Sign In to Follow Application
View All Documents & Correspondence

Variant Phosphoribosyl Pyrophosphate Amidotransferase And Method For Producing Purine Nucleotide By Using Same

Abstract: The present application relates to a variant phosphoribosyl pyrophosphate amidotransferase, a microorganism comprising same, and a method for producing a purine nucleotide by using same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
11 November 2019
Publication Number
50/2021
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
cal@patentindia.com
Parent Application
Patent Number
Legal Status
Grant Date
2023-12-12
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. LEE, Ji Hye
106-1301, 121, Gwanak-daero, Dongan-gu, Anyang-si, Gyeonggi-do 13922
2. PARK, So Jung
205-1406, 92, Jungbu-daero 223beon-gil, Paldal-gu,Suwon-si, Gyeonggi-do 16496
3. BAEK, Min Ji
102-902, 15, Gwanggyohosu-ro, Yeongtong-gu,Suwon-si, Gyeonggi-do 16515

Specification

Mutant phosphoribosylpyrophosphate amidotransferase and method for preparing purine nucleotides using same
technical field
[One]
The present application relates to a mutant phosphoribosyl pyrophosphate amidotransferase, a microorganism comprising the same, a purine nucleotide production method using the same, a composition for purine nucleotide production, a purine nucleotide production increase method, or the mutant mutant phosphoribosyl pyrophosphate to the use of amidotransferases.
[2]
background
[3]
5'-inosine monophosphate (hereinafter IMP), one of the nucleic acid-based substances, is an intermediate material in the nucleic acid biosynthesis and metabolism system, and is used in various fields such as pharmaceuticals and various medical applications, and 5'-guanylic acid (5' -Guanine monophosphate (hereinafter GMP) is widely used as a food seasoning additive or for food. IMP is known to taste beef by itself, and it is known to enhance the flavor of monosodium glutamic acid (MSG) like GMP, so it is in the spotlight as a refined nucleic acid-based seasoning.
[4]
As a method for preparing IMP, a method of enzymatically decomposing ribonucleic acid extracted from yeast cells, a method of chemically phosphorylating inosine produced by fermentation (Agri. Biol. Chem., 36, 1511 (1972), etc.) and a method of culturing a microorganism directly producing IMP and recovering the IMP in the culture medium. Among these methods, the method currently most widely used is a method using a microorganism capable of directly producing IMP.
[5]
In addition, as a method for manufacturing GMP, 5'-xanthosine monophosphate (hereinafter, XMP) produced by microbial fermentation is converted to GMP using coryneform microorganisms, XMP produced by microbial fermentation is an essay There is a method of converting to GMP using Lycia coli. Among the above methods, when XMP is produced and then produced by a method of converting to GMP, the productivity of XMP, a precursor of the conversion reaction, should be strengthened during microbial fermentation, and not only the produced XMP but also the GMP already generated during the entire process of the conversion reaction. should not be lost.
[6]
On the other hand, enzymes in their natural state do not always show optimal properties in terms of activity, stability, and substrate specificity for optical isomers required for industrial use. Attempts have been made Among them, there are examples where the rational design of the enzyme and the site-directed mutagenesis method are applied to improve the enzyme function, but in many cases, information on the structure of the target enzyme is insufficient or the structure- It has a disadvantage that it cannot be applied effectively because the correlation between functions is not clear. In this case, it has been reported that the activity is improved by attempting to improve the enzyme through a directed evolution method of screening an enzyme of a desired trait from a mutant enzyme library constructed through random mutation of the enzyme gene.
[7]
DETAILED DESCRIPTION OF THE INVENTION
technical challenge
[8]
In order to produce purine nucleotides in a high yield by a method for producing purine nucleotides through the microbial fermentation, the inventors conducted extensive research, and completed the present application by discovering a protein variant having a higher purine nucleotide production ability.
[9]
means of solving the problem
[10]
One object of the present application is to provide a variant phosphoribosylpyrophosphate amidotransferase.
[11]
Another object of the present application is to provide a polynucleotide encoding a variant phosphoribosylpyrophosphate amidotransferase.
[12]
Another object of the present application is to provide a vector comprising the polynucleotide.
[13]
Another object of the present application is to provide a microorganism producing purine nucleotides comprising the variant phosphoribosylpyrophosphate amidotransferase and the vector.
[14]
Another object of the present application is to provide a method for producing purine nucleotides comprising culturing the microorganism of the genus Corynebacterium in a medium.
[15]
Another object of the present application is to provide a composition for producing purine nucleotides, including the mutant phosphoribosylpyrophosphate amidotransferase of the present application.
[16]
Another object of the present application is to provide a method for increasing the production of purine nucleotides, including the mutant phosphoribosylpyrophosphate amidotransferase of the present application.
[17]
Another object of the present application is to provide a use of the variant phosphoribosylpyrophosphate amidotransferase for the production of purine nucleotides.
[18]
Another object of the present application is to provide a use of the polynucleotide for the production of purine nucleotides.
[19]
Another object of the present application is to provide a use of the microorganism of the genus Corynebacterium for the production of purine nucleotides.
[20]
Effects of the Invention
[21]
In the case of culturing a microorganism of the genus Corynebacterium using the mutant phosphoribosylpyrophosphate amidotransferase of the present application, it is possible to produce purine nucleotides in high yield. In addition, the prepared purine nucleotides can be applied to various products such as human food or food additives, seasonings, and pharmaceuticals as well as animal feed or animal feed additives.
[22]
Best mode for carrying out the invention
[23]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present application fall within the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.
[24]
[25]
One aspect of the present application for achieving the above object is to provide a mutant phosphoribosylpyrophosphate amidotransferase having a polypeptide comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO:2. Specifically, the present application provides a variant phosphoribosylpyrophosphate amidotransferase having a polypeptide comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 2, wherein the amino acid substitution is the second amino acid from the N-terminus and/or the substitution of the 445th amino acid.
[26]
Another aspect of the present application is, from the N-terminus in the amino acid sequence of SEQ ID NO: 2, a) the second amino acid is substituted with methionine, b) the 445th amino acid is substituted with arginine, or c) 2 To provide a mutant phosphoribosylpyrophosphate amidotransferase in which the th amino acid is substituted with methionine and the 445th amino acid is substituted with arginine.
[27]
[28]
As used herein, the term "phosphoribosylpyrophosphate amidotransferase" is an enzyme that plays an important role in purine biosynthesis. For the purpose of the present application, the enzyme refers to a protein involved in the production of purine nucleotides.
[29]
In the present application, SEQ ID NO: 2 refers to an amino acid sequence having phosphoribosylpyrophosphate amidotransferase activity. Specifically, SEQ ID NO: 2 is a protein sequence having phosphoribosylpyrophosphate amidotransferase activity encoded by the purF gene. The amino acid sequence of SEQ ID NO: 2 can be obtained from GenBank of NCBI, which is a known database. For example, Corynebacterium sp.), but is not limited thereto, and sequences having the same activity as the amino acid may be included without limitation. In addition, the range of the amino acid sequence of SEQ ID NO: 2 may include an amino acid sequence having phosphoribosylpyrophosphate amidotransferase activity of SEQ ID NO: 2 or an amino acid sequence having 80% or more homology or identity thereto It is not limited. Specifically, the amino acid has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to SEQ ID NO: 2 and/or SEQ ID NO: 2 ( identity) may contain amino acids. The amino acid sequence having homology or identity may be a sequence having less than 100% identity, except for sequences having 100% identity in the above categories. In addition, it is apparent that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application, as long as the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the protein.
[30]
[31]
As used herein, the term "mutant phosphoribosylpyrophosphate amidotransferase" refers to a mutant polypeptide having purine nucleotide-producing ability, a purine nucleotide-producing mutant polypeptide, a purine nucleotide-producing mutant polypeptide, phosphoribosylpyro It may be used in combination with a variant polypeptide having phosphate amidotransferase activity, a phosphoribosylpyrophosphate amidotransferase variant, and the like.
[32]
The mutant phosphoribosylpyrophosphate amidotransferase contains mutations at the 2nd position and/or the 445th position from the N-terminus in the amino acid sequence of SEQ ID NO:2. The mutant phosphoribosylpyrophosphate amidotransferase is one in which the 2nd and/or 445th amino acid in the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid, and contains the amino acid of SEQ ID NO: 2 or a wild-type microorganism-derived non-mutated It may have enhanced activity compared to phosphoribosylpyrophosphate amidotransferase. Such a variant phosphoribosylpyrophosphate amidotransferase is at least 80%, 85%, 90%, 95%, 96%, 97%, 98 with SEQ ID NO: 2 and/or SEQ ID NO: 2 described above. %, or means that the second or 445th amino acid from the N-terminus is mutated in an amino acid having more than 99% homology or identity
[33]
In one example, the mutant phosphoribosylpyrophosphate amidotransferase is a) in the amino acid sequence of SEQ ID NO: 2 a) the second amino acid is substituted with methionine, b) the 445th amino acid is substituted with arginine, Or c) the second amino acid is substituted with methionine and the 445th amino acid is substituted with arginine, and has enhanced phosphoribosylpyrophosphate amidotransferase activity compared to the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 may have, but is not limited thereto.
[34]
[35]
For the purpose of the present application, in the case of a microorganism containing the mutant phosphoribosylpyrophosphate amidotransferase, the purine nucleotide production is a wild-type microorganism, a microorganism containing a wild-type phosphoribosylpyrophosphate amidotransferase, or a mutant type increased compared to microorganisms that do not contain phosphoribosylpyrophosphate amidotransferase. While the wild-type Corynebacterium sp. strain cannot produce purine nucleotides or can produce a very trace amount even if it produces purine nucleotides, the purine of the microorganism through the mutant phosphoribosylpyrophosphate amidotransferase of the present application It is significant that it can increase nucleotide production.
[36]
[37]
Specifically, the mutant phosphoribosylpyrophosphate amidotransferase may include an amino acid sequence in which the 2nd and/or 445th amino acids are substituted with other amino acids. Specifically, the mutant phosphoribosyl pyrophosphate amidotransferase is a) from the N-terminus in the amino acid sequence of SEQ ID NO: 2 a) the second amino acid is substituted with methionine, b) the 445th amino acid is arginine (Arginine) ), or c) a polypeptide comprising an amino acid sequence in which the second amino acid is substituted with methionine and the 445th amino acid is substituted with arginine. In addition, the mutant phosphoribosylpyrophosphate amidotransferase is an amino acid sequence in which the 2nd and / or 445th amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid, or an amino acid sequence of 80% or more It may include, but is not limited to, amino acid sequences having homology or identity. Specifically, the variant phosphoribosylpyrophosphate amidotransferase of the present application is at least 80%, 85 %, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity. In addition, if an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, in addition to the amino acid sequence at the 2nd and/or 445th position, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added It is obvious that they are included within the scope of the present application.
[38]
[39]
That is, even if it is described as 'a protein or a polypeptide having an amino acid sequence described in a specific SEQ ID NO:' in the present application, if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO: some sequences are deleted, It is apparent that proteins having modified, substituted, conservatively substituted or added amino acid sequences may also be used in the present application. For example, if it has the same or corresponding activity as the mutant phosphoribosylpyrophosphate amidotransferase, adding a sequence that does not change the function of the protein before and after the amino acid sequence, a naturally occurring mutation, its It is not intended to exclude latent mutations or conservative substitutions, and it is apparent that such sequence additions or mutations also fall within the scope of the present application.
[40]
The term “conservative substitution” means substituting an amino acid for another amino acid having similar structural and/or chemical properties. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; Aromatic amino acids include phenylalanine, tryptophan and tyrosine, and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine and tryptophan.
[41]
Accordingly, in the present application, the term “variant” may include conservative substitution and/or modification of one or more amino acids in addition to 'a protein or polypeptide having an amino acid sequence set forth in a specific SEQ ID NO:' can For example, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, are removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein. The variants may also include other modifications, including deletions or additions of amino acids, which have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein either co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide. The term “mutant” may include terms such as mutant, modified, mutated protein, mutant polypeptide, mutation, etc. (in English, modification, modified protein, modified polypeptide, mutant, mutein, divergent, etc.), and mutant It is not limited thereto as long as it is a term used in the intended meaning.
[42]
[43]
Homology and identity refer to the degree to which two given amino acid sequences or base sequences are related and can be expressed as percentages. The terms homology and identity can often be used interchangeably.
[44]
Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially, homologous or identical sequences generally have moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Polynucleotides containing degenerate codons instead of codons in hybridizing polynucleotides are also contemplated.
[45]
In general, a codon determines which amino acid is to be encoded, and three nucleotide sequences are paired to form a codon. The types of codons are greater than the types of encoded amino acids, and the types of amino acids generated vary according to the combination of codons. Translation starts from the start codon and the first amino acid may be fMet. In general, fMET is transported to the mRNA codon corresponding to the atg sequence of DNA and translation proceeds, but even when the first DNA of the mRNA ORF (open reading frame) is gtg or ttg, fMet is transported and translation can proceed. That is, the start codon may be atg, gtg, or ttg.
[46]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the “FASTA” program. or, as performed in the Needleman Program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, The Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) including SIAM J Applied Math 48: 1073) For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW, can be used to determine homology, similarity or identity.
[47]
Homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. 48: 443 by comparing the sequence information using a GAP computer program. In summary, the GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" refers to a relevance between sequences.
[48]
In addition, a variant polypeptide consisting of an amino acid sequence in which the 2nd and/or 445th amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 2 is substituted with other amino acids by codon degeneracy, or homology or identity thereof It is apparent that polynucleotides that can be translated into variant polypeptides having In addition, in the amino acid sequence of SEQ ID NO: 2, a) the second amino acid is methionine by hydridation under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence. (Methionine) substituted, b) the 445th amino acid is substituted with arginine, or c) the 2nd amino acid is substituted with methionine and the 445th amino acid is substituted with arginine Any polynucleotide sequence encoding poribosylpyrophosphate amidotransferase may be included without limitation.
[49]
[50]
As used herein, the term "polynucleotide" refers to a DNA or RNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, a polynucleotide encoding a polypeptide. nucleotide fragments.
[51]
The polynucleotide encoding the mutant phosphoribosylpyrophosphate amidotransferase of the present application is not limited as long as it is a polynucleotide sequence encoding a mutant polypeptide having the phosphoribosylpyrophosphate amidotransferase activity of the present application. may be included. In the present application, the gene encoding the amino acid sequence of phosphoribosylpyrophosphate amidotransferase is a purF gene, and specifically may be derived from Corynebacterium stasis, but is not limited thereto.
[52]
Specifically, the polynucleotide of the present application has various modifications in the coding region within the range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or considering codons preferred in the organism to express the polypeptide. This can be done. Any polynucleotide sequence encoding a mutant phosphoribosylpyrophosphate amidotransferase in which the 2nd or 445th amino acid in the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid may be included without limitation. For example, the polynucleotide of the present application may include a partially modified sequence in SEQ ID NO: 1, but is not limited thereto.
[53]
In addition, the second or 445th amino acid in the amino acid sequence of SEQ ID NO: 2 is obtained by hydridation under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence. Any sequence encoding a protein having the activity of a mutant phosphoribosylpyrophosphate amidotransferase substituted with other amino acids may be included without limitation. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., supra). For example, genes having high homology or identity, 40% or more, specifically 85% or more, 90% or more, more specifically 95% or more, even more specifically 97% or more, In particular, the conditions in which genes having 99% or more homology or identity hybridize with each other and genes with lower homology or identity do not hybridize, or at 60° C., which is a washing condition for normal Southern hybridization 1XSSC, 0.1% SDS, specifically 60°C 0.1XSSC, 0.1% SDS, more specifically 68°C 0.1XSSC, at a salt concentration and temperature equivalent to 0.1% SDS, 1 time, specifically 2 to 3 times Conditions for washing can be enumerated.
[54]
Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
[55]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
[56]
The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[57]
[58]
In the present application, the gene encoding the amino acid sequence of the variant phosphoribosylpyrophosphate amidotransferase is the purF gene, and the description of the polynucleotide encoding it is the same as described above.
[59]
The polynucleotide encoding the variant phosphoribosylpyrophosphate amidotransferase in the present application is also the same as described above.
[60]
[61]
Another aspect of the present application includes a polynucleotide encoding the variant phosphoribosylpyrophosphate amidotransferase, or a vector including the polynucleotide.
[62]
As used herein, the term "vector" refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable regulatory sequence so that the target polypeptide can be expressed in a suitable host. The regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
[63]
The vector used in the present application is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors may be used. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used.
[64]
For example, a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and to confer a selectable phenotype such as drug resistance, auxotrophicity, resistance to cytotoxic agents, or expression of a surface polypeptide. markers may be used. In an environment treated with a selective agent, only cells expressing a selectable marker survive or exhibit other expression traits, and thus transformed cells can be selected.
[65]
[66]
The present application is another aspect, and the present application includes a polynucleotide encoding the mutant phosphoribosylpyrophosphate amidotransferase or the mutant phosphoribosylpyrophosphate amidotransferase. , a microorganism that produces purine nucleotides. Specifically, the microorganism containing the mutant phosphoribosylpyrophosphate amidotransferase and/or the polynucleotide encoding the same may be a microorganism prepared by transformation with a vector containing the polynucleotide, but is not limited thereto. does not
[67]
As used herein, the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced into a host cell and expressed in any form, as long as it can be expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are usually operably linked to the polynucleotide. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[68]
In addition, the term "operably linked" as used herein means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target polypeptide of the present application and the gene sequence are functionally linked.
[69]
[70]
As used herein, the term "microorganism comprising a variant polypeptide" or "microorganism comprising a variant phosphoribosylpyrophosphate amidotransferase" refers to a microorganism or a purine nucleotide having a naturally weak ability to produce purine nucleotides. It refers to a microorganism to which the ability to produce purine nucleotides is granted to a parent strain that does not have the ability to produce The microorganism is a microorganism expressing a mutant phosphoribosylpyrophosphate amidotransferase having a polypeptide comprising one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 2, wherein the amino acid substitution is the second amino acid from the N-terminus Substitution with methionine and/or substitution at amino acid position 445 with arginine may be included. In addition, the microorganism is a microorganism expressing a variant polypeptide having phosphoribosylpyrophosphate amidotransferase activity in which the 2nd and / or 445th amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 2 However, the present invention is not limited thereto.
[71]
The microorganism is transformed with a vector comprising a polynucleotide encoding a variant phosphoribosylpyrophosphate amidotransferase or a polynucleotide encoding a variant phosphoribosylpyrophosphate amidotransferase. As a cell or microorganism capable of expressing the same, for the purpose of the present application, the host cell or microorganism is any microorganism capable of producing purine nucleotides, including the mutated phosphoribosylpyrophosphate amidotransferase.
[72]
In the present application, the microorganism producing the purine nucleotides may be used in combination with the microorganism producing the purine nucleotides and the microorganism having the ability to produce purine nucleotides.
[73]
[74]
For the purpose of the present application, "purine nucleotide" means a nucleotide containing a purine-based structure. For example, it may be IMP, XMP or GMP, but is not limited thereto.
[75]
[76]
Specifically, the term "IMP (5'-inosine monophosphate)" is one of the nucleic acid-based substances composed of the following formula (1).
[77]
[Formula 1]
[78]

[79]
IUPAC is also called 5'-inosine monophosphate, 5'-inosine acid, and is widely used as a flavor enhancer along with XMP or GMP in food.
[80]
[81]
The term "GMP (5'-guanine monophosphate)" is one of the nucleic acid-based substances composed of the following formula (2).
[82]
[Formula 2]
[83]

[84]
The IUPAC name is [(2R,3S,4R,5R)-5-(2-Amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-3,4-dihydroxytetrahydro-2-furanyl]methyl It is dihydrogen phosphate, and other names are called 5'-guanidylic acid, 5'-Guanylic acid, or guanylic acid.
[85]
GMP is widely used as a food additive such as sodium guanylate, dipotassium guanylate, and calcium guanylate in the form of a salt, and has a synergistic effect to enhance taste when used as an additive together with IMP. GMP may be manufactured by converting from XMP, but is not limited thereto. As confirmed in one embodiment of the present application, the variant polypeptide of the present application can increase the production of XMP, and the GMP can also be converted from the increased production of XMP to increase the production. It is obvious that it is included in the scope of the application.
[86]
[87]
The term, "XMP (5'-xanthosine monophosphate)" is an intermediate substance of purine metabolism composed of the following formula (3). 5'-inosine monophosphate, also called 5'-xanthylic acid as IUPAC name, may be formed from IMP through the action of IMP dehydrogenase, or XMP may be converted to GMP through the action of GMP synthase. In addition, XMP can be formed from XTP by (d) the enzyme deoxyribonucleoside triphosphate pyrophosphohydrolase containing XTPase activity.
[88]
[Formula 3]
[89]

[90]
As used herein, the term "purine nucleotide-producing microorganism" includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and causes such as insertion of an external gene or enhanced or inactivated activity of an intrinsic gene As a result, a specific mechanism is weakened or enhanced, and may be a microorganism in which genetic mutation or activity is enhanced for the production of a desired purine nucleotide. For the purpose of the present application, the microorganism producing the purine nucleotides is characterized in that the production capacity of the desired purine nucleotides is increased, including the mutant phosphoribosylpyrophosphate amidotransferase, specifically Corynebacterium It may be a genus microorganism. Specifically, in the present application, the microorganism producing purine nucleotides or the microorganism having the ability to produce purine nucleotides may be a microorganism in which a part of a gene in the purine nucleotide biosynthesis pathway is enhanced or weakened, or a part of a gene in the purine nucleotide decomposition pathway is enhanced or weakened. have. For example, in the microorganism, the expression of the gene purA encoding adenylosuccinate synthetase may be weakened. Additionally, depending on the purine nucleotides, the expression of guaB , a gene encoding 5'-inosine dehydrogenase present in the IMP degradation pathway, may be regulated. Specifically, when the purine nucleotide is an IMP, guaBExpression may be weakened, and if the purine nucleotide is XMP or GMP, guaB expression may be enhanced, but is not limited thereto.
[91]
In the present application, the term "the genus Corynebacterium microorganism that produces purine nucleotides" may be a microorganism of the genus Corynebacterium having the ability to produce purine nucleotides through natural type or mutation. Specifically, in the present application, the microorganism of the genus Corynebacterium having a purine nucleotide producing ability refers to a Corynebacterium having an improved purine nucleotide producing ability by enhancing the activity of the gene purF encoding a phosphoribosylpyrophosphate amidotransferase. It may be a microorganism of the genus Leum. More specifically, in the present application, the microorganism of the genus Corynebacterium having the ability to produce purine nucleotides includes the mutant phosphoribosylpyrophosphate amidotransferase of the present application or a polynucleotide encoding the same, or the mutant phosphory It refers to a microorganism of the genus Corynebacterium that has been transformed with a vector containing a polynucleotide encoding bolus pyrophosphate amidotransferase, and has improved purine nucleotide production ability. The 'microorganism of the genus Corynebacterium having improved purine nucleotide production ability' refers to a microorganism having improved purine nucleotide production ability than the parent strain or unmodified microorganism before transformation. The 'unmodified microorganism' is a natural strain itself, a microorganism that does not contain a protein variant that produces the purine nucleotide, or a vector containing a polynucleotide encoding the mutated phosphoribosylpyrophosphate amidotransferase microorganisms that have not been transformed into
[92]
In the present application, "Corynebacterium genus microorganism" is specifically Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Brevibacterium lactofermentum ( Brevibacterium lactofermentum ) , Brevibacterium Plastic pan ( Brevibacterium flavu m), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Corynebacterium epi syeonseu ( Corynebacterium efficiens ), Corynebacterium stay Yorkshire varnish ( Corynebacterium stationis) or the like , but is not necessarily limited thereto.
[93]
[94]
As another aspect, the present application provides a method for producing purine nucleotides, which includes culturing a microorganism of the genus Corynebacterium that produces the purine nucleotides of the present application in a medium. For example, the method of the present application may further include recovering purine nucleotides from the microorganism or medium after the culturing.
[95]
In the method, the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, and the like. At this time, the culture conditions are not particularly limited thereto, but use a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) to an appropriate pH (eg, pH 5 to 9, specifically can control pH 6 to 8, most specifically pH 6.8) and maintain aerobic conditions by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45 ° C, specifically 25 to 40 ° C, and may be cultured for about 10 to 160 hours, but is not limited thereto. The purine nucleotides produced by the culture may be secreted into the medium or remain in the cells.
[96]
In addition, the culture medium used is a carbon source that includes sugars and carbohydrates (eg, glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oils and fats (eg, soybean oil, sunflower seed). Oil, peanut oil and coconut oil), fatty acids (eg palmitic acid, stearic acid and linoleic acid), alcohols (eg glycerol and ethanol) and organic acids (eg acetic acid) may be used individually or in combination. , but not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (such as peptone, yeast extract, broth, malt extract, corn steep liquor, soy meal and urea), or inorganic compounds (such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate) may be used individually or in combination, but is not limited thereto. As the phosphorus source, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium-containing salt corresponding thereto, etc. may be used individually or in combination, but is not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.
[97]
In the method of recovering the purine nucleotides produced in the culturing step of the present application, the desired purine nucleotides may be collected from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. may be used, and a desired purine nucleotide may be recovered from a medium or microorganism using a suitable method known in the art.
[98]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Accordingly, the recovered purine nucleotides may be in purified form or a microbial fermentation broth containing purine nucleotides (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).
[99]
As another aspect of the present application, there is provided a composition for producing purine nucleotides, comprising a variant phosphoribosylpyrophosphate amidotransferase.
[100]
The composition for producing purine nucleotides refers to a composition capable of producing purine nucleotides by the polynucleotide of the present application. For example, the composition includes the polynucleotide, and may further include, without limitation, a composition capable of operating the polynucleotide. The polynucleotide may be in a form included in a vector to enable expression of an operably linked gene in an introduced host cell.
[101]
In addition, the composition may further include any suitable excipients commonly used in compositions for the production of purine nucleotides. Such excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, but are not limited thereto.
[102]
[103]
As another aspect of the present application, it provides a method for increasing purine nucleotide production, comprising culturing the mutant phosphoribosylpyrophosphate amidotransferase in a microorganism of the genus Corynebacterium.
[104]
The terms "mutant phosphoribosylpyrophosphate amidotransferase", "Corynebacterium genus microorganism", "culture" and "homoserine or homoserine-derived L-amino acid" are as described above.
[105]
[106]
As another aspect of the present application, there is provided the use of the mutant phosphoribosylpyrophosphate amidotransferase for the production of purine nucleotides or a composition for production of purine nucleotides.
[107]
As another aspect of the present application, there is provided a use of the polynucleotide for production of purine nucleotides or a composition for production of purine nucleotides.
[108]
As another aspect of the present application, there is provided a use of the microorganism of the genus Corynebacterium for the production of purine nucleotides or a composition for production of purine nucleotides.
[109]
Modes for carrying out the invention
[110]
Hereinafter, the present application will be described in more detail by way of Examples. However, these examples are for illustrative purposes of the present application, and the scope of the present application is not limited by these examples, and it will be apparent to those of ordinary skill in the art to which the present application pertains.
[111]
[112]
Example 1: Production of a wild-type-based IMP producer
[113]
[114]
The wild-type strain of the genus Corynebacterium cannot produce IMP, or even if it does produce IMP, it can produce a very trace amount. Therefore, a wild-type Corynebacterium stationis ( Corynebacterium stationis ) IMP production line was prepared based on ATCC6872. Specifically, the encoding succinate taken care of by other adenylate kinase purA to inosinate and 5'-dihydro-encoding the recombinase guaB was prepared IMP-producing strain in which the activity of weakening.
[115]
[116]
Example 1-1: purA weakened strain production
[117]
In order to construct a strain in which the initiation codon of purA has been changed , a vector for insertion containing purA was first prepared . To clone the purA gene into the vector for insertion, PCR was performed using primers SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6 using the genomic DNA of Corynebacterium stasis ATCC6872 as a template, 94 A process of denaturation for 30 seconds at °C, annealing at 55 °C for 30 seconds, and extension at 72 °C for 2 minutes was repeated 30 times. Using the two DNA fragments obtained by the PCR reaction as a template, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 2 minutes using SEQ ID NOs: 3 and 6 primers (extension) The process was repeated 30 times by PCR under conditions to obtain a DNA fragment. The obtained DNA fragment was digested with restriction enzyme XbaI, and then cloned into pDZ (Korea Patent Registration No. 10-0924065 and International Patent Publication No. 2008-033001) vector digested with the same restriction enzyme. The vector constructed by the above method was named pDZ-purA-a1t.
[118]
[Table 1]
SEQ ID NO: Primer name sequence (5'-3')
3 pDZ-purA(a1t)-1 GCTCTAGAGGCCACGATGCCCGGAGCATC
4 pDZ-purA(a1t)-2 TAACGATAGCTGCCAAGGTTATTCACTTCCTAGATTT
5 pDZ-purA(a1t)-3 AGGAAGTGAATAACCTTGGCAGCTATCGTTATCGTCG
6 pDZ-purA(a1t)-4 GCTCTAGAGGTCACGAATGGGTAGGTGCC
[119]
[120]
After transforming the recombinant vector pDZ-purA-a1t into Corynebacterium stationis ATCC6872 by electroporation, the strain in which the vector is inserted into the chromosome by recombination of the homologous sequence is kanamycin (kanamycin) was selected in a medium containing 25 mg/L. The selected primary strain was again subjected to secondary crossover and sequencing was performed to finally select a strain into which the mutation was introduced, which was named ATCC6872-purA(a1t) strain.
[121]
[122]
Example 1-2: guaB weakened strain production
[123]
In order to construct a strain in which the initiation codon of guaB is changed, in order to construct a strain in which the initiation codon of guaB is changed, a vector for insertion containing guaB was first prepared. Specifically, PCR was performed using primers of SEQ ID NOs: 7 and 8 and SEQ ID NOs: 9 and 10 using the genomic DNA of Corynebacterium stasis ATCC6872 as a template to clone the guaB gene into the vector for insertion, the PCR Using the product as a template, PCR was performed again using SEQ ID NOs: 7 and 10 as primers, and the obtained DNA fragment was cloned as in Example 1-1. The constructed vector was named pDZ-guaB-a1t.
[124]
[Table 2]
SEQ ID NO: Primer name sequence (5'-3')
7 pDZ-guaB(a1t)-1 GCTCTAGACTACGACAACACGGTGCCTAA
8 pDZ-guaB (a1t)-2 CACGATTTTCGGTCAATACGGGTCTTCTCCTTCGCAC
9 pDZ-guaB (a1t)-3 AGGAGAAGACCCGTATTGACCGAAAATCGTGTTTCT
10 pDZ-guaB (a1t)-4 GCTCTAGAATCGACAAGCAAGCCTGCACG
[125]
[126]
After transforming the ATCC6872-purA(a1t) strain prepared in Example 1-1 with the recombinant vector pDZ-guaB-a1t by electroporation, the vector was inserted into the chromosome by recombination of the homologous sequence. The strain was selected in a medium containing 25 mg/L of kanamycin. The selected primary strain was again subjected to secondary crossover and sequencing was performed to the selected strain to finally select the strain into which the mutation was introduced.
[127]
The finally selected, wild-type Corynebacterium stationis ( Corynebacterium stationis ) The IMP-producing strain based on ATCC6872 was named CJI9088.
[128]
[129]
Example 1-3: Fermentation potency experiment of CJI9088
[130]
After dispensing 2ml of the seed medium into an 18mm diameter test tube and autoclaving, ATCC6872 and CJI9088 were inoculated, respectively, and cultured with shaking at 30° C. for 24 hours to use as a seed culture solution. 29ml of the fermentation medium was dispensed into a 250ml Erlenmeyer flask for shaking, and after autoclaving at 121℃ for 15 minutes, 2ml of the seed culture was inoculated and cultured for 3 days. Culture conditions were adjusted to a rotation speed of 170 rpm, a temperature of 30° C., and a pH of 7.5.
[131]
After completion of the culture, the production of IMP was measured by a method using HPLC (SHIMAZDU LC20A), and the culture results are shown in Table 3 below. The following results suggest that the strains weakened by purA and guaB have IMP-producing ability.
[132]
[Table 3]
strain name IMP (g/L)
ATCC6872 0
CJ9088 0.52
[133]
[134]
- Seed medium: glucose 1%, peptone 1%, broth 1%, yeast extract 1%, sodium chloride 0.25%, adenine 100mg/l, guanine 100mg/l, pH 7.5
[135]
- Fermentation medium: sodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20mg/l, manganese sulfate 20mg/l, zinc sulfate 20mg/l, copper sulfate 5mg/l, L-cysteine ​​23mg /l, alanine 24mg/l, nicotinic acid 8mg/l, biotin 45㎍/l, thiamine hydrochloride 5mg/l, adenine 30mg/l, phosphoric acid (85%) 1.9%, glucose 2.55%, fructose 1.45% were added and used. .
[136]
[137]
Example 2: Excavation of phosphoribosylpyrophosphate amidotransferase-enhanced mutations
[138]
[139]
In order to enhance the activity of phosphoribosylpyrophosphate amidotransferase, the first enzyme in the IMP biosynthesis pathway, to improve IMP production, a mutation library of purF , a gene encoding phosphoribosylpyrophosphate amidotransferase, was constructed. The purpose of this study was to discover a reinforcing mutation that produced and increased IMP production capacity.
[140]
[141]
Example 2-1: Construction of a vector containing purF
[142]
To construct a purF mutation library, a recombinant vector containing purF was first prepared . PCR was performed using the primers of SEQ ID NO: 11 and SEQ ID NO: 12 with the genomic DNA of Corynebacterium stasis ATCC6872 as a template, and the amplified product was obtained from the E. coli vector pCR2.1 using TOPO Cloning Kit (Invitrogen). cloning to obtain pCR-purF.
[143]
[Table 4]
SEQ ID NO: Primer name sequence (5'-3')
11 purF tempF AAGTTGATGCTTCAGGCCACA
12 purF tempR TGCAAGGATTGGCTCTTTGT
[144]
[145]
Example 2-2: purF mutation library construction
[146]
A purF mutation library was prepared based on the vector constructed in Example 2-1 . The library was prepared using the error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit). Under conditions in which mutations may occur, PCR reaction was performed using SEQ ID NO: 13 and SEQ ID NO: 14 as primers. Specifically, after pre-heating at 94 °C for 30 seconds under the condition that 0 to 3 mutations occur per 1000bp, the process of 30 seconds at 94 °C and 1 minute and 30 seconds at 68 °C was repeated 25 times. Using the PCR product obtained at this time as a megaprimer (500~125ng), the process was repeated 25 times for 50 seconds at 95 °C, 50 seconds at 60 °C, and 12 minutes at 68 °C, followed by DpnI treatment and transformation into E. coli DH5α. It was plated on LB solid medium containing kanamycin (25 mg/L). After selecting 20 transformed colonies, plasmids were obtained and polynucleotide sequences were analyzed. As a result, it was confirmed that mutations were introduced at different positions at a frequency of 2mutations/kb. About 20,000 transformed E. coli colonies were taken and plasmids were extracted, and this was named pTOPO-purF-library.
[147]
[Table 5]
SEQ ID NO: Primer name sequence (5'-3')
13 purF lib F ACACGAGATAGCCCAGTGG
14 purF lib R TCGTAGTTGCCATCAAAGCA
[148]
[149]
Example 2-3: Evaluation of the prepared library and selection of strains
[150]
The pTOPO-purF-library prepared in Example 2-2 was transformed into the strain CJI9088 prepared in Example 1 by the electroporation method, and then smeared on a nutrient medium containing 25 mg/L of kanamycin to insert the mutant gene. 10,000 colonies of the strained strain were secured, and each colony was named from CJI9088_pTOPO_purF(mt)1 to CJI9088_pTOPO_purF(mt)10000.
[151]
[152]
- Nutrient medium: peptone 1%, broth 1%, sodium chloride 0.25%, yeast extract 1%, agar 2%, pH 7.2
[153]
[154]
Each obtained 10,000 colonies were inoculated into 200 μl of autoclaved seed medium and cultured with shaking at 30° C. and 1200 rpm using a microplate shaker (TAITEC) in 96 deep well plate for 24 hours to obtain a seed culture medium. was used. After dispensing 290 μl of the autoclaved fermentation medium into a 96 deep well plate, 20 μl of each of the seed cultures was inoculated, and incubated with shaking for 72 hours in the same manner as above.
[155]
In order to analyze the production of 5'-inosinic acid produced in the culture medium, 3 μl of the culture supernatant was transferred to a 96-well UV-plate dispensed with 197 μl of distilled water after completion of the culture. Next, using a microplate reader, shaking for 30 seconds, measuring the absorbance with a spectrophotometer at 25°C and a wavelength of 270 nm, and comparing the absorbance of the CJI9088 strain by 10% or more, the mutant strain 50 Dog colonies were selected. Other colonies showed similar or decreased absorbance compared to the control.
[156]
The 50 selected strains were repeatedly checked for 5'-inosine acid production through absorbance measurement in the same way as above, and the CJ9088_pTOPO_purF(mt)201, CJI9088_pTOPO_purF (mt)5674 strains with significantly improved 5'-inosine acid production compared to the CJI9088 strain. Two types were selected.
[157]
[158]
Example 2-4: Variation confirmation through gene sequencing
[159]
In order to confirm the genetic mutation of the mutant strain, PCR was performed in the CJI9088_pTOPO_purF(mt)201 and CJI9088_pTOPO_guaB(mt)5674 strains using the primers of SEQ ID NOs: 15 and 16 and sequencing was performed to convert the purF gene into the wild-type purF gene. strains ATCC6872 and CJI9088 containing
[160]
As a result, it was confirmed that both of the above strains contained mutations in different positions of the purF gene, respectively.
[161]
Specifically, the CJI9088_pTOPO_purF(mt)201 strain has a mutation in which the second valine is substituted with methionine in the purF amino acid sequence shown in SEQ ID NO: 2, and the CJI9088_pTOPO_purF(mt)5674 strain has the purF amino acid sequence shown in SEQ ID NO: 2 at position 445 A mutation in which glycine was substituted with arginine was confirmed.
[162]
[Table 6]
SEQ ID NO: Primer name sequence (5'-3')
15 purF-seq-F ACACGAGATAGCCCAGTGG
16 purF-seq-R ACCAAGTCATCGACCGCACATT
[163]
In Examples 3 and 4 below, it was attempted to confirm whether the mutations affect the IMP production amount of microorganisms of the genus Corynebacterium, respectively.
[164]
[165]
Example 3: Confirmation of IMP production capacity in CJI9088
[166]
[167]
IMP-producing ability was confirmed by introducing the mutation identified in Example 2 into CJI9088, an IMP-producing strain derived from ATCC6872.
[168]
[169]
Example 3-1: Construction of insertion vector containing purF mutation
[170]
In order to introduce the mutation selected in Example 2 into the strain, an insertion vector was prepared. The process of creating a vector for introducing purF mutations is as follows.
[171]
Using the genomic DNA of ATCC6872 as a template, PCR was performed using SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, respectively, as primers. After denaturing at 94°C for 5 minutes, PCR was repeated 20 times for 30 seconds at 94°C, 30 seconds at 55°C, and 1 minute at 72°C, followed by polymerization at 72°C for 5 minutes. PCR was performed using the resulting DNA fragments as templates, respectively, and SEQ ID NO: 17 and SEQ ID NO: 20 as primers. The obtained DNA fragment was digested with XbaI. The DNA fragment was cloned into a linear pDZ vector digested with an XbaI restriction enzyme using T4 ligase to prepare pDZ-purF (V2M). In the same manner as above, SEQ ID NO: 21 and SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24 were subjected to PCR with primers, and PCR was performed with SEQ ID NO: 21 and SEQ ID NO: 24 with primers using each DNA fragment obtained as a template, The obtained DNA fragment was digested with XbaI and cloned into a linear pDZ vector in which the DNA fragment was digested with XbaI restriction enzyme using T4 ligase to prepare pDZ-purF (G445R).
[172]
[Table 7]
SEQ ID NO: Primer name sequence (5'-3')
17 purF V2M 1F GGGTCTAGAAGTACTGACCCGACCACTGCA
18 purF V2M 1R TGGGGAAAGTAGTGTTCATCACGACGC
19 purF V2M 2F TAGTAGAATCAGCGTCGTGATGAACAC
20 purF V2M 2R GGGTCTAGATGGATTCCTGCCTCATTGACA
21 purF G445R 1F GGGTCTAGACCGATGGCAAGACCTTGTACG
22 purF G445R 1R CAAACCCTAAAGAGTTCTGCTCTGATAGCTTC
23 purF G445R 2F CAGTGTGCGAAGCTATCAGAGCAGACTCTT
24 purF G445R 2R GGGTCTAGACAAGGTCATCGATGTAGCCATCG
[173]
[174]
Example 3-2: Variant introduction and evaluation in CJI9088 strain
[175]
The strain into which the pDZ-purF (V2M) and pDZ-purF (G445R) vectors prepared in Example 3-1 were transformed into CJI9088 and the vector was inserted into the chromosome by recombination of the homologous sequence was kanamycin 25 Selected in a medium containing mg/L. The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected. To determine whether the genetic mutation was introduced into the final transformed strain, PCR was performed using the primers of SEQ ID NO: 15 and SEQ ID NO: 16, and it was confirmed that the mutation was introduced in the strain by analyzing the nucleotide sequence. Specifically, the strain into which the V2M mutation of the purF gene was introduced was named CJI9088_purF_m1, and the strain into which the G445R mutation was introduced was named CJI9088_purF_m2. In addition, to prepare a mutant strain containing both V2M and G445R mutations, pDZ-purF (G445R) vector was transformed into CJI9088_purF_m1 strain, and colonies were obtained in the same manner as above. By performing gene sequence analysis of the obtained colonies, strains into which both V2M and G445R mutations of the purF gene were introduced were selected, and this was named CJI9088_purF_m1m2.
[176]
As shown in the results below, in the case of the CJI9088_purF_m1 and CJI9088_purF_m2 strains having V2M mutation or G445R mutation in the purF gene compared to the control strain CJI9088, IMP concentrations were 0.15 g/L (128%) and 0.09 g/L (117%), respectively. ) was confirmed to be improved. In addition, in the case of the CJI9088_purF_m1m2 strain containing both V2M and G445R mutations, the IMP concentration was improved by 0.31 g/L (159%), confirming that when both mutations were included, the greatest effect on improving the IMP concentration was confirmed.
[177]
[Table 8]
strain name IMP (g/L)
CJ9088 0.52
CJI9088_purF_m1 0.67
CJI9088_purF_m2 0.61
CJI9088_purF_m1m2 0.83
[178]
[179]
Example 4: Confirmation of IMP-producing ability in IMP-producing strains derived from ATCC6872
[180]
[181]
In order to confirm the effect of the purF variant found in Example 2 based on the high-concentration IMP-producing strain, the high-concentration IMP-producing strain CJI0323 (Accession No. KCCM12151P, Korean Patent Registration No. 10-1904675) was introduced to confirm the IMP-producing ability. .
[182]
[183]
Example 4-1: Variant introduction and evaluation in CJ0323 strain
[184]
The strain into which the pDZ-purF (V2M) and pDZ-purF (G445R) vectors prepared in Example 3-1 were transformed into CJI0323 and the vector was inserted into the chromosome by recombination of the homologous sequence was kanamycin 25 Selected in a medium containing mg/L. The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected. To determine whether the genetic mutation was introduced into the final transformed strain, PCR was performed using the primers of SEQ ID NO: 15 and SEQ ID NO: 16, and it was confirmed that the mutation was introduced in the strain by analyzing the nucleotide sequence. Specifically, the strain into which the V2M mutation of the purF gene was introduced was named CJI0323_purF_m1, and the strain into which the G445R mutation was introduced was named CJI0323_purF_m2. In addition, to prepare a mutant strain containing both V2M and G445R mutations, pDZ-purF(G445R) vector was transformed into CJI0323_purF_m1 strain, and colonies were obtained in the same manner as above. By performing gene sequence analysis of the obtained colonies, strains into which both V2M and G445R mutations of the purF gene were introduced were selected, and this was named CJI0323_purF_m1m2.
[185]
The CJ0323_purF_m1 is referred to as CJ2353, and it was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty, on September 10, 2018, and was given an accession number KCCM12316P. In addition, the produced CJI0323_purF_m2 is referred to as CJ2354, and it was deposited with the Korea Microorganism Conservation Center, a trust institution under the Budapest Treaty, on September 10, 2018, and was given an accession number KCCM12317P.
[186]
[187]
As shown in the results below, in the case of the CJI0323_purF_m1 and CJI0323_purF_m2 strains having V2M mutation or G445R mutation in the purF gene compared to the control CJI0323 strain, the IMP concentration was 1.9 g/L (119%) and 0.95 g/L (109%), respectively. ) was confirmed to be improved. In addition, in the case of the CJI0323_purF_m1m2 strain containing both V2M and G445R mutations, the IMP concentration was improved by 3.33 g/L (134%), confirming that when both mutations were included, the greatest effect was found in improving the IMP concentration.
[188]
[Table 9]
strain name IMP (g/L)
CJ0323 9.52
CJ0323_purF_m1 11.42
CJ0323_purF_m2 10.47
CJ0323_purF_m1m2 12.85
[189]
[190]
Example 5: Confirmation of 5'-xanthyl acid production ability of purF mutation
[191]
[192]
In order to confirm the effect of the purF mutant found in Example 2 based on the XMP-producing strain, the mutant was introduced into the high-concentration XMP-producing strain KCCM10530 (Korean Patent Publication No. 10-2005-0056670) to confirm the XMP-producing ability.
[193]
[194]
Example 5-1: Variant introduction and evaluation in KCCM10530 strain
[195]
The pDZ-purF (V2M) and pDZ-purF (G445R) vectors prepared in Example 3-1 were transformed into KCCM10530, and the strain into which the vector was inserted into the chromosome by recombination of the homologous sequence was kanamycin 25 Selected in a medium containing mg/L. The selected primary strain was again subjected to secondary cross-over, and a strain into which the mutation of the target gene was introduced was selected. To determine whether the genetic mutation was introduced into the final transformed strain, PCR was performed using the primers of SEQ ID NO: 15 and SEQ ID NO: 16, and it was confirmed that the mutation was introduced in the strain by analyzing the nucleotide sequence. Specifically, the strain into which the V2M mutation of the purF gene was introduced was named KCCM10530_purF_m1, and the strain into which the G445R mutation was introduced was named KCCM10530_purF_m2. In addition, to prepare a mutant strain containing both V2M and G445R mutations, pDZ-purF (G445R) vector was transformed into KCCM10530_purF_m1 strain, and colonies were obtained in the same manner as above. By performing gene sequence analysis of the obtained colonies, strains into which both V2M and G445R mutations of the purF gene were introduced were selected, and this was named KCCM10530_purF_m1m2.
[196]
The KCCM10530_purF_m1 is referred to as CJX1681, and it was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty on September 10, 2018, and was given an accession number KCCM12312P. In addition, the manufactured KCCM10530_purF_m2 is referred to as CJX1682, and it was deposited with the Korea Microorganism Conservation Center, a trustee institution under the Budapest Treaty, on September 10, 2018, and was given an accession number KCCM12313P.
[197]
[198]
As shown in the results below, in the case of the KCCM10530_purF_m1 and KCCM10530_purF_m2 strains having V2M mutation or G445R mutation in the purF gene compared to the control KCCM10530 strain, the XMP concentration was 1.77 g/L (115%) and 0.8 g/L (107%), respectively. ) was confirmed to be improved. In addition, in the case of the KCCM10530_purF_m1m2 strain containing both V2M and G445R mutations, the XMP concentration was improved by 2.36 g/L (120%), confirming that when both mutations were included, the greatest effect was found in improving the XMP concentration.
[199]
[Table 10]
strain name IMP (g/L)
KCCM10530 11.8
KCCM10530_purF_m1 13.57
KCCM10530_purF_m2 12.68
KCCM10530_purF_m1m2 14.16
[200]
[201]
From the above description, those skilled in the art to which the present application pertains will be able to understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims described below, rather than the detailed description, and equivalent concepts thereof, to be included in the scope of the present application.

Claims:-

[Claim 1]
In the amino acid sequence of SEQ ID NO: 2, a) the second amino acid is substituted with methionine from the N-terminus, b) the 445th amino acid is substituted with arginine, or c) the second amino acid is substituted with methionine and the 445th amino acid is substituted with arginine, a mutant phosphoribosylpyrophosphate amidotransferase.
[Claim 2]
A polynucleotide encoding the mutant phosphoribosylpyrophosphate amidotransferase of claim 1 .
[Claim 3]
A vector comprising the polynucleotide of claim 2 .
[Claim 4]
A microorganism of the genus Corynebacterium comprising the mutant phosphoribosylpyrophosphate amidotransferase of claim 1, producing purine nucleotides.
[Claim 5]
The microorganism of the genus Corynebacterium for producing purine nucleotides according to claim 4, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis .
[Claim 6]
A method for producing purine nucleotides, comprising the step of culturing the microorganism of the genus Corynebacterium of claim 4 in a medium.
[Claim 7]
The method of claim 6, further comprising recovering the purine nucleotides from the microorganism or medium after the culturing step.
[Claim 8]
The method of claim 6, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis ( Corynebacterium stationis ).
[Claim 9]
A composition for producing purine nucleotides, comprising the mutant phosphoribosylpyrophosphate amidotransferase of claim 1 or the microorganism of claim 4.
[Claim 10]
A method for increasing purine nucleotide production, comprising the mutant phosphoribosylpyrophosphate amidotransferase of claim 1 or the microorganism of claim 4.
[Claim 11]
Use of the variant phosphoribosylpyrophosphate amidotransferase of claim 1 for the production of purine nucleotides.
[Claim 12]
Use of the polynucleotide of claim 2 for the production of purine nucleotides.
[Claim 13]
Use of the microorganism of the genus Corynebacterium of claim 4 for the production of purine nucleotides.

Documents

Application Documents

# Name Date
1 201937045842-STATEMENT OF UNDERTAKING (FORM 3) [11-11-2019(online)].pdf 2019-11-11
2 201937045842-SEQUENCE LISTING(PDF) [11-11-2019(online)].pdf 2019-11-11
3 201937045842-SEQUENCE LISTING [11-11-2019(online)].txt 2019-11-11
4 201937045842-REQUEST FOR EXAMINATION (FORM-18) [11-11-2019(online)].pdf 2019-11-11
5 201937045842-NOTIFICATION OF INT. APPLN. NO. & FILING DATE (PCT-RO-105) [11-11-2019(online)].pdf 2019-11-11
6 201937045842-FORM 18 [11-11-2019(online)].pdf 2019-11-11
7 201937045842-FORM 1 [11-11-2019(online)].pdf 2019-11-11
8 201937045842-DECLARATION OF INVENTORSHIP (FORM 5) [11-11-2019(online)].pdf 2019-11-11
9 201937045842-COMPLETE SPECIFICATION [11-11-2019(online)].pdf 2019-11-11
10 201937045842-Proof of Right (MANDATORY) [13-12-2019(online)].pdf 2019-12-13
11 201937045842-FORM-26 [30-12-2019(online)].pdf 2019-12-30
12 201937045842-FORM 3 [29-05-2020(online)].pdf 2020-05-29
13 201937045842.pdf 2021-10-18
14 201937045842-FER.pdf 2022-04-27
15 201937045842-certified copy of translation [28-06-2022(online)].pdf 2022-06-28
16 201937045842-PETITION UNDER RULE 137 [20-10-2022(online)].pdf 2022-10-20
17 201937045842-OTHERS [20-10-2022(online)].pdf 2022-10-20
18 201937045842-FER_SER_REPLY [20-10-2022(online)].pdf 2022-10-20
19 201937045842-CORRESPONDENCE [20-10-2022(online)].pdf 2022-10-20
20 201937045842-CLAIMS [20-10-2022(online)].pdf 2022-10-20
21 201937045842-US(14)-HearingNotice-(HearingDate-06-11-2023).pdf 2023-10-06
22 201937045842-FORM 3 [01-11-2023(online)].pdf 2023-11-01
23 201937045842-Correspondence to notify the Controller [02-11-2023(online)].pdf 2023-11-02
24 201937045842-Written submissions and relevant documents [20-11-2023(online)].pdf 2023-11-20
25 201937045842-Annexure [20-11-2023(online)].pdf 2023-11-20
26 201937045842-PatentCertificate12-12-2023.pdf 2023-12-12
27 201937045842-IntimationOfGrant12-12-2023.pdf 2023-12-12

Search Strategy

1 searchE_26-04-2022.pdf

ERegister / Renewals

3rd: 19 Dec 2023

From 19/07/2021 - To 19/07/2022

4th: 19 Dec 2023

From 19/07/2022 - To 19/07/2023

5th: 19 Dec 2023

From 19/07/2023 - To 19/07/2024

6th: 11 Jun 2024

From 19/07/2024 - To 19/07/2025

7th: 26 May 2025

From 19/07/2025 - To 19/07/2026