Sign In to Follow Application
View All Documents & Correspondence

Vaccine Formulation For Prophylaxis And Treatment Of Chandipura Virus Infections In Mammals

Abstract: The present invention is related to pharmaceutical formulations capable of eliciting protective immune response against Chandipura virus infection in humans and other mammalian hosts. The immunogenic formulation comprises Chandipura virus glycoprotein (G protein) and/or nucleoprotein expressed as recombinant proteins and purified from host cells. Vaccine compositions comprising the recombinant proteins elicit neutralizing antibodies similar to the vaccine compositions of purified inactivated Chandipura virus in a stable formulation. Methods of inactivating Chandipura virus for use as a candidate vaccine are disclosed. The vaccine compositions have been formulated with adjuvants to potentiate the immune response. The vaccine compositions disclosed in the invention are highly immunogenic and elicit protective immune response in mammalian host. The immunogenic compositions are formulated for in vivo administration to humans. The immunogenic preparation will also find use in diagnosing for the presence of the virus.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
30 November 2010
Publication Number
47/2013
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

BHARAT BIOTECH INTERNATIONAL LIMITED
GENOME VALLEY, TURKAPALLY SHAMEERPET, HYDERABAD - 500 078.

Inventors

1. ELLA, KRISHNA MURTHY
GENOME VALLEY, TURKAPALLY SHAMEERPET, HYDERABAD - 500 078.
2. SUMATHY, K.
GENOME VALLEY, TURKAPALLY SHAMEERPET, HYDERABAD - 500 078.

Claims

1. Vaccine formulation for prophylaxis and treatment of Chandipura virus infections in mammals comprising Chandipura virus of any genotype or virus antigens thereof, as therapeutically active ingredient

2. Vaccine formulation as claimed in claim 1, wherein said Chandipura virus is inactivated by heat, UV Jjght, by chemical means or by gamma irradiation

3. Vaccine formulation as claimed in claim 2, wherein said chemical inactivation of Chandipura virus is done under conditions selected from: a. use of beta propiolactone (BPL) at a concentration of 1:1500: to 1:4000, preferably between 1: 2000 to 1: 3500 dilution of BPL: virus suspension, for a period of 2-14 days at 2-8°C, preferably for 7 days at 2-8°C, or at 22°C for a period of 4-6 days; b. use of formalin (formaldehyde) at a concentration of 1:2500 to 1:4000 dilution of formalin to virus suspension for a period of 4-15 days at 2-8°C or at a temperature of 25°C for a period of 4-8 days.

4. Vaccine formulation according to Claim 2, wherein said Chandipura virus cultured in Vero cells is inactivated wherein the inactivation is carried out before or after purification of the virus.

5. Vaccine formulation according to claim 1, wherein the Chandipura virus antigen is purified glycoprotein of Chandipura virus.

6. Vaccine formulation of claim 5, wherein the glycoprotein is recombinant protein expressed and purified from eukaryotic expression system such as baculovirus mediated insect cell expression system, yeast or mammalian cells.

7. The host cell for recombinant expression according to claim 6 is yeast such as Saccharomyces spp, Kluveromyces spp, Schizosaccharomyces pombe, Hanensula polymorpha, Pichia pastoris etc, preferably Pichia pastoris.

8. Recombinant DNA constructs comprising (i) a vector and (ii) at least one nucleic acid fragment of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4 or SEQ ID NO.9 encoding the glycoprotein of amino acid sequence of SEQ ID No.5, SEQ ID No.6 or SEQ ID No.8 according to any of the preceding claims.

9. An immunogenic preparation according to claim 1, wherein the Chandipura virus antigen is recombinant nucleoprotein of SEQ ID No.7 expressed and purified from a prokaryotic host such as E.coli.

10. A method for producing recombinant protein of any of the preceding claims comprising of the following steps: i) culturing the host cell cloned with recombinant construct of claims 8 and 9; ii) harvesting the cells and isolating the recombinant protein therefrom; iii) purifying the said protein by at least one of the following methods: ion exchange chromatography, gel filtration, affinity chromatography, hydrophobic column chromatography, fractionation with salt, organic solvent(s), centrifugation etc.

11. A method of concentration and purification of the virus that includes one or more of the following methods: a. ultrafiltration through 100 kD - 1000 kD membrane; b. ultracentrifugation and density gradient centrifugation; c. column chromatography such as gel filtration, ion exchange chromatography, hydrophobic interaction chromatography, affinity matrix chromatography, precipitation with polyethylene glycol, Himax™, organic and inorganic salts.

12. A stable vaccine formulation of claim 1 comprising of: a. purified and inactivated Chandipura virus antigen; b. phosphate buffer, 10 mM to 500 mM pH 6.7 to 7.4 or phosphate-citrate buffer of similar pH; c. sugar and sugar alcohol concentration in the range of 0.1 % to 5% wherein the sugars are selected from the list comprising: lactose, maltose, sucrose, glucose, trehalose, and sugar alcohols such as mannitol or sorbitol, inulin and /or a combination of the different sugars thereof; d. 25mM-200mMNaCl; e. adjuvant selected from a list consisting of aluminum hydroxide, aluminum phosphate, gamma inulin, algammulin or a combination thereof; f. optionally includes protein additives such human serum albumin at the concentration of 0.1 % to 5%.

13. A lyophilized formulation according to Claim 1 comprising of: a. purified and inactivated Chandipura virus as antigen; b. phosphate buffer 10 mM to 500 mM pH 6.7 to 7.4 or phosphate-citrate buffer of similar pH; c. sugar or sugar alcohol concentration in the range of 0.1 % to 50%, preferably 1 - 5%, wherein the sugars are selected from a list consisting of lactose, maltose, sucrose or trehalose, inulin, sugar alcohol or a combination thereof; d. 25mM-200mMNaCl; e. optionally, protein additives such human serum albumin etc. are used in the concentration range of 0.1% to 5%.

14. Pharmaceutical composition comprising antigens according to any of the preceding claims in an effective amount to be administered as a vaccine in a pharmacologically acceptable carrier by at least one of the following routes such as intramuscular, intradermal, subcutaneous, intravenous, oral and intranasal route of administration in mammals preferably humans for eliciting a protective antibody response.

15. A in vitro or in vivo method for usage of antigenic molecules of any of the preceding claims for preparation vaccine formulations, immunodiagnostic and an immunotherapeutic agent for Chandipura virus infection.

16. An immunogenic composition according to claim 1 that is a combination of Chandipura virus antigen and Japanese encephalitis virus antigen for human administration, for prophylaxis of both Chandipura virus and Japanese encephalitis viral infections.

Specification

Field of invention

The present invention relates to vaccine formulations for prophylaxis and treatment of Chandipura virus infections in mammals. More particularly, the invention provides immunogenic formulations comprising heat, ultraviolet light, gamma irradiated or chemically inactivated whole virion of Chandipura virus or purified antigens of the virus thereof, in stable formulation for administration to humans.

Background of the invention

Chandipura virus (CHPV) is a member of the order Mononegavirales, family Rhabdoviridae, genus Vesiculovirus. CHPV genome organization is similar to that of the well characterized Vesiculo stomatitis virus (VSV). CHPV infection in children causes encephalitis that is often fatal. Clinical symptoms include high fever, headaches, drowsiness, vomiting and convulsions resulting in coma. Most patients die within 24- 48 hrs of hospitalization as there is no treatment as yet for the virus infection.

Chandipura virus (CHPV) was first isolated from a serum sample of a patient during an outbreak of febrile illness in Nagpur in 1965. CHPV gained public health importance for the first time in 2003 when the virus caused a large encephalitis outbreak in the state of Andhra Pradesh (Rao et al., 2004) and Maharashtra. The fatality rate due to CHPV was as high as 55% in the state of Andhra Pradesh (Rao et al. 2004). Mortality rate of 78.4% mortality was reported during an epidemic in Gujarat, India (Chadha et al. 2005). The virus infection has been recurring in epidemics since then, and appears to be widespread as serological survey identified neutralizing antibodies to CHPV in both humans and domestic animals throughout the India and also in Sri Lanka and Africa. The virus has also been isolated from sandflies in India (Geevarghese et al. 2005) and in West Africa (Fontenille et al.1994).

There is no vaccine available for the prophylaxis of the virus infection. CHPV has a non-segmented ~ 11 kb negative strand RNA genome. Transcription of the viral genome is encoded by viral RNA-dependent RNA polymerase. CHPV genome encodes four major proteins, the Nucleocapsid protein (N protein), Phosphoprotein (P protein), Matrix protein (M protein), Glycoprotein (G protein) and the Large protein (L protein). The N protein encapsidates genomic RNA in order to protect it from cellular RNAses. The glycoprotein of all the Rhabdoviruses are N-glycosylated class I transmembrane protein that form trimeric spikes on the surface of the virus. The spikes formed by the glycoprotein mediate the attachment of the virus to the cellular receptors to mediate endocytosis and fusion with the cellular membranes. Glycoprotein elicits neutralizing antibodies and has been demonstrated to offer protective effect in mice against intracerebral challenge with the virus (Venkateswarlu and Arankalle, 2009).There is no vaccine commercially available for prophylaxis of Chandipura virus infection. There is no specific therapeutics for treatment of the CHPV infection.

Chandipura glycoprotein (G-protein) is highly immunogenic and offers protective immune response against Chandipura virus infection. The CHPV G-protein has been expressed and purified from baculovirus infected insect cells as a secretory protein (Venkateswarlu and Arankalle, 2009). Baculovirus mediated expression of recombinant protein is expensive for vaccine production at the industrial scale. Not too many products derived from baculovirus infected insect cells have been commercialized to date, more so for the vaccines targeted for the paediatric segment. Hence there is no adequate safety record for administering baculovirus derived vaccines to infants and children against whom this vaccine is primarily targeted.

Our use of yeast, particularly Pichia pastoris as the expression system for Chandipura glycoprotein (G-protein) offers distinct economical advantage as it is suitable for manufacture of low cost and highly effective vaccine. There is very good safety record as a number of commercial products derived from yeast including Pichia pastoris have been successfully commercialized. A recombinant vaccine Revac-Bmcf, consisting of hepatitis B small antigen derived from Pichia pastoris as the expression system has been successfully commercialized as a vaccine for children below two years old. There is no information available if the baculovirus-insect cell derived G-protein is comparable in its efficacy to the whole virion vaccine. In the present invention the potency of the recombinant Pichia derived G-protein vaccine has been compared with that of the inactivated Chandipura virus whole virion vaccine in order to study if they elicit comparable levels of neutralizing antibodies and offer protective efficacy against challenge with the virus. This information is particularly important because any recombinant antigen purified from the host cells in which they are expressed should assume a conformation that can elicit neutralizing antibodies as efficiently as the whole virion vaccine. In order to compare the results, the methods employed for obtaining an inactivated whole virion vaccine are also critical such as the choice of the inactivating agent, the time and temperature of exposure of the virus to the inactivating agent and the method of virus purification that is not deleterious to the integrity of the whole virus. Different methods of Chandipura virus inactivation are described in the invention. The use of inactivated whole virion of Chandipura virus as a very promising candidate vaccine is one aspect of the invention.

One aspect of the invention describes expressing the subunit antigens of the Chandipura virus in yeast and E.coli, purification of recombinant CHPV G protein and preparing a stable pharmaceutical composition and/or formulation suitable for administration as a vaccine, and optionally in combination with CHPV Nucleoprotein and other bacterial and/or viral proteins. The compositions and methods are useful for prophylaxis, therapeutic treatment and diagnosis of Chandipura virus infections in mammals particularly humans. Further, the enhanced stability and extended shelf life is imparted by the addition of excipients that are pharmaceutically acceptable in a vaccine formulation. The excipients are selected from a list that includes sugars, sugar alcohols, amino acids, human serum albumin and high molecular weight polymers. The immunogenicity of all the antigenic formulations were further enhanced by the addition of adjuvants.

Object of the invention

The main object of the present invention is to provide a stable vaccine composition for Chandipura virus (CHPV) obviating if not completely, but substantially the draw backs of the existing techniques by providing pharmaceutical formulations capable of eliciting protective antibody and cytotoxic T cell response against Chandipura virus infection.

Another object of the invention is to provide vaccine compositions and methods of preparing and using Chandipura virus antigens of defined sequence, particularly the Glycoprotein (G-protein) expressed as recombinant protein and purified from host cells such as yeast or E.coli to elicit protective immune response when administered in vivo

Another object of the invention provides vaccine compositions and methods of preparing and using Chandipura virus antigens of defined sequence, particularly the Nucleoprotein (N-protein) expressed as recombinant protein and purified from host cells such as E.coli cells in order to elicit protective immune response when administered in vivo

Another aspect of the invention is to provide immunogenic formulation comprising whole virion of Chandipura virus inactivated by heat, gamma irradiation, ultraviolet light, or by chemical means using inactivating agent(s) for use as an effective vaccine in humans and to compare the immunogenicity of the formulation with that of the subunit antigens

Another object of the invention provides vaccine compositions with adjuvants for enhancing the immunogenicity of the vaccine formulations

Yet another object of the present invention is to provide methods and compositions of Chandipura virus (CHPV) and the use of the subunit antigens of the virus thereof, for
prophylaxis, therapeutic treatment and diagnosis of Chandipura virus infections in mammals particularly in humans.

Summary of the invention

The present invention relates to pharmaceutical formulations capable of eliciting protective antibody and cytotoxic T cell responses against Chandipura virus infection. The invention relates to compositions and methods of preparing and using Chandipura virus antigens of defined sequence expressed as recombinant proteins and purified from host cells. Compositions containing the antigens are used to elicit protective immune response. The potency of such subunit vaccines are comparable with that elicited by the vaccine consisting of whole inactivated virion of CHPV. The inactivated whole virion of Chandipura virus is a very effective vaccine for prophylaxis of Chandipura virus infection. The antibodies, of the present invention, against the virus or the subunit antigens can be used for treatment and for diagnosis of Chandipura virus infections. The purified recombinant CHPV subunit antigens such as the glycoprotein (G protein) are formulated in a stable composition for in vivo administration to humans. The method of eliciting protective antibody and cytotoxic T cell responses either singly or in combination with other vaccines is included.

The antibodies of the present invention against the virus or the subunit antigens can be used for treatment and for diagnosis of Chandipura virus infections.

Further, the purified recombinant CHPV subunit antigens and the inactivated virions are formulated in a stable formulation for in vivo administration to mammals particularly humans.

Vaccine compositions containing the whole inactivated virion or the subunit antigens of the CHPV virus can be used singly, or in combination with other viral and bacterial vaccines for broad protective efficacy in humans. The method of eliciting protective antibody and cytotoxic T cell responses either singly or in combination with other vaccines is included. The other vaccines that could be used in combination include but is not limited to that for hepatitis B, hepatitis A, hemophilus influenzae, typhoid, cholera, Japanese encephalitis, diphtheria, pertussis and tetanus (DTP), meningococcal vaccines, any enteroviral vaccine such as that for Hand, foot and mouth disease (HFMD), enterovirus encephalitis, enterovirus non-polio like encephalitis, MMR vaccines, polio vaccines, rotavirus vaccines, pneumococcal vaccines etc.

Brief description of the drawings

Figure-1: Figure 1 is a diagrammatic representation of PCR amplification of the (1A) CHPV Glycoprotein (G protein) gene and (IB) Nucleoprotein (N protein) gene using gene specific primers.

Figure-2: Figure 2 is gel picture (2A) showing the purified Chandipura virus.

Figure-3: Figure 3 is expression of Glycoprotein in Pichia pastoris at different time intervals of induction.

Figure-4: Figure 4 shows purified recombinant glycoprotein from Pichia pastoris.

Detailed description of the invention

Detailed embodiments of the present invention are disclosed herein however, it is to be understood that the disclosed embodiments are merely exemplary of the invention, which can be embodied in various forms. Therefore, specific structural and functional details disclosed herein are not to be interpreted as limiting, but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure. Further, the terms and phrases used herein are not intended to be limiting but rather to provide an understandable description of the invention.

The envelope Glycoprotein (G-protein) is the major protein on the surface of the Chandipura virus. The G-protein spikes are the major antigenic determinants. Hence the glycoprotein is an excellent vaccine candidate and is the immunogen of choice for subunit vaccine for prophylaxis of CHPV infections. The sequence of the candidate CHPV G-protein vaccine and the method for cloning and expression in eukaryotic and prokaryotic expression system is included within the scope of the invention. The eukaryotic expression system of choice includes mammalian cells, baculovirus in insect cells, and yeast cells of any species, most preferably Pichia pastoris or Saccharomyces cerevisiae.

Pichia pastoris as recombinant expression host is advantageous at industrial scale as it is cost effective for large scale manufacture compared to other eukaryotic expression systems. Recombinant proteins derived from Pichia pastoris have been successfully commercialized and have been found safe for human use. Purification of the virus antigens using the proprietary Himax™ technology in addition to the routine chromatography, precipitation and centrifugation techniques facilitates isolation of the antigens by a cost-effective method that is safe for human application and economical at the industrial scale than conventional density gradient ultracentrifugation. This will also enable the production of low cost vaccine. The Chandipura G-protein expressed in Pichia pastoris was found to be as immunogenic as the whole virion vaccine.

The gene encoding G protein is cloned, expressed and purified as a polypeptide. Either the polypeptide or the virus like particles can be used as vaccine candidate. It can also be expressed as a chimeric protein comprising the CHPV glycoprotein in combination CHPV Nucleoprotein (N-protein) and with other bacterial and viral antigens. The said antigens are capable of inducing a strong antibody response and cytotoxic T cell response when administered to the host. The Glycoprotein gene sequence can be the native sequence from the virus or a synthetic gene sequence that is optimized for expression in a suitable eukaryotic host such as yeast cells, particularly Pichia pastoris. The sequence of glycoprotein gene used in the invention consists of the full length sequence that has been optimized for expression in yeast cells. The optimization of the sequence for yeast expression includes the addition of Kozak's consensus sequence such as (gcc)gccRccATGG (where R is A/G) at the 5' end of the gene such as in SEQ ID NO.l or the use of yeast consensus sequence (5l-[(A/Y)A(A/T)AATGTCT]-3', where Y is a pyrimidine nucleotide) such as in SEQ ID NO.2. A truncated sequence without the membrane targeting sequence (first 21 amino acids) at the N-terminus is also optimized for expression in yeast cells with Kozak's consensus sequence at the 5' end of the G-gene such as in SEQ ID No.3 and with yeast consensus sequence at the 5' end of the G-gene such as in SEQ ID. No.4. Translation of the SEQ ID NO.3 results in protein with SEQ ID NO. 8. Furthermore, the nucleotide sequence encoding the full length glycoprotein is codon optimized such as in SEQ ID NO. 9 for expression in Pichia pastoris. SEQ ID NO.9 can be used to clone the mature glycoprotein gene without the N-terminal membrane targeting sequence. The sequence PCR amplification with a primer to incorporate the Kozak's consensus sequence for enhanced expression and translation of the SEQ ID NO.3 results in a protein that has aspartic amino acid instead of the native tyrosine residue at the N-terminus of the mature glycoprotein sequence following the initiator codon methionine. The amino acid change facilitated incorporation of the Kozak's consensus sequence for enhanced expression. The full length G-protein sequence is the SEQ ID NO.5 and the mature G-protein with deletion of the N-terminal membrane targeting sequence is SEQ ID No.6. These proteins could optionally include 6-8 amino acid Histidine tag either at the N-terminus or at the C-terminus of the protein for facilitating purification by affinity chromatography. The recombinant proteins SEQ ID No.5 and SEQ ID No.6 are equally immunogenic and are excellent vaccine candidates for prophylaxis of CHPV infections. The nucleocapsid protein as in SEQ ID NO.7 can also be used as a candidate vaccine either singly or in combination with G-protein. Addition of His tag to the protein simplifies the purification process.

The aforementioned proteins are expressed as intracellular proteins in yeast or as secretory proteins and purified there from. Any suitable expression vector is selected from the list that includes but is not limited to pPIC3.5, pPIC3.5K, pA018, pPIC9, pPIC9K pHIL-D2, pHIL-Sl, pGAPZ and pGAPa A,B,C, pPICZ A,B,C vectors etc. Any plasmid vector suitable for expression in any yeast organism such Pichia pastoris, Saccharomyces cerevisiae, Hanensula polymorpha, Schizosaccharomyces pombe, Kluveromyces spp or any other genus/species of yeast can be used. The Pichia pastoris strains such as GS115, KM71 and protease deficient strains such as SMD1168 or SMD1163 is used. The CHPV G-gene of the aforementioned sequences can be cloned either in single copy or more than one copy in any of the aforementioned yeast vectors and in any of the yeast strains. The G-protein can be expressed intracellularly or can be expressed as a secretory protein, where the protein is secreted out of the yeast cells into the medium. The yeast derived and purified recombinant G-protein is as efficacious as the whole CHPV virion in eliciting a strong immune response with neutralizing antibodies that protect the mice from infection with the live virus challenge. Hence the yeast derived CHPV G-protein is an excellent subunit vaccine for the prophylaxis of CHPV infection. Purification of the virus G-protein is carried out by any of the following techniques that includes but is not limited to: zonal ultra-centrifugation, density gradient centrifugation and ultrafiltration with membranes, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography, salting with inorganic salts one such example being ammonium sulphate, and by the use of proprietary Himax™ technology, other inorganic salts, organic solvents and other organic compounds such as polyethylene glycol. The protein with His tag at the N-terminus or at the C-terminus can be purified by any metal-affinity chromatography. Purification of the viral antigens has been achieved by either one or a combination of two or more of the above mentioned methods.

The efficacy of the yeast derived vaccine in offering protective immune response is compared with the Chandipura whole virion vaccine that is prepared in the following manner and whose development as candidate vaccine is included within the scope of this invention. The methods are establishment of stable infection in continuous cell culture, methods of virus purification, inactivation for production of vaccine lots are adequately described in the examples. Vero cells (ATCC CCL-81) is used as the cell substrate for the adaptation of the Chandipura virus strain and for eventual production of vaccines from this cell substrate. A cell line that can be propagated in vitro in culture can be used as a host for virus culture. For example, diploid cell lines such as MRC-5 and WI-38 and serially passaged cell lines such as Vero, BHK-21, CHO cells etc. can be used. For propagating CHPV strains, preferably permissive cells are selected which allow the virus to grow well. For example Vero cells, BHK-21, C6/C3 mosquito cell line, MRC-5, CV-1, BSC-1, MA104, MDCK, WI-38, CHO cells, CaCO-2 etch and DBS-FLC-1, DBS-FLC-2, DBS-FRhl-2, ESK-4, HEL, IMR-90, WRL68, etc. conventionally used for producing a virus vaccine can be used ("ATCC Microbes and Cell at Work", 2nd Edition., ppl44, American Type Culture Collection (ATCC) 1991, USA). One such cell line used in the current invention is Vero cells which have been validated for use as a host cell for vaccine production. The validated Vero cell lines conforms to the Requirements for Biological Substances No.50 regarding requirements for use of cells for the production of biologicals recommended by the World Health Organization (WHO) thereby confirming these cell lines as qualified for producing a vaccine (WHO Technical report Series, No. 878, pp 19-52, 1998). Furthermore for maintenance in cell culture of the above-mentioned cell lines, stationary culture in monolayers, perfusion system culture, shake flasks, roller tube/bottle culture, suspension culture, microcarrier culture, cell factories and cell stacks and the like can be adopted. Any commercially available microcarriers for e.g. Cytodex (Pharmacia Biotech, Sweden) and other animal cell culture devices can be used.

The methods described in the current invention are applicable to any genotype/serotype/strains of Chandipura virus. The virus particles obtained from infected patients or isolated from the vectors of the virus where the virus resides can be adapted in cell lines and propagated in vitro in cell culture in several passages. In an alternative protocol, the virus particles have been passaged once through 2-day old suckling mice and the virus re-isolated and passaged in cell culture in vitro. This increased the titer of the virus in cell culture.

Purification of the virus is achieved by physical or chemical means and preferably by a combination of both. Physical methods utilize the physical properties of the virus such as density, size, mass, sedimentation coefficient etc. and includes any of the following techniques but is not limited to: zonal ultra-centrifugation, density gradient centrifugation, ultrafiltration with membranes with size cut offs above 100 kDa to remove serum and cellular components. Purification through chemical means employs methods such as adsorption/desorption through chemical or physiochemical reactions and includes for example purification by ultracentrifugation, density gradient centrifugation, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, gel filtration chromatography, salting with inorganic salts one such example being ammonium sulphate, and by the use of proprietary Himax™ technology, organic salts, organic solvents, aluminum phosphate, aluminum hydroxide and organic compounds such as polyethylene glycol. Purification of the virus is achieved by either one or a combination of two or more of the above mentioned methods. The virus can be visualized by a negative staining method using 2% (w/v) uranyl acetate can be observed under an electron microscope at a magnification of about 20,000 to about 200,000.

The virus is inactivated either by heat, gamma irradiation, ultra violet light or by chemical inactivation. A chemical inactivating agent is selected from the following list which includes but is not limited to: formalin, beta-propiolactone (BPL), glutaraldehyde, N-acetylethyleneimine, binary ethyleneimine, tertiary ethyleneimine, ascorbic acid, caprylic acid, psolarens, detergents including non-ionic detergents etc. is added to a virus suspension to inactivate the virus. For example, when using formalin and beta-propiolactone, the amount to be added is about 0.001% to 0.5% (v/v). Optimally the concentration of formalin used for inactivation was 1:2000 to 1: 4000, preferably, 1:2500 and 1: 3000 dilution of formalin to virus suspension; in case of beta-propiolactone, the optimum concentration ranged from 1: 1500 to 1: 4000, most preferably, between the ranges 1:2500 to 1:3500 of beta propiolactone to the virus suspension. The optimum inactivation temperature is about 2-8°C for a duration of 48 hours to 200 hours, preferably for 7 days at 4°C. Inactivation is also effective at intermediate temperatures of around 22°C for a shorter duration up to 4-5 days. Heat inactivation is effective for Chandipura virus at any temperatures above 37°C, preferably from 50°C to 65°C for a period of 30 min to 6 hours. Gamma irradiation was found to be effective for virus infectivity and the gamma irradiated vaccine elicited a high level of neutralizing antibodies. The optimum exposure of virus to gamma irradiation was 10 Kilogray to 25 Kilogray for a period of 30 minutes to 48 hours with varying level of neutralizing antibody titers elicited with varying time period of exposure to the radiation. Neutralizing antibody titer obtained by immunization with the gamma irradiated vaccine preparation in a stable formulation, is estimated by in vitro serum neutralization assay and is a measure of protective efficacy of the vaccine. Inactivation of the virus particles by of the means described in the invention can be achieved either before or after purification of the virus.

The antigenic compositions of Chandipura virus are formulated in pharmaceutically acceptable carrier for immunization in humans. The antigenic formulations are formulated in alum which potentiated the immune response. Aluminum phosphate also offered similar potency; other aluminum compounds such as aluminum sulphate phosphate can also be used with the Chandipura virus antigens. Formulation with gamma inulin increased the potency of the vaccine. Other polymorphic forms of inulin such as alpha inulin, delta and epsilon forms of inulin or any other high molecular weight inulin can be used as an adjuvant with the Chandipura virus antigens. The methods of gamma inulin preparation are available in the prior art (US 4,954,622; PCT/AU86/00311). A combination of inulin and alum known as algammulin was found to be a highly effective adjuvant that increased the potency of the vaccine several fold.

The methods of preparation of gamma inulin and algammulin and their use as vaccine adjuvant is also disclosed in the prior art (Cooper and Steele, 1991). The novelty of the invention is the vaccine composition of Chandipura virus antigens with gamma inulin / algammulin as the vaccine adjuvant that increased the immunogenicity of the virus antigens several fold. No adverse events were observed when the adjuvanted vaccines were inoculated in mice. Inulin can be used in combination with other organic and inorganic compounds such as aluminum sulphate phosphate and calcium phosphate among others. Other adjuvants can be selected from the list that includes but is not limited to calcium phosphate, liposomes, chitosan and complex carbohydrates such as dextran, dextrins, starch, mannans and glucomannans, galactomannans, beta-glucans, heparin, cellulose, pectins and pectinates, lectins and any other carbohydrates, either synthetic or derived from any source; any biodegradable and biocompatible polymers, such as poly lactide and poly(lactide co-glycolides; PLG) or PLGA; any emulsions including but not limited to oil in water emulsions one such example being AS03, other squalene based adjuvants such as MF59 etc., any water in oil emulsion; liposomes prepared with cholecalciferol as one of the ingredients along with other lipid soluble compounds; liposomes of other compositions; RIBI adjuvant systems, saponins including but not limited to QS-21, QuilA, tomatine, ISCOMs, ISCOMATRIX etc, lipopeptides, glycopeptides, lipopolysaccharides, muramyl dipeptides and any peptide based adjuvants, oligonucleotides, any TLR ligands as adjuvants, any cytokine, vitamins and non-toxic bacterial toxins such as Monophosphoryl lipid A and derivatives, CpG and non-CpG containing oligonucleotides etc. Any other organic and inorganic compounds that increase the humoral and cell mediated immunity when combined with Chandipura virus antigens is suitable to be used in the vaccine formulation.

The Chandipura virus antigens when used singly or when used in combination elicits high level of protective neutralizing antibodies. For e.g. the inactivated CHPV vaccine when used in combination with vaccine for Japanese encephalitis (JE) elicited neutralizing antibodies against both the viruses and hence a good combination to use for prophylaxis of encephalitis infection. The combination vaccines could also include vaccine for enterovirus mediated encephalitis along with CHPV vaccine and JE vaccine or a combination of CHPV inactivated viral vaccine in combination with JE vaccine alone. Such a combination was found to elicit to protective neutralizing antibodies against both the viruses when tested in mice. Alternatively, the antigenic formulation could comprise the CHPV glycoprotein in combination with two or more of the purified antigens such as inactivated Japanese encephalitis virus and enterovirus. Either recombinant enterovirus antigens or whole inactivated virion could be used in the combination. The combination of the aforementioned vaccines is an admixture of the virus antigens in a pharmaceutically acceptable formulation for human administration. The vaccines antigens of the aforementioned combination can be mixed in a suitable ratio that is required for eliciting protective antibodies against the candidate vaccine viruses. The antigenic formulations can be delivered by one of the several methods, either by oral, mucosal or by parenteral routes, preferably intradermal or intramuscular routes in mammals preferably in human subjects' inorder to elicit a protective antibody and/or cytotoxic T cell responses. The antigens could also be delivered in pharmaceutically acceptable biodegradable polymers. The aforementioned formulations are used for prophylaxis or therapeutic treatment of Chandipura virus infections. The antibodies against the G-protein are used for diagnosis and for therapeutic treatment of the CHPV infection.

The immunogen of a Chandipura virus vaccine is a representative example of an immunogen of a vaccine against infectious diseases caused by Chandipura viruses of any strain or genotypic variants of the Chandipura virus. The vaccine of the present invention is provided in a sealed vial or ampoule in a liquid or lyophilized form. In the case of liquid formulation, it can either be parenterally administered or orally or by intranasal route to a subject to be vaccinated in an amount of about 0.05ml to 5 ml per person. In the case of a dry lyophilized formulation, it is injected after being re-solubilized with a suitable solubilizing solution.

According to the present invention, the method that is applicable to strains of Chandipura virus being used in the current invention is applicable to any CHPV strain with a broad antigenic spectrum. The broad spectrum antigenic response would offer a satisfactory immune protection against plural strains of CHPV in addition to the virus strain used in production of the vaccine. As known to those skilled in the art, a divalent or polyvalent vaccine may be prepared by mixing vaccines produced from two or more CHPV strains that have been genetically confirmed as CHPV and is mixed in a suitable ratio based on the antigenic protein content. Such mixing would provide a vaccine preparation having a broader antigenic spectrum for protection against the infection.

An inactivated virus particle of the present invention is diluted with any suitable diluent that is pharmaceutically acceptable so as to obtain the desired titer. The buffer used in the formulation may be phosphate buffer or phosphate-citrate buffer or any other pharmaceutically acceptable buffer. A vaccine may optionally contain preservative(s), stabilizer(s) etc. Reducing and non-reducing sugars, sugar alcohols such sorbitol and mannitol, glycerol, amino acids, human serum albumin is added in the range of 0.01% to 10% for the liquid formulation and upto 60% of the total solids for a lyophilized formulation. Such a stable formulation of the immunogen either in a liquid or in a lyophilized form and after reconstitution in a pharmaceutically acceptable buffer or water is suitable for administration parenterally in human host and can also be formulated for oral and intranasal administration. In another aspect of the invention, virus particles obtained according to the present invention, as well the recombinant viral proteins and the antibody against the virus or the virus antigens can be used as a reagent in the diagnostic tests e.g. as an antigen in an immunoprecipitation method, a hemagglutination inhibition (HI) test, complement fixation (CF) reaction, ELISA, radioimmunoassay, immunofluorescence, Western Blot and the like. More specifically using the entire or a part of an inactivated virus particle of the present invention, a diagnostic assay with high sensitivity and specificity for detecting infection by different strains of the Chandipura virus can be provided. As used herein the term "a part" of an inactivated virus particle refers to a fraction of the virus which retains desired antigenicity and is derived from the virus particles including for example, structural protein solubilized during the purification step described in the given examples or expressed in a recombinant expression system. Polyclonal antibodies or monoclonal antibodies specific for the virus can be used in a diagnostic assay for Chandipura virus infection.

For potency testing of the vaccine, the vaccine formulations are tested in Balb/c mice and rabbits were used for raising polyclonal antisera. The resultant serum is assayed by in vitro neutralization tests neutralizing antibodies against the CHPV and the antibody titer is determined by ELISA. Seroconversion was observed in the animals immunized with the vaccine formulations described in the present invention. The vaccine of the present invention is stable. The vaccine of the present invention is more potent and safe as the yeast derived vaccines have previously been administered in neonates and children. The vaccine of the present invention is cost effective and yeast expression system is highly advantageous at the industrial scale for manufacturing of low cost and safe vaccines.

EXAMPLES

Example 1-

Establishment of Chandipura virus culture in Vero cells:
Chandipura virus was isolated from the serum sample and throat swab samples of a patient with suspected Japanese encephalitis or other unknown infection with informed consent and under medical supervision in 2007. The sample was negative for JE and Chikungunya viruses by RT-PCR with gene specific primers. The identity of the virus that produced cytopathic effect (cpe) when grown in Vero cells in culture was later identified as Chandipura virus by PCR amplification and sequencing of the glycoprotein gene. The virus was plaque purified, and was propagated in continuous cell culture in Vero cells (ATCC No. CCL-81) and in BHK-21 cells and MRC-5 cells. The medium for virus infection was DMEM (Dulbecco's Modified Eagle Medium; Sigma-Aldrich, Product No. D5523 and used per the manufacturer's instructions) containing 0% - 1% FBS. At the end of 48 hours of infection, the cytopathic effect was near total in Vero and BHK21 cells and the virus was present largely in the extracellular medium. The virus titer significantly enhanced to more than 108 5 TCIDso /ml after passaging through 2-day old mouse brain. Virus infection and propagation were also alternately tested in a serum free medium. For scaling the production of cells for virus infection, one cryovial containing 5 x 106 viable Vero cells from working cell bank were used for seeding one T175 cell culture grade flask. DMEM containing 5 % FBS and 50 ug/ml of neomycin sulfate was used for revival and replenishing the cells. After 90 % confluence of the cell monolayer in T175 flasks, the cells were trypsinized and propagated further in cell factories / cell stacks (CF10). DMEM medium was used for propagation (~ 2.0 L/ CF10) Chandipura virus isolate was confirmed for the identity by complete RT-PCR of the virus Glycoprotein (G protein) and the Nucleoprotein (N protein) and by DNA sequencing using gene specific primers.

Example 2-

Prepa ration of inactivated virus:
The purified virions of Chandipura virus were heat inactivated at different temperatures ranging from 50°C - 60°C for upto 6 hours. The infectivity of the virions was checked by re-infection of the virus in Vero cells. No re-infection was observed in three serial passages of the virus when heat treated upto 6 hours at a range of temperatures from 50°C - 60°C. Chemical inactivation of the virus was carried out with either formalin or with beta propiolactone. When formalin (formaldehyde) was used, the concentrations tested were in the range of 1: 1500 to 1: 4000 at different time periods from upto 14 days at temperatures ranging from 2-8°C upto 22°C. The preferable time and temperature of inactivation with formalin was 2-8°C at a dilution of 1:3000 or 1:3500 for 7 days. Beta propiolactone completely inactivated the virus when tested at dilutions from 1:1500 to 1:3500 at either 22°C for 4 days or at 2-8°C for 7 days. Both the formalin and beta propiolactone inactivated formulations were highly immunogenic and elicited neutralizing antibodies when used as a vaccine formulation. Gamma irradiation of the vaccine was carried out with 10 kGy (kilogray) radiation from a ^Co source for different time intervals from 30 min to 48 hours and the neutralizing antibody titers at different time of exposure were tested after immunization in mice. The virus stocks were kept frozen in dry ice during irradiation. The completeness of the virus inactivation was tested by serial passaging in Vero cells, before formulating as vaccine. The vaccine formulation buffer used for gamma irradiation optionally contained 20 mM ascorbic acid and 20 mM histidine.

Example 3-

Purification of the Chandipura virus:
The viral harvest from CF10 cell factories were clarified with a 0.45 (am filter, concentrated by filtration with a 300 kDa cut off membrane and buffer exchanged with 50 mM phosphate buffer, pH 7.4. The concentrated viral harvest is loaded on to a pre-charged cellufine sulphate resin in a column equilibrated with the same buffer. The column is washed extensively with buffer containing 50 mM NaCl and the bound virus was eluted serially with increasing salt concentrations from 150 mM to 1000 mM. The fractions containing the virus was pooled and analyzed on gel for purity. The fractions containing the virus particles were concentrated and buffer exchanged with a 300 kDa cut off membrane. The concentrated bulk virus was sterile filtered with a 0.22 urn capsule filter and stored frozen at -80°C until use.

Example 4-

Recombinant cloning and expression of the viral Glycoprotein and Nucleoprotein genes:
The glycoprotein (G protein) and the Nucleoprotein (N protein) genes were cloned in yeast vector and in E.coli vector respectively after Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) of the CHPV viral RNA. Viral RNA was isolated using Absolutely RNA Miniprep kit (Stratagene, La Jolla, CA, USA) from infected Vero cells (ATCC CCL-81). RT-PCR was carried out using the AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Stratagene) as per the kit protocols, and the glycoprotein and nucleoprotein genes was amplified with the PfuUltra High-Fidelity DNA polymerase (Stratagene). Gene specific primers were used to amplify the genes encoding the Glycoprotein (G protein) gene and the Nucleoprotein (N protein) genes. The primers used for RT-PCR amplification of the G protein gene are:

Forward primer 1: 5' ACATGAATTCGCCGCCACCATGGATTTGAGTATAG 3'
OR

Forward primer 2: 5' ACATGAATTCGCCGCCACCATGGCTTTGAGTATAG 3'

Reverse Primer 1: 5' GCATGGATCCGCGGCCGCTCATACTCTGGCTCTCATGTTG 3,

when cloning the native G protein gene from the CHPV virus by RT-PCR. Alternatively, the codon optimized synthetic gene encoding the G protein was used as template to clone the mature G protein gene by PCR using the following PCR primers:

Forward primer 3: 5'

CATGAATTCGCCGCCACCATGGACTTGTCCATCGCATTCCCTGAG3' Reverse primer 2: 5' GCATGGATCCGCGGCCGCTTAGACTCTTGCTCTCATG 3'

PCR amplification was carried out with denaturation at 94°C for 40 seconds, annealing at 58°C for 45 seconds and extension at 70°C for 3 min for 30 cycles, and final extension at 70°C for 10 min. The PCR fragments after amplification were gel purified and digested with EcoRl and Notl and cloned into the EcoRl and Notl sites of pPIC3.5K or pPIC9 vector in the AOX1 locus under the control of the AOX1 promoter and transformed in Pichia pastoris GS115 strain and induced by methanol as per the protocols outlined in the Invitrogen corporation, Carlsbad, USA) and transformed into Pichia pastoris GS115 as per the manufacturer's (Invitrogen) user manual "A Manual of Methods for Expression of Recombinant Proteins in Pichia pastoris''' Version M Jan 2002, of Pichia Expression Kit, Catalog # Kl710-01, Invitrogen Corporation, Carlsbad, USA).

The sequence encoding the Nucleoprotein was amplified by RT-PCR. PCR of the CHPV cDNA was carried out using the following gene specific primers:

NP FP1 (Forward primer): 5' ACACCATATGAGTTCTCAAGTATTCTGC 3'
and
NP RP1: (Reverse primer): 5' ACATGGATCCTCATGCAAAGAGTTTCCTGGC 3'
The PCR fragment was digested with Ndel and BamHl and cloned into the Ndel and BamHl -sites of the prokaryotic expression vector, pET-1 IB and the recombinant plasmid containing the insert was transformed in competent E.coli DH5a cells. The recombinant plasmid isolated from
DH5a cells was transformed in E.coli BL21(DE3) cells for recombinant expression of the
protein.

Example 5-

Purification of the CHPV recombinant antigens:

The yeast cells after induction with methanol were harvested, and lysed in 50 mM Tris-HCl buffer pH 8.0, containing 0.2% Triton X-100 and 5 mM EDTA by sonication and /or with glass beads. The cell suspension was centrifuged at 8000 x g for 10 min. The supernatant was precipitated with salt treatment (Himax, proprietary mix) and precipitated. The protein was eluted from the salt precipitate with Tris-HCl buffer, pH 8.2. The elutes were concentrated and diafiltered with 50 mM Tris-HCl, pH 8.2 and loaded on a cellufine sulphate column equilibrated with the same buffer. The protein was eluted with NaCl of different concentration. The purity of the preparation was checked on 12% SDS-PAGE with silver staining. The identity of the protein was confirmed by Western blot. The nucleoprotein gene cloned in E.coli cells were induced with 0.2 mM IPTG (isopropyl p-D-1-thiogalactopyranoside) for 12 hours at 20°C. The cell pellet after centrifugation at 8,000 rpm for 10 min was washed with 50 mM Tris-HCl pH 8.0 containing 2 mM EDTA and 0.1% Triton X-100. The cells were lysed by sonication, centrifuged at 10,000 rpm for 20 min and the supernatant containing the soluble nucleoprotein was purified serially on strong cation exchange POROS®HS column and on phenyl sepharose columns. The fractions containing the protein were pooled and concentrated by filtration through a 10 kDa membrane. The protein concentration of the purified recombinant glycoprotein and the nucleoprotein was estimated by bicinchoninic acid (BCA) method.

Example 6-

Preparation of vaccine formulations:

The formulation of Chandipura virus antigens was prepared in 40 mM phosphate buffer, pH 6.9 - 7.2 with 154mM NaCl. The viral preparations were formulated in a liquid formulation with aluminum hydroxide/aluminum phosphate at 0.025% to 4% final concentration and tested. The final concentration used in the vaccine formulations ranged from 0.025% to 0.1% of aluminum hydroxide. Addition of other adjuvants further enhanced the potency of the vaccine preparation. Addition of polymorphic form of inulin, particularly the gamma inulin increased the potency of the vaccine at least five fold as determined both by ELISA and by estimation of neutralizing antibody titer by serum neutralization tests (SNT). Gamma inulin concentration was tested at various concentrations ranging from 5 mg/ml to 200 mg/ml. Gamma inulin comprises particles with a molecular weight of above 8000 daltons and is virtually insoluble in water at 37°C. Preparation of gamma inulin is well known in the prior art. The high molecular weight inulin Orafti®HPX was obtained from Beneo Orafti, Belgium. Gamma inulin fractions were prepared by the methods outlined in the prior art (US 4,954,622; PCT/AU86/00311) and the preparation of algammulin was as per the methods described in Cooper and Steele, 1991. The gamma inulin and algammulin preparations at a concentration of 0.5 mg/ml were used in the vaccine formulations after testing these at concentrations ranging from O.lmg/ml to 50 mg/ml. The adjuvants and the antigens were added and allowed to adsorb for 2 hours at ambient temperature and used immediately for injections. Formulations that additionally contained either one or combination of sugars such as sucrose, maltose, trehalose, lactose, glucose, mannitol or sorbitol and inulin conferred good stability to the vaccine formulations. The presence of sugars in the range of 0.5% -10%, and preferably in the range of 0.5% to 5% conferred good stability to the formulations as determined by accelerated stability at 37°C four weeks. Similar formulation was also tested with phosphate-citrate buffer of pH 6.8 - 7.2 and no difference was observed. Higher concentration of above sugars, buffer and salt as upto 60% of the total solids conferred good stability on lyophilized formulation of the vaccine. Addition of human serum albumin from 0.2% upto 5% to the formulation increased the vaccine stability of the lyophilized formulation. The stability of the formulation was tested by accelerated stability at 37°C for four weeks and followed by potency tests in mice.

Example 7-

Determination of the immunogenicitv of the vaccine preparations:

Six one month old Balb/c mice were used in each group. The animals in each group were injected intramuscularly with about 0.1 ml /mouse of serially diluted vaccine preparation starting with a highest dose of 20 ug and diluted upto 100 ng/ mouse. The Chandipura virus antigen was estimated by BCA method and by ELISA using rabbit anti-Chandipura virus antisera. The dilutions were made in buffer containing the appropriate amount of adjuvant and stabilizers as outlined in the previous examples. For control animals, equal volume containing the same quantity of adjuvant was injected without the viral antigens. The vaccine antigens tested include the whole virion of CHPV inactivated with beta-propiolactone (BPL) or formalin, or by gamma irradiation or by heat as described elsewhere in the examples, as well with the purified CHPV glycoprotein and the nucleoprotein. A combination of the glycoprotein and nucleoprotein was also tested. All the vaccine formulations and dilutions as described in this example were three dose administrations at 7, 14 and 28 days. Blood was collected at 7 days after the booster injections. Equal amount of serum was pooled for each group and the complement was inactivated at 56°C for about 30 min. The resultant serum was used for estimation of neutralizing antibody by serum micro neutralization test and for the estimation of total antibody titer by indirect ELISA. In an alternate experiment, similar amount of the inactivated virus preparation was administered by other routes. The buffer used in all the formulations was 40 mM phosphate buffer, pH 6.8 - 7.2 containing 150 mM NaCl.
Polyclonal antibodies were raised in rabbit by injecting 100 ng of the purified virus isolate intramuscularly and injecting a similar amount of antigen as a booster dose 14 and 28 days after the first antigen administration. For ELISA, 1 ng of the antigen was coated on 96-well ELISA plates in carbonate buffer, pH 9.6 overnight at 2-8°C. The wells were blocked with 3% skimmed milk in phosphate buffered saline (PBS), pH 7.4. The plates were incubated at 37°C for one hour and the wells were washed with PBS containing 0.05% Tween-20 (PBST) five times. Serial dilutions of the vaccine antisera were made in PBST and incubated at 37°C for two hours. The plates were washed 8 times with PBST, and then 1:2500 dilution of mouse anti-IgG in PBST was added as the secondary antibody and incubated for one hour at 37°C. The wells were washed five times with PBST and three times with PBS and the color developed by adding OPD (o-Phenylenediamine, Sigma Aldrich, USA) and H202 The readings were taken 10 min after the addition of IN sulfuric acid. Antibody titer as a measure of seroconversion in animals is estimated as the reciprocal of the serum dilution that is above that of control animal + 3 x standard deviation of control. The ELISA results showed that the vaccine from even 100 ng of the BPL inactivated CHPV antigen elicited high antibody response. The IgG antibody titer (reciprocal of serum dilution) by ELISA varied from 3200 for 100 ng to upto 64,000 for 20 fig without alum and from 12,800 upto 320,000 with alum as adjuvant. Since the neutralizing estimation is important for potency of vaccine, the neutralizing antibody titers in the vaccine antisera were determined by complete inhibition of cytopathic effect of 100 TCID50/ml CHPV in Vero E6 cell monolayer. The 50% tissue culture infectivity dose (TCID50) was calculated, and 100 TCID50 of virus was used per assay. Microneutralization assays were performed with serial dilutions of serum in Minimal Essential Medium (Sigma-Aldrich, St. Louis, MO, USA). The sera dilutions were incubated with an equal volume of the medium containing 100 TCID50 of virus for 90 min at 37°C and added to a monolayer of Vero E6 cells (100,000 cells per well) in 96-well flat-bottom plates. The plates were incubated for six days at 37°C in a 5% C02 incubator. Neutralization titer is expressed as the highest dilution of the serum that causes complete inhibition of the virus cytopathic effect. Each serum dilution was tested in quadruplicates. Pooled sera from control animals were used as control in the assays. In another experiment, a range of concentrations of CHPV from 0.5 ug to 20 ug was tested in combination with inactivated vaccine containing 6 ug of Japanese encephalitis (JE) inactivated whole virion vaccine (JENVAC®). The combination vaccine was formulated with 0.25 mg of alum and injected intramuscularly in 6 nos of mice. Three doses were administered at 7, 14 and 28 days and the blood samples were collected at 7 days after last dose administration. For estimation of neutralizing antibody titers against JE, Plaque reduction neutralization test (PRNT50) was employed. The vaccine antisera was serially diluted four-fold and mixed with the appropriate dilution of CHPV and incubated at 37°C for 90 min. The antiserum/virus mixture is added to a confluent monolayer of Vero cells in 6-well plate and incubated for 60 min at 37°C. To each well, 0.9 % of carboxymethyl cellulose solution is added and the plates incubated for 5 days at 37°C in a CO2 incubator. At the end of incubation, the number of plaques is counted. The dilution of serum that reduces the number of plaques by 50% compared to the serum free virus is a measure of virus neutralizing antibody as PRNT50 value.

Figure-1 in the drawings represents PCR amplification of the (1A) approximately ~ 1.53 Kb CHPV Glycoprotein (G protein) gene and the (IB) ~ 1.3 Kb Nucleoprotein (N protein) gene using gene specific primers. The size of the amplified gene fragment is shown against the 1 Kb ladder in both the cases. In the two gel pictures, the G gene and the N gene PCR products are marked with thicker arrows.

Figure-2 represents the gel picture (2A) showing the purified Chandipura virus; the purified CHPV was run on 10% SDS-PAGE under denaturing conditions; the three major proteins Glycoprotein (G), Nucleoprotein (N) and the Matrix protein (M) are indicated in the picture. 2B is the Western blot of the CHPV developing using rabbit anti-CHPV polyclonal sera. The CHPV antigens are indicated by thick arrows.

Figure-3 represents the expression of Glycoprotein in Pichia pastoris at different time intervals of induction with methanol. Lane 1 - uninduced cells; lane 2- 0 hrs after addition of methanol; lane 3 - 24 hrs; lane 4- 48 hrs; lane 5 - molecular size marker; lane 6- 72hrs; lane 6-96 hrs; lane 7-120 hrs after induction with methanol. The thick arrow indicates the induced ~ 65 kD G protein.

Figure-4 represents purified recombinant glycoprotein from Pichia pastoris.

Table 1:

Below table-1 illustrates the immunogenicity of the inactivated whole virion of Chandipura virus and the recombinant antigens were estimated by the serum neutralizing antibody titer. Six
balb/cmice were injected per dose group. The numbers in parenthesis indicate the %
seroconversion of the vaccinated animals. The control animals were injected with equal volume of the vehicle (data not shown). The antibody titer is expressed as the reciprocal of the serum dilution that causes complete inhibition of the virus cytopathic effect in Vero cells. ND – not determined.

Table-1-

Table 2:

Below table 2 illustrates immunogenicity of the CHPV antigens tested with different adjuvants as indicated in the examples. Aluminum phosphate and aluminum hydroxide was used at 0.25 mg/dose; gamma inulin and algammulin was used at 1 mg/dose along with 2.5 ng of the different CHPV antigens as indicated. Six balb/c mice were used per dose group. The numbers in parenthesis indicate the % seroconversion of the vaccinated animals. The control animals were injected with equal volume of the vehicle containing the adjuvant alone and no neutralizing antibody against the virus antigen could be detected in the sera samples (data not shown). The antibody titer is expressed as the reciprocal of the serum dilution that causes complete inhibition of the virus cytopathic effect in Vero cells.

Table-2-

Table 3: Combination of 2.5 ue Chandipura virus antigen (BPL inactivated) and 6 ue of Japanese encephalitis inactivated whole virion vaccine (JENVAC®) was injected intramuscularly in 6 nos of balb/c mice at intervals of 7,14 and 28 days
Sequence listing is enclosed in electronic form on CD.

References;

Rao BL, Basu A, Wairagkar NS, Gore MM, Arankalle VA, Thakare JP, et al. A large outbreak of acute encephalitis with high fatality rate in children in Andhra Pradesh, India, in 2003, associated with Chandipura virus. Lancet 2004; 364:869-74.
Chadha MS, Arankalle VA, Jadi RS, Joshi MV, Thakare JP, Mahadev PV, et al. An outbreak of Chandipura virus encephalitis in the eastern districts of Gujarat state, India. Am J Trop Med Hyg 2005;73:566-70.

Fontenille D, Traore-Lamizana M, Trouillet V, Leclerc A, Mondo M, Ba Y, et al. First isolations of arboviruses from Phlebotomine sandflies in West Africa. Am J Trop Med Hyg. 1994; 50:570-4.

Venkateswarlu CH, Arankalle VA. Recombinant glycoprotein based vaccine for Chandipura virus infection. Vaccine 2009; 27:2845-50
Geevarghese G, Arankalle VA, Jadi R, Kanojia PC, Joshi MV, Mishra AC. Detection of chandipura virus from sand flies in the genus Sergentomyia (Diptera: Phlebotomidae) at Karimnagar District, Andhra Pradesh, India. J Med Entomol. 2005; 42
Cooper PD, Steele EJ. Algammulin, a new vaccine adjuvant comprising gamma inulin particles containing alum: preparation and in vitro properties. Vaccine. 1991; 9, 351-357.

We claim:

1. Vaccine formulation for prophylaxis and treatment of Chandipura virus infections in mammals comprising Chandipura virus of any genotype or virus antigens thereof, as therapeutically active ingredient

2. Vaccine formulation as claimed in claim 1, wherein said Chandipura virus is inactivated by heat, UV Jjght, by chemical means or by gamma irradiation

3. Vaccine formulation as claimed in claim 2, wherein said chemical inactivation of Chandipura virus is done under conditions selected from:

a. use of beta propiolactone (BPL) at a concentration of 1:1500: to 1:4000,
preferably between 1: 2000 to 1: 3500 dilution of BPL: virus suspension, for a
period of 2-14 days at 2-8°C, preferably for 7 days at 2-8°C, or at 22°C for a
period of 4-6 days;

b. use of formalin (formaldehyde) at a concentration of 1:2500 to 1:4000 dilution
of formalin to virus suspension for a period of 4-15 days at 2-8°C or at a
temperature of 25°C for a period of 4-8 days.

4. Vaccine formulation according to Claim 2, wherein said Chandipura virus cultured in Vero cells is inactivated wherein the inactivation is carried out before or after purification of the virus.

5. Vaccine formulation according to claim 1, wherein the Chandipura virus antigen is purified glycoprotein of Chandipura virus.

6. Vaccine formulation of claim 5, wherein the glycoprotein is recombinant protein expressed and purified from eukaryotic expression system such as baculovirus mediated insect cell expression system, yeast or mammalian cells.

7. The host cell for recombinant expression according to claim 6 is yeast such as Saccharomyces spp, Kluveromyces spp, Schizosaccharomyces pombe, Hanensula polymorpha, Pichia pastoris etc, preferably Pichia pastoris.

8. Recombinant DNA constructs comprising (i) a vector and (ii) at least one nucleic acid fragment of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4 or SEQ ID NO.9 encoding the glycoprotein of amino acid sequence of SEQ ID No.5, SEQ ID No.6 or SEQ ID No.8 according to any of the preceding claims.

9. An immunogenic preparation according to claim 1, wherein the Chandipura virus antigen is recombinant nucleoprotein of SEQ ID No.7 expressed and purified from a prokaryotic host such as E.coli.

10. A method for producing recombinant protein of any of the preceding claims comprising of the following steps:
i) culturing the host cell cloned with recombinant construct of claims 8 and 9;
ii) harvesting the cells and isolating the recombinant protein therefrom;
iii) purifying the said protein by at least one of the following methods: ion exchange
chromatography, gel filtration, affinity chromatography, hydrophobic column
chromatography, fractionation with salt, organic solvent(s), centrifugation etc.

11. A method of concentration and purification of the virus that includes one or more of the following methods:
a. ultrafiltration through 100 kD - 1000 kD membrane;
b. ultracentrifugation and density gradient centrifugation;
c. column chromatography such as gel filtration, ion exchange chromatography,
hydrophobic interaction chromatography, affinity matrix chromatography,
precipitation with polyethylene glycol, Himax™, organic and inorganic salts.

12. A stable vaccine formulation of claim 1 comprising of:
a. purified and inactivated Chandipura virus antigen;

b. phosphate buffer, 10 mM to 500 mM pH 6.7 to 7.4 or phosphate-citrate buffer
of similar pH;
c. sugar and sugar alcohol concentration in the range of 0.1 % to 5% wherein the sugars are selected from the list comprising: lactose, maltose, sucrose, glucose, trehalose, and sugar alcohols such as mannitol or sorbitol, inulin and /or a combination of the different sugars thereof;
d. 25mM-200mMNaCl;
e. adjuvant selected from a list consisting of aluminum hydroxide, aluminum phosphate, gamma inulin, algammulin or a combination thereof;
f. optionally includes protein additives such human serum albumin at the concentration of 0.1 % to 5%.

13. A lyophilized formulation according to Claim 1 comprising of:
a. purified and inactivated Chandipura virus as antigen;
b. phosphate buffer 10 mM to 500 mM pH 6.7 to 7.4 or phosphate-citrate buffer of similar pH;
c. sugar or sugar alcohol concentration in the range of 0.1 % to 50%, preferably 1
- 5%, wherein the sugars are selected from a list consisting of lactose, maltose,
sucrose or trehalose, inulin, sugar alcohol or a combination thereof;
d. 25mM-200mMNaCl;
e. optionally, protein additives such human serum albumin etc. are used in the concentration range of 0.1% to 5%.

14. Pharmaceutical composition comprising antigens according to any of the preceding claims in an effective amount to be administered as a vaccine in a pharmacologically acceptable carrier by at least one of the following routes such as intramuscular, intradermal, subcutaneous, intravenous, oral and intranasal route of administration in mammals preferably humans for eliciting a protective antibody response.

15. A in vitro or in vivo method for usage of antigenic molecules of any of the preceding claims for preparation vaccine formulations, immunodiagnostic and an immunotherapeutic agent for Chandipura virus infection.

16. An immunogenic composition according to claim 1 that is a combination of Chandipura virus antigen and Japanese encephalitis virus antigen for human administration, for prophylaxis of both Chandipura virus and Japanese encephalitis viral infections.

Documents

Application Documents

# Name Date
1 3628-che-2010 correspondence others 30-11-2010.pdf 2010-11-30
2 3628-che-2010 sequence listing 30-11-2010.pdf 2010-11-30
3 3628-che-2010 form-5 30-11-2010.pdf 2010-11-30
4 3628-che-2010 form-3 30-11-2010.pdf 2010-11-30
5 3628-che-2010 form-2 30-11-2010.pdf 2010-11-30
6 3628-che-2010 form-1 30-11-2010.pdf 2010-11-30
7 3628-che-2010 description(provisional) 30-11-2010.pdf 2010-11-30
8 3628-CHE-2010 CORRESPONDENCE OTHERS 25-01-2011.pdf 2011-01-25
9 3628-che-2010 form-1 25-01-2011.pdf 2011-01-25
10 3628-che-2010 power of attorney 25-01-2011.pdf 2011-01-25
11 3628-CHE-2010 FORM-13 29-04-2011.pdf 2011-04-29
12 3628-CHE-2010 SEQUENCE LISTING 29-11-2011.pdf 2011-11-29
13 3628-CHE-2010 POWER OF ATTORNEY 29-11-2011.pdf 2011-11-29
14 3628-CHE-2010 FORM -5 29-11-2011.pdf 2011-11-29
15 3628-CHE-2010 FORM -3 29-11-2011.pdf 2011-11-29
16 3628-CHE-2010 FORM -2 29-11-2011.pdf 2011-11-29
17 3628-CHE-2010 FORM -13 29-11-2011.pdf 2011-11-29
18 3628-CHE-2010 DRAWING 29-11-2011.pdf 2011-11-29
19 3628-CHE-2010 DESCRIPTION (COMPLETE) 29-11-2011.pdf 2011-11-29
20 3628-CHE-2010 CORRESPONDENCE OTHERS 29-11-2011.pdf 2011-11-29
21 3628-CHE-2010 CLAIMS 29-11-2011.pdf 2011-11-29
22 3628-CHE-2010 ASSIGNMENT 29-11-2011.pdf 2011-11-29
23 3628-CHE-2010 ABSTRACT 29-11-2011.pdf 2011-11-29
24 3628-CHE-2010 FORM-18 25-05-2012.pdf 2012-05-25
25 3628-CHE-2010 CORRESPONDENCE OTHERS 25-05-2012.pdf 2012-05-25
26 3628-CHE-2010 FORM-3 13-01-2014.pdf 2014-01-13
27 3628-CHE-2010 CORRESPONDENCE OTHERS 13-01-2014.pdf 2014-01-13
28 Form 13 [04-03-2016(online)].pdf 2016-03-04
29 Description(Complete) [04-03-2016(online)].pdf 2016-03-04
30 Form 3 [16-11-2016(online)].pdf 2016-11-16
31 3628-CHE-2010-FER.pdf 2017-02-10
32 3628-CHE-2010-Information under section 8(2) (MANDATORY) [03-08-2017(online)].pdf 2017-08-03
33 3628-CHE-2010-FORM 3 [03-08-2017(online)].pdf 2017-08-03
34 3628-CHE-2010-FORM 4(ii) [07-08-2017(online)].pdf 2017-08-07
35 3628-CHE-2010-AbandonedLetter.pdf 2017-12-13

Search Strategy

1 3628SEARCHSTRATEGY_08-02-2017.pdf