Sign In to Follow Application
View All Documents & Correspondence

Whole Cell Biosensor For The Detection Of Arsenic Contamination In The Drinking Water

Abstract: Arsenic contamination in ground/drinking water is a serious concern in India. Continuous monitoring of ground water arsenic contamination is indispensable in prevention of arsenic poisoning. Attempts are being made worldwide to generate efficient and low cost biological solutions for detection of arsenic in the environmental sample for which, a robust, economic, portable, easy to operate and fast detection systems are required. Here we propose to develop whole cell arsenic biosensor by transforming E coli with recombinant plasmid harboring a fused gene construct of the regulatory (repressor) gene of Pannonibacter indicus strain HT23T ars operon and a reporter gene (viz. GFP/Luciferase). Probable false positive results will be eliminated with optimal use of regular gene and repressor protein binding sites. In vitro assessment for arsenic detection will be carried out to establish reliability and efficacy of the whole cell sensor. This whole cell biosensor will give an advantage with its simple operational procedure over those of expensive and high end complex arsenic detection mechanism with specialized analytical machines. This whole cell biosensor will give an advantage with its simple operational procedure over those of expensive and high end complex arsenic detection mechanism with specialized analytical machines. This will also require small efforts to regenerate the bacterial population (sensor) and less expertise to operate, hence reducing the operating cost further.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
23 May 2016
Publication Number
47/2017
Publication Type
INA
Invention Field
MICRO BIOLOGY
Status
Email
lsdavar@ca12.vsnl.net.in
Parent Application
Patent Number
Legal Status
Grant Date
2023-07-03
Renewal Date

Applicants

Institute of Life sciences
(An autonomous Institute of Dept. Biotechnology, Govt. India), Nalco Square, PO: Chandrasekharpur, Nalco Square, Bhubaneswar-751023,India

Inventors

1. Dr. Subrata K. Das
Functional Genomics of Extremophiles Institute of Life Sciences, (An Autonomous Institute of the Department of Biotechnology, Government of India), Nalco Square, Bhubaneswar-751 023, India
2. Dr. Saumya Bandyopadhyay
Functional Genomics of Extremophiles Institute of Life Sciences (An Autonomous Institute of the Department of Biotechnology, Government of India), Nalco Square, Bhubaneswar-751 023, India

Claims

1. A method of detecting of inorganic arsenic in water using the recombinant construct comprising 141arsR regulator of the bacterium P. indicus strain HT23T (DSM 23407T) fused with the reporter (GFP) gene in the plasmid pBlueScript harbored in E. coli strain BL21 (DE3), wherein the inorganic arsenic induces the ars promoter for the expression of green fluorescence protein (GFP).

2. The method as claimed in claim 1, wherein the amount of inorganic arsenic concentration with 0.6 mg/L arsenite can be detected.

Specification

TITLE:
Whole cell biosensor for the detection of arsenic contamination in the drinking water FIELD OF INVENTION-
This invention relates to a recombinant sensory gene circuit transformed into E. coli detecting inorganic arsenic contamination in drinking water. Biological sensor circuit comprised of the regulatory gene (arsR) along with its 5' regulatory region from ars operon of a highly arsenic resistant, novel, indigenous bacterium (Pannonibacter indicus strain HT23T) and a reporter (viz GFP/Luciferase) gene fused downstream along with more than one optimally placed ArsR binding sites.
BACKGROUND OF THE INVENTION •
Arsenic is at the top of the Environmental Protection Agency's (EPA) priority list of drinking water contaminants and a serious concern in India. South and South-East Asia, especially the 'Bengal basin' shared by West Bengal (India) and Bangladesh is the worst hit region that has attracted global attention (Chakraborti et al., 2004). Several Indian states have also reported arsenic ground water contamination in different parts (Pandey et al, 1999; Gurunadha Rao et al 2001).
In accordance with the World Health Organization (WHO) global standard of permissible arsenic contamination in ground water (Tsai et al, 2009), Parliamentary estimates committee, Government of India also recommends the permissible arsenic content in drinking water to be 10 ug/L instead of current 50 ug/L.
Measures are being taken and intense efforts are being carried out to provide secure drinking water to the population of affected region to prevent severe health hazards caused by arsenic consumption. These efforts must go in collaboration with robust, economic, portable, easy to operate and fast detection systems. Present detection or estimation of arsenic is based on '

physical parameters which are done by analytical instruments like inductively coupled plasma mass spectrometry (1CP-MS) or Hydride Generation Atomic Absorption Spectroscopy (AAS) etc. Detection of toxic compound by analytical methods is expensive. Therefore, attempts are being made worldwide to generate efficient and low cost biological solutions for detection of arsenic in the environmental sample. For continuous monitoring of a vast number of water samples, an easily available, portable and more economic detection system is required. In this regard, bacterial whole cell arsenic biosensors would be a viable choice for their virtue of economic regeneration and easy handling.
Previous attempts of arsenic biosensors involved attachment of a reporter gene downstream of regulator/repressor (arsR) gene. Attachment of ArsR to its binding site inhibits expression of downstream genes. Binding of arsenite to ArsR leads to detachment of ArsR from its binding site followed by expression of both the regulator and the reporter gene. Major flaw of this simple but robust principle is the leaky expression of regulator and reporter leading to false positive results unlike the proposed solution that prevents false positive expression with optimal use of more than one ArsR binding sites. Attachment of additional ArsR binding site downstream of arsR prevents basal level leaky expression of regulator and reporter genes that will further confirm reduce false positive results. (Fig. A, B). in another approach, the ArsR will be uncoupled from its feedback regulation loop in sensor circuit. The reporter will be placed downstream to the ars promoter (Pars) with two ArsR binding sites attached at both 5' and 3' ends (Fig. C). Expression of arsR will be controlled by a separate promoter (Px, where x may be Pars or any suitable promoter). Here the arsR and the reporter will be transcribed divergently. Here the magnitude of expression of either gene will not affect each other.
OBJECTIVES OF THE TNVENTION:
An object of this invention is to propose a recombinant sensory gene circuit transformed into E. coli detecting inorganic arsenic contamination in drinking water.

An object of the present invention is to propose a whole cell biosensor harbouring a recombinant gene circuit to detect arsenic contamination in drinking water.
Another object of the present invention is to reduce the false positive results to have an accurate measurement of the extent of contamination.
The invention of Cell based sensor will be cost effective and affordable BRIEF DESCRIPTION OF THE INVENTION
This invention relates to a method of detecting of inorganic arsenic in water using the recombinant construct comprising 141arsR regulator of the bacterium P. indicus strain HT23T (DSM 23407T) fused with the reporter (GFP) gene in the plasmid pBlueScript harbored in E coli strain BL21 (DE3), wherein the inorganic arsenic induces the cars promoter for the expression of green fluorescence protein (GFP).
According to this invention the bacterium, Pannonibacter indicus strain HT23T, is an indigenous, highly arsenate resistant (500 mM) strain, isolated from hot spring sediment. To prepare the arsenic biosensor, Pannonibacter indicus strain HT23T arsR gene along with 141 bp 5' upstream flanking DNA stretch was amplified from plasmid pTopHTars23 and cloned in HindIII/Pstl digested pBS-FsFfCBDGG (Patro et al, 2013, containing GFP as one of the reporter genes) to generate the arsenic biosensor precursor gene construct designated as pBS-141arsR. pBS-14larsR was transformed in E coli BL21 (DE3) cells. Overnight grown culture (pBS-141arsR in BL21 DE3) was inoculated in 50 ml Luria broth supplemented with ampicillin (50 ug/ml) and incubated at 37°C and 200 rpm for 3 hours to reach OD approximately 0.4 at 600 nm. Higher GFP expression in E coli (BL21 DE3 harbouring plasmid pBS-141arsR) was observed after 1

hour of incubation in flasks spiked with 600 μg/L of sodium arsenite, as compared to the control flasks with no arsenite. Basal level leaky expression of GFP in control flasks can further be eliminated by attaching an additional ArsR binding site at immediate 3' downstream of arsR in pBS-141arsR.
The 141 bp arsenic resistance system (ars) operon regulatory elements along with the arsR gene were sourced from a highly arsenate resistant bacterium Pannonibacter indicus strain HT23 . Owing to its very high arsenate tolerance, it is expected that the proposed arsenic biosensor will be a very potent low cost solution for continuous monitoring of ground water arsenic contamination in future.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS;
Fig. 1: Complete nucleotide sequences of ars gene cluster including adjacent genes of the strain Pannonibacter indicus strain HT23T.
Fig. 2: Expression of GFP under transcriptional control of 141 bp 5' upstream flanking region of HT23T ars DNA region.
Fig. 3: Expression of GFP in recombinant plasmid pBS-141ar,sR. A, un-induced and B, induced with 0.6 mg/L arsenite.
Fig. 4A: General working principle of the biosensor precursor based on pBS141ar.sR. Attachment of ArsR to its binding site inhibits expression of the genes. Binding of arsenite to ArsR causes detachment of ArsR from its binding site leading to the expression of regulator (arsR) conjugated with reporter (GFP) gene.
4B: Attachment of additional ArsR binding site downstream of arsR prevents basal level leaky expression of regulator (arsR) and reporter (GFP) genes, that will further confirm the positive results.
4C: In alternate approach, the reporter (GFP/Luciferase) to be placed downstream to the ars (Pars) promoter with double ArsR binding sites attached at both ends of the promoter. Here the arsR and the reporter will be transcribed divergently. Binding and release mechanism of ArsR are same as described earlier.

DETAILED DESCRIPTION OF THE INVENTION:
Identification of ars genes in P indicus strain HT23T. Amplification of ars genes
To facilitate the functional characterization of the ars DNA region, the ars genes of strain HT23T were amplified by PCR and the amplified products were sequenced. The primers used in PCR were designed from the genome sequence of Pannonibacter phragmitetus DSM 14782T (Bioproject: PRJNA200437, http://www.ncbi.nlm.nih.gov/genome/genomes/16375), RafSeq: NZARNQ01000000. Individual genes of ars gene cluster was amplified with Taq DNA polymerase, cloned in pGEMT-Easy vector and sequenced. Intergenic sequences were determined using gene specific internal primers (all primers and PCR amplification programs are summarized in Table land 2). The entire ars DNA region including 141 bp 5' flanking region was amplified by PCR using High Fidelity Advantage HF2 DNA polymerase (Clontech). PCR products were subsequently cloned in pBlueScript vector and sequenced. Annealing temperatures and elongation times for each gene were varied according to the primer Tm and expected size of products. Nucleotides underlined are restriction sites for different restriction enzymes. Gene sequence homology was searched by using BLAST (Altschul et al, 1997). Multiple sequence alignment was done by ClustalW. Five different online topology prediction methods were used to model the topology of Acr3; HMMTOP (http://www.enzim.hu/hmmtop/) (Tusnady and Simon, 1998), SOSUI (http://bp.nuap.nagoya-u.ac.jp/sosui/sosuiframe0.html) (Hirokawa et al, 1998) TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/) (Sonnhammer et al, 1998), TMpred (http://www.ch.embnet.org/software/TMPRED_form.html) (Hofmann and Stoffel, 1993) and Toppred (http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html) (Claros et al.. 1994). All methods were used in single sequence mode and all user adjustable parameters were left as default values.

Table 1. Bacterial strains and plasmids
Strains and Description Reference/s
Plasmids puree
E. coli strains
HB101 supE44 hsdS20(rB- m B- ) recA3 ara-14 proA2 lacYl Promega
galK2 rpsL20 xyl-5 mtl-1
DH5a E. coli host strain, endAl hsdR17 supE44 thi-1 recAl Bethesda
gyrA96 relA 1 D (argF-lac ZYA) Research
Laboratories, Inc
BL21 (DE3) F-, ompT hsdSB(rB-mB-) gal dem (DE3) Life
technologies
P. indicus strain Hot spring isolate, high arsenic resistance Bandyopadh
HT23T(DSM yay et al,
234077) 2013,
Plasmids
pBlueScript (SK) Ampr, lacZ\ ColEl replicon, Cloning vector Stratagene
pGEMT-Easy Ampr, lacZ\ Cloning vector Promega
pBS-FsFfCBDGG pBlueScript based GFP-GUS vector with bi directional (Patro et
promoter construct a/., 2013)
pGEMarsR Apr (PCR amplified fragment obtained with HTarsRxF/ our study
HTarsRxR primers inserted into pGEMT-Easy; HT23Tar.sR
gene).
pGEMarsCk Apr (PCR amplified fragment obtained with our study
HTarsCkxF/HTarsCkxR primers inserted into pGEMT-Easy; Low Molecular Weight protein family gene from HT23T designated in this study as arsCk)
pGEMocr3 Apr (PCR amplified fragment obtained withHTacr3xF our study
/HTacr3xR primers inserted into pGEMT-Easy; HT23Tacr3 gene).
pGEMarsC Apr (PCR amplified fragment obtained with HTarsCxF/ our study
HTarsCxR primers inserted into pGEMT-Easy, HT23T arsC gene).

pGEMintarsRacr3 Apr (PCR amplified arsR-acr3 intergenic region obtained our study
with intarsRacr3F/intarsRacr3R primers, inserted into pGEMT-Easy).
pGEMintacr3arsC Apr (PCR amplified acr3- arsC mtergenic region obtained our study
with intacr3arsCF/intacr3arsCR primers, inserted into pGEMT-Easy).
pGWar.sR5' Apr [PCR amplified fragment obtained from Stul restriction our study
digested genomic DNA library (DL-4) with GW2arsR (GSP2)/ kit supplied adapter specific primer 2 (AP2) primers inserted into pGEMT-Easy]
pG War$C3' Apr [PCR amplified fragment obtained from Stul restriction our study
digested genomic DNA library (DL-4) with GW2ar.sC (GSP2)/ kit supplied adapter specific primer 2 (AP2) primers, inserted into pGEMT-Easy]
pTopHTars23 Apr (pBlueScript (SK) carrying the XballSaR digested our study
fragment of whole ars gene cluster of HT23T with 141 bp 5' upstream flank PCR amplified withTOintOPpro F/ TOgenOParsCR primers)
pBS-141GFP Apr {Hindlll/Pstl digested PCR amplified fragment our study
obtained with HindpromoFl/ Pstpromol41R primers inserted into Hindlll/Pstl digested pBS-FsFfCBDGG)
pBS-141 arsR Apr (Hindlll/Pstl digested PCR amplified fragment our study
obtained with HindpromoFl/ PstarsRR primers inserted into Hindlll/Pstl digested pBS-FsFfCBDGG)
Table 2. Primers and thermal cycling programs used
Gene/ Primer Primer Sequence (5' - 3') Programme
fragments
arsR HTarsRxF GACCGAATTCGATGAACTAGAAA 95°Cfor5min
(forward) CCATCGC 95°C for 30 sec.
55°Cfor45sec.
HTarsRxR GATAATGTCGACTTATGGCATCCG 72°C for 30sec.
(reverse) GCTGCT 35 cycles (Taq)
LMW HTarsCkxF GATCGAATTCACCGAGAAAACCT 95°Cfor5min
protein (forward) ACAATG 95°C for 30 sec.
family gene, 55°C for 45 sec.
designated HTarsCkxR TCAGCAGTCGACTCACTTCACCTT 72°C for 40sec.
asarsCk (reverse) TTCAGC 35 cycles (Taq)

HTacr3x F GATCACGAATTCTCCCTGTTTGAA 95°C for 5min
(forward) CGCTAC 95°C for 30 sec.
acr3 55°C for 45 sec.
HTacr3xR GATAATGTCGACTCAGGCCTGTCC 72°C fori min.
(reverse) TTCTGT (Taq)/ 72°C for 2
min.(pfu) 35
cycles 72°C for 7 min.
HTarsCx F GATCACGAATTCGATGCCACGAT 95°C for 5min
(forward) CTATCAC 95°C for 1 min.
arsC 55°Cfor45sec.
HTarsCxR GATAATGTCGACTCAGCTGATCCG 72°C for 40sec
(reverse) CTTGCC (Taq)/ 72°C for 1
min (pfu) 35
cycles
Intergenic Intacr3arsCF TCCTGCTGCAGACCGTGTTCATCT 95°Cfor5min
sequence (forward) 95°C for 30 sec.
acr3 arsC 50°C for 30 sec.
Intacr3arsCR CTTCAGATATTCGATGACCGTG 72°Cfor 1.30min
(reverse) 35 cycles (Taq)
72°C for 7 min.
Intergenic intarsRacr3 F AGCAGCTCAGGCAGATGATGCT 95°C for 5min
sequence (forward) 95°C for 30 sec.
ursR acrh 50°C for 30 sec.
intarsRacr3R CAGGTTGACCTTGGCGATTTC 72°Cfor2min
(reverse) 35 cycles (Taq)
72°C for 7 min.
Fused acr3 HTacr3xF GATCACGAATTCTCCCTGTTTGAA 95°Cfor2min
arsC (forward) CGCTAC 95°C for 30 sec.
HTarsCxR GATAATGTCGACTCAGCTGATCCG 55°C for 30 sec.
(reverse) CTTGCC 72°C for 90
sec.(Taq)/
72°C for 3 min.
(pfu) 35 cycles
72°C for 5 min.
Nucleotides underlined are restriction sites

Genome walking
Genome walking was carried out with Genome Walker™ Universal Kit (Clontech) to know the 5' and 3' flanking regions of ars DNA region following manufacturer's protocol.
Construction of GenomeWalker™ Libraries
Genomic DNA required for construction of Genome Walker DNA libraries was isolated from strain HT23'.
Digestion of Genomic DNA
For each library construction, a total of five reactions were set up. Where four blunt-end restriction digestions (DL1, DL2, DL3, DL4) with four different enzymes were set up with experimental genomic DNA. One Pvu II digestion of human genomic DNA was taken as a positive control. Reaction mixers were set up in separate 1.5-ml tubes as follows:
Components were mixed by tapping the tube. Incubate at 37°C for 2 hrs and vortexed at low speed for 5-10 sec. Return to 37°C overnight (16-18 hr). 5 ul each digested samples were checked for complete digestion on 0.8% agarose gel. Digested DNA was purified by passing it through spin columns supplied with the kit (GenomeWalker™ Universal Kit, clontech).
Ligation of Genomic DNA to Genome Walker™ Adaptors
Four ligation reactions were set up, three blunt-end digestions (EcoKV/ DL2/setB, Pvulll DL3/ setC and StuM DL4/ setD) and one positive control as mentioned earlier. Ligation mixture was prepared as follows:


Overnight incubation carried out at 16°C in a thermal cycler. Reactions were stopped by heating at 70°C for 5 min. 32 il of TE (10:1, pH 7.5) was added to make a final volume of 40 il. Mixed by vortexing at slow speed for 10-15 sec. Vials were centrifuged very briefly and each sample was stored in 10 il aliquots at -20°C till use.
PCR amplification
25 il reactions were set up for DL-2, DL-3 and DL-4 with kit supplied adapter primes (API and AP2) and gene specific primers (GSP1 and GSP2) for both arsR and arsC genes to amplify 5' and 3' flanking regions of ars DNA region. Adapter primers were supplied in the kit. Gene specific primers were designed according to the guidelines suggested by the manufacturer. In Table 3, sequence of gene specific primers are summarized
Table 3. Primers used for genome walking experiment Nucleotides underlined are restriction site for EcoRl,

Primary PCR
Reaction mixture was prepared as follows:

Reaction mixture was vortexed briefly and spined in a microcentrifuge. 0.5 il of GSP1 and lil of each DNA library (including the positive control) were added to the respective tubes. Thermal cycling was carried out in two-step:
94°C for 25 sec and 72°C for 3 min for 7 cycles, 94°C for 25 sec and 67°C for 3 min for 32 cycles. An additional extension at 67°C for 7 min was conducted after the final cycle. 5 jj.1 of the primary PCR products were checked on a 1.5% agarose gel. 1.5 ul of each primary PCR products (including positive and negative controls) were diluted to 50 ul with deionized H20 and used as the template for the secondary PCR.
Secondary PCR
Reaction mixture for secondary PCR was prepared in 0.5 ml tubes as described for
primary PCR where lul of AP2 primer was added instead of API and 1 il of GSP2 replaced GSP1. lil of each diluted primary PCR product were added in to respective tubes. Briefly spin down in a microcentrifuge. Two-step thermal cycle parameters were:
94°C for 25 sec and 72°C for 3 min for 5 cycles, 94°C for 25 sec and 67°C for 3 min for 20 cycles. Final extension was carried out at 67°C for an additional 7 min.

Cloning of GenomeWalker™ Products
Ampl icons were eluted from 1% agarose gel, ligated to pGEMT-Esay (Promega) vector and transformed into E coli DH5a (Table 1). Recombinant plasmid was sequenced with T7 and SP6 promoter primers.
Amplification and cloning of total ars operon along with 5' 141 bp region along with strain HT23T ars operon in pBlueScript (SK)
Nucleotides underlined are restriction sites for Xbal/Sall
Total ars DNA region with 141 bp 5' upstream sequence was amplified from P indicus genomic DNA and cloned in pBlueScript vector and designated as pTopHTars23 and transformed in E. coli DH5a.
Expression assay and regulatory activity ofarsR gene
pBSK(+) vector based plasmid pBS-FsFfCBDGG (Patro et al, 2013) was digested with Hindlll and Pstl restriction enzymes to remove the whole promoter at 5' flank of GFP gene. 141 bp long 5' upstream region of HT23 ars gene cluster was amplified by PCR from plasmid pTopHTar.y23 (Primers: Hindpromo Fl and PstpromoHl R; PCR condition summarized in Table 4) and cloned in Hindlll and Pstl digested pBS-FsFfCBDGG at 5' upstream of GFP. New plasmid construct designated as pBS-141GFP. The recombinant plasmid was transformed in to E coli BL21 (DE3)

cells for expression study. Overnight grown cultures were inoculated in 50 ml Luria broth supplemented with ampicillin (50 ug/ml) and incubated at 37°C and 200 rpm for 6 hours. Cells were viewed under microscope for GFP expression. Similarly, arsR gene from strain HT23T was amplified along with 141 bp 5' upstream flanking sequence from plasmid pTopHTar.s23 (Primers: Hindpromo Fl and PstavsRR; PCR conditions summarized in table 5) and cloned in pBS-FsFfCBDGG and designated as pBS-141arsR. The recombinant plasmid was transformed in E coli BL21 (DE3) cells. Overnight grown culture (pBS-141arsR in BL21) was inoculated in 50 ml Luria broth with supplemented with ampicillin (50 ug/ml) and incubated as mentioned above for 3 hours to reach OD at 600 nm approximately 0.4. One of the flasks was spiked with 0.6 mg/L of sodium arsenite and incubated for additional 1 hour. Cells from both flasks were viewed under microscope for GFP expression as mentioned earlier as shown in (Figure 4a, b, c) Table 5. Primers and thermal cycling programs
Nucleotides underlined are restriction sites for different restriction enzymes.

Results:
Genome walking and plasmid constructs
Genome walking was carried out to identify the 5' upstream and 3' downstream regions of the ars DNA region. Stu\ restriction enzyme digested genomic DNA was used as a DNA template to amplify the 5' upstream region of ars DNA region. Kit supplied adapter primers (section 3.12.4) and gene specific primer GWlarsR and GW2arsR were used to amplify 954 bp DNA fragment by PCR and cloned into the pGEMT-Easy vector to yield pGWarsR5'. The cloned DNA fragment in pGWarsR5' was sequenced with T7 and SP6 primers. Total 954 nucleotides sequence were obtained at 5' upstream region of arsR. Blast search revealed 813 nucleotides showing sequence homology with modification methylase of P phragmitetus (GenBank WP_019963 089.1) and remaining 141 nucleotides were found as intergenic sequence with putative regulatory regions of ars DNA region. Similarly, Stul restriction enzyme digested genomic DNA was used as a DNA template to amplify the 3' downstream region of ars gene cluster. Gene specific primers GWlarsC and GW2arsC were used to amplify 304 bp DNA fragment and cloned into the pGEMT-Easy vector to yield pGWar.sC3'. The cloned DNA fragment in the pGWarsC3, was sequenced with T7 and SP6 primers. Total 304 nucleotides were obtained at 3' downstream region of arsC. Sequence analysis showed the arsC gene having 118 intergenic nucleotides at 3' end followed by a hypothetical protein.
After assembling of all these sequences two primers TOintOPproF and TOgenOParsCR were used to amplify 2.551 kb DNA fragment containing ars genes from Pannonibacter indicus strain HT23T. PCR amplified DNA fragment was cloned in to pBlueScript vector to yield pTopHTars23.The recombinant plasmid pTopHTars23 was isolated and sequenced. The sequence revealed four complete open reading frames (ORFs). Data base sequence similarity searches showed all the four ORFs have maximum identity with arsenate resistance genes of Pannonibacter phragmitetus (DSM 14782 ). Comparison of the deduced amino acid sequences were done by BLASTX analysis. The deduced amino acid sequence revealed that the ORF1 of

Pannonibacter indicus is a transcription regulator/repressor (arsR) (384 nucleotides encoding 127 amino acids). The deduced protein product of ORF2 is a protein-tyrosine-phosphatase gene of Low molecular weight phosphatase (LMW) gene family of hypothetical function (528 nucleotides encoding 175 amino acids and designated as arsCk). The protein product of ORF3 is an arsenite extrusion pump (acr3) (1059 nucleotides encoding 352 amino acids). The ORF4 is the DNA sequence for arsenate reductase (arsC) (423 nucleotides encoding 140 amino acids) (Figure 1). Analysis of the 2.551 kb DNA fragment also revealed that arsR (ORF1) and arsCk (ORF2) are separated by 10 nucleotides, arsCk (ORF2) and acrZ (ORF3) by three nucleotides and acr2> (ORF3) and arsC (ORF4) by three nucleotide sequences. All four genes had start codon (ATG) and stop codon at 5' to 3' orientation. All four open reading frames were transcribed in the same direction.
Sequence of whole ars gene cluster (5'-3') including adjacent genes of the strain Pannonibacter indicus strain HT23T. Total 4490bp nucleotides
Expression assay and regulatory activity of arsR gene
The bi-directional promoter construct (FsFfCBD) at 5' upstream region of GFP in plasmid pBS-FsFfCBDGG (Patro et al, 2013) was removed by Hindlll and Pstl restriction digestion. The 141 bp 5' upstream region of arsR in ars DNA region of HT23T was amplified by PCR from plasmid pTopHTars23 and cloned into the Hindlll and Pstl restriction site of the plasmid pBS-FsFfCBDGG. The recombinant plasmid was designated as pBS-141GFP. Plasmid pBS-141GFP was sequenced and transformed in to E coli BL21 (DE3). Expression of GFP in pBS-141GFP suggests the presence of promoter elements in the 141 bp fragment (Figure 2).
Similarly, arsR along with 141 bp 5' upstream region was amplified from plasmid pTopHTars23 and cloned into the Hindlll and Pstl restriction site of pBS-FsFfCBDGG to yield pBS-141araR. The recombinant plasmid pBS-141arsR was transformed into E coli BL21 (DE3). Expression of GFP was observed from the cultures spiked with 0.6 mg/L sodium arsenite (Figure 3B). Basal level expression of GFP was also found in absence of arsenite. Reduced GFP expression may be due to repressor activity of arsR and addition of As+3 facilitates release of repressor protein and leads to transcription of arsR and GFP in plasmid pBS-141arsR.

BIOLOGICAL MATERIALS
Strains and plasmids Description Reference/
source
P. indicus strain Hot spring isolate, high arsenic resistance Bandyopadhyay et
HT231 (DSM 23407T) al, 2013
Plasmid: pBS- Apr (Hindlll/Pstl digested PCR amplified Our study
141 arsR fragment obtained with HindpromoF 1 / PstarsRR
primers inserted into Hindlll/Pstl digested pBS-
FsFfCBDGG)

WE CLAIM:
1. A method of detecting of inorganic arsenic in water using the recombinant construct comprising 141arsR regulator of the bacterium P. indicus strain HT23T (DSM 23407T) fused with the reporter (GFP) gene in the plasmid pBlueScript harbored in E. coli strain BL21 (DE3), wherein the inorganic arsenic induces the ars promoter for the expression of green fluorescence protein (GFP).
2. The method as claimed in claim 1, wherein the amount of inorganic arsenic concentration with 0.6 mg/L arsenite can be detected.

Documents

Application Documents

# Name Date
1 Form 3 [23-05-2016(online)].pdf 2016-05-23
2 Description(Provisional) [23-05-2016(online)].pdf 2016-05-23
3 Other Patent Document [01-09-2016(online)].pdf 2016-09-01
4 OTHERS [23-05-2017(online)].pdf 2017-05-23
5 Drawing [23-05-2017(online)].pdf 2017-05-23
6 Description(Complete) [23-05-2017(online)].pdf_170.pdf 2017-05-23
7 Description(Complete) [23-05-2017(online)].pdf 2017-05-23
8 201631017650-FORM 18 [07-02-2020(online)].pdf 2020-02-07
9 201631017650-FER.pdf 2022-06-22
10 201631017650-OTHERS [25-10-2022(online)].pdf 2022-10-25
11 201631017650-FORM-26 [25-10-2022(online)].pdf 2022-10-25
12 201631017650-FER_SER_REPLY [25-10-2022(online)].pdf 2022-10-25
13 201631017650-CLAIMS [25-10-2022(online)].pdf 2022-10-25
14 201631017650-PatentCertificate03-07-2023.pdf 2023-07-03
15 201631017650-IntimationOfGrant03-07-2023.pdf 2023-07-03
16 201631017650-REQUEST FOR CERTIFIED COPY [03-08-2023(online)].pdf 2023-08-03
17 201631017650-FORM28 [03-08-2023(online)].pdf 2023-08-03

Search Strategy

1 201631017650patE_21-06-2022.pdf

ERegister / Renewals

3rd: 03 Oct 2023

From 23/05/2018 - To 23/05/2019

4th: 03 Oct 2023

From 23/05/2019 - To 23/05/2020

5th: 03 Oct 2023

From 23/05/2020 - To 23/05/2021

6th: 03 Oct 2023

From 23/05/2021 - To 23/05/2022

7th: 03 Oct 2023

From 23/05/2022 - To 23/05/2023

8th: 03 Oct 2023

From 23/05/2023 - To 23/05/2024

9th: 25 Apr 2024

From 23/05/2024 - To 23/05/2025

10th: 08 May 2025

From 23/05/2025 - To 23/05/2026