Sign In to Follow Application
View All Documents & Correspondence

Yarrowia Sp. Variant And Method For Preparing Fat By Using Same

Abstract: The present application relates to a Yarrowia sp. variant strain and, more particularly, to: a Yarrowia sp. variant strain in which the activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated; a method for increasing fat in the strain, comprising a step of culturing the strain; or a method for preparing fat.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
20 September 2022
Publication Number
29/2023
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. JANG, Jiryang
330, Dongho-ro, Jung-gu, Seoul 04560
2. LEE, Peter
330, Dongho-ro, Jung-gu, Seoul 04560
3. BAE, Jee Yeon
330, Dongho-ro, Jung-gu, Seoul 04560
4. KIM, Ju-yeon
330, Dongho-ro, Jung-gu, Seoul 04560
5. PARK, Hye Min
330, Dongho-ro, Jung-gu, Seoul 04560
6. KIM, Hyung Joon
330, Dongho-ro, Jung-gu, Seoul 04560
7. PARK, Sang Min
330, Dongho-ro, Jung-gu, Seoul 04560

Claims

1. A variant strain of the genus Yarrowia, wherein activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated.

2. The variant strain of the genus Yarrowia of claim 1, wherein the phosphatidylethanolamine N-methyltransferase is encoded by cho2 gene, and the cho2 gene consists of a polynucleotide sequence of SEQ ID NO: 1.

3. The variant strain of the genus Yarrowia of claim 2, wherein the cho2 gene is deleted.

4. The variant strain of the genus Yarrowia of claim 1, wherein the phospholipid methyltransferase is encoded by opi3 gene, and the opi3 gene consists of a polynucleotide sequence of SEQ ID NO: 11.

5. The variant strain of the genus Yarrowia of claim 4, wherein the opi3 gene is deleted.

6. The variant strain of the genus Yarrowia of claim 1, wherein the strain of the genus Yarrowia includes Yarrowia lipolytica.

7. The variant strain of the genus Yarrowia of claim 1, wherein the variant strain of the genus Yarrowia is a choline auxotrophic strain.

8. The variant strain of the genus Yarrowia of claim 1, wherein the variant strain of the genus Yarrowia has an increased fat content, as compared with a wild-type.

9. The variant strain of the genus Yarrowia of claim 8, wherein the fat includes triacylglycerol (TAG).

10. A cosmetic composition comprising one or more of the variant strain of the genus Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a dry product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dry product, and the lysate.

11. A food composition comprising one or more of the variant strain of the genus - 48 - Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a dry product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dry product, and the lysate.

12. A feed composition comprising one or more of the variant strain of the genus Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a dry product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dry product, and the lysate.

13. A medical composition comprising one or more of the variant strain of the genus Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a dry product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dry product, and the lysate.

14. A method of increasing a fat in a strain, comprising: culturing a variant strain of the genus Yarrowia, wherein activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated.

15. The method of increasing a fat in a strain of claim 14, wherein the culturing the strain is culturing the strain in a medium containing choline.

16. The method of increasing a fat in a strain of claim 15, wherein a concentration of the choline in the medium is 0.05 mM to 5 mM.

17. The method of increasing a fat in a strain of claim 15, wherein a C/N ratio in the medium is 40 to 80.

18. The method of increasing a fat in a strain of claim 14, wherein the fat includes triacylglycerol (TAG).

19. A method of preparing a fat, comprising: culturing a variant strain of the genus Yarrowia, wherein activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated. - 49 -

20. The method of preparing a fat of claim 19, further comprising: recovering the fat from the strain, a culture thereof, an extract thereof, a dry product thereof, or a lysate thereof, after the culturing the strain.

21. The method of preparing a fat of claim 19, wherein the culturing the strain is culturing the strain in a medium containing choline.

22. The method of preparing a fat of claim 21, wherein a C/N ratio in the medium is 40 to 80.

23. Use of a variant strain of the genus Yarrowia, wherein activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated; a culture of the strain; an extract of the strain; a dry product of the strain; a lysate of the strain; a cosmetic composition, a food composition, a feed composition, or a medical composition, each including one or more of the strain, the culture, the extract, the dry product, and the lysate, and a fat recovered from one or more of the strain, the culture, the extract, the dry product, and the lysate in fat production.

Specification

TECHNICAL FIELD
The present disclosure relates to yeast improvement for enhancement of fat content,
and a preparation method thereof, and in particular, a variant strain of the genus Yarrowia,
in which activity of phosphatidylethanolamine N-methyltransferase (PEMT) or
phospholipid methyltransferase is inactivated, and 5 thus a fat content is enhanced, and a
method of increasing a fat in the strain by culturing the variant strain of the genus
Yarrowia in a medium containing choline.
BACKGROUND ART
10 Oleaginous yeasts that produce fatty acid derivatives such as free fatty acids, fatty
alcohols, fatty acid ethyl esters, alkanes, etc. have received attention in various fields such
as energy, cosmetics, foods, feed, etc., and various studies related thereto have been
conducted. Among them, triacylglycerol (TAG), which is a precursor of fatty acid
derivatives and is a fatty form available for long-term storage, has been studied for the
15 synthesis of large quantities thereof.
As a method of improving TAG contents in oleaginous yeasts, strategies for
enhancing TAG biosynthetic pathways (e.g., dga1-2, slc1, acl1-2, acc1, sct1, lro1),
inhibiting TAG degradation (e.g., tgl1-4, faa1, pxa1-2), and inhibiting beta-oxidation (e.g.,
pox1-6, mfe1, pex1-32, pot1) are mainly used by many researchers (U.S. Patent
20 Application Publication No. 2013-0344548 A1).
In recent years, various strategies have been attempted to improve the fat content
in yeasts, but there has been no remarkable increase in the fat content. Accordingly,
there is a demand for an alternative to improve the level of fat production while preventing
deterioration of yeast growth.
25
DISCLOSURE
TECHNICAL PROBLEM
The present inventors found that the fat production may be increased by a variant
strain, in which activity of phosphatidylethanolamine N-methyltransferase or phospholipid
- 3 -
methyltransferase is inactivated, thereby completing the present disclosure.
TECHNICAL SOLUTION
An object of the present disclosure is to provide a variant strain of the genus
Yarrowia, in which activity of 5 phosphatidylethanolamine N-methyltransferase (PEMT) or
phospholipid methyltransferase is inactivated.
Another object of the present disclosure is to provide a cosmetic composition, a
food composition, a feed composition, or a medical composition, each including at least
one of the variant strain of the genus Yarrowia, a culture of the strain, an extract of the
10 strain, a dry product of the strain, a lysate of the strain, and a fat recovered from at least
one of the strain, the culture, the extract, the dry product, and the lysate.
Still another object of the present disclosure is to provide a method of increasing a
fat in a strain, including: culturing the variant strain of the genus Yarrowia.
Still another object of the present disclosure is to provide a method of preparing a
15 fat, the method including: culturing the variant strain of the genus Yarrowia.
Still another object of the present disclosure is to provide use of the variant strain
of the genus Yarrowia, the culture of the strain, the extract of the strain, the dry product of
the strain, the lysate of the strain, the cosmetic composition, the food composition, the
feed composition, the medical composition, or the culture of the variant strain of the genus
20 Yarrowia in fat production.
ADVANTAGEOUS EFFECTS
The variant strain of the genus Yarrowia of the present disclosure may increase
intracellular fat production by inactivation of activity of phosphatidylethanolamine N25
methyltransferase (PEMT) or phospholipid methyltransferase.
A method of increasing a fat in the strain and a method of preparing a fat of the
present disclosure can effectively increase fat production while preventing deterioration of
growth of the strain at the same time.
A cosmetic composition, a food composition, a feed composition, and a medical
- 4 -
composition of the present disclosure can provide improved functionality by increasing a
fat content.
BEST MODE
The present disclosure will be described in 5 detail as follows. Meanwhile, each
description and embodiment disclosed in this disclosure may also be applied to other
descriptions and embodiments. That is, all combinations of various elements disclosed in
this disclosure fall within the scope of the present disclosure. Further, the scope of the
present disclosure is not limited by the specific description described below.
10 Further, those skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific embodiments of the
disclosure described herein. Further, these equivalents should be interpreted to fall
within the present disclosure.
15 To achieve the above objects, one aspect of the present disclosure provides a
variant strain of the genus Yarrowia, in which activity of phosphatidylethanolamine Nmethyltransferase
or phospholipid methyltransferase is inactivated.
As used herein, the “phosphatidylethanolamine N-methyltransferase (PEMT)” is a
transferase enzyme that converts phosphatidylethanolamine (PE) to phosphatidylcholine
20 (PC). Phosphatidylcholine produced via PEMT may be utilized in choline synthesis,
membrane structure, and VLDL secretion to play a wide range of physiological roles. In
the present disclosure, the phosphatidylethanolamine N-methyltransferase may be used
interchangeably with PEMT. In the present disclosure, the phosphatidylethanolamine Nmethyltransferase
may be encoded by cho2 gene.
25 As used herein, the “phospholipid methyltransferase” is an enzyme that catalyzes a
methylation reaction of phosphatidylethanolamine (PE), and may play a role in
synthesizing phosphatidylcholine (PC). In the present disclosure, the phospholipid
methyltransferase may be encoded by opi3 gene.
The inactivation of the activity of the phosphatidylethanolamine N-
5 -
methyltransferase or phospholipid methyltransferase of the present disclosure means
inactivation of activity of one of the two enzymes or inactivation of a combination thereof.
With respect to the objects of the present disclosure, the variant strain of the genus
Yarrowia, in which activity of one of the two enzymes is inactivated or activities of both
of them are inactivated, may have the increased 5 fat content in the strain, as compared with
the wild-type, but is not limited thereto.
Sequences of the “phosphatidylethanolamine N-methyltransferase” or
“phospholipid methyltransferase” may be obtained from a public database, and examples
10 of the public database may include GenBank of the NCBI, etc. For example, it may be
phosphatidylethanolamine N-methyltransferase and/or phospholipid methyltransferase
derived from the genus Yarrowia (Yarrowia sp.), and specifically, the
phosphatidylethanolamine N-methyltransferase may include an amino acid sequence of
SEQ ID NO: 2, and the phospholipid methyltransferase may include an amino acid
15 sequence of SEQ ID NO: 12, but is not limited thereto. The polypeptide including the
amino acid sequence of SEQ ID NO: 2 may be used interchangeably with a polypeptide
having the amino acid sequence of SEQ ID NO: 2 or a polypeptide consisting of the amino
acid sequence of SEQ ID NO: 2, and the polypeptide including the amino acid sequence of
SEQ ID NO: 12 may be used interchangeably with a polypeptide having the amino acid
20 sequence of SEQ ID NO: 12 or a polypeptide consisting of the amino acid sequence of
SEQ ID NO: 12. Further, any polypeptide sequence may also be included, as long as it
has the same activity as the above amino acid sequence.
Further, the polypeptide may include the amino acid sequence of SEQ ID NO: 2 of
the phosphatidylethanolamine N-methyltransferase and/or the amino acid sequence of
25 SEQ ID NO: 12 of the phospholipid methyltransferase, or an amino acid sequence having
30% or more homology or identity thereto, but is not limited thereto. Specifically, the
polypeptide may include an amino acid sequence having at least 30%, 60%, 80%, 85%,
90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to SEQ ID NO: 2 of
the phosphatidylethanolamine N-methyltransferase and/or SEQ ID NO: 12 of the
- 6 -
phospholipid methyltransferase. Additionally, it is obvious that any polypeptide having
an amino acid sequence with deletion, modification, substitution, or addition in part of the
sequence may also be included within the scope of the present disclosure, as long as the
amino acid sequence has homology or identity described above and exhibits efficacy
5 corresponding to that of the polypeptide.
In other words, although described as “a protein or polypeptide consisting of an
amino acid sequence of a specific SEQ ID NO” in the present disclosure, it is obvious that
any polypeptide having an amino acid sequence with deletion, modification, substitution,
or addition in part of the sequence may also be used in the present disclosure, as long as
10 the polypeptide may have an activity identical or corresponding to that of a polypeptide
consisting of the amino acid sequence of the corresponding SEQ ID NO. For example, it
is obvious that any polypeptide may belong to the “polypeptide consisting of the amino
acid sequence of SEQ ID NO: 2”, as long as it has an activity identical or corresponding to
that of the “polypeptide consisting of the amino acid sequence of SEQ ID NO: 2”.
15 In the present disclosure, genes encoding the phosphatidylethanolamine Nmethyltransferase
and the phospholipid methyltransferase may be cho2 and opi3 genes,
respectively. Polynucleotide sequences encoding the amino acids of the present
disclosure may be polynucleotide sequence(s) of SEQ ID NO: 1 and/or SEQ ID NO: 11
encoding the phosphatidylethanolamine N-methyltransferase and/or the phospholipid
20 methyltransferase, but are not limited thereto. Further, the polynucleotide sequences may
include any sequence without limitation, as long as it has the same activity as that of the
polynucleotide sequence. The cho2 gene may be a nucleotide sequence encoding the
amino acid sequence of SEQ ID NO: 2, and more specifically, may be a sequence
including the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto. The
25 sequence including the nucleotide sequence of SEQ ID NO: 1 and the polynucleotide
including the nucleotide sequence of SEQ ID NO: 1 may be used interchangeably with a
polynucleotide having the nucleotide sequence of SEQ ID NO: 1, a polynucleotide
consisting of the nucleotide sequence of SEQ ID NO: 1, and a gene consisting of the
polynucleotide sequence of SEQ ID NO: 1.
- 7 -
The opi3 gene may be a nucleotide sequence encoding the amino acid sequence of
SEQ ID NO: 12, and more specifically, may be a sequence including a nucleotide
sequence of SEQ ID NO: 11, but is not limited thereto. The sequence including the
nucleotide sequence of SEQ ID NO: 11 and the polynucleotide including the nucleotide
sequence of SEQ ID NO: 11 may be used interchangeably 5 with a polynucleotide having
the nucleotide sequence of SEQ ID NO: 11, a polynucleotide consisting of the nucleotide
sequence of SEQ ID NO: 11, and a gene consisting of the polynucleotide sequence of SEQ
ID NO: 11.
As used herein, the term “polynucleotide”, which refers to a long-chain polymer of
10 nucleotides formed by linking nucleotide monomers via covalent bonds, has a meaning
collectively including DNA or RNA molecules. Nucleotides, which are the basic
structural units of polynucleotides, include not only natural nucleotides but also modified
analogs thereof in which sugar or base moieties are modified (see Scheit, Nucleotide
Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543–
15 584 (1990)).
The polynucleotide may include a polynucleotide encoding the
phosphatidylethanolamine N-methyltransferase and/or the phospholipid methyltransferase
polypeptide of the present disclosure or a polynucleotide sequence having at least 30%,
60%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to the
20 phosphatidylethanolamine N-methyltransferase and/or phospholipid methyltransferase
polypeptide of the present disclosure. Additionally, it is obvious that any polynucleotide
sequence with deletion, modification, substitution, or addition in part of the sequence may
also be included within the scope of the present disclosure, as long as the polynucleotide
sequence has this homology or identity and encodes the polypeptide.
25 Additionally, it is apparent that due to codon degeneracy, a polynucleotide which
may be translated into a polypeptide including the amino acid sequence of SEQ ID NOs: 2
and/or 12 or a polypeptide including an amino acid sequence having 30% or more identity
to SEQ ID NOs: 2 and/or 12 or a polypeptide having homology or identity thereto may
also be included. Alternatively, a probe which may be prepared from a known gene
- 8 -
sequence, for example, any polynucleotide sequence which hybridizes with a sequence
complementary to all or a part of the polynucleotide sequence under stringent conditions
to encode a polypeptide including an amino acid sequence having 30% or more identity to
the amino acid sequence of SEQ ID NO: 2, may be included without limitation. The
“stringent conditions” refer to the conditions 5 which allow the specific hybridization
between polynucleotides. Such conditions are specifically disclosed in the literature (e.g.,
J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring
Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). For
10 example, the stringent conditions may include conditions under which genes having high
homology or identity, genes having 30% or more, 70% or more, 80% or more, specifically
85% or more, specifically 90% or more, more specifically 95% or more, much more
specifically 97% or more, particularly specifically 99% or more homology or identity
hybridize with each other, while genes having homology or identity lower than the above
15 homology or identity do not hybridize with each other; or may include ordinary washing
conditions of Southern hybridization, i.e., washing once, specifically twice or three times,
at a salt concentration and a temperature corresponding to 60°C, 1ХSSC, 0.1% SDS,
specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SSD.
Hybridization requires that two polynucleotides have complementary sequences,
20 although mismatches between bases are possible depending on stringency of the
hybridization. The term “complementary” is used to describe a relationship between
nucleotide bases that may hybridize with each other. For example, with respect to DNA,
adenosine is complementary to thymine, and cytosine is complementary to guanine.
Therefore, the present disclosure may also include an isolated polynucleotide fragment
25 complementary to the entire sequence as well as a polynucleotide sequence substantially
similar thereto.
Specifically, a polynucleotide having homology or identity may be detected using
hybridization conditions including a hybridization step at a Tm value of 55°C under the
above-described conditions. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but
- 9 -
is not limited thereto, and may be appropriately controlled by those skilled in the art
depending on the purpose thereof.
The appropriate stringency for hybridizing polynucleotides depends on the length
and degree of complementarity of the polynucleotides, and these variables are well known
5 in the art (e.g., J. Sambrook et al., supra).
As used herein, the term “homology” or “identity” refers to the degree of relevance
between two given amino acid sequences or nucleotide sequences, and may be expressed
as a percentage. The terms “homology” and “identity” are often used interchangeably
10 with each other.
The sequence homology or identity of conserved polynucleotides or polypeptides
may be determined by standard alignment algorithms and may be used together with a
default gap penalty established by the program being used. Substantially, homologous or
identical sequences are generally expected to hybridize to all or at least about 50%, about
15 60%, about 70%, about 80%, or about 90% or more of the entire length of the sequences
under moderate or highly stringent conditions. Polynucleotides that contain degenerate
codons instead of codons in the hybridizing polynucleotides are also considered.
Whether any two polynucleotide or polypeptide sequences have homology,
similarity, or identity may be determined by a known computer algorithm such as the
20 “FASTA” program using default parameters as in Pearson et al. (1988) Proc. Natl. Acad.
Sci. USA 85:2444. Alternatively, it may be determined by the Needleman–Wunsch
algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443–453), which is performed
using the Needleman program of the EMBOSS package (“EMBOSS: The European
Molecular Biology Open Software Suite”, Rice et al., 2000, Trends Genet. 16:276–277)
25 (version 5.0.0 or later) (GCG program package (Devereux, J. et al., Nucleic Acids
Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J MOLEC
BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press,
San Diego, 1994; and CARILLO et al. (1988) SIAM J Applied Math 48:1073). For
example, homology, similarity, or identity may be determined using BLAST or ClustalW
- 10 -
of the National Center for Biotechnology Information.
The homology, similarity, or identity of polynucleotides or polypeptides may be
determined by comparing sequence information using, for example, the GAP computer
program, such as Needleman et al. (1970), J Mol Biol. 48:443, as disclosed in Smith and
Waterman, Adv. Appl. Math (1981) 2:482. In 5 summary, the GAP program defines it as
the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides
or amino acids) by the total number of the symbols in the shorter of the two sequences.
Default parameters for the GAP program may include (1) a unary comparison matrix
(containing a value of 1 for identities and 0 for non-identities) and the weighted
10 comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution
matrix) of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as disclosed in Schwartz and
Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research
Foundation, pp. 353–358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10
penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension
15 penalty of 0.5); and (3) no penalty for end gaps. Accordingly, as used herein, the term
“homology” or “identity” refers to the relatedness between sequences.
The “inactivation” of the activity of the polypeptide or protein of the present
disclosure refers to a case where the polypeptide or protein is not in any way expressed or
20 a case where the polypeptide or protein is expressed but exhibits no activity or reduced
activity, as compared with a natural wild-type strain, a parent strain, or a strain in which
the corresponding polypeptide or protein is not modified. The inactivation or attenuation
may be used interchangeably with the terms “attenuation”, “down-regulation”, “decrease”,
“reduce”, etc. In this regard, the inactivation is a concept that includes a case where the
25 activity of a polypeptide itself is reduced or eliminated, as compared with the activity of
the polypeptide originally possessed by a microorganism, due to a modification in the
gene encoding the polypeptide, a modification in an expression regulatory sequence,
deletion of a part or the entirety of the gene, etc.; a case where the level of overall
polypeptide activity within a cell is reduced, as compared with the wild-type strain or the
- 11 -
strain before modification, due to inhibition of expression of the gene encoding the
polypeptide, or inhibition of translation, etc.; a case where the gene is not in any way
expressed; or a case where the gene is expressed but exhibits no activity; and a
combination thereof.
In the present disclosure, the inactivation 5 is not limited thereto, and may be
achieved by applying various methods well known in the art (Nakashima N. et al.,
“Bacterial cellular engineering by genome editing and gene silencing”. Int J Mol Sci.
2014; 15(2):2773–2793, Sambrook et al. Molecular Cloning 2012, etc.). Examples of
the methods include a method of deleting a part or the entirety of a gene encoding the
10 polypeptide on a chromosome; a method of replacing the gene encoding the polypeptide
on the chromosome with a gene that is modified to reduce the activity of the enzyme; a
method of introducing a modification into an expression regulatory sequence of the gene
encoding the polypeptide on the chromosome; a method of replacing the expression
regulatory sequence of the gene encoding the polypeptide with a sequence having a weak
15 activity or no activity (e.g., a method of replacing a promoter of the gene with a promoter
weaker than an endogenous promoter); a method of deleting a part or the entirety of the
gene encoding the polypeptide on the chromosome; a method of introducing an antisense
oligonucleotide (e.g., antisense RNA), which inhibits translation from an mRNA into the
protein or polypeptide via complementary binding to a transcript of the gene encoding the
20 polypeptide on the chromosome; a method of making the attachment of a ribosome
impossible by forming a secondary structure by artificially adding a complementary
sequence to the SD sequence on the front end of the SD sequence of the gene encoding the
polypeptide; and a reverse transcription engineering (RTE) method, which adds a
promoter for reverse transcription to the 3′ terminal of the open reading frame (ORF) of
25 the polynucleotide sequence of the gene encoding the polypeptide; or a combination
thereof, but are not particularly limited thereto.
Specifically, the method of deleting a part or the entirety of the gene encoding the
protein or polypeptide may be performed by replacing the polynucleotide encoding the
endogenous target protein within the chromosome with a polynucleotide or a marker gene
- 12 -
having a partially deleted nucleic acid sequence via a vector for chromosomal insertion
into microorganisms. For example, a method of deleting a gene by homologous
recombination may be used, but the method is not limited thereto. Further, the term
“part”, as used herein, may specifically refer to 1 to 300 nucleotides, more specifically 1 to
100 nucleotides, and even more specifically 5 1 to 50 nucleotides, although it may vary
depending on the kinds of polynucleotide, and this may be appropriately decided by those
skilled in the art. However, the part is not particularly limited thereto.
The method of deleting a part or the entirety of the gene may be performed by
inducing a mutation using light such as ultraviolet rays or chemical substances, and
10 selecting a strain, in which the target gene is deleted, from the obtained mutants. The
method of deleting the gene includes a method using DNA recombination technology.
The DNA recombination technology may be accomplished by, for example, injecting a
nucleotide sequence or vector including a nucleotide sequence having homology to a
target gene into the microorganism to cause homologous recombination. In addition, the
15 injected nucleotide sequence or vector may include a dominant selection marker, but is not
limited thereto.
In addition, the method of modifying an expression regulatory sequence may be
performed by inducing a modification in the expression regulatory sequence through
deletion, insertion, conservative or non-conservative substitution, or a combination thereof
20 so as to further weaken the activity of the expression regulatory sequence or by replacing
the sequence with a nucleic acid sequence having a weaker activity. The expression
regulatory sequence may include a promoter, an operator sequence, a sequence encoding a
ribosome-binding domain, and a sequence for regulating the termination of transcription
and translation, but is not limited thereto.
25 Furthermore, the method of modifying the gene sequence on the chromosome may
be performed by inducing a modification in the sequence through deletion, insertion,
conservative or non-conservative substitution, or a combination thereof so as to further
weaken the activity of the polypeptide; or by replacing the sequence with a gene sequence
modified to have a weaker activity or a gene sequence modified to have no activity at all,
- 13 -
but is not limited thereto.
However, the above description is only an example, and the method is not limited
thereto, and the microorganism may be a microorganism in which expression of genes
encoding enzymes of various known biosynthetic pathways that increase fat content is
promoted, enzymes of related pathways are 5 inactivated, or an enzyme in a pathway that
consumes an intermediate, cofactor, or energy source in the fat biosynthetic pathways is
inactivated. The microorganism with the increased fat content may be prepared by
applying various known methods.
With respect to the objects of the present disclosure, the microorganism of the
10 present disclosure may be any microorganism, as long as it is a microorganism in which
the activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid
methyltransferase is inactivated and the fat content increased, as compared with the nonmodified
microorganism or the wild-type.
As used herein, the term “non-modified microorganism” may refer to a native
15 strain itself or a microorganism in which the activity of phosphatidylethanolamine Nmethyltransferase
or phospholipid methyltransferase is not reduced or inactivated, but is
not limited thereto. The “non-modified microorganism” may be used interchangeably
with “a strain before modification”, “a microorganism before modification”, “a nonvariant
strain”, “a non-modified strain”, “a non-variant microorganism”, “a non-modified
20 microorganism”, or “a reference microorganism”.
As used herein, the “wild-type” refers to a universal phenotype originally
possessed when a new variant is observed in a species due to mutation in the genotype.
The wild-type strain of the present disclosure may be a strain of the genus
25 Yarrowia. The “genus Yarrowia” is a fungal genus in the family Dipodascaceae. The
genus is a yeast capable of utilizing unusual carbon sources, such as hydrocarbons, and
may be monotypic. The strain of the genus Yarrowia may be specifically Yarrowia
bubula, Yarrowia deformans, Yarrowia lipolytica, Yarrowia porcina, Yarrowia
yakushimensis, and more specifically Yarrowia lipolytica, but is not limited thereto.
- 14 -
The “variant strain” of the present disclosure refers to a strain having a new
phenotype, when a new variant is observed in a microbial strain due to mutation in the
genotype.
The “variant strain of the genus Yarrowia” 5 of the present disclosure may be a strain
of the genus Yarrowia, in which the activity of phosphatidylethanolamine Nmethyltransferase
is inactivated, the activity of phospholipid methyltransferase is
inactivated, or the activities of phosphatidylethanolamine N-methyltransferase and
phospholipid methyltransferase are inactivated.
10 Further, it may be a strain of the genus Yarrowia, in which the cho2 gene encoding
phosphatidylethanolamine N-methyltransferase, the opi3 gene encoding phospholipid
methyltransferase, or a combination thereof is deleted, but is not limited thereto.
Specifically, with respect to the objects of the present disclosure, the variant strain
of the genus Yarrowia is not limited, as long as it is a variant strain in which the activity of
15 phosphatidylethanolamine N-methyltransferase or phospholipid methyltransferase is
inactivated, and thus the fat content in the strain is increased, as compared with the wildtype.
As used herein, the “microorganism having the increased fat content, as compared
with the wild-type” may be used interchangeably with “a fat-producing microorganism”,
20 “a microorganism having ability to produce a fat”, “a microorganism for fat production”,
“a triacylglycerol (TAG)-producing microorganism”, “a microorganism having ability to
produce triacylglycerol (TAG)”, or “a microorganism for triacylglycerol (TAG)
production”.
25 The variant strain of the genus Yarrowia may be a choline auxotrophic strain
provided with choline auxotrophy. The “choline” is colorless and strongly alkaline, and
is a component of phospholipids, acetyl choline, B vitamins, etc. It is synthesized from
the route of choline synthesis via serine and ethanolamine in living organisms, and is also
chemically synthesized with trimethylamine and ethylene oxide.
- 15 -
With respect to the objects of the present disclosure, when the strain, which is a
choline auxotrophic strain, is cultured in a medium containing choline, it is possible to
recover the growth of the strain, and at the same time, to increase the fat content in the
strain.
5
As used herein, the term “fat”, which is a kind of lipid, is an ester in which three
fatty acids are bound with one glycerol, and is a representative organic substance. Fat is
contained in living organisms and may be used as an energy source. Specifically, the fat
may be triacylglycerol (TAG), but is not limited thereto.
10 The “triacylglycerol (TAG)”, which is a kind of fat, is a triglyceride having a
structure in which three fatty acid molecules are bonded to one glycerin molecule via an
ester linkage. In order to increase the TAG content, a strategy for enhancing the TAG
biosynthetic pathway, inhibiting TAG degradation, or inhibiting beta-oxidation may be
used. The term “fat” may be used interchangeably with “TAG” or “triacylglycerol”. In
15 addition, TAG may be a precursor of fatty acid derivatives and a form of fat that may be
stored for a long time.
Another aspect of the present disclosure provides a cosmetic composition, a food
composition, a feed composition, or a medical composition, each including at least one of
20 the variant strain of the genus Yarrowia of the present disclosure; a culture of the strain; an
extract of the strain; a dry product of the strain; a lysate of the strain; and a fat recovered
from at least one of the strain, the culture, the extract, the dry product, and the lysate.
The “genus Yarrowia” and the “variant strain of the genus Yarrowia” of the present
disclosure are the same as described above.
25 With respect to the objects of the present disclosure, the composition may include
the variant strain of the genus Yarrowia itself, in which the activity of
phosphatidylethanolamine N-methyltransferase or phospholipid methyltransferase is
inactivated, and thus the fat content in the strain is increased, as compared with the wildtype,
and may include the culture, dry product, extract, or lysate of the strain. In addition,
- 16 -
the composition may include a fat recovered from any one of the strain of the present
disclosure, the culture, the dry product, the extract, or the lysate of the strain. However,
the composition may include any form without limitation, as long as it is able to increase
the desired TAG content within the scope of the present disclosure.
5
The “cosmetic composition” of the present disclosure may be formulated into a
preparation selected from the group consisting of a solution, an ointment for external use,
a cream, a foam, a nutrient lotion, a softening lotion, a pack, a softening water, an
emulsion, a makeup base, an essence, a soap, a liquid cleaner, a bath product, a sunscreen
10 cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a surfactantcontaining
cleansing oil, a powder foundation, an emulsion foundation, a wax foundation,
a patch, and a spray, but is not limited thereto.
The cosmetic composition may further include one or more cosmetically
acceptable carrier which are blended in general skin cosmetics, and as a common
15 component, for example, oil, water, a surfactant, a moisturizer, a lower alcohol, a thickener,
a chelating agent, a pigment, a preservative, a fragrance, etc. may be appropriately blended,
but the carrier is not limited thereto. The cosmetically acceptable carrier to be included
in the cosmetic composition of the present disclosure varies depending on the formulation
of the cosmetic composition.
20 The cosmetic composition of the present disclosure may include at least one of the
variant strain of the genus Yarrowia; the culture of the strain; the extract of the strain; the
dry product of the strain; the lysate of the strain; and a fat recovered from at least one of
the strain, the culture, the extract, the dry product, and the lysate, and thus may include the
increased fat content.
25 The “food composition” of the present disclosure includes all forms such as a
functional food, a nutritional supplement, a health food, a food additive, etc., and the
above kinds of the food composition may be prepared into various forms according to a
common method known in the art.
The food composition of the present disclosure may include forms of pills,
- 17 -
powders, granules, infusions, tablets, capsules, liquids, etc., and examples of the foods to
which the composition of the present disclosure is added include various foods, such as
beverages, gums, teas, vitamin complexes, health supplement foods, etc.
The food composition of the present disclosure may include other additional
ingredients such as various 5 herbal medicinal extracts, food supplement additives, or
natural carbohydrates, etc., as in common foods. In addition, the food supplement
additives may include food additives commonly used in the art, for example, a fragrance
agent, a flavoring agent, a coloring agent, a filler, a stabilizer, etc.
Examples of the natural carbohydrate include common sugars, such as
10 monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.;
polysaccharides, e.g., dextrin, cyclodextrin, etc.; and sugar alcohols such as xylitol,
sorbitol, erythritol, etc. Also, as a fragrance agent, a natural fragrance agent (e.g.,
rebaudioside A, glycyrrhizin, etc.) and a synthetic fragrance agent (saccharine, aspartame,
etc.) may be advantageously used.
15 In addition, the food composition of the present disclosure may include various
nutrients, vitamins, minerals (electrolytes), a flavor agent such as a synthetic flavor agent,
a natural flavor agent, etc., a coloring agent, an extender (cheese, chocolate, etc.), pectic
acid and salts thereof, alginic acid and salts thereof, organic acid, a protective colloid
thickener, a PH adjuster, a stabilizer, a preservative, glycerin, alcohol, a carbonating agent
20 used for a carbonated drink, etc. In addition, the functional food composition of the
present disclosure may include flesh that may be used for preparing natural fruit juice,
fruit juice drinks, and vegetable drinks. Such components may be used independently or
in combination.
The food composition of the present disclosure may be prepared by adding raw
25 materials and ingredients commonly added in the art during the preparation.
Additionally, the formulations of the food may be prepared without limitation as long as it
may be acknowledged as a food. The food composition of the present disclosure may be
prepared into various types of formulations. Unlike general drugs, the food composition
of the present disclosure has advantages in that there are no side effects caused by long-
18 -
term administration, etc., because the food composition employs a food as a raw material,
and the food composition of the present disclosure has excellent portability, and thus the
food of the present disclosure may be consumed as a supplement.
The food composition of the present disclosure may include at least one of the
variant strain of the genus Yarrowia; the culture 5 of the strain; the extract of the strain; the
dry product of the strain; the lysate of the strain; and a fat recovered from at least one of
the strain, the culture, the extract, the dry product, and the lysate, and thus may include an
increased fat content.
The “feed composition” of the present disclosure refers to any natural or artificial
10 diet, meal, etc., or components of such meals intended or suitable for being eaten, taken in,
or digested by animals. The feed composition may be prepared into various types of
feeds known in the art, and specifically, may include concentrated feeds, bulky feeds,
and/or specialized feeds.
A kind of the feed is not particularly limited, and any feed generally used in the art
15 may be used. Non-limiting examples of the feed may include plant-based feeds, such as
grains, nuts, food by-products, seaweeds, fibers, drug by-products, fats and oils, starches,
gourds, grain by-products, etc.; and animal-based feeds such as proteins, inorganic matters,
fats and oils, minerals, single cell proteins, zooplanktons, foods, etc. These may be used
alone or in a mixture of two or more thereof.
20 The feed composition of the present disclosure may include at least one of the
variant strain of the genus Yarrowia; the culture of the strain; the extract of the strain; the
dry product of the strain; the lysate of the strain; and a fat recovered from at least one of
the strain, the culture, the extract, the dry product, and the lysate, and thus may include an
increased fat content.
25 The “medical composition” of the present disclosure refers to those prepared for
the purpose of preventing or treating a disease, and may be used after being respectively
formulated into various forms according to a common method. For example, the medical
composition may be formulated into oral dosage forms such as powders, granules, tablets,
capsules, suspensions, emulsions, syrups, etc., and may be formulated in the form of
- 19 -
preparations for external use, suppositories, and sterile injectable solutions.
In addition, the medical composition may be prepared by further including
pharmaceutically acceptable carriers, such as buffers, preservatives, analgesics,
solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, etc. known in the art,
5 according to each formulation.
Meanwhile, the medical composition of the present disclosure is administered in a
pharmaceutically effective amount. As used herein, the term “pharmaceutically effective
amount” means an amount which is sufficient to treat diseases at a reasonable benefit/risk
ratio applicable to any medical treatment and does not cause any adverse effect. The
10 effective dosage level may be determined by those skilled in the art, depending on factors,
including a patient’s health conditions, severity, drug activity, drug sensitivity,
administration method, administration time, administration route, excretion rate, duration
of treatment, drugs used in combination or used concurrently, and other factors well
known in the medical field.
15 The medical composition of the present disclosure may include at least one of the
variant strain of the genus Yarrowia; the culture of the strain; the extract of the strain; the
dry product of the strain; the lysate of the strain; and a fat recovered from at least one of
the strain, the culture, the extract, the dry product, and the lysate, and thus may include an
increased fat content.
20 With respect to the objects of the present disclosure, the increased fat content in the
strain may be an increased TAG content, but is not limited thereto.
Still another aspect of the present disclosure provides a method of increasing a fat
in a strain, including: culturing the variant strain of the genus Yarrowia of the present
25 disclosure.
The “genus Yarrowia”, the “variant strain of the genus Yarrowia”, and the “fat” are
the same as described above.
As used herein, the “culturing” refers to growing the variant strain of the genus
Yarrowia under appropriately controlled environmental conditions. The culturing
- 20 -
process of the present disclosure may be achieved according to an appropriate medium
and culture conditions known in the art. Such a culturing process may be used by easy
adjustment of the conditions by those skilled in the art according to the strain being
selected.
The culturing the strain may be, 5 but is not particularly limited to, performed in a
batch process, a continuous process, a fed-batch process, etc. known in the art. In this
regard, with respect to the culturing conditions, pH may be adjusted to a suitable pH (e.g.,
pH 5 to 9, specifically pH 6 to 8, and most specifically pH 6.8) using a basic compound
(e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g.,
10 phosphoric acid or sulfuric acid), but is not particularly limited thereto. Additionally,
aerobic conditions may be maintained by introducing oxygen or an oxygen-containing gas
mixture to the culture. The culturing temperature may be maintained at 20°C to 45°C,
and specifically 25°C to 40°C for about 10 hours to 160 hours, but is not limited thereto.
As used herein, the “medium” refers to a culture medium which includes a
15 substance obtained by mixing nutrients required for culturing the variant strain of the
genus Yarrowia as a main component, and/or a product obtained after culturing. The
medium and other culture conditions used in culturing the microorganism of the present
disclosure are not particularly limited, as long as the medium is a medium commonly used
in culturing the microorganism, but the microorganism of the present disclosure may be
20 cultured in a common medium containing appropriate carbon sources, nitrogen sources,
phosphorous sources, inorganic compounds, amino acids and/or vitamins, etc., under
aerobic conditions while adjusting temperature, pH, etc.
As a carbon source for the culture medium used in the present disclosure, sugars
and carbohydrates (e.g., glucose, sucrose, lactose, fructose, galactose, mannose, maltose,
25 arabinose, xylose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil,
sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid,
and linoleic acid), alcohols (e.g., glycerol and ethanol), organic acids (e.g., acetic acid), etc.
may be used alone or in combination. Specifically, the carbon source may be one or
more selected from the group consisting of glucose, fructose, maltose, galactose, mannose,
- 21 -
sucrose, arabinose, xylose, and glycerol, but is not limited thereto. Further, the culture
medium used in the present disclosure may include, as the carbon source, glucose at a
concentration of 10 g/L to 50 g/L, 10 g/L to 40 g/L, 20 g/L to 50 g/L, 20 g/L to 40 g/L, or
25 g/L to 35 g/L, but is not limited thereto.
A nitrogen source for the 5 culture medium used in the present disclosure may be
classified into an organic nitrogen source or an inorganic nitrogen source, but the organic
nitrogen source or the inorganic nitrogen source may be used alone or in a mixture.
Specifically, the nitrogen source may be an organic nitrogen source selected from the
group consisting of a yeast extract, a beef extract, peptone, and tryptone, or an inorganic
10 nitrogen source selected from the group consisting of ammonium acetate, ammonium
nitrate, ammonium chloride, ammonium sulfate, sodium nitrate, urea, and monosodium
glutamate (MSG). Further, in the culture medium used in the present disclosure,
examples of the nitrogen source may include a yeast extract, ammonium sulfate, sodium
nitrate, and MSG, but are not limited thereto.
15 The yeast extract may be included in the culture medium at a concentration of
0.1 g/L to 10 g/L, 0.5 g/L to 10 g/L, 0.5 g/L to 7 g/L, 0.5 g/L to 5 g/L, 0.5 g/L to 3 g/L,
0.5 g/L to 2 g/L, or 0.5 g/L to 1.5 g/L, the ammonium sulfate may be included in the
culture medium at a concentration of 1 g/L to 5 g/L, 1 g/L to 4 g/L, 2 g/L to 5 g/L, or 2 g/L
to 4 g/L, the sodium nitrate may be included in the culture medium at a concentration of
20 0.1 g/L to 10 g/L, 0.5 g/L to 9 g/L, 1 g/L to 9 g/L, 2 g/L to 9 g/L, 3 g/L to 9 g/L, 5 g/L to
9 g/L, or 7 g/L to 9 g/L, and the MSG may be included in the culture medium at a
concentration of 0.1 g/L to 2 g/L, 0.1 g/L to 1.5 g/L, 0.5 g/L to 2 g/L, or 0.5 g/L to 1.5 g/L,
but these are not limited thereto.
25 The culturing the variant strain of the genus Yarrowia of the present disclosure
may be culturing the strain in a medium containing choline. Specifically, a concentration
of choline in the medium containing choline of the present disclosure may be 0.05 mM to
5 mM, 0.1 mM to 5 mM, 0.1 mM to 3 mM, 0.1 mM to 2 mM, or 0.1 mM to 1 mM, but is
not limited thereto.
- 22 -
With respect to the objects of the present disclosure, when the strain, which is a
choline auxotrophic strain, is cultured in a medium containing choline, it is possible to
recover the growth of the strain, and at the same time, to increase the fat content in the
strain.
With respect to the objects 5 of the present disclosure, the medium may have an
optimal C/N ratio in order to increase the fat content in the strain.
As used herein, the “C/N ratio (carbon-to-nitrogen ratio; C:N ratio)” refers to a
ratio of the mass of carbon to the mass of nitrogen in a medium. As the ratio increases,
the nitrogen source in the medium may decrease, and accordingly, the cell concentration
10 may decrease due to growth inhibition.
As the C/N ratio in the medium of the present disclosure increases, OD value may
decrease, and the intracellular fat content may increase. Thus, for the maximum
productivity of fat, a preferred C/N ratio in the medium is important.
The C/N ratio showing the maximum fat productivity in the strain of the present
15 disclosure may be calculated by OD * fat content value, and the C/N ratio in the medium
may be 10 to 120, specifically 30 to 90, more specifically 40 to 80, and much more
specifically 50 to 70, but is not limited thereto.
The preferred C/N ratio in the medium may effectively increase the productivity of
fat while preventing the growth inhibition of the strain of the present disclosure.
20
Still another aspect of the present disclosure provides a method of preparing a fat,
including: culturing the variant strain of the genus Yarrowia of the present disclosure, in
which activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid
methyltransferase is inactivated.
25 The “genus Yarrowia”, the “variant strain of the genus Yarrowia”, the “culturing”,
and the “fat” of the present disclosure are the same as described above.
The culturing the strain may be culturing the strain in a medium containing choline.
The concentration of choline in the medium containing choline of the present
disclosure may be 0.05 mM to 5 mM, 0.1 mM to 5 mM, 0.1 mM to 3 mM, 0.1 mM to
- 23 -
2 mM, or 0.1 mM to 1 mM.
The C/N ratio in the medium may be 10 to 120, specifically 30 to 90, more
specifically 40 to 80, and much more specifically 50 to 70, but is not limited thereto.
With respect to the objects of the present disclosure, when the strain, which is a
choline auxotrophic strain, is cultured 5 in a medium containing choline, it is possible to
recover the growth of the strain, and at the same time, to increase the fat content in the
strain, and thus it is easy to prepare the fat.
The method of preparing a fat of the present disclosure may further include
preparing the microorganism of the present disclosure, preparing a medium for culturing
10 the strain, or a combination thereof (in any order), for example, prior to the culturing.
The method of preparing a fat of the present disclosure may further include
recovering the fat from the strain, the culture thereof, the extract thereof, the dry product
thereof, or the lysate thereof, after culturing the variant strain of the genus Yarrowia. In
15 other words, the fat may be collected from the strain itself or the culture thereof which is
produced in the culturing of the present disclosure. For example, centrifugation,
filtration, anion-exchange chromatography, crystallization, HPLC, etc. may be used, and
the target fat may be recovered from the cultured strain or the culture thereof, the dry
product thereof, or the lysate thereof using an appropriate method known in the art.
20 Further, the recovering the fat may further include isolation and/or purification,
which may be performed using an appropriate method known in the art. Therefore, the
recovered fat may be in a purified form or a microbial fermentation liquid containing the
fat.
25 Still another aspect of the present disclosure provides use of the variant strain of
the genus Yarrowia, in which the activity of phosphatidylethanolamine Nmethyltransferase
or phospholipid methyltransferase is inactivated; the culture of the
strain; the extract of the strain; the dry product of the strain; the lysate of the strain; the
cosmetic composition, the food composition, the feed composition, or the medical
- 24 -
composition, each including at least one of the strain, the culture, the extract, the dry
product, and the lysate, and the fat recovered from at least one of the strain, the culture,
the extract, the dry product, and the lysate, in the fat production.
The “phosphatidylethanolamine N-methyltransferase”, the “phospholipid
methyltransferase”, the “genus Yarrowia”, the 5 “variant strain of the genus Yarrowia”, the
“culturing”, the “fat”, the “cosmetic composition”, the “food composition”, the “feed
composition”, and the “medical composition” of the present disclosure are the same as
described above.
10 MODE FOR INVENTION
Hereinafter, the present disclosure will be described in more detail with reference
to exemplary embodiments. However, these embodiments are only for more specifically
illustrating the present disclosure, and it will be apparent to those of ordinary skill in the
art that the scope of the present disclosure is not limited to these embodiments.
15
Example 1. Preparation of Wild-Type Yeast-Based Deficient Strain
To prepare an auxotrophic strain for ethanolamine or choline, a strain was prepared
in which a CHO2- or OPI3-encoding gene was deleted, based on a wild-type yeast strain,
Yarrowia lipolytica POlf (ATCC MYA-2613).
20
1-1. Preparation of cho2-deficient strain (“CC08-0162”)
To prepare a cassette capable of deleting the cho2 gene on the chromosome of
Yarrowia lipolytica, a polynucleotide sequence of SEQ ID NO: 1 and an amino acid
sequence of SEQ ID NO: 2 of cho2 (YALI0E06061g) were obtained based on nucleotide
25 sequences registered at KEGG (Kyoto Encyclopedia of Genes and Genomes).
PCR was performed using a genomic DNA of Yarrowia lipolytica PO1f as a
template and primers of SEQ ID NOs: 3 and 4, SEQ ID NOs: 7 and 8, and SEQ ID NOs: 9
and 10, respectively. PCR was also performed using a URA3 auxotrophic marker as a
template and primers of SEQ ID NOs: 5 and 6. PCR was performed for 35 cycles under
- 25 -
conditions consisting of denaturation at 95°C for 1 minute; annealing at 55°C for 1
minute; and polymerization at 72°C for 1 minute and 30 seconds.
As a result, 5′ UTR of 1,055 bp, 5′ UTR_RP of 638 bp, 3′ UTR of 1050 bp, and
URA3 of 1,569 bp were obtained. The DNA fragments amplified by PCR were prepared
into one cho2-deficient cassette through overlap 5 extension PCR, and design of the cassette
was performed in the order of 5′ UTR–URA3–5′ UTR_RP–3′ UTR.
The cho2-deficient cassette was transformed into Yarrowia lipolytica PO1f by heat
shock and selected on a solid medium containing no uracil. The primary strain thus
selected was subjected to a second crossover to prepare a cho2 gene–deficient strain.
10 The deficient strain thus prepared was designated as CC08-0162 and deposited under the
Budapest Treaty in the Korean Culture Center of Microorganisms (KCCM), an
international depository authority, on February 20, 2020, under Accession
No. KCCM12672P.
15 [Table 1]
SEQ ID NO: Primer name Sequence (5′–3′)
3 CHO2_5′_For GTACCCGGGGATCCTCTAGAGTCATCCGCAAACACAACAC
4 CHO2_5′_Rev GCAATGACGAGTCAGACAGGGGTGTTTGTGGAAGCTGGTG
5 CHO2_URA_For CACCAGCTTCCACAAACACCCCTGTCTGACTCGTCATTGC
6 CHO2_URA_Rev CGCATTCTGCGTACATTTTGCTGGTGGTATTGTGACTGGG
7 CHO2_5′RP_For CCCAGTCACAATACCACCAGCAAAATGTACGCAGAATGCG
8 CHO2_5′RP_Rev CAGATATGCTCTCTGCAAACGGTGTTTGTGGAAGCTGGTG
9 CHO2_3′_For CACCAGCTTCCACAAACACCGTTTGCAGAGAGCATATCTG
10 CHO2_3′_Rev GCAGGTCGACTCTAGAGAGAGGTCTGTTCACAACATCGGC
1-2. Preparation of opi3-deficient strain (“CC08-0123”)
To prepare a cassette capable of deleting the opi3 gene on the chromosome of
- 26 -
Yarrowia lipolytica, a polynucleotide sequence of SEQ ID NO: 11 and an amino acid
sequence of SEQ ID NO: 12 of opi3 (YALI0E12441g) were obtained based on nucleotide
sequences registered at KEGG (Kyoto Encyclopedia of Genes and Genomes).
PCR was performed using the genomic DNA of Yarrowia lipolytica PO1f as a
template and primers of SEQ ID NOs: 13 and 14, SEQ 5 ID NOs: 17 and 18, and SEQ ID
NOs: 19 and 20, respectively. PCR was also performed using the URA3 auxotrophic
marker as a template and primers of SEQ ID NOs: 15 and 16. PCR was performed for
35 cycles under conditions consisting of denaturation at 95°C for 1 minute; annealing at
55°C for 1 minute; and polymerization at 72°C for 1 minute and 30 seconds.
10 As a result, 5′ UTR of 980 bp, 5′ UTR_RP of 730 bp, 3′ UTR of 1,001 bp, and
URA3 of 1,569 bp were obtained. The DNA fragments amplified by PCR were prepared
into one opi3-deficient cassette through overlap extension PCR, and design of the cassette
was performed in the order of 5′ UTR–URA3–5′ UTR_RP–3′ UTR.
The opi3-deficient cassette was transformed into Yarrowia lipolytica PO1f by heat
15 shock and selected on a solid medium containing no uracil. The primary strain thus
selected was subjected to a second crossover to prepare an opi3 gene–deficient strain.
The deficient strain thus prepared was designated as CC08-0123 and deposited under the
Budapest Treaty at the Korean Culture Center of Microorganisms (KCCM), an
international depository authority, on February 20, 2020, under Accession
20 No. KCCM12673P.
[Table 2]
SEQ ID NO: Primer name Sequence (5′–3′)
13 OPI3_5′_For GTACCCGGGGATCCTCTAGACACCAACATTCGACATGGAC
14 OPI3_5′_Rev GCAATGACGAGTCAGACAGGGAGTTTTCCAGAGAGCCAAC
15 OPI3_URA_For GTTGGCTCTCTGGAAAACTCCCTGTCTGACTCGTCATTGC
16 OPI3_URA_Rev CAGTCCTTAATCAACGGTGGCTGGTGGTATTGTGACTGGG
- 27 -
17 OPI3_5′RP_For CCCAGTCACAATACCACCAGCCACCGTTGATTAAGGACTG
18 OPI3_5′RP_Rev CGTAGGCCGTTTTCTGTTGCGAGTTTTCCAGAGAGCCAAC
19 OPI3_3′_For GTTGGCTCTCTGGAAAACTCGCAACAGAAAACGGCCTACG
20 OPI3_3′_Rev GCAGGTCGACTCTAGAGAGTGCCGTCTCGATTGTCACAGG
1-3. Preparation of cho2- and opi3-codeficient strain (“CC08-0183”)
To examine the effect of cho2 and opi3 codeficiency in Yarrowia lipolytica PO1f, a
cho2- and opi3-codeficient strain was prepared in the same manner as in Examples 1-1
and 1-2, and the strain, in which the respective genes 5 were deleted in combination, were
designated as CC08-0183 and deposited under the Budapest Treaty at the Korean Culture
Center of Microorganisms (KCCM), an international depository authority, on February 20,
2020, under Accession No. KCCM12671P.
10 Example 2. Evaluation of Growth and Fat Accumulation of Wild-Type Strain–
Based Deficient Strains
The growth and fat accumulation of the deficient strains CC08-0162, CC08-0123,
and CC08-0183 prepared in Example 1 were evaluated.
15 2-1. Evaluation according to medium
The two kinds of strains and the control group (PO1f) were seeded in a 250 mL
corner-baffle flask containing 50 mL of YPD or YLMM1 (Yarrowia lipolytica minimal
media 1) at an initial OD of 0.01, and cultured with shaking at 250 rpm and 30°C for
72 hours. In YLMM1, 0.3 mM choline chloride (CL) was added, if necessary.
20 Compositions of the YPD and fat medium 1 (YLMM1) are as follows.

20 g/L glucose, 10 g/L yeast extract (manufactured by BD, Bacto yeast extract,
0.38% choline in Bacto yeast extract), 0.5 g/L uracil, 20 g/L Bacto peptone
- 28 -

40 g/L glucose, 1.7 g/L yeast nitrogen base without amino acids and ammonium
sulfate, 0.5 g/L uracil, and 2.5 g/L ammonium sulfate were dissolved in 0.1 M sodium
5 phosphate buffer (pH 7.2).
After the culturing was terminated, the culture medium was centrifuged to discard
the supernatant, and cells remaining in the lower layer were dried in a dry oven at 60°C
for 24 hours, followed by crude fat extraction. Crude fat extraction was performed
10 according to the feed standard analysis method (feed standard analysis method. 2001.
National Livestock Research Institute, Rural Development Administration), and the
analyzed OD and the intracellular crude fat content are shown in Table 3 below. The
results in Table 3 are the results of experiments performed in triplicate, and the increase in
the crude fat content was evaluated by mean values thereof.
15
[Table 3]
Medium Strain OD600 Crude fat content [%]
Batch 1 Batch 2 Batch 3 Mean Batch 1 Batch 2 Batch 3 Mean
YPD PO1f 60.8 63.2 62.9 62.3 9.7 9.4 9.4 9.5
CC08-O162 61.5 60.9 62.7 61.7 11.2 10.7 11.4 11.1
CC08-O123 62.5 62.4 61.4 62.1 11.0 10.7 10.7 10.8
CC08-O183 61.7 61.5 61.9 61.7 11.1 11.0 11.2 11.1
YlMM1 PO1f 47.2 46.1 47.7 47.0 10.9 11.5 12.4 11.6
PO1f (w/ CL) 46.6 47.9 47.2 47.2 11.9 11.1 11.5 11.5
CC08-O162 10.8 11.9 13.6 12.1 15.0 14.6 15.1 14.9
CC08-O162 (w/ CL) 44.4 45.0 48.3 45.9 16.4 16.1 16.4 16.3
CC08-O123 18.0 16.6 17.3 17.3 14.2 14.4 14.9 14.5
- 29 -
CC08-O123 (w/ CL) 45.7 46.5 46.4 46.2 16.1 15.6 16.3 16.0
CC08-O183 12.1 12.1 12.4 12.2 14.9 15.0 15.1 15.0
CC08-O183 (w/ CL) 45.8 46.1 45.9 45.9 16.3 16.5 16.2 16.3
As shown in Table 3, it was confirmed that the crude fat content was increased
regardless of the medium in the strains, in which the cho2 or opi3 gene was individually or
simultaneously deleted from the parent strain PO1f. It was also observed that the crude
fat content increased when the same strain 5 was cultured in YLMM1 than when cultured in
YPD. The increase was about 17% in the cho2-deficient strain and about 14% in the
opi3-deficient strain, as compared with PO1f, in the YPD medium. In contrast, the
increase was about 28% in the cho2-deficient strain and about 25% in the opi3-deficient
strain, as compared with PO1f, in the YLMM1 medium, indicating that the increase of the
10 fat content was larger in YLMM1 than in YPD. In addition, in the strain in which the
cho2 and opi3 genes were simultaneously deleted, an increase of the fat content similar to
that of the cho2-deficient strain was observed.
However, unlike YPD, YLMM1 contained no choline, and thus the pathway to
synthesize phosphatidylcholine from phosphatidyl ethanolamine was blocked, and the
15 cho2-deficient strain, the opi3-deficient strain, and the cho2- and opi3-codeficient strain
provided with choline auxotroph showed growth inhibition in YLMM1.
Thus, 0.3 mM choline was added to the medium for growth recovery, and it was
confirmed that when choline was added to the medium, the growth of the choline
auxotrophic strain was recovered as much as in the control group, and the crude fat
20 content in the strain was also increased by about 10%, as compared with no addition of
choline.
The growth and fat accumulation of the cho2- and opi3-deficient strains prepared
based on Yarrowia lipolytica PO1f yeast showed a similar tendency to those of the
budding yeast Saccharomyces cerevisiae, but the strains are different from Saccharomyces
25 cerevisiae in that when choline was added, their growth recovered and the fat content was
- 30 -
also increased, which is a characteristic of the oleaginous yeast, Yarrowia lipolytica.
2-2. Evaluation of growth and fat accumulation according to C/N ratio
When culturing was performed in YLMM1 with a C/N ratio of 30, as compared
with YPD with a C/N ratio of less than 1, in Example 5 2-1, the fat content in the strain was
confirmed to increase. Accordingly, the three kinds of strains prepared in Example 1 and
the control PO1f were cultured in CN test media having different C/N ratios, and the
growth and fat accumulation were evaluated according to the C/N ratio. Each strain was
seeded in a 250 mL corner-baffle flask containing 50 mL of CN test medium, to which
10 different concentrations of ammonium sulfate were added, at an initial OD of 0.01, and
cultured with shaking at 250 rpm and 30°C for 72 hours. The composition of the CN test
medium according to the C/N ratio is as follows.

15 40 g/L glucose; 1.7 g/L yeast nitrogen base without amino acids and ammonium
sulfate; 0.5 g/L uracil; 0.3 mM choline chloride; 2.5 g/L (C/N ratio of 30), 1.25 g/L (C/N
ratio of 60), 0.83 g/L (C/N ratio of 90), or 0.63 g/L (C/N ratio of 120) ammonium sulfate
were dissolved in 0.1 M sodium phosphate buffer (pH 7.2).
20 After the culturing was terminated, the culture medium was centrifuged to discard
the supernatant, and cells remaining in the lower layer were dried in a dry oven at 60°C
for 24 hours, followed by fat extraction. Crude fat extraction was performed according
to the feed standard analysis method (feed standard analysis method. 2001. National
Livestock Research Institute, Rural Development Administration), and the analyzed OD
25 and the intracellular crude fat content are shown in Table 4 below. The results in Table 4
are the results of experiments performed in triplicate, and the increase in the fat content
was evaluated by mean values thereof.
- 31 -
[Table 4]
C/N ratio Strain OD600 Crude fat content [%]
Batch1 Batch 2 Batch 3 Mean Batch 1 Batch 2 Batch 3 Mean
30 PO1f 47.2 46.1 47.7 47.0 10.9 11.5 12.4 11.6
CC08-O162 44.4 45.0 48.3 45.9 16.4 16.1 16.4 16.3
CC08-O123 45.7 46.5 46.4 46.2 16.1 15.6 16.3 16.0
CC08-O183 46.2 45.9 46.0 46.0 16.1 16.3 16.2 16.2
60 PO1f 44.9 45.5 45.5 45.3 12.8 12.9 13.3 13.0
CC08-O162 44.5 44.0 43.8 44.1 18.9 18.4 19.1 18.8
CC08-O123 44.9 44.6 45.2 44.9 18.0 18.8 19.3 18.7
CC08-O183 43.9 44.2 44.1 44.1 19.2 18.5 18.9 18.9
90 PO1f 33.3 34.1 33.1 33.5 15.5 15.1 15.0 15.2
CC08-O162 32.0 31.7 31.1 31.6 22.2 21.8 22.3 22.1
CC08-O123 32.6 32.2 32.1 32.3 21.7 21.9 22.4 22.0
CC08-O183 31.8 32.1 31.5 31.8 21.9 22.5 22.2 22.2
120 PO1f 23.7 23.9 24.4 24.0 16.7 16.4 16.7 16.6
CC08-O162 23.3 23.2 23.7 23.4 24.1 24.6 24.2 24.3
CC08-O123 23.8 23.1 23.0 23.3 24.0 24.1 23.6 23.9
CC08-O183 23.4 23.6 23.1 23.4 24.3 24.0 24.1 24.1
As shown in Table 4, it was confirmed that the fat content was increased regardless
of the C/N ratio of the medium in the strains, in which the cho2 or opi3 gene was
individually or simultaneously deleted from the parent strain PO1f, 5 as in Example 2-1. It
was also observed that the increase was at a similar level to be about 43%, regardless of
the C/N ratio.
- 32 -
However, as the C/N ratio in the medium increased, the nitrogen source decreased
and the OD tended to decrease, whereas the intracellular fat content tended to increase.
In order to obtain the C/N ratio showing the maximum productivity, the OD * fat content
value was calculated. In all strains, when the C/N ratio was 60, the maximum OD * fat
content value was observed. Therefore, it was 5 evaluated that the C/N ratio of 60 is the
optimal C/N ratio.
Example 3. Preparation and Evaluation of Fat-Accumulating SCO023-Based
Deficient Strain
10
3-1. Preparation of fat-accumulating strain SCO023
To examine the effect of CHO2- or OPI3-encoding gene deletion on a fataccumulating
strain, a high fat-producing yeast strain was prepared.
To prepare the high fat-producing yeast strain, the TAG degradation pathway was
15 first blocked. The TAG degradation pathway is as follows: TAG is converted into fatty
acid (FA) by TGL3 and 4, and the FA is introduced into the peroxisome with the aid of
acyl-CoA binding proteins. The introduced FA is acylated by two peroxisomal acyl-CoA
Synthases (pxa1, 2), and the acylated FA is desaturated by acyl-CoA oxidases (pox1-6) at
the vinyl position. In the desaturated FA-CoA ester, the double bond portion is hydrated
20 by multi-function enzyme 2 (MFE2-C domain, mfe1), and a 3-hydroxyacyl-CoA
intermediate is formed. Here, the A/B domain of the MFE2 enzyme acts to oxidize the 3-
hydroxyacyl-CoA intermediate to a 3-ketoacyl-CoA intermediate, and the 3-ketoacyl-CoA
intermediate is cleaved at the alpha carbon by peroxisomal 3-oxyacyl-thiolase (pot1) to
produce acetyl-CoA and fatty acyl-CoA. FA degradation occurs, as the cycle from the
25 pox reaction to the pot1 reaction is repeated (AIMS Bioengineering 2016. 3(4):493–514).
Among the genes, pox2 (YALI0F10857), mfe1 (YALI0E15378), and pot1
(YALI0E18568) were deleted in Yarrowia lipolytica PO1f to prevent each enzyme from
being expressed. In addition, in order to reduce the number of peroxisomes, the place
where beta-oxidation occurs, pex10 (YALI0C01023), which is a gene involved in the
- 33 -
formation of peroxisomes, was deleted to prevent the enzyme from being expressed (AIMS
Bioengineering 2016. 3(4):493–514). Finally, mhy1 (YALI0B21582), which is a
morphology-related gene, was deleted. If mhy1 gene was deleted, the carbon flux into
amino acid biosynthesis decreased and the carbon flux into fat biosynthesis increased,
thereby increasing the intracellular 5 crude fat content (Biochim. Biophys. Acta. 2018.
1863(1):81–90).
To prepare a cassette capable of deleting each gene, a polynucleotide sequence of
SEQ ID NO: 21 and an amino acid sequence of SEQ ID NO: 22 of pox2, a polynucleotide
sequence of SEQ ID NO: 23 and an amino acid sequence of SEQ ID NO: 24 of mfe1, a
10 polynucleotide sequence of SEQ ID NO: 25 and an amino acid sequence of SEQ ID
NO: 26 of pex10, a polynucleotide sequence of SEQ ID NO: 27 and an amino acid
sequence of SEQ ID NO: 28 of pot1, and a polynucleotide sequence of SEQ ID NO: 29
and an amino acid sequence of SEQ ID NO: 30 of mhy1 were obtained based on
nucleotide sequences registered at KEGG.
15 Design of each gene-deficient cassette was performed in the order of 5′UTR–
URA3–5′UTR_RP–3′UTR, and 5′UTR, 5′UTR_RP, and 3′UTR were subjected to PCR
using the genomic DNA of Yarrowia lipolytica PO1f as a template and the following
primers, respectively; for the preparation of a pox2-deficient cassette, primers of SEQ ID
NOs: 31 and 32, SEQ ID NOs: 35 and 36, SEQ ID NOs: 37 and 38, for the preparation of
20 an mfe1-deficient cassette, primers of SEQ ID NOs: 39 and 40, SEQ ID NOs: 43 and 44,
SEQ ID NOs: 45 and 46, for the preparation of a pex10-deficient cassette, primers of SEQ
ID NOs: 47 and 48, SEQ ID NOs: 51 and 52, SEQ ID NOs: 53 and 54, for the preparation
of a pot1-deficient cassette, primers of SEQ ID NOs: 55 and 56, SEQ ID NOs: 59 and 60,
SEQ ID NOs: 61 and 62, and for the preparation of an mhy1-deficient cassette, primers of
25 SEQ ID NOs: 63 and 64, SEQ ID NOs: 67 and 68, SEQ ID NOs: 69 and 70 were used.
For URA3, PCR was performed using a URA3 auxotrophic marker as a template and
primers of SEQ ID NOs: 33 and 34 for the preparation of the pox2-deficient cassette,
primers of SEQ ID NOs: 41 and 42 for the preparation of the mfe1-deficient cassette,
primers of SEQ ID NOs: 49 and 50 for the preparation of the pex10-deficient cassette,
- 34 -
primers of SEQ ID NOs: 57 and 58 for the preparation of the pot1-deficient cassette, and
primers of SEQ ID NOs: 65 and 66 for the preparation of the mhy1-deficient cassette.
PCR was performed for 35 cycles under conditions consisting of denaturation at
95°C for 1 minute; annealing at 55°C for 1 minute; and polymerization at 72°C for 1
minute and 30 seconds. As a result, pox2_5′ UTR 5 of 1,035 bp, pox2_5′ UTR_RP of
720 bp, pox2_3′ UTR of 1,010 bp, pox2_URA3 of 1,569 bp, mfe1_5′ UTR of 1,003 bp,
mfe1_5′ UTR_RP of 709 bp, mfe1_3′ UTR of 1,036 bp, mfe1_URA3 of 1,569 bp,
pex10_5′ UTR of 1,032 bp, pex10_5′ UTR_RP of 735 bp, pex10_3′ UTR of 1,033 bp,
pex10_URA3 of 1,569 bp, pot1_5′ UTR of 1,036 bp, pot1_5′ UTR_RP of 735 bp, pot1_3′
10 UTR of 1,010 bp, pot1_URA3 of 1,569 bp, mhy1_5′ UTR of 921 bp, mhy1_5′ UTR_RP
of 526 bp, mhy1_3′ UTR of 1,029 bp, and mhy1_URA3 of 1,569 bp were obtained. The
DNA fragments amplified by PCR were prepared into a pox2-, mfe1-, pex10-, pot1-, or
mhy1-deficient cassette through overlap extension PCR.
15 First, the pox2-deficient cassette was transformed into Yarrowia lipolytica PO1f by
heat shock and selected on a solid medium containing no uracil. The primary strain thus
selected was subjected to a second crossover to prepare a pox2 gene–deficient strain. In
the same manner, mfe1-, pex10-, pot1-, and mhy1-deficient strains were prepared using
mfe1-, pex10-, pot1-, or mhy1-deficient cassettes. The deficient strains thus prepared
20 were designated as “SCO023”.
[Table 5]
SEQ ID NO: Primer name Sequence (5′–3′)
31 POX2_5′_For GTACCCGGGGATCCTCTAGAGATTCCGCCAAGTGAGACTG
32 POX2_5′_Rev GCAATGACGAGTCAGACAGGCGTTGCTTGTGTGATTTTTG
33 POX2_URA_For CAAAAATCACACAAGCAACGCCTGTCTGACTCGTCATTGC
34 POX2_URA_Rev CGCTTGTCCAGTATGAATAGCTGGTGGTATTGTGACTGGG
- 35 -
35 POX2_5′RP_For CCCAGTCACAATACCACCAGCTATTCATACTGGACAAGCG
36 POX2_5′RP_Rev CAATAAATACCCGCTTGTCCGTTGCTTGTGTGATTTTTG
37 POX2_3′_For CAAAAATCACACAAGCAACGGACAAGCGGGTATTTATTG
38 POX2_3′_Rev GCAGGTCGACTCTAGACCAAACAAAGCTGATGACAC
39 MFE1_5′_For GTACCCGGGGATCCTCTAGACAAGCCAAAGAGATGTTGAC
40 MFE1_5′_Rev GCAATGACGAGTCAGACAGGGTTAATAACGTATCTTCTAC
41 MFE1_URA_For GTAGAAGATACGTTATTAACCCTGTCTGACTCGTCATTGC
42 MFE1_URA_Rev CAAATCAGCCGTTGGCCTGCCTGGTGGTATTGTGACTGGG
43 MFE1_5′RP_For CCCAGTCACAATACCACCAGGCAGGCCAACGGCTGATTTG
44 MFE1_5′RP_Rev CACTTGGTCAGATAATAGCGTTAATAACGTATCTTCTAC
45 MFE1_3′_For GTAGAAGATACGTTATTAACGCTATTATCTGACCAAGTG
46 MFE1_3′_Rev GCAGGTCGACTCTAGATGCTTGAAGGCATATGTGACTG
47 PEX10_5′_For GTACCCGGGGATCCTCTAGAGTTTTCGTCTTAGCGTCATG
48 PEX10_5′_Rev GCAATGACGAGTCAGACAGGGCCGAGGCAGATTTGGGTTG
49 PEX10_URA_For CAACCCAAATCTGCCTCGGCCCTGTCTGACTCGTCATTGC
50 PEX10_URA_Rev GAGTCCAGTAATTCTTTCCGCTGGTGGTATTGTGACTGGG
51 PEX10_5′RP_For CCCAGTCACAATACCACCAGCGGAAAGAATTACTGGACTC
52 PEX10_5′RP_Rev CCTTCCATCCAGACCTCGTCGCCGAGGCAGATTTGGGTTG
53 PEX10_3′_For CAACCCAAATCTGCCTCGGCGACGAGGTCTGGATGGAAGG
54 PEX10_3′_Rev GCAGGTCGACTCTAGAGCTGACCTATACCAGATCAGACGC
55 POT1_5′_For GTACCCGGGGATCCTCTAGACACAATACCCCACAGTGTGC
56 POT1_5′_Rev GCAATGACGAGTCAGACAGGGTGTGTCTTGGTTGGATGAG
57 POT1_URA_For CTCATCCAACCAAGACACACCCTGTCTGACTCGTCATTGC
58 POT1_URA_Rev CAGGCGCTCCCCCATTGGCGCTGGTGGTATTGTGACTGGG
- 36 -
59 POT1_5′RP_For CCCAGTCACAATACCACCAGCGCCAATGGGGGAGCGCCTG
60 POT1_5′RP_Rev GTTCGATCGCGATTCATTTCGTGTGTCTTGGTTGGATGAG
61 POT1_3′_For CTCATCCAACCAAGACACACGAAATGAATCGCGATCGAAC
62 POT1_3′_Rev GCAGGTCGACTCTAGAGAGGAGTGCTAAAATTAGCCCTGC
63 MHY1_5′_For GTACCCGGGGATCCTCTAGATGTCAGCGAAAGCTCAAAG
64 MHY1_5′_Rev GCAATGACGAGTCAGACAGGCAATTCGAGGTCCATTTTGG
65 MHY1_URA_For CCAAAATGGACCTCGAATTGCCTGTCTGACTCGTCATTGC
66 MHY1_URA_Rev GTGGTGCTTTTGTACTTGTCCTGGTGGTATTGTGACTGGG
67 MHY1_5′RP_For CCCAGTCACAATACCACCAGGACAAGTACAAAAGCACCAC
68 MHY1_5′RP_Rev GAAGGCGCTCTACCTCTAGTCCAATTCGAGGTCCATTTTG
69 MHY1_3′_For CAAAATGGACCTCGAATTGGACTAGAGGTAGAGCGCCTTC
70 MHY1_3′_Rev GCAGGTCGACTCTAGACTGTGTTTGATTAGCTCTTCTCAG
3-2. Preparation of SCO023-based cho2-deficient strain (“SCO079”)
A cho2 gene–deficient strain was prepared based on the high fat-producing yeast
strain SCO023 prepared in Example 3-1. The cho2-deficient cassette prepared in
Example 1-1 was transformed into SCO023 by 5 heat shock and selected on a solid medium
containing no uracil. The primary strain thus selected was subjected to a second
crossover to prepare a cho2 gene–deficient strain. The deficient strain thus prepared was
designated as “SCO079”.
10 3-3. Preparation of SCO023-based opi3-deficient strain (“SCO163”)
An opi3 gene–deficient strain was prepared based on the high fat-producing yeast
strain SCO023 prepared in Example 3-1. The opi3-deficient cassette prepared in
Example 1-2 was transformed into SCO023 by heat shock and selected on a solid medium
containing no uracil. The primary strain thus selected was subjected to a second
15 crossover to prepare an opi3 gene–deficient strain. The deficient strain thus prepared
- 37 -
was designated as “SCO163”.
3-4. Flask test
A flask test of the SCO079 and SCO163 strains prepared in Examples 3-2 and 3-3
5 was performed.
The two kinds of strains and the control group were seeded in a 250 mL cornerbaffle
flask containing 50 mL of YLMM2, to which different concentrations of choline
were added, at an initial OD of 0.01, and cultured with shaking at 250 rpm and 30°C for
72 hours. The composition of the YLMM2 is as follows.
10
40 g/L glucose, 1.7 g/L yeast nitrogen base without amino acids and ammonium
sulfate, 0.5 g/L uracil, and 1.25 g/L ammonium sulfate were dissolved in 0.1 M sodium
phosphate buffer (pH 7.2).
15 After the culturing was terminated, the culture medium was centrifuged to discard
the supernatant, and cells remaining in the lower layer were dried in a dry oven at 60°C
for 24 hours, followed by fat extraction. Crude fat extraction was performed according
to the feed standard analysis method (feed standard analysis method. 2001. National
Livestock Research Institute, Rural Development Administration), and the analyzed OD
20 and the intracellular fat content are shown in Table 6 below. The results in Table 6 are
the results of experiments performed in triplicate, and the increase in the fat content was
evaluated by mean values thereof.
[Table 6]
Strain Choline
concentration
[mM]
OD600 Crude fat content [%]
Batch 1 Batch 2 Batch 3 Mean Batch 1 Batch 2 Batch 3 Mean
SCO023 0.00 45.5 45.9 46.0 45.8 22.8 23.0 22.6 22.8
- 38 -
0.05 45.8 46.4 45.8 46.0 22.7 22.3 22.8 22.6
0.10 46.1 45.5 46.1 45.9 22.8 22.7 23.2 22.9
0.30 46.3 46.0 46.3 46.2 22.6 22.4 22.8 22.6
0.50 46.8 47.2 46.7 46.9 22.9 22.5 23.0 22.8
1.00 47.1 47.0 46.0 46.7 22.4 22.3 22.8 22.5
SCO079 0.00 9.8 9.6 11.2 10.2 25.3 25.2 25.7 25.4
0.05 31.7 31.4 31.7 31.6 26.5 26.1 26.0 26.2
0.10 44.0 43.9 43.5 43.8 27.9 26.7 26.7 27.1
0.30 46.6 44.4 44.9 45.3 27.5 27.7 27.6 27.6
0.50 45.2 47.1 44.8 45.7 26.8 26.3 26.1 26.4
1.00 45.4 46.3 46.6 46.1 25.7 26.0 26.3 26.0
SCO163 0.00 11.4 10.5 12.0 11.3 25.9 25.1 24.9 25.3
0.05 33.5 31.6 31.8 32.3 26.0 26.0 25.7 25.9
0.10 43.7 44.4 44.5 44.2 26.1 26.4 26.1 26.2
0.30 44.6 45.8 44.3 44.9 26.9 26.0 27.2 26.7
0.50 45.5 44.7 45.1 45.1 26.3 25.6 26.4 26.1
1.00 46.0 45.8 44.7 45.5 26.0 26.1 25.6 25.9
As shown in Table 6, the strain, in which the cho2 or opi3 gene was deleted from
the parent strain SCO023, showed the fat content equal or similar to the parent strain
SCO023 in the medium containing choline at a concentration of 0 mM or 0.055 mM, but
OD was much reduced. When choline was added 5 at a concentration of 0.1 mM or more
to the medium, the OD was recovered to the level of the control group, and the effect of
increasing the fat content in the strain was also observed. When 0.1 mM to 1 mM
choline was added to the medium, SCO079 showed a 16% to 22% increase in the crude fat
- 39 -
content, and SCO163 showed a 14% to 18% increase in the crude fat content, as compared
with SCO023. However, in the SCO023 strain, where the PEMT pathway remained,
there was no change in the crude fat content, regardless of the choline concentration in the
medium.
As a result, it was confirmed that when 5 an appropriate amount of choline was
added to the strain, in which the cho2 or opi3 gene on the PEMT pathway was deleted, the
growth of the strain recovered and the fat content in the strain was increased. However,
it was confirmed that the increase in the fat content was relatively low when choline was
added after the cho2 and opi3 genes were deleted based on the fat accumulating strain
10 SCO023, as compared with the case where the cho2 and opi3 genes were deleted based on
the wild-type strain.
Example 4. Preparation and Evaluation of Fat-Accumulating SCO028-Based
Deficient Strain
15
4-1. Preparation of fat-accumulating strain SCO028
To examine the effect of CHO2- or OPI3-encoding gene deletion on a strain having
a higher fat content than the strain prepared in Example 3-1, another high fat-producing
yeast strain was prepared.
20 It is known that when acyl-CoA:diacylglycerol acyltransferase isozyme I (DGA1),
which is a terminal enzyme of the fat biosynthetic pathway, is overexpressed, based on
mfe1- and pex10-deficient strains, the fat content is increased (Nat. Commun. 2014.
5:3131). Therefore, a promoter of dga1 (YALI0E32769) was replaced with a TEFINt
promoter, based on the SCO023 strain prepared in Example 3-1, in which the fat
25 degradation pathway was blocked and the carbon flux into fat biosynthesis increased
(METAB ENG 2015. 29:56–65). A process of preparing a cassette for the promoter
replacement is as follows.
To prepare the cassette capable of replacing the promoter of dga1 gene, a
polynucleotide sequence of SEQ ID NO: 71 and an amino acid sequence of SEQ ID
- 40 -
NO: 72 of dga1 were obtained based on the nucleotide sequence registered at KEGG.
Design of the cassette for replacing the dga1 promoter was performed in the order of 5′
UTR–TEFINt1–URA3–TEFINt2–gene(dga1), and for 5′ UTR, TEFINt1, and TEFINt2,
PCR was performed using the genomic DNA of Yarrowia lipolytica PO1f as a template
and primers of SEQ ID NOs: 73 and 74, SEQ ID 5 NOs: 75 and 76, SEQ ID NOs: 79 and 80,
and SEQ ID NOs: 81 and 82, respectively. Further, PCR was performed using the URA3
auxotrophic marker as a template and primers of SEQ ID NOs: 77 and 78. PCR was
performed for 35 cycles under conditions consisting of denaturation at 95°C for 1 minute;
annealing at 55°C for 1 minute; and polymerization at 72°C for 1 minute and 30 seconds.
10 As a result, dga1_5′ UTR of 1,539 bp, dga1_TEFINt1 of 573 bp, dga1_TEFINt2 of 571 bp,
dga1_gene of 1,539 bp, and dga1_URA3 of 1,574 bp were obtained. The DNA
fragments amplified by PCR were subjected to overlap extension PCR to prepare the
cassette for replacing the dga1 promoter.
The cassette for replacing the dga1 promoter was transformed into SCO023 by
15 heat shock and selected on a solid medium containing no uracil. The primary strain thus
selected was subjected to a second crossover to prepare a strain in which the dga1
promoter was replaced with the TEFINt promoter. The deficient strain thus prepared was
designated as “SCO028”.
20 [Table 7]
SEQ ID NO: Primer name Sequence (5′–3′)
73 DGA1_5′_For GTACCCGGGGATCCTCTAGAGACGAGAAACAAATCATGTG
74 DGA1_5′_Rev CGCCGCCAACCCGGTCTCTAGCTTTTGTTTTGTGTGACTTG
75 DGA1_TEF1_For CAAGTCACACAAAACAAAAGCTAGAGACCGGGTTGGCGGCG
76 DGA1_TEF1_Rev GACGAGTCAGACAGGAGGCACTGCGGTTAGTACTGCAAAAAG
77 DGA1_URA_For CTTTTTGCAGTACTAACCGCAGTGCCTCCTGTCTGACTCGTC
78 DGA1_URA_Rev CGCCGCCAACCCGGTCTCTTGGTGGTATTGTGACTGGG
- 41 -
79 DGA1_TEF2_For CCCAGTCACAATACCACCAAGAGACCGGGTTGGCGGCG
80 DGA1_TEF2_Rev GTAGTATTGTGAGTCGATAGTCTGCGGTTAGTACTGCAAAAAG
81 DGA1_dga1_For CTTTTTGCAGTACTAACCGCAGACTATCGACTCACAATACTAC
82 DGA1_dga1_Rev GCCTGCAGGTCGACTCTAGATTACTCAATCATTCGGAACTC
4-2. Preparation of SCO028-based cho2-deficient strain (“SCO048”)
A cho2 gene–deficient strain was prepared based on the high fat-producing yeast
strain SCO028 prepared in Example 4-1. The cho2-deficient cassette prepared in
Example 1-1 was transformed into SCO028 by 5 heat shock and selected on a solid medium
containing no uracil. The primary strain thus selected was subjected to a second
crossover to prepare a cho2 gene–deficient strain. The deficient strain thus prepared was
designated as “SCO048”.
10 4-3. Preparation of SCO028-based opi3-deficient strain (“SCO067”)
An opi3 gene–deficient strain was prepared based on the high fat-producing yeast
strain SCO028 prepared in Example 4-1. The opi3-deficient cassette prepared in
Example 1-2 was transformed into SCO028 by heat shock and selected on a solid medium
containing no uracil. The primary strain thus selected was subjected to a second
15 crossover to prepare an opi3 gene–deficient strain. The deficient strain thus prepared
was designated as “SCO067”.
4-4. Flask test
A flask test of the SCO048 and SCO067 strains prepared in Examples 4-2 and 4-3
20 was performed.
The two kinds of strains and SCO028 were seeded in a 250 mL corner-baffle flask
containing 50 mL of YLMM2 containing no choline or containing 0.3 mM choline at an
initial OD of 0.01, and each cultured with shaking at 250 rpm and 30°C for 72 hours.
The composition of the YLMM2 is the same as in Example 3-4.
- 42 -
After the culturing was terminated, the culture medium was centrifuged to discard
the supernatant, and cells remaining in the lower layer were dried in a dry oven at 60°C
overnight, followed by fat extraction. Crude fat extraction was performed according to
the feed standard analysis 5 method (feed standard analysis method. 2001. National
Livestock Research Institute, Rural Development Administration), and the analyzed OD
and the intracellular fat content are shown in Table 8 below. The results in Table 8 are
the results of experiments performed in triplicate, and the increase in the fat content was
evaluated by mean values thereof.
10
[Table 8]
Strain OD600 Crude fat content [%]
Batch 1 Batch 2 Batch 3 Mean Batch 1 Batch 2 Batch 3 Mean
SCO028 44.8 44.1 43.7 44.2 45.9 45.9 45.6 45.8
SCO028 (w/ CL) 43.9 44.0 44.6 44.2 45.3 45.8 46.0 45.7
SCO048 11.2 11.4 11.3 11.3 47.2 47.1 47.6 47.3
SCO048 (w/ CL) 43.3 43.4 45.0 43.9 52.3 54.4 49.9 52.2
SCO067 11.7 11.9 11.2 11.6 47.1 47.8 46.7 47.2
SCO067 (w/ CL) 44.5 44.1 44.6 44.4 50.3 50.8 50.7 50.6
As shown in Table 8, the strain in which the cho2 or opi3 gene was deleted from
the parent strain SCO028 showed an equal or similar fat content in the medium containing
15 no choline, but OD was much reduced.
When 0.3 mM choline was added to the medium, the OD was recovered to the
level of the control group, and the effect of increasing the fat content in the strain was also
observed, as in Example 3-4. When 0.3 mM choline was added to the medium, SCO048
showed a 14% increase in the fat content, and SCO067 showed a 10% increase in the fat
- 43 -
content, as compared with SCO028.
Accordingly, it was also confirmed that when an appropriate amount of choline
was added to the strain, in which the cho2 or opi3 gene was deleted, the growth of the
strain was recovered, and at the same time, the fat content in the strain was increased. In
addition, as described in Example 3-4, as 5 the fat content in the strain increased, the
increase in the fat content decreased when the cho2 and opi3 genes were deleted.
Based on the above description, it will be understood by those skilled in the art that
the present disclosure may be implemented in a different specific form without changing
10 the technical spirit or essential characteristics thereof. Therefore, it should be understood
that the above embodiment is not limitative, but illustrative in all aspects. The scope of
the disclosure is defined by the appended claims rather than by the description preceding
them, and therefore all changes and modifications that fall within metes and bounds of the
claims or equivalents of such metes and bounds are therefore intended to be embraced by
15 the claims.

WE CLAIM:
1. A variant strain of the genus Yarrowia, wherein activity of phosphatidylethanolamine
N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated.
2. The variant strain of the genus Yarrowia of claim 1, wherein the
phosphatidylethanolamine N-methyltransferase is encoded by cho2 gene, and the cho2
gene consists of a polynucleotide sequence of SEQ ID NO: 1.
3. The variant strain of the genus Yarrowia of claim 2, wherein the cho2 gene is deleted.
4. The variant strain of the genus Yarrowia of claim 1, wherein the phospholipid
methyltransferase is encoded by opi3 gene, and the opi3 gene consists of a
polynucleotide sequence of SEQ ID NO: 11.
5. The variant strain of the genus Yarrowia of claim 4, wherein the opi3 gene is deleted.
6. The variant strain of the genus Yarrowia of claim 1, wherein the strain of the genus
Yarrowia includes Yarrowia lipolytica.
7. The variant strain of the genus Yarrowia of claim 1, wherein the variant strain of the
genus Yarrowia is a choline auxotrophic strain.
8. The variant strain of the genus Yarrowia of claim 1, wherein the variant strain of the
genus Yarrowia has an increased fat content, as compared with a wild-type.
9. The variant strain of the genus Yarrowia of claim 8, wherein the fat includes
triacylglycerol (TAG).
10. A cosmetic composition comprising one or more of the variant strain of the genus
Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a
dry product of the strain, a lysate of the strain, and a fat recovered from one or more
of the strain, the culture, the extract, the dry product, and the lysate.
11. A food composition comprising one or more of the variant strain of the genus
- 48 -
Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a
dry product of the strain, a lysate of the strain, and a fat recovered from one or more
of the strain, the culture, the extract, the dry product, and the lysate.
12. A feed composition comprising one or more of the variant strain of the genus
Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a
dry product of the strain, a lysate of the strain, and a fat recovered from one or more
of the strain, the culture, the extract, the dry product, and the lysate.
13. A medical composition comprising one or more of the variant strain of the genus
Yarrowia of any one of claims 1 to 9, a culture of the strain, an extract of the strain, a
dry product of the strain, a lysate of the strain, and a fat recovered from one or more
of the strain, the culture, the extract, the dry product, and the lysate.
14. A method of increasing a fat in a strain, comprising: culturing a variant strain of the
genus Yarrowia, wherein activity of phosphatidylethanolamine N-methyltransferase
(PEMT) or phospholipid methyltransferase is inactivated.
15. The method of increasing a fat in a strain of claim 14, wherein the culturing the strain
is culturing the strain in a medium containing choline.
16. The method of increasing a fat in a strain of claim 15, wherein a concentration of the
choline in the medium is 0.05 mM to 5 mM.
17. The method of increasing a fat in a strain of claim 15, wherein a C/N ratio in the
medium is 40 to 80.
18. The method of increasing a fat in a strain of claim 14, wherein the fat includes
triacylglycerol (TAG).
19. A method of preparing a fat, comprising: culturing a variant strain of the genus
Yarrowia, wherein activity of phosphatidylethanolamine N-methyltransferase (PEMT)
or phospholipid methyltransferase is inactivated.
- 49 -
20. The method of preparing a fat of claim 19, further comprising: recovering the fat from
the strain, a culture thereof, an extract thereof, a dry product thereof, or a lysate
thereof, after the culturing the strain.
21. The method of preparing a fat of claim 19, wherein the culturing the strain is culturing
the strain in a medium containing choline.
22. The method of preparing a fat of claim 21, wherein a C/N ratio in the medium is 40 to 80.
23. Use of a variant strain of the genus Yarrowia, wherein activity of
phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid
methyltransferase is inactivated; a culture of the strain; an extract of the strain; a dry
product of the strain; a lysate of the strain; a cosmetic composition, a food
composition, a feed composition, or a medical composition, each including one or
more of the strain, the culture, the extract, the dry product, and the lysate, and a fat
recovered from one or more of the strain, the culture, the extract, the dry product, and
the lysate in fat production.

Documents

Application Documents

# Name Date
1 202217053740.pdf 2022-09-20
2 202217053740-STATEMENT OF UNDERTAKING (FORM 3) [20-09-2022(online)].pdf 2022-09-20
3 202217053740-Sequence Listing in txt [20-09-2022(online)].txt 2022-09-20
4 202217053740-Sequence Listing in PDF [20-09-2022(online)].pdf 2022-09-20
5 202217053740-REQUEST FOR EXAMINATION (FORM-18) [20-09-2022(online)].pdf 2022-09-20
6 202217053740-FORM 18 [20-09-2022(online)].pdf 2022-09-20
7 202217053740-FORM 1 [20-09-2022(online)].pdf 2022-09-20
8 202217053740-DECLARATION OF INVENTORSHIP (FORM 5) [20-09-2022(online)].pdf 2022-09-20
9 202217053740-COMPLETE SPECIFICATION [20-09-2022(online)].pdf 2022-09-20
10 202217053740-FORM-26 [24-09-2022(online)].pdf 2022-09-24
11 202217053740-certified copy of translation [24-09-2022(online)].pdf 2022-09-24
12 202217053740-Certified Copy of Priority Document [04-10-2022(online)].pdf 2022-10-04
13 202217053740-Proof of Right [26-12-2022(online)].pdf 2022-12-26
14 202217053740-FORM 3 [10-01-2023(online)].pdf 2023-01-10