Sign In to Follow Application
View All Documents & Correspondence

Bioinformatics Based Discovery Of Novel Gene Targets For Detection And Diagnosis Of Lymphatic Filariasis In Human Patients

Abstract: Abstract The present invention discloses a LAMP-based assay for the detection and diagnosis of Lymphatic Filariasis (LF) using novel gene targets. Leveraging advanced computational algorithms, the present invention provides comprehensive analysis of genomic, transcriptomic, and proteomic data, culminating in the systematic identification and prioritization of gene targets.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
08 February 2024
Publication Number
33/2025
Publication Type
INA
Invention Field
PHYSICS
Status
Email
Parent Application

Applicants

Foundation for Neglected Disease Research
Plot 20A, KIADB Industrial Area, Veerapura, Doddaballapur, Bangalore, Karnataka – 561 203

Inventors

1. Vigneshwaran Ravishankar
1337, Gnanagiri Road, Sivakasi, Tamil Nadu, PIN:626189
2. Shridhar Narayanan
Prestige Royale Gardens, Doddaballapur Road, Avalahalli, Yelahanka, Bangalore 560064 Karnataka
3. RK Shandil
3 Flat # 4106, Prestige Royale Gardens, Doddaballapur Road, Bangalore 560064

Claims

1. A process for detecting lymphatic filariasis (LF) infection in patients comprising loop-mediated isothermal amplification (LAMP) assay to amplify gene targets associated with LF pathogens wherein the presence of the said targets in a biological sample indicates LF infection.

2. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 1 wherein the said gene targets are as listed in Table A.

3. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 1 wherein the said gene targets are rnpB, ftsZ, mutM, mraY and dapF.

4. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 2 wherein the said gene targets are detected using primers as listed in Table B.

5. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 3 wherein the said gene targets are detected using specific primers as listed in Table 1.

6. The process for detecting lymphatic filariasis (LF) as claimed in claim 1 wherein the said pathogen is Wuchereria bancrofti, Brugia malayi or Brugia timori.

7. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 1 wherein the said biological sample is selected from the group consisting of blood, serum, plasma, urine, saliva, tears, stools, sputum, wound swabs, tissue biopsy samples, vaginal fluids and bodily secretions.

8. A kit for detecting pathogens causing lymphatic filariasis (LF), the said kit comprising the primers targeting LF-associated gene sequences and a reaction mixture for loop-mediated isothermal amplification (LAMP) assay.

Specification

DESC:Loop-Mediated Isothermal Amplification (LAMP) assay for detection of Lymphatic Filariasis in human patients
1. Related Application
This application is related to and takes priority from the Provisional application 202441008629 filed on 8th Feb 2024 and International Application PCT/IB2024/063018 filed on 20th Dec 2024, both of which are incorporated herein in its entirety.

2. Field of the Invention
The present invention discloses a LAMP-based assay for the detection and diagnosis of Lymphatic Filariasis (LF) using novel gene targets. Leveraging advanced computational algorithms, the present invention involves comprehensive analysis of genomic, transcriptomic, and proteomic data, culminating in the systematic identification and prioritization of gene targets.

3. Background of the Invention
Lymphatic filariasis (LF) is a difficult to diagnose neglected tropical parasitic infection and is a serious public concern in endemic countries. LF is a challenging-to-diagnose neglected tropical disease that poses a significant public health threat in endemic regions (Matapo et al 2023). The disease is predominantly found in tropical and subtropical areas of Asia, Africa, the western Pacific, parts of South America, and the Caribbean (Singh et al 2020). In 2000, the World Health Organization (WHO) initiated the Global Program to Eliminate Lymphatic Filariasis (GPELF) with the ambitious goal of eradicating LF by 2020. In India, 99.4% of the cases are caused by Wuchereria bancrofti whereas Brugia malayi is responsible for 0.6% of the problem (https://ncvbdc.mohfw.gov.in/index4.php? lang=1&level=0&linkid=458&lid= 3730). Despite notable progress in reducing the overall disease burden, many targets that were set for achieving promising results remain unsuccessful. Several factors have contributed to this, including the lack of simple yet sensitive diagnostic tests, challenges related to population compliance with mass drug administration (MDA), and other additional hurdles. The causative agents of human filariasis encompass Wuchereria bancrofti, Brugia malayi, Brugia timori, Loa loa, Mansonella perstans, Mansonella ozzardi, Mansonella streptocerca, and Onchocerca volvulus. Of these, three are responsible for LF: Wuchereria bancrofti accounts for more than 90% of LF cases (WHO, 2019), while Brugia malayi is prevalent in Southeast Asia, and Brugia timori is found in southeastern Indonesia. Clinical diagnosis is challenging, and laboratory diagnosis is hindered by the lack of agent-specific, highly sensitive, and cost-effective tests. The primary objective of this study is to develop a molecular test for LF detection that is highly sensitive, cost-effective, and suitable for point of care/field application in low resource settings, specifically tailored to the needs of the Indian population.
Previously, Polymerase Chain Reaction (PCR) techniques targeting filarial DNA regions, such as 5S rRNA (Thanchomnang et al. 2013), Hha I (Saeed et al. 2014), 16S rRNA (Mukhopadhyay et al. 2008), tph 1 (Laney et al. 2010), ssp 1 (McCarthy et al. 1996), ITS 1, and ITS 2, have gained widespread use due to their high sensitivity and specificity, but they have more limitations as they couldn’t differentiate all filarial agents and needed advanced instrumentation and better laboratory Setups.
3.1 Diagnostic Challenges
Traditional diagnostic methods for LF primarily involve the examination of blood samples for the presence of microfilariae, the larval stage of the parasite. These methods have several limitations:
i. Sensitivity: Microfilariae may not always be present in the bloodstream, resulting in false-negative results.
ii. Specificity: Cross-reactions with other parasitic infections can produce false positives.
iii. Labor-Intensive: Microscopic examination requires skilled technicians and may not be practical in resource-limited settings.
iv. Invasive: Blood sample collection is invasive and may not be well-received in some communities.
v. Limited diagnostics availability.
3.2 Hypothesis
Molecular diagnostic assays play a pivotal role in diagnosing infectious diseases, especially those that are difficult to grow/culture/isolate, or diagnose through traditional methods. Meticulously designed and validated, molecular biology-based assays become indispensable tools in diagnostic microbiology. Quantitative PCR assays provide quantitative information about the parasitic load present in infected specimens. In recent times, isothermal amplification tests, exemplified by Loop-Mediated Isothermal Amplification (LAMP), have undergone significant advancements, notably minimizing subjectivity in test results. These assays, characterized by their color-based yes or no outcome, are particularly well-suited for field applications, facilitating both disease detection and population screening in resource-limiting settings. The enhanced objectivity of LAMP assays makes them a valuable resource in decision-making processes related to mass drug administration in filariasis, thus enabling informed choices and decision-making regarding the continuation or cessation of such interventions.
4. Summary of Invention
Lymphatic filariasis (LF) is a difficult to diagnose neglected tropical parasitic infection and is a serious public concern in endemic countries. This disease is predominantly seen in the tropical and sub-tropical regions of Asia, Africa and parts of South America, hence underscores the importance of targeted interventions for effective management and control within these regions. The present invention provides a significant milestone in advancing the detection methodologies for filarial agents, particularly Wuchereria bancrofti and Brugia malayi. Through comprehensive whole-genome scanning of these parasitic organisms, we have successfully identified novel gene markers that serve as crucial indicators for the detection of lymphatic filariasis.
In one aspect, the invention provides filarial genes that were hitherto unknown previously.
In another aspect, specific primers are designed to detect these filarial genes in human clinical specimens
The invention is also valuable as it provides a process to validate quantitative PCR and/or a specifically designed Loop-Mediated Isothermal Amplification (LAMP) assay to achieve definitive diagnosis of filariasis (Wuchereria bancrofti, Brugia malayi and Brugia timori) in the clinic. By integrating multi-omics data and employing state-of-the-art bioinformatics methodologies, the disclosed approach provides a robust framework for the rapid and accurate identification of gene targets associated with LF.

5. Brief Description of the Invention
5.1 Experimental protocol for identifying novel gene markers for detecting lymphatic filariasis
We have used bioinformatics approaches for the identification of novel gene markers specific to lymphatic filariasis. Following steps were used:
i. Genome Scanning: The initial step involved obtaining complete genomic data from the filarial parasites Wuchereria bancrofti and Brugia malayi. This genomic data provided a comprehensive overview of the parasites' DNA, encompassing all genes and genetic information.
ii. Gene selection: After acquiring the genome data, the crucial task of identifying specific genes relevant to the research was performed. Criteria for gene selection included factors such as gene length, gene essentiality for the parasite's survival and reproduction, and role in the disease process.
a) Gene Length: Longer genes offer more regions for primer design, thus are favoured for diagnostic purposes.
b) Essentiality: Targeting essential genes crucial for the parasite's survival was considered relevant for effective diagnostics.
c) Role in Disease: Genes involved in the disease process or encoding proteins expressed during infection were also considered favourably.
i. Performing BLASTn: After identifying potential target genes, the BLASTn tool was utilized to search the filarial genome for sequences matching or similar to the selected genes. This step aided in pinpointing specific regions within the genome aligning with the target genes, narrowing the focus to the most relevant genomic areas.
ii. Multiple Sequence Alignment: Specific hits from the BLASTn search were subjected to Multiple Sequence Alignment (MSA), a bioinformatics technique aligning multiple DNA sequences. MSA facilitated the identification of conserved regions and variations across different filarial strains, a crucial step in designing primers targeting filarial DNA while avoiding non-specific binding.
iii. Designing Filarial-Specific Primers: Informed by the MSA results, primers highly specific to filarial parasites were designed, targeting the conserved regions identified in the alignment. These filarial-specific primers found applications in Polymerase Chain Reaction (PCR) assays, enabling the detection and study of filarial DNA in biological samples.
This comprehensive approach, combining laboratory techniques with bioinformatics tools, enabled us to identify, validate, and design primers specific to filarial parasites. It proved to be a critical approach for research aimed at understanding filarial diseases and developing accurate diagnostic tests.
5.2. Novel genes identified for Real-time-based detection of filarial parasites.
The following genes were identified based on the experimental procedures described above:
1. rnpB (Ribonuclease P)
2. ATP6 (ATP synthase F0 subunit 6)
3. ND6 (NADH dehydrogenase subunit 6)
4. ftsZ (Cell division cycle protein)
5. COX 2 (Cytochrome oxidase 2)
Table 1: List of gene-specific primers designed for developing quantitative PCR assay in detecting filarial parasites
SEQ. ID No. Primer name Primer Sequence (5’ -> 3’)
1 rnpB_F AGTAGCTGCTGTTGTGTGG
2 rnpB_R GTTTATGTAGCTATTTATCTA
3 ATP6_F TTTTRGTKAGTGGWTTTAG
4 ATP6_R AAAAYATACAAAYCAAAGTTA
5 ND6_F TGRGATCCWATRAAAAG
6 ND6_R TTACAASCCACGYATAAA
7 ftsZ_F CATATGCTTTTCATCACG
8 ftsZ_R CCATTAACTCAGTCACC
9 COX2_F CCTRTTCCYAGTAATTCT
10 COX2_R AAATATCCTAAAGAYCAAG

Degeneracy codes were as follows:
K = G+T; R = A+G ; S = G+C ; W = A+T and Y = C+T
5.3. Phylogenetic relationship of Wuchereria sp. (Figure 1)
Phylogenetic analysis of different parasitic species, including Wuchereria and Brugia was performed using MEGA 11 software. The detailed procedure is described below.
a) Multiple Sequence Alignment: The DNA sequences of various parasites, including Wuchereria sp. and Brugia sp. were retrieved from NCBI and aligned using MEGA 11 software. Multiple Sequence Alignment (MSA) is a crucial step to compare and align these sequences, ensuring that they are in the same order so one can identify their similarities and differences.
b) Substitution Matrix Selection: The selection of an appropriate substitution matrix is essential for constructing a phylogenetic tree. The substitution matrix is a mathematical model that describes how one DNA base can change or mutate into another over evolutionary time. Tamura 3-parameter model with a Gamma distribution was selected for inferring the phylogeny. This model estimates evolutionary distances between sequences, considering different substitution rates and the possibility of multiple substitutions at a single site. The selection of this model is based on the Bayesian Information Criterion (BIC) score, where a lower BIC score indicates a better fit of the model to the data.
c) Phylogenetic Tree Construction: The selected substitution matrix was used to interpret the phylogeny and the phylogenetic relationship was inferred using the Neighbor-Joining algorithm. The Neighbor-Joining algorithm is a popular method for inferring evolutionary relationships between species. It constructs a tree by iteratively joining the closest pairs of species based on their genetic distances as calculated using the substitution matrix. The resulting tree represents the hypothesized evolutionary relationships among the species, with branch lengths indicating the genetic distances.
d) Validation with Bootstrapping: Phylogenetic tree construction is subject to inherent uncertainties stemming from data variations and methodological choices. The bootstrapping technique was employed to validate the reliability of the phylogenetic tree. Bootstrapping involves generating numerous datasets by repeatedly and randomly sampling from your initial data while allowing for replacement. Subsequently, multiple phylogenetic trees are built using these resampled datasets. Through a comparison of these resultant trees, the stability and confidence in the branching patterns are evaluated based on the branches observed in your original tree. Elevated bootstrap values at specific nodes signify strong support for those branches, whereas lower values indicate higher uncertainty.
Figure 1: Phylogenetic relationship of filarial parasites inferred using MEGA 11 software.
Based on the phylogeny, Dirofilaria sp. Onchocerca sp. Mansonella sp. and Litomosodies sp. are closely related to Wuchereria and Brugia sp.
6. Novel genes for developing LAMP assay
6.1 LAMP applications in diagnostics
LAMP (Loop-Mediated Isothermal Amplification) is a molecular biology technique used in diagnostics. It is particularly valuable because of its ability to amplify DNA rapidly and specifically under isothermal conditions, meaning it doesn't require a traditional thermal cycler or PCR machine that involves cycling through different temperature steps.
The application of LAMP assay in diagnostics is as follows:
a. Infectious Disease Diagnosis: LAMP is frequently used to detect the presence of pathogens like bacteria, viruses, and parasites. It is an excellent tool for diagnosing malaria, tuberculosis, HIV, and COVID-19.
b. Point-of-Care Testing: LAMP is well-suited for point-of-care testing in resource-limited settings due to its rapid and simple nature. Healthcare workers can use LAMP assays in the field to quickly identify diseases.
c. Food Safety Testing: LAMP can detect foodborne pathogens like Salmonella, E. coli, and Listeria. This ensures the safety of food products and can prevent foodborne illness outbreaks.
d. Environmental Monitoring: LAMP can detect and monitor environmental contaminants, such as identifying waterborne pathogens or assessing the presence of specific organisms in environmental samples.
e. Agricultural and Veterinary Diagnostics: LAMP is used to detect diseases in livestock, crops, and plants. For example, it can be used to identify animal diseases like foot-and-mouth disease or plant pathogens responsible for crop diseases.
f. Genetic Testing: LAMP can identify genetic mutations associated with various diseases or conditions, making it valuable in genetic diagnostics.
g. Biomedical Research: LAMP is used in various research applications, such as studying gene expression, genetic variation, or the presence of specific DNA sequences in samples.
h. Forensic Analysis: LAMP is utilized in forensic science to identify genetic material at crime scenes or in paternity testing.
The advantages of LAMP in diagnostics include its speed, simplicity, and robustness. It can produce results in as little as 15-60 minutes and is less prone to contamination due to the isothermal amplification process. Additionally, it requires minimal equipment, making it suitable for field applications and resource-limited settings. However, like any diagnostic method, LAMP also has limitations and specific requirements depending on the target applications.
6.2 Advantages of LAMP over PCR
a. Isothermal Amplification: LAMP operates at a constant temperature (typically around 60-65°C), while PCR requires a series of temperature cycling steps. This isothermal nature of LAMP simplifies the equipment requirements and reduces the need for precise temperature control, making it more accessible for field or point-of-care testing.
b. Speed: LAMP is generally faster than PCR. It can produce results in as little as 15-60 minutes, whereas PCR typically takes a few hours due to its cycling temperature steps.
c. Simplicity: LAMP involves fewer primer sets (typically 4-6 primers) than the multiple primers used in PCR. This simplicity reduces the risk of primer-dimer formation and simplifies primer design.
d. Robustness: LAMP is more robust and less sensitive to inhibitors and contaminants in the sample compared to PCR. This robustness makes it suitable for complex samples, such as blood or environmental samples.
e. Visual Detection: LAMP assays can be designed to allow for visual detection of results. The reaction produces a noticeable change in turbidity or color, which can be observed with the naked eye. This is especially useful in low-resource settings where sophisticated detection equipment is unavailable.
f. Specificity: LAMP is highly specific due to its use of multiple primers that recognize distinct regions of the target DNA. This reduces the risk of false-positive results.
g. Cost-Effectiveness: LAMP can be more cost-effective because it doesn't require expensive thermal cyclers and equipment needed for PCR. Additionally, the isothermal nature of LAMP can reduce energy consumption.
h. Low Sample Volume: LAMP can work with smaller sample volumes, which can be beneficial when dealing with limited or precious samples.
i. Multiplexing: LAMP is adaptable for multiplexing, meaning it can detect multiple targets in a single reaction. This is advantageous in applications where the simultaneous detection of multiple pathogens or genetic markers is required.
j. Field Applications: LAMP is well-suited for field or point-of-care applications because of its speed, simplicity, and isothermal operation. This makes it valuable in remote or resource-limited settings.
6.3 Experimental strategy for identification of novel genes in developing LAMP assay
The key factors in designing LAMP primers are Tm, stability at the end of primers, GC content and secondary structure.
6.3.1 Tm
The Nearest-Neighbor method is currently the most accurate approximation method for estimating Tm, which is the melting temperature of DNA. Tm calculations are influenced by experimental factors such as salt concentration and oligo concentration, so it is preferable to determine Tm under fixed experimental conditions, with an oligo concentration of 0.1 µM, a sodium ion concentration of 50 mM, and a magnesium ion concentration of 4 mM. For the specific DNA regions being analyzed, the target Tm values have been designed to be approximately 65°C (ranging from 64 to 66°C) for F1c and B1c, about 60°C (ranging from 59 to 61°C) for F2, B2, F3, and B3, and approximately 65°C (ranging from 64 to 66°C) for the loop primers.
6.3.2 Stability at the end of the primers
The primers' ends play a crucial role as the starting points for DNA synthesis, and they need to exhibit a certain level of stability. Specifically, the 3' ends of F2/B2, F3/B3, and LF/LB, as well as the 5' end of F1c/B1c, are intentionally designed to have a free energy of -4 kcal/mol or less. It's important to ensure that the 5' end of F1c, which corresponds to the 3' end of F1 after the amplification process, maintains this stability. In thermodynamics, the change in free energy (?G) is the difference between the end product's free energy and the initial reactant's free energy.
6.3.3 GC content
The primers are created with a specific target for their GC content, falling within the range of approximately 40% to 65%. However, primers with a GC content ranging from 50% to 60% are generally associated with providing more effective primer sequences.
6.3.4 Secondary structure
It is imperative that the inner primers do not contribute to the formation of secondary structures. Additionally, to prevent the occurrence of primer dimers, it is essential that the 3' ends of the primers do not possess complementary sequences to each other.
6.4 Experimental protocol for Total Nucleic Acid (TNA)-based LAMP primer design

Note:
1. LAMP primers were designed based on specific criteria, and PCR results were examined.
2. In cases of no amplification, primer redesign was undertaken, and the PCR process was repeated.
3. Upon observing amplification, loop primers were designed to enhance specificity, sensitivity, and efficiency.
4. If the loop primers yielded unsatisfactory results, they were subsequently redesigned for optimization.
A system for bioinformatics-based discovery of 24 gene targets associated with lymphatic filariasis as mentioned in the Table A and their respective primer sequences are mentioned in Table B and Table C.
Table A. List of genes identified for detecting and diagnosing Lymphatic filariasis.
S. No. Gene name Description
1 dapF Diaminopimelate epimerase
2 sucD Succinate-semialdehyde dehydrogenase
3 sucC succinyl-CoA synthetase
4 rpsP 30S ribosomal protein S16
5 clpX ATP-dependent Clp protease ATP-binding subunit clpX
6 gmk guanylate kinase
7 der ribosome biogenesis GTPase Der
8 mutM bifunctional DNA-formamidopyrimidine glycosylase/lyase
9 ftsZ Cell division protein
10 mraY phospho-N-acetylmuramoyl-pentapeptide transferase
11 cysS cysteine tRNA ligase
12 ruvC crossover junction endodeoxyribonuclease RuvC
13 ftsY signal recognition particle-docking protein FtsY
14 hscA Fe-S protein assembly chaperone HscA
15 pyrE orotate phosphoribosyltransferase
16 rodA rod shape-determining protein RodA
17 ribD 3,4-dihydroxy-2-butanone-4-phosphate synthase
18 ffh signal recognition particle protein
19 typA translational GTPase TypA
20 htpG molecular chaperone HtpG
21 ftsH ATP-dependent zinc metalloprotease FtsH
22 rnpB RNase P RNA component class A
23 ATP6 ATP Synthase Membrane Subunit 6
24 COX2 Cytochrome Oxidase 2

Table B. Gene-specific primers for LAMP assay.
SEQ. ID No. Name of primers Primer Sequence (5’ -> 3’)
11. rnpB_F3_2.46 AATAGTGACGGGTAACACC
12. rnpB_B3_2.46 TTTACCCGAGTAGATATGAAGA
13. rnpB_FIP_2.46 CACCTTTTCACCCTTACCTAAGAATCCGGAGGTAACTCCAGTT
14. rnpB_BIP_2.46 GTAAGAGCACACCATAGCAATGGCTACTCTTATTTAATCTTGCTCCTA
15. rnpB_F3_2.36 CACAGCAGAGGAAAGTCC
16. rnpB_B3_2.36 TTTACCCGAGTAGATATGAAGA
17. rnpB_FIP_2.36 GGCGGTAATTTTCTGTAGTCCTATAAAATAGTGACGGGTAACACC
18. rnpB_BIP_2.36 GTAAGAGCACACCATAGCAATGGCTACTCTTATTTAATCTTGCTCCTA
19. rnpB_F3_2.36_2 CACAGCAGAGGAAAGTCC
20. rnpB_B3_2.36_2 CTACTCTTATTTAATCTTGCTCCTA
21. rnpB_FIP_2.36_2 GGCGGTAATTTTCTGTAGTCCTATGCTCCAAGGAAAAATAGTGAC
22. rnpB_BIP_2.36_2 ATTCTTAGGTAAGGGTGAAAAGGTGGTTGGTTACTTGACTACCAATG
23. ftsZ_F3_1.46 TGATTGGTACTGGGGAGG
24. ftsZ_B3_1.46 GGTAGCACCAAATATTATATTTGCA
25. ftsZ_FIP_1.46 CGCCCCTTTCATTGATACATTATCACAGAGGGAGAAGATAGAGC
26. ftsZ_BIP_1.46 TATTGATTAATATTACCGGCGGTGGCTACTTCTTCGCGCACTC
27. ftsZ_LF_1.46 GCAGCTTCTGCAGCACTGATA
28. ftsZ_BF_1.46 GGTTGATGCTGCGGCGAATA
29. ftsZ_F3_2.06 TAATGGTTATGCCAGGGC
30. ftsZ_B3_2.06 AACAGAGTCATATCTCCACC
31. ftsZ_FIP_2.06 TCTGCCTCCCCAGTACCAATCTGATATAGAAACAGTAATGAGCG
32. ftsZ_BIP_2.06 TGCAGAAGCTGCAATATCTAATCCGCCGGTAATATTAATCAATATTCCT
33. ftsZ_LB_2.06 GATAATGTATCAATGAAAGGGGCGC
34. COX2_F3_2.07 TATGTTTCGGCAGCCTGA
35. COX2_B3_2.07 TGAATTACATCTTTAGAAGTGCA
36. COX2_FIP_2.07 GGCTTCATGAACGAATCAAAATTCATAAAGGTTATTGGTCACCAATGA
37. COX2_BIP_2.07 ATGGGTGATTTTCGTTTATTTGACGCCGATATTTACACCGACAGG
38. ATP6_F3_2.29 TGAATTTGTGGATTAGTTTTTCC
39. ATP6_B3_2.29 CTAATACGTAAAGTCAAAGCAAC
40. ATP6_FIP_2.29 AGTACGAACCCCTAATCAAGAAAAAGTCCTTGAGCTAGTGTTGG
41. ATP6_BIP_2.29 TTGAGGAAGACCATTCTTGAGAGTTCAAAAAACTCAATCAGTGAGAA
42. ATP6_F3_2.06 CTGTGTTTTGAATTTGTGGATT
43. ATP6_B3_2.06 TCAAAGCAACACCACTCA
44. ATP6_FIP_2.06 AGTACGAACCCCTAATCAAGAAAAACCTTTGTTTAGTCCTTGAGCT
45. ATP6_BIP_2.06 TTGAGGAAGACCATTCTTGAGAGTTCAAAAAACTCAATCAGTGAGAA
46. rpsP_F3_2.28 CAAGATTTGGTGCAAAGAAAC
47. rpsP_B3_2.28 ACCATAGTACCCTTTCAGTTG
48. rpsP_FIP_2.28 GCCCTATTCTCTCAATAAAACGTCCGCCCTTTTTACAGAATAGTTGT
49. rpsP_BIP_2.28 AGTACGATCCAATGCTACCAAAAGAGCACCTACACTTAGCCAAT
50. rpsP_LF_2.28 TTGGCGCACGTGAATCAGC
51. rpsP_LF_1.5 TGGCGCACGTGAATCAGC
52. dapF_F3_2.01 GTTATAGTAATAGCCAACTCCAG
53. dapF_B3_2.01 GGTTTGCCCATATTGACCTT
54. dapF_FIP_2.01 ATATCCAACGCAACGTGCTGTGCTTTATGCACATTTATAATGC
55. dapF_BIP_2.01 TGTCAGAAAGAAGTACTGAGTATGCCCCACTTTGAAGCACTCT
56. dapF_LF_2.01 CACATTTCGACTTCACCACCGTC
57. dapF_LB_2.01 TCGAGTTAGTAAACGAGCGCATTTT
58. dapF_F3_1.62 AGTCCTAAAAGAATGTACGGTA
59. dapF_B3_1.62 CATTATTAGATATCCAACGCAAC
60. dapF_FIP_1.62 GCCATTTTGATTGGCAATTTCTCTAGTAACAATTTCGTTATCATAGACTC
61. dapF_BIP_1.62 GCGACCAAGTTATAGTAATAGCCAAATTTCGACTTCACCACCG
62. dapF_LF_1.62 TCCAATTCAAGTTGTTTATCGAGCG
63. dapF_LB_1.62 GCAGCTGATTGCTTTATGCACATT
64. rnpB_F3_2.28 GAAATAAGTAGCTGCTGTTGT
65. rnpB_B3_2.28 TGACTACCAATGTTGCCA
66. rnpB_FIP_2.28 CGGGTGTTACCCGTCACTATTGTGGTAAACACAGCAGAGG
67. rnpB_BIP_2.28 ATAGGACTACAGAAAATTACCGCCTTGCTATGGTGTGCTCTT
68. rnpB_LF_2.28 TCCTTGGAGCCCGGACTT
69. rnpB_LB_2.36 AAGAGCACACCATAGCAATGGC
70. dapF_LF ACATTTCGACTTCACCACCGTC
71. dapL_LB CACCATCGAGTTAGTAAACGAGCG
72. mraY_F3 GATCGACTTTGGCTACCT
73. mraY_B3 TCGCTCCTATAAACGTGATG
74. mraY_FIP AAGGCCATCTAGGCCATCTGTACCATTTGCTGCATTTATAGTGG
75. mraY_BIP CAACTCAAATCATCGCTTCTTTTGTGAATAGGATAACACTTATATCTGCT
76. mraY_LF GATTCACAGCGTTAGAAGAGCCG
77. mraY_LB TGGGATTAGTTGCATACATGACTCA
78. mutM_F3 ATACGCTTCTGAGAGTCTG
79. mutM_B3 CAAGGTTTTTGAACTTTACCATA
80. mutM_FIP GTAGCAAGTTTTTCGCACTCTTTATGAGCTCGCATATCACCAC
81. mutM_BIP ATACTCTGAGTGATGCAATCATAGCAAGTATCCAACAGATCCAGAT
82. mutM_LF ACGTCAAATCTTGTGCTGATCTCA
83. mutM_LB GTGGGTCGACGTTAAAAGATTATGC

Table C. Gene-specific primers for Quantitativ PCR assay
SEQ. ID No. Primer name Primer Sequence (5’ -> 3’)
1 rnpB_F AGTAGCTGCTGTTGTGTGG
2 rnpB_R GTTTATGTAGCTATTTATCTA
3 ATP6_F TTTTRGTKAGTGGWTTTAG
4 ATP6_R AAAAYATACAAAYCAAAGTTA
5 ND6_F TGRGATCCWATRAAAAG
6 ND6_R TTACAASCCACGYATAAA
7 ftsZ_F CATATGCTTTTCATCACG
8 ftsZ_R CCATTAACTCAGTCACC
9 COX2_F CCTRTTCCYAGTAATTCT
10 COX2_R AAATATCCTAAAGAYCAAG

7. Examples
The following examples further illustrate and enable the invention. The description however should not be construed as limiting the scope of the invention.
7.1. Experimental protocol of LAMP assay:
The reaction components were initially thawed at room temperature and placed on ice. The reaction mixture for the LAMP assay was prepared by mixing 12.5 µl of WarmStart Colorimetric LAMP 2X Master Mix, 2.5 µl of 10X LAMP primer mixture (prepared according to the manufacturer’s guidelines from NEB, Ipswich, MA, USA), 1 µl of serially diluted reference DNA material or spiked DNA template, and 9 µl of molecular biology grade water, resulting in a final volume of 25 µl per reaction. The reaction mixture was pipetted to ensure thorough mixing, with a bright pink colour observed, indicating the initial high pH required for a successful pH-LAMP reaction. The reaction tubes were then sealed and incubated at 65°C for 30 minutes. Following incubation, the tubes were visually examined for colour change, and the results were documented by photography or scanning to capture the colorimetric outcomes.
7.2. Experimental data findings
The present project proposes a LAMP-based molecular diagnostic test for Lymphatic Filariasis (LF). Preliminary studies have provided crucial insights that support the feasibility of the LAMP assay for LF diagnosis. We have successfully identified and verified LF-specific genetic markers through bioinformatics approaches using tools like CLC Sequence Viewer 8.0, MEGA X and NEB LAMP primer design. Also, we have established proof-of-concept with reference DNA and spiked biological samples in laboratory settings. An initial assessment of the assay performance has been completed with W. bancrofti spiked biological samples. The key findings from our preliminary research are described below.
I. Identification of LF-Specific Genetic Markers
To ensure high accuracy and specificity for the LAMP assay, we conducted an extensive bioinformatics analysis to identify genetic markers unique to W. bancrofti, the primary causative agent of LF. The identification process involved:
i. Genomic Screening and Marker Selection: We screened novel candidate markers unique to W. bancrofti and highly specific to the LF-causing parasites using publicly available genomes and sequence databases. This screening helped to exclude any sequences shared with other parasitic or co-infective organisms, thus preventing cross-reactivity.
ii. Verification of Target Stability and Conservation: Candidate markers were further assessed for their stability and conservation across multiple strains of W. bancrofti from different geographical regions. This step ensured the selected markers were consistent, non-variable, and applicable to LF cases across diverse endemic areas.
Based on these bioinformatics approaches using CLC Sequence Viewer 8.0, MEGA X, NEB LAMP primer design, we have identified 5 novel gene targets, including rnpB, ftsZ, mutM, mraY and dapF, for detecting W. bancrofti using LAMP assay. The validated genetic markers were subsequently selected for developing LAMP assay due to their superior diagnostic potential in accurately detecting W. bancrofti infections.
II. Laboratory assessment of LAMP assay with reference DNA of W. bancrofti
We developed a LAMP assay using the identified genetic markers and conducted laboratory validation to assess its sensitivity, specificity, and practical feasibility. This validation was initially optimized with the reference DNA material. Critical aspects of the validation are as follows:
A. Primer Design and Optimization:
Multiple LAMP primer sets were designed, including outer primers (F3 and B3), internal primers (FIP and BIP), and loop primers, explicitly targeting the identified LF genetic markers. These primers were optimised to ensure efficient and specific amplification in the LAMP assay.
B. Sensitivity Testing:
The LAMP assay was optimised to detect as low as 400 fg of W. bancrofti DNA per reaction, meeting the high sensitivity requirements necessary for identifying low parasite loads typical of early-stage infections. This level of sensitivity confirms the assay’s potential for detecting early infections and preventing further transmission.
C. Specificity Testing
As the primers were designed specifically for the LF-targeted genes, there was possibly no cross-reactivity, underscoring the assay’s high specificity to W. bancrofti DNA.
D. Reproducibility and Consistency
Repeated LAMP assay tests consistently showed high accuracy, sensitivity, and specificity. Negative controls were included in each run to validate the results and demonstrate assay reliability.
E. Development of Visual Detection Mechanisms
Colorimetric detection using pH-sensitive dyes showed precise, easily interpretable results, with positive reactions indicated by a colour change of pink to yellow, enabling non-specialized users to read results directly. This visual detection is critical for field use, as it removes the need for complex instrumentation, making the assay user-friendly and accessible for healthcare professionals.
Table 1: LAMP-optimized assay results of various novel gene targets for the detection of W. bancrofti with reference DNA samples
S. No. Description Interpretation and Figure 2
1 rnpB
gene-specific primers, Fig. 2a i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. Negative control remains pink, confirming no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 400 fg.
2 ftsZ
gene-specific primers, Fig. 2b i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes indicates positive reactions.
ii. Negative control remains pink, confirming no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 4 pg.
3 mutM
gene-specific primers, Fig. 2c i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. Negative control remains pink, confirming no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 8 pg.
4 mraY
gene-specific primers, Fig. 2d i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. No amplification in negative control confirms no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 4 pg.
5 dapF
gene-specific primers, Fig. 2e i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. No amplification in negative control confirms no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 800 fg.

III. Laboratory assessment of LAMP assay with spiked biological samples of W. bancrofti
We developed a LAMP assay using the identified genetic markers and conducted laboratory validation to assess its sensitivity, specificity, and practical feasibility. This validation was initially optimized with the reference DNA material and further extended to spiked biological samples of W. bancrofti to simulate actual field conditions and ensure accuracy. Critical aspects of the validation are as follows:
A. Primer Design and Optimization:
Multiple LAMP primer sets were designed, including outer primers (F3 and B3), internal primers (FIP and BIP), and loop primers, explicitly targeting the identified LF genetic markers. These primers were optimised to ensure efficient and specific amplification in the LAMP assay.
B. Sensitivity Testing:
The LAMP assay was optimised with spiked biological samples to detect as low as 4 pg of W. bancrofti DNA per reaction, meeting the high sensitivity requirements necessary for identifying low parasite loads typical of early-stage infections. This level of sensitivity confirms the assay’s potential for detecting early infections and preventing further transmission.
C. Specificity Testing
As the primers were designed specifically for the LF-targeted genes, there was possibly no cross-reactivity, underscoring the assay’s high specificity to W. bancrofti DNA.
D. Reproducibility and Consistency
Repeated LAMP assay tests consistently showed high accuracy, sensitivity, and specificity. Positive and negative controls were included in each run to validate the results and demonstrate assay reliability.
E. Development of Visual Detection Mechanisms
Colorimetric detection using pH-sensitive dyes showed precise, easily interpretable results, with positive reactions indicated by a colour change of pink to yellow, enabling non-specialized users to read results directly. This visual detection is critical for field use, as it removes the need for complex instrumentation, making the assay user-friendly and accessible for healthcare professionals.
Table 2: LAMP-optimized assay results of various gene targets for the detection of W. bancrofti with spiked biological samples
S. No. Description Interpretation of Figure 3
1 rnpB
gene-specific primers, Fig. 3a i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. Negative control remains pink, confirming no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 4 pg.
2 ftsZ
gene-specific primers, Fig. 3b iv. Negative reactions are indicated in pink, and a change to yellow after 30 minutes indicates positive reactions.
v. Negative control remains pink, confirming no primer dimer formation.
vi. The limit for DNA sensitivity was confirmed to be ~ 40 pg.
3 mutM
gene-specific primers, Fig. 3c i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. Negative control remains pink, confirming no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 800 pg.
4 mraY
gene-specific primers, Fig. 3d i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. No amplification in negative control confirms no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 4 pg.
5 dapF
gene-specific primers, Fig. 3e i. Negative reactions are indicated in pink, and a change to yellow after 30 minutes of incubation indicates a sign of positive reactions.
ii. No amplification in negative control confirms no primer dimer formation.
iii. The limit for DNA sensitivity was confirmed to be ~ 80 pg.

The present study has identified and validated LF-specific genetic markers and demonstrated the feasibility of a LAMP assay for W. bancrofti detection with spiked biological samples. Laboratory validation results highlight the sensitivity, specificity, and reliability of the assay, establishing a platform for the development of prototypes and performing assay testing in field settings. By overcoming the limitations of current diagnostic methods and providing an accurate, easy-to-use test for LF in the field, this research project has the potential to significantly improve health outcomes in areas affected by LF. This new LAMP assay will provide faster and more reliable diagnosis, allowing timely treatment and developing strategies for better control of LF in low-resource settings.

8. References
1. National Centre for Vector Borne Diseases Control (https://ncvbdc.mohfw.gov.in/index4.php? lang=1&level=0&linkid=458&lid=3730)
2. MSD Manuals: Professionals version. Bancroftian and Brugian Lymphatic Filariasis. March 2019 (https://www.msdmanuals.com/en-gb/professional/infectious-diseases/nematodes-roundworms/bancroftian-and-brugian-lymphatic-filariasis)
3. World Health Organisation. Lymphatic filariasis factsheet: Epidemiology. 2019. (http://www.who.int/ lymphatic_filariasis/epidemiology/en/)
4. Thanchomnang T, Intapan PM, Tantrawatpan C, Lulitanond V, Chungpivat S, Taweethavonsawat P, Kaewkong W, Sanpool O, Janwan P, Choochote W, Maleewong W. Rapid detection and identification of Wuchereria bancrofti, Brugia malayi, B. pahangi, and Dirofilaria immitis in mosquito vectors and blood samples by high resolution melting real-time PCR. Korean J Parasitol. 2013 Dec;51(6):645-50.
5. Saeed, M., Siddiqui, S., Bajpai, P., K Srivastava, A., & Mustafa, H. Amplification of Brugia malayi DNA using Hha1 Primer as a Tool. In The Open Conference Proceedings Journal. 2014, 5 (1).
6. Mukhopadhyay, A. K., Patnaik, S. K., Babu, P. S., & Rao, K. N. M. B. (2008). Knowledge on lymphatic filariasis and mass drug administration (MDA) programme in filaria endemic districts of Andhra Pradesh, India. Journal of vector borne diseases, 45(1), 73.
7. Laney, S. J., Ramzy, R. M., Helmy, H. H., Farid, H. A., Ashour, A. A., Weil, G. J., & Williams, S. A. (2010). Detection of Wuchereria bancrofti L3 larvae in mosquitoes: a reverse transcriptase PCR assay evaluating infection and infectivity. PLoS neglected tropical diseases, 4(2), e602.
8. McCarthy, J. S., Zhong, M., Gopinath, R., Ottesen, E. A., Williams, S. A., & Nutman, T. B. (1996). Evaluation of a polymerase chain reaction-based assay for diagnosis of Wuchereria bancrofti infection. Journal of Infectious Diseases, 173(6), 1510-1514.
9. Matapo BB, Mpabalwani EM, Kaonga P, Simuunza MC, Bakyaita N, Masaninga F, Siyumbwa N, Siziya S, Shamilimo F, Muzongwe C, Mwase ET, Sikasunge CS. (2023) Lymphatic Filariasis Elimination Status: Wuchereria bancrofti Infections in Human Populations after Five Effective Rounds of Mass Drug Administration in Zambia. Trop Med Infect Dis.;8 (7):333.
10. Singh RP, Lourduraj DB, Vijayalakshmi G. (2020), A study on “clinical epidemiology of filarial lymphedema patients attending filariasis clinic in Pondicherry”, Clinical Epidemiology and Global Health, 8 (3), 915-919.
,CLAIMS:We Claim:
1. A process for detecting lymphatic filariasis (LF) infection in patients comprising loop-mediated isothermal amplification (LAMP) assay to amplify gene targets associated with LF pathogens wherein the presence of the said targets in a biological sample indicates LF infection.

2. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 1 wherein the said gene targets are as listed in Table A.

3. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 1 wherein the said gene targets are rnpB, ftsZ, mutM, mraY and dapF.

4. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 2 wherein the said gene targets are detected using primers as listed in Table B.

5. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 3 wherein the said gene targets are detected using specific primers as listed in Table 1.

6. The process for detecting lymphatic filariasis (LF) as claimed in claim 1 wherein the said pathogen is Wuchereria bancrofti, Brugia malayi or Brugia timori.

7. The process for detecting lymphatic filariasis (LF) infection in patients as claimed in claim 1 wherein the said biological sample is selected from the group consisting of blood, serum, plasma, urine, saliva, tears, stools, sputum, wound swabs, tissue biopsy samples, vaginal fluids and bodily secretions.

8. A kit for detecting pathogens causing lymphatic filariasis (LF), the said kit comprising the primers targeting LF-associated gene sequences and a reaction mixture for loop-mediated isothermal amplification (LAMP) assay.

Documents

Application Documents

# Name Date
1 202441008629-STATEMENT OF UNDERTAKING (FORM 3) [08-02-2024(online)].pdf 2024-02-08
2 202441008629-Sequence Listing in txt [08-02-2024(online)].txt 2024-02-08
3 202441008629-Sequence Listing in PDF [08-02-2024(online)].pdf 2024-02-08
4 202441008629-PROVISIONAL SPECIFICATION [08-02-2024(online)].pdf 2024-02-08
5 202441008629-POWER OF AUTHORITY [08-02-2024(online)].pdf 2024-02-08
6 202441008629-OTHERS [08-02-2024(online)].pdf 2024-02-08
7 202441008629-FORM FOR STARTUP [08-02-2024(online)].pdf 2024-02-08
8 202441008629-FORM FOR SMALL ENTITY(FORM-28) [08-02-2024(online)].pdf 2024-02-08
9 202441008629-FORM 1 [08-02-2024(online)].pdf 2024-02-08
10 202441008629-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [08-02-2024(online)].pdf 2024-02-08
11 202441008629-DECLARATION OF INVENTORSHIP (FORM 5) [08-02-2024(online)].pdf 2024-02-08
12 202441008629-Proof of Right [15-03-2024(online)].pdf 2024-03-15
13 202441008629-ENDORSEMENT BY INVENTORS [15-03-2024(online)].pdf 2024-03-15
15 202441008629-Sequence Listing in txt [23-12-2024(online)].txt 2024-12-23
16 202441008629-Sequence Listing in PDF [23-12-2024(online)].pdf 2024-12-23
17 202441008629-DRAWING [23-12-2024(online)].pdf 2024-12-23
18 202441008629-CORRESPONDENCE-OTHERS [23-12-2024(online)].pdf 2024-12-23
19 202441008629-COMPLETE SPECIFICATION [23-12-2024(online)].pdf 2024-12-23
20 202441008629-Request Letter-Correspondence [31-12-2024(online)].pdf 2024-12-31
21 202441008629-Power of Attorney [31-12-2024(online)].pdf 2024-12-31
22 202441008629-FORM28 [31-12-2024(online)].pdf 2024-12-31
23 202441008629-Form 1 (Submitted on date of filing) [31-12-2024(online)].pdf 2024-12-31
24 202441008629-Covering Letter [31-12-2024(online)].pdf 2024-12-31
25 202441008629-Proof of Right [16-01-2025(online)].pdf 2025-01-16