plaque purified from passage 2 sample in Vero cells.
EXAMPLE 11:
Determination of the immunogenicity of the virus:
An amount of the Chikungunya virus antigen of the CHK/03/06 isolate was measured by protein estimation by BCA method and by ELISA using rabbit anti-Chikungunya virus antisera. Polyclonal antibodies were raised in rabbit by injecting 100 jig of the purified Chikungunya virus CHK/03/06 isolate intradermally /subcutaneously/intramuscularly and injecting a similar amount of antigen as a booster dose 7-14 days after the first antigen administration. Injection of a single dose of virus purified from BHK21 cells gave an ELISA titer of ~ 6400, and a titer of > 80 by virus neutralization assay compared to normal rabbit serum of ~ 4. Four samples of convalescent human antisera gave a varying titer of 80 - 240 as against control human serum that gave a titer of - 4. Antisera was also raised against both the CHK/01/06 and CHK/03/06 isolates of the virus. Good seroconversion was observed as determined by ELISA and by in vitro neutralization assay. The neutralizing assay titer observed after single booster injection was higher.
EXAMPLE 12:
Haemagglutination and Haemagglutination Inhibition:
The hemagglutination titer was estimated by standard procedure using goose red blood cell suspension. Haemagglutination inhibition of the immune sera from rabbit and convalescent human sera were determined by standard protocols. Both the rabbit antisera and convalescent human sera showed haemagglutination inhibition. The HA titer of the purified virus was higher than the harvested neat virus sample. The HA titer of infected virus sample and the purified via i. sample after serial dilutions are depicted in Fig. 6
EXAMPLE 13:
Animal testing:
Fifteen one month old Balb/c mice were used in each group. The animals in each group were injected intraperitoneally with about 0.2 ml to 0.5ml /mouse of serially diluted vaccine preparation of the CHK/03/06 isolate ranging in dose from 1 jig to about 200 (xg for the different test groups. The animals were boosted 14 days after the first immunization. Blood was collected either at 7 and 14 days after the booster injection. Equal amount of serum was pooled for each group and complement was inactivated at 56°C for about 30 min. The resultant serum was used for neutralizing test as an immune serum and for estimation of antibody titer by ELISA. In an alternate experiment, similar amount of the inactivated virus preparation was administered intramuscularly. The antibody response was higher with intramuscular injection. All the formulations contained the viral antigen along with aluminium hydroxide in 40 mM phosphate buffer, pH 6.8 - 7.2 containing 150 mM NaCl, 50 jig/dose oligonucleotides and varying amounts of excipients as mentioned in the Example below.
EXAMPLE 14:
Formulation:
The formulation of Chikungunya virus antigen CHK/03/06 was prepared in 40 mM phosphate buffer, pH 6.9 - 7.2 with or without 154 mM NaCl. The viral preparations were formulated in a liquid formulation with aluminium hydroxide/aluminium phosphate containing either one or combination of sugars such as sucrose, maltose, trehalose, lactose, glucose, mannitol or sorbitol. The presence of sugars in the range of 0.5% -10% and preferably in the range of 0.5% to 5% conferred good stability on the formulation as determined by accelerated stability at 37 DEG C for three weeks. A significantly high titer of antibody response was obtained when oligonucleotides at a dose of 50 |ig /dose was included in the liquid formulation. Similar formulation was also tested with phosphate-citrate buffer of pH 6.8 - 7.2 and no difference was observed. Higher concentration of above sugars, buffer and salt as upto 60% of the total solids conferred good stability on lyophiiized formulation of the vaccine. The stability of the formulation was tested by potency tests in mice.
EXAMPLE 15:
Recombinant cloning and expression of the viral antigens in prokaryotic and eukaryotic expression systems:
The CHK/03/06 virus isolate was used as the source for cloning and expression of all viral antigens with the sequences given in SEQ ID NO. 1 to SEQ ID NO. 10. The complete open reading frame of the Chikungunya virus Structural polyprotein encoded by the SEQ ID NO.l was amplified by RT-PCR of the viral genomic RNA using the primers CHKCPFP as the forward primer and CHKE1RP as the reverse primer to obtain a ~ 3776 bp PCR fragment. The PCR fragment was digested with Ndel and BamHl and cloned into the Ndel and BamHl sites of the prokaryotic expression vector, pETl IB and the recombinant plasmid containing the insert was transformed in E.coli DH5a. In an alternative method, the open reading frame encoding the Chikungunya virus structural polyprotein, the SEQ ID NO.2 was cloned and expressed in a similar manner using CHKCKOZAKFP as the forward primer and CHKE1RP2 as the reverse primer to obtain a fragment of similar size. The SEQ ID NO. 2 has been amplified with a primer sequence that introduces a Kozak's consensus sequence at the 5' end for enhanced expression in eukaryotic expression system. The primer sequence CHKCKOZAKFP has EcoRl site and CHKE1RP2 has a Hindlll and Notl sites to facilitate cloning into baculovirus vector pFastBac (Invitrogen Corporation, Carlsbad, USA) and Pichia vector pPIC3.5K (Invitrogen Corporation, Carlsbad, USA) respectively.
The SEQ ID NO. 2 was further amplified with a C-terminal primer that introduced 6- Histidine residues at the C-terminal end to obtain SEQ ID NO. 3. SEQ ID NO.l and SEQ ID NO.2 encode the protein of SEQ ID NO.4. SEQ ID NO. 3 encodes the protein of SEQ ID NO.5 that has the 6 His residues at the C-terminal end. The 6-Histidine residues at the C-terminal end of SEQ ID NO. 5, facilitates the purification of the expressed protein on Ni+ affinity column. Both SEQ ID No.4 and SEQ ID NO.5 have been expressed for assembly of the virus like particle in yeast and in baculovirus mediated expression in SfE> cells The PCR gene fragments corresponding to SEQ ID NO.2, and SEQ ID NO.3 were digested with EcoRl and Not 1 and gel purified by standard protocols and cloned into EcoRl and Notl sites of the yeast expression vector pPIC3.5K (Invitrogen Corporation, Carlsbad, USA). The positive clones were sel ;ted after confirmation by PCR using the same primers. The recombinant plasmid encoding the complete structural protein of SEQ ID NO.4 and SEQ ID NO.5 was transformed into Pichia Pastoris GS115 as per the manufacturers (Invitrogen) instruction and as outlined in their protocols. The PCR amplified fragment has been cloned into the AOX1 locus and expressed under the AOX1 promoter by methanol induction. The cloning, screening, isolation of the recombinant Pichia strains and induction of the cloned gene with methanol were carried out as per the User's manual "A Manual of Methods for Expression of Recombinant Proteins in Pichia pastoris" Version M Jan 2002, of Pichia Expression Kit, Catalog # K1710-01, Invitrogen Corporation, Carlsbad, USA).
The complete Open Reading Frame (ORF) of the Chikungunya virus Structural polyprotein encoded by the SEQ ID NO.2 and SEQ ID NO.3 amplified by RT-PCR were digested with EcoRl and Hind III, gel purified and cloned into the EcoRl and Hind III sites of the pFastBac vector under the control of the polyhedron promoter (Invitrogen Corporation, Carlsbad, USA). The Methods for cloning and selection of the recombinant baculovirus vector as are exactly outlined in the User's manual of Bac to Bac Baculovirus expression system ("An efficient site-specific transposition system to generate baculovirus for high-level expression of recombinant proteins" Version D, 6 April 2004, Invitrogen Corporation, Carlsbad, USA). In brief, the method utilizes a site specific transposition of the expression cassette such as the recombinant pFastBac vector with the cloned inserts as described above into a baculovirus shuttle vector (bacmid) propagated in E.coli. Recombinant pFastBac vector containing one of the inserts SEQ ID NO.4 or SEQ ID NO.5 cloned under the control of the polyhedron promoter is transformed into competent cells of E.coli Max Efficiency DHlOBac™, that contains a baculovirus shuttle vector (bMON 14272) and a helper plasmid (pMON7124) that facilitates transposition to allow efficient re-generation of the recombinant bacmid following the transposition of the pFastBac recombinant constructs containing the SEQ ID NO. 4 or SEQ ID NO. 5. The recombinant bacmid were selected on ampicillin, gentamicin and kanamycin containing plates by blue/white selection using bluo-gal and IPTG. The recombinant bacmid was isolated by standard protocols similar to that of isolation of plasmid DNA and 1 (ig of the bacmid DNA was used for transfection with the use of Cellfectin™ reagent into Sf9 insect cells that were grown in Grace's insect cell medium (Invitrogen Corporation, USA). The methods used for transfection, isolation and titration of PI viral stock are exactly as descril xl in the User's manual of Bac-to-Bac Baculovirus Expression system as given above.
The open reading frame of each of the structural antigens such as the Capsid, E3, E2, 6K polypeptide and El structural proteins corresponding to the following sequence IDs: SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10 respectively encoded in the structural polyprotein sequence were amplified by PCR using gene specific primers as outlined below in the first step of amplification. In the second step reverse primers that encode for 6 histidine residues were used for PCR (primer sequences not given) of each of the individual genes and cloned into pETl 1 B for prokaryotic expression in E.coli and in pFastBac vector for baculovirus mediated expression in insect cells.
Some of the PCR primers originally designed for E.coli and baculovirus cloning did not have suitable restriction sites for cloning into pPIC3.5 K for expression in Pichia pastoris, Those PCR fragments that had EcoRl site at the 5' end and BamHl site in the C-terminal by virtue of the presence of these restriction sites in the forward and reverse primers respectively, were initially cloned into the EcoRl and BamHl sites of the vector pBluescript SK+ . The selected recombinant clone was digested with EcoRl and Notl and the digested fragment was then subcloned in pPIC3.5K for yeast transformation as described above. The primer sequences used for various amplifications are as indicated below. Expression of El and CapsM antigens in E.coli and the Capsid protein in yeast is shown in Fig.$ and in Fig.^ Primer sequences:
1) CHKCKOZAKFP:
5' ATTGAATTCACCATGGAGTTCATCCCAACCCAAAC 3'
2) CHKE1RP2:
5' AACAAGCTTGCGGCCGCTTAGTGCCTGCTGAACGACACG 3'
3) CHKSPE3FP:
5' ACCGAATTCATATGAGTCTTGCCATCCCAGTTATG 3'
4) CHKSPE3RP:
5' TGCAAGCTTGGATCCTTAGCGTCGCTGGCGGTGGGGAG 3'
5) CHKSP6KFP:
5' ACGGAATTCATATGGCCACATACCAAGAGGCTGCG 3'
6) CHKSP6KRP:
5' ATTAAGCTTGGATCCTTAGGTGCCCACACTGTGAGCGC 3'
7) CHKCPFP:
5' ACAGAATTCATATGGAGTTCATCCCAACCCAAAC 3'
8) CHKCPRP:
5' ATTAAGCTTGGATCCTTACCACTCTTCGGCCCCCTCGGGG 3'
9) CHKE1FP:
5' TAGAATTCATATGTACGAACACGTAACAGTGATCC 3'
10) CHKE1RP:
5' TATAAGCTTGGATCCTTAGTGCCTGCTGAACGACACGC 3'
11) CHKE2FP:
5' TCGGAATTCATATGAGCACCAAGGACAACTTCAATGTC 3'
12) CHKE2RP:
5' TCCAAGCTTGGATCCTTACGCTTTAGCTGTTCTGATGCAGC 3' EXAMPLE 16:
The recombinant antigens expressed in either prokaryotic or eukaryotic expression system can be used for diagnostic purpose such as in ELISA. ELISA has been established using the inactivated whole virus and using rabbit antisera. Similar technique can be established using the purifed recombinant antigens instead of the whole virus as antigen. Polyclonal antisera or monoclonal antibody against the virus antigens particularly the structural antigens can be used as immunotherapeutic agent.
Bibliography
1. Baneijee K and Ranadive SN. 1988. Oligonucleotide fingerprinting of Chikungunya virus strains. Ind. J. Med. Res. 87:531-541.
2. Bedekar SD and Pavri KM. 1969a. Studies with Chikungunya virus. Part I. Susceptibility of birds and small mammals. Ind. J. Med. Res. 57:1181-1192.
3. Bedekar SD and Pavri KM. 1969b. Studies with Chikungunya virus. Part II. Serologiacl survey of humans and animals in India. Ind. J. Med. Res. 57:1193-1197.
4. Casals J. 1957. The arthropod-borne group of animal viruses. Trans. N. Y. Acad. Sci. 19:219-235.
5. Chain MMT, Doane RW and McLean DM. 1966. Morphological development of Chikungunya virus. Can. . Microbiol. 12:895-899.
6. Chakravarthy SK and Sarkar JK. 1969. Susceptibility of new born and adult laboratory animals to Chikungunya virus. Ind. J. Med. Res. 57:1157-1164.
7. Chaturvedi UC, Mehrotra NK, Mathur A, Kapoor AK and Mehrotra RM. 1970. Chikungunya virus HI antibodies in the population of Lucknow and Kanpur. Ind. Jour. Med. Res. 58:297-301.
8. Eckels KH, Harrison VR and Hetrick FM. 1970. Chikungunya virus vaccine prepared by Tween-ether extraction. Applied Microbiol. 19:321-325.
9. Edelman R, Tacket CO, Wasserman SS, Bodison SA, Perry JG and Magniafico JA. 2000. Phase II safety and immunogenicity study of live chikungunya virus vaccine TSI-GSD-218. Am. J. Trop. Med. Hyg. 62:681-685.
10. Fauquet CM, Mayo MA, Maniloff J, Desselberger J and Ball LA (Eds.). 2005. 8th Report of the International Committee on Taxonomy of Viruses.
11. Giovarelli M, Viano I, Zucca M, Valbonesi R and Dianzani F. 1977. Effect of anti- □-chain-specific immunosuppression on Chikungunya virus encephalitis of mice. Infect. Immun. 16:849-852.
12. Hahon N and Hankins WA. 1970. Assay for Chikungunya virus in cell monolayers by immunofluorescence. Applied Microbiol. 19:224-231.
13. Hahon N and Zimmerman WD. 1970. Chikungunya virus infection of cell monolayers by cell-to-cell and extracellular transmission. Applied Microbiol. 19:389-391.
14. Hannoun. 1968. Arbovirus haemgglutinins: differential susceptibility to trypsin. Nature 219:753-755.
15. Harrison VR, Binn LN and Randall R. 1967. Comparative immunogenicities of chikungunya vaccines prepared in avian and mammalian tissues. Amer. J. Trop. Med. Hyg. 16:786-791.
16. Harrison VR, Eckels KH, Bartelloni PJ and Hampton C. 1971. Production and evaluation of a formalin-killed chikungunya vaccine. J. Immunol. 107:643-647.
17. Hearn HJ and Rainey CT. 1963. Cross-protection in aminals infected with group A arboviruses. J. Immunol. 90:720-724.
18. Heise MT, Simpson DA and Johnston JE. 2000. Sindbis-group alphavirus replication in periosteum and endosteum of long bones in adult mice. J. Virol. 74:9294-9299.
19. Higashi N, Matsumoto A, Tabata K and Nagatomo Y. 1967. Electron microscope
study of development of Chikungunya virus in green monkey kidney stable (Vero) cells. Virology 3:55-69.
20. Khan AH, Monta K, Parquet MC, Hasebe F, Mathenge EGM and Igarashi A. 2002. Complete nucleotide sequence of chikungunya virus and evidence for an internal polyadenylation site. J. Gen. Virol. 83:3075-3084.
21. Killington RA, Stokes A and Hierholzer JC. 1996. Virus purification. In "Virology methods manual," Mahy BWJ and Kangro (Eds). Academic Press, San Diego, CA, pp 71-89.
22. Klien F, Mahlandt BG, Cockey RR and Lincoln RE. 1970. Concentration of Rift valley fever and Chikungunya viruses by precipitation. Applied Microbiol. 20:346- 350.
23. Lanciotti RS, Ludwig ML, Rwaguma EB, Lutwama JJ, Kram TM et al. 1998. Emergence of epidemic O'nyong-nyong fever in Uganda after a 35-year absence: genetic characterization of the virus. Virology 252:252-268.
24. Levitt NH, Ramsburg HH, Hasty SE, Repik PM, Cole FE Jr and Lupton HW. 1986. Development of an attenuated strain of chikungunya virus for use in vaccine production. Vaccine 4:157-162.
25. McClain DJ, Pittman PR, Ramsburg HH, Nelson GO, Rossi CA, Mangiafico J A, Schmaljohn AL and Malinoski FJ. 1998. Immunologic interference from sequential administration of live attenuated alphavirus vaccines. J. Infect. Dis. 177:634-641.
26. Mcintosh BM, Paterson HE, McGillivray G and DeSousa J. Further studies on the Chikungunya outbreak in Southern Rhodesia in 1962. I. Mosquitoes, wild primates and birds in relation to the epidemic. Ann. Trop. Med. Parasitol. 58:45-51.
27. Myers RM, Carey DE, Reuben R, Jesudass ES, De Ranitz C, Jadhav M. 1965. The 1964 epidemic of Dengue-like fever in South India: isolation of Chikungunya virus from human sera and from mosquitoes. Ind. J. Med. Res. 53:694-701.
28. Nimmannitya S, Halstead SB, Cohen SN and Margiotta MR. 1969. Dengue and chikungunya virus infection in man in Thailand, 1962-1964. I. Observations on hospitalized patients with hemorrhagic fever. Am. J. Trop. Med. Hyg. 18:954-971.
29. Parks JJ and Price WJ. 1958. Studies on immunologic overlap among certain arthropod-borne viruses. Am. J. Trop. Med. Hyg. 67:187-206.
30. Paul SD and Singh KRP. 1968. Experimental infection of Macaca radiata with Chikungunya virus and transmission of virus by mosquitoes. Ind. J. Med. Res. 56:802-810.
31. Porterfield JS. 1961. Cross-neutralization studies with group A arthropod-borne viruses. Bull WHO 24:735-741.
32. Powers AM, Brault AC, Tesh RB and Weaver SC. 2000. Re-emergence of chikungunya and o'nyong-nyong viruses: evidence for distinct geographical lineages and distant evolutionary relationships. J. Gen. Virol. 81:471-479.
33. Ranadive SN and Banerjee K. 1990. Cloning and expression of Chikungunya virus genes coding structural proteins in Escherichia coli. Ind. J. Med. Res. 91:386-392.
34. Rao TR, Carey DE and Pavri KM. 1965. Preliminary isolation and identification of Chikungunya virus from cases of Dengue-like illness in Madras city. Ind. J. Med. Res. 53:689-693.
35. Ravi V. 2006. Re-emergence of chikungunya virus in India. Ind. J. Med. Microbiol. 24:83-84.
36. Sarkar JK, Chatteijee SN and Chakravarty SK. 1964. Haemorrhagic fever in Calcutta: some epidemiological observations. Ind. J. Med. Res. 52:651-659.
37. Sarkar JK, Chatterjee JK, Chakravarti SK and Mitra AC. 1965. Chikungunya virus infection with haemorrhagic manifestations. Ind. Jour. Med. Res. 53:921-925.
38. Schuffenecker I, Iteman I, Michault A, Murri S, Frangeul L, Vaney M-C, Lavenir R, Pardigon N, Reynes, J-M, Pettinelli F, Biscornet L, Diancourt L, Michel S, Duquerroy S, Guigon G, Frenkiel M-P, Brehin A-C, Cubito N, Despres P, Kunst F, Rey FA, Zeller H and Brisse S. 2006. Genome microevolution of Chikungunya viruses causing the Indian Ocean outbreak. PLOS Med. 3:e263.
39. Shaw KV, Clarence JG, Jr., and Banerjee G. 1964. Virological investigation of the epidemic of haemorrhagic fever in Calcutta: isolation of three strains of Chikungunya virus. Ind. J. Med. Res. 52:676-682.
40. Simizu B, Yamamoto K, Hashimoto K and Ogata T. 1984. Structural proteins of Chikungunya virus. J. Virol. 51:254-258.
41. Umrigar MD and Kadam SS. 1974. Comparative sensitivity of suckling mice and Vero cells for primary isolation of Chikungunya virus. Ind. J. Med. Res. 62:1893- 1895.
42. Weiss HJ, Halstead SB and Russ SB. 1965. Hemorrhagic disease in rodents caused by Chikungunya virus. 1. Studies of hemostasis. Proc. Soc. Exp. Biol. Med. 119:427- 432.

WF. CLAIM:
1 A vaccine formulation for the prophylaxis and treatment of Chikungunya virus infection in mammals where the Chikungunya virus antigen is the genotype of the virus isolate CHK/03/06, whose structural polyprotein sequence is as given in SEQ ID 4 and is applicable to any genotype or genetic variants of Chikungunya virus.
2 A method of adaptation and propagation of the Chikungunya virus in continuous cell culture in vitro in Vero, MRC-5 and or BHK21 cells to obtain a high infectious titer of > 108/ml.
3 A vaccine formulation according to Claim 1 wherein the said virus antigen in the formulation is purified and inactivated Chikungunya virus.
4 A vaccine formulation according to Claim 1 wherein the said virus antigen in the formulation is purified and heat inactivated Chikungunya virus.
5 A vaccine formulation according to Claim 2, wherein the purified virus antigen is inactivated by chemical means either before or after purification of the virus.
6 A vaccine formulation according to any of the preceding claims, wherein the virus inactivating agent is one of the following:
i) beta-propiolactone (BPL) used at a concentration ranging from .001% to 0.4%, preferably from 0.01% to 0.1% or at a dilution of 1:500 to 1: 3000 of BPL:virus
ii) formalin (formaldehyde) used at a concentration ranging from 0 to 0.4% preferably from 0.01% to 0.1% or at a dilution of 1:500 to 1:4000 of formalin: virus and incubated for 2 hrs at 37 DEG C and at +2 to + 8 DEG C for 4&-96 frrs, preferably 48 hrs to 72 hrs
iii) is selected from a list of other inactivating agents such as ionic detergents, non-ionic detergents, ascorbic acid and glutaraldehye
7. A vaccine formulation according to claim 5, wherein BPL inactivation is carried out at one the following temperature and time period:
i) 2 hrs to 4 hrs at 37 DEG C followed by incubation at +2 to +8 DEG C for 48 to 200 hours, preferably 48 hrs to 120 hrs at +2 to +8 DEG C
ii) at 22 DEG C for 40 hrs to 96 hrs, preferably 48 hrs to 72 hours.
8. A method of concentration and purification of the virus that includes one or more of the following methods:
i) ultrafiltration through 100 kD - 1000 kD membrane
ii) ultracentrifugation and density gradient centrifugation
iii) column chromatography such as gel filtration, ion exchange chromatography particularly the MonolithTM anion column, hydrophobic interaction chromatography, affinity matrix chromatography
iv) precipitation with polyethylene glycol, HimaxTM, organic and inorganic salts
9. A stable liquid vaccine formulation comprising of:
i) purified and inactivated Chikungunya virus antigen
ii) phosphate buffe, 10 mM to 500 mM pH 6.7 to 7.4 or phosphate-citrate buffer of similar pH
iii) Sugar concentration in the range of 0.1 % to 5% wherein the sugars are selected from the list comprising: lactose, maltose, sucrose, glucose, trehalose and or a combination thereof
iv) 25 mM - 200 mM NaCl
v) protein additives such human serum albumin, lactalbumin hydrolyzate, yeast hydrolyzate, gelatin etc are used in the concentration of 0.1% to 5%
10. A lyophilized formulation according to Claim 1 comprising of:
i) purified and inactivated Chikungunya virus as antigen
ii) phosphate buffer 10 mM to 500 mM pH 6.7 to 7.4 or phosphate-citrate buffer of similar pH
iii} sugar concentration in the range of 0.1 % to 50% wherein the sugars are selected from a list comprising: lactose, maltose, sucrose, glucose, trehalose and or a combination thereof
iv) 25 mM - 200 mM NaCl
v) Protein additives such human serum albumin, lactalbumin hydrolyzate, yeast hydrolyzate, gelatin etc are used in the concentration range of 0.1% to 5%
11. A potentially immunogenic composition wherein the amino acid sequence consists of SEQ ID No.4.
12. A potentially immunogenic composition wherein the amino acid sequence consists of SEQ ID No.5.
13. A potentially immunogenic composition wherein the amino acid sequence consists of any of the SEQ IDs such as SEQ ID NO. 6 to SEQ ID NO. 10.
14. The nucleotide sequence of SEQ ID NO.l and the nucleotide sequences of SEQ ID NO. 2 and SEQ ID NO. 3 that have been modified to include a Kozak's consensus sequence for enhanced eukaryotic expression.
t5. Recombinant DNA constructs comprising (i) a vector and (ii) at least one nucleic acid fragment (SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3) encoding the amino acid sequence of any of the proteins such as SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7, SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10 according to any of the preceding claims.
16. A recombinant DNA construct according to claim 15, wherein the vector is a prokaryotic plasmid expression vector being cloned in a prokaryotic host preferably E.coli.
17. A recombinant DNA construct according to claim 15, wherein the vector is a eukaryotic plasmid expression vector being cloned in a eukaryotic host such as yeast and in baculovirus for expression in insect cells, and for processing and assembly of the SEQ ID NO.4 and SEQ ID NO.5 as virus like particles (VLPs) by the host cells.
18. A method for producing the recombinant protein of any of the preceding claims comprising of the following steps:
i) culturing the host cell cloned with recombinant construct of Claims 16 and 17,
ii) harvesting the cells and isolating the recombinant protein therefrom,
iii) purifying the said protein by at least one of the following methods: ion exchange chromatography, gel filtration, affinity chromatography, hydrophobic column chromatography, fractionation with salt, organic solvent(s), centrifiigation, electrophoresis etc.
19. A Pharmaceutical composition comprising antigens according to any of the preceding claims in an effective amount to be used as a vaccine in a pharmacologically and physiologically acceptable carrier with or without an adjuvant and a stabilizing agent.
20. A method according to the preceding claims where the adjuvant is atleast one of the following: aluminium hydroxide, aluminium phosphate, calcium phosphate, mineral oil, Freund's adjuvant, immunostimulatory oligonucleotides, polycationic peptides, or any other suitable organic or inorganic compounds that can be used as an adjuvant.
21. A pharmaceutical composition according to any of the preceding claims wherein the virus antigen(s) are used in the range of 1 to 1000 (xg preferably 5 to 500 fig and more preferably 10 to 100 fig for vaccination per dose.
22. A pharmaceutical composition according to any of the preceding claims, wherein the buffer comprises at least one of the following: phosphate buffer, phosphate- citrate buffer or any other pharmaceutically and physiologically acceptable buffer, and further comprising an added adjuvant as claimed in claim 20.
23. A in vitro or in vivo method for usage of antigenic molecules of any of the preceding claims for preparation of any form of an immunodiagnostic and an immunotherapeutic agent for Chikungunya virus infection.
24. A method of eliciting a protective immune response against Chikungunya virus in mammals preferably humans, comprising administering a composition according to any of the preceding claims by atleast one of the following routes such as
intramuscular, intradermal, subcutaneous, intravenous, oral and intranasal route of administration.
25. The invention substantially such as herein described.

Documents

Orders

Section Controller Decision Date

Application Documents

# Name Date
1 1583-CHE-2006 FORM-18 04-08-2010.pdf 2010-08-04
2 1583-CHE-2006 CORRESPONDENCE OTHERS 06-07-2011.pdf 2011-07-06
3 1583-che-2006-form 1.pdf 2011-09-03
4 1583-che-2006-drawings.pdf 2011-09-03
5 1583-che-2006-description(provisional).pdf 2011-09-03
6 1583-che-2006-correspondnece-others.pdf 2011-09-03
7 1583-che-2006-abstract.pdf 2011-09-03
8 1583-CHE-2006 FORM-3.pdf 2011-11-29
9 1583-CHE-2006 FORM-1.pdf 2011-11-29
10 1583-CHE-2006 DRAWINGS.pdf 2011-11-29
11 1583-CHE-2006 DESCRIPTION (COMPLETE).pdf 2011-11-29
12 1583-CHE-2006 CORRESPONDENCE OTHERS.pdf 2011-11-29
13 1583-CHE-2006 CLAIMS.pdf 2011-11-29
14 1583-CHE-2006 ABSTRACT.pdf 2011-11-29
15 1583-CHE-2006 POWER OF ATTORNEY 16-04-2012.pdf 2012-04-16
16 1583-CHE-2006 FORM-13 16-04-2012.pdf 2012-04-16
17 1583-CHE-2006 CORRESPONDENCE OTHERS 16-04-2012.pdf 2012-04-16
18 1583-CHE-2006 FORM-3 07-10-2014.pdf 2014-10-07
19 1583-CHE-2006 CORRESPONDENCE OTHERS 07-10-2014.pdf 2014-10-07
20 1583-CHE-2006 FORM-13 30-03-2015.pdf 2015-03-30
21 FORM-13 for change in address for service.pdf 2015-04-08
22 FORM-1-Revised.pdf 2015-04-08
23 DRAWINGS.pdf 2015-04-08
24 Amended page 8, 10, 16.pdf 2015-04-08
25 AMENDED CLAIMS- CLEAN COPY.pdf 2015-04-08
26 ACK- NBA + FORM-1 + FORM-13.pdf 2015-04-08
27 1583-CHE-2006- RESPONSE TO FER.pdf 2015-04-08
28 1583-CHE-2006_EXAMREPORT.pdf 2016-07-02
29 1583-CHE-2006-HearingNoticeLetter.pdf 2018-01-18
30 1583-CHE-2006-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [14-02-2018(online)].pdf 2018-02-14
31 1583-CHE-2006-ExtendedHearingNoticeLetter_01Mar2018.pdf 2018-02-16
32 1583-CHE-2006-Response to office action (Mandatory) [22-02-2018(online)].pdf 2018-02-22
33 1583-CHE-2006-Annexure (Optional) [22-02-2018(online)].pdf 2018-02-22
34 1583-CHE-2006-FORM 3 [28-02-2018(online)].pdf 2018-02-28
35 1583-CHE-2006-Written submissions and relevant documents (MANDATORY) [16-03-2018(online)].pdf 2018-03-16
36 1583-CHE-2006-Annexure (Optional) [16-03-2018(online)].pdf 2018-03-16
37 1583-CHE-2006-REQUEST FOR CERTIFIED COPY [15-07-2019(online)].pdf 2019-07-15