Sign In to Follow Application
View All Documents & Correspondence

A Process For Algal Mediated Transformation Of Sugars To Biodiesel

Abstract: The present invention provides a cost effective biotechnological process for production of bio-fuels from isolated and characterized microalgae. The algal strains used in the present invention having higher biomass, higher lipid productivity, higher pH and temperature tolerance are selected from the group consisting of Chlorella vulgaris iOC-1, Chlorella vulgaris iOC-2, Chlorella kessleri, Botrococcus bruni, Dunaliella salina and Nannochloris oculat or a combination thereof having 95-100% similarity with 18s ribosomal nucleic acids nucleotide sequences (rDNA) given for Seq. ID 1, Seq. ID 2, Seq. ID 3, Seq. ID 4, Seq. ID 5 and Seq. ID 6. The present process of bio-fuel production comprises the steps of producing lipid from green algae in bioreactors by various novel steps and extracting oil from dried algal cells and ultimately producing biodiesel by transesterification of the said extracted oil.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
12 October 2011
Publication Number
43/2014
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2019-12-06
Renewal Date

Applicants

INDIAN OIL CORPORATION LTD.
INDIAN OIL BHAVAN, 2, GARIAHAT ROAD (SOUTH), DHAKURIA, KOLKATA-700068, WEST BENGAL, INDIA

Inventors

1. MAHENDRA PRATAP SINGH
INDIAN OIL CORPORATION LTD., RESEARCH & DEVELOPMENT (R&D) CENTRE, SECTOR-13, FARIDABAD-121007, HARYANA, INDIA
2. MANOJ KUMAR
INDIAN OIL CORPORATION LTD., RESEARCH & DEVELOPMENT (R&D) CENTRE, SECTOR-13, FARIDABAD-121007, HARYANA, INDIA
3. DHEER SINGH
INDIAN OIL CORPORATION LTD., RESEARCH & DEVELOPMENT (R&D) CENTRE, SECTOR-13, FARIDABAD-121007, HARYANA, INDIA
4. DEEPAK KUMAR TULI
INDIAN OIL CORPORATION LTD., RESEARCH & DEVELOPMENT (R&D) CENTRE, SECTOR-13, FARIDABAD-121007, HARYANA, INDIA
5. RAVINDER KUMAR MALHOTRA
INDIAN OIL CORPORATION LTD., RESEARCH & DEVELOPMENT (R&D) CENTRE, SECTOR-13, FARIDABAD-121007, HARYANA, INDIA

Claims

1. A process for producing bio-fuels, comprising: selecting a microalgae or a combination thereof having 95-100% similarity with 18s ribosomal nucleic acids nucleotide sequences (rDNA) given for Seq. ID 1, Seq. ID 2, Seq. ID 3, Seq. ID 4, Seq. ID 5 and Seq. ID 6. - obtaining high cell density of microalgae by culturing the said microalgae heterotrophically at pH and temperature conditions suitable to inhibit growth of undesired microbes and to obtain lipid with less unsaturated fatty acids. - extracting oil from the harvested algal cells to produce biodiesel.

2. The process as claimed in claim 1, wherein pH value is maintained between 5.0 and 9.0 and the temperature is maintained between 10 to 60 °C.

3. The process as claimed in claim 1, wherein said cell-density is between 11 to 24 g/L (dry cell weight basis) and 100-200g/l (wet weight basis).

4. The process as claimed in claim 1, wherein the oil content ranges from 22-58% dry cell weight.

5. The process as claimed in claim 1, wherein the culture medium comprises of at least one carbon source , one nitrogen source and one phosphorus source.

6. The process as claimed in claim 5, wherein the carbon source is selected from a group comprising of pentoses, hexoses sugar or other monosaccharide, disaccharides and polyschharides

7. The process as claimed in claim 5, wherein the concentration of said at least one of hexoses or pentoses or other monosaccharides, disaccharides, and polysaccharides, in bioreactor is controlled between 0.01 and 100 g/L.

8. The process as claimed in claim 5, wherein the source of carbon is selected from the group consisting of pure sugar(s), hydrolysates of corn starch, wheat flour, hydrolysate of lignocellulosic biomass along with , organic waste water streams like sewage treatment plant, wasterwater from crude oil refining industry containing hydrocarbons , water from distillery.fruit processing industrydairy industry,, molasses,and organic material etc.

9. The process as claimed in claim 5, wherein the nitrogen selected from the group consisting of glycine, yeast powder, yeast extract, peptone, ammonium chloride, urea, KNO3, ammonium nitrate, ammonia, or corn syrup and nitrogen containing compounds present in said wastewater stream.

10. The process as claimed in claim 1, wherein initial inoculum for heterotrophic growth is preferably prepared under phototrophic conditions and then inoculated in a bioreactor maintained under heterotrophic condition.

11. The process as claimed in claim 10, wherein amount of inoculum in the bioreactor is between 0.01% and 50% by volume, preferably 20%.

12. The process as claimed in claim 1, wherein the medium in reactor is agitated with a speed of between 5 to 1,000 rpm, preferably 700 rpm.

Specification

FIELD OF THE INVENTION
[001] The present invention is related to the field of biofuel. More particularly, the present invention is directed to a process for the production of lipids suitable for biofuel production from microalgae by heterotrophic cultivation.
BACKGROUND OF THE INVENTION
[002] The need of energy is increasing continuously, because of increase in
industrialization and population. The basic sources of this energy are petroleum, natural gas, coal, hydro and nuclear. The major disadvantage of using petroleum based fuels is atmospheric pollution created by the use of petroleum diesel. Petroleum diesel combustion is a major source of greenhouse gas (GHG). Apart from these emissions, petroleum diesel is also major source of other air contaminants including NOx, SOx, CO, particulate matter and Volatile Organic Compounds (VOC).
[003] Biomass is one of the better sources of energy. Large-scale introduction of
biomass energy could contribute to sustainable development on several fronts, environmentally, socially and economic. Bio-diesel (monoalkyl esters) is one of such alternative fuel, which is obtained by the transesterification of triglyceride oil with monohydric alcohols. Biodiesel fuel can be prepared from waste cooking oil, such as palm, soybean, canola, rice bran, sunflower, coconut, corn oil, fish oil, chicken fat and algae which would partly decrease the dependency on petroleum-based fuel.
[004] Macroalgae has also been used in the production of biodiesel. Microalgae with
higher oil content than plants are known and they are faster and easier to grow. Microalgae can provide several different types of renewable biofuels. These include methane produced by anaerobic digestion of the algal biomass, biodiesel derived from microalgal oil and photobiologically produced biohydrogen. The idea of using microalgae as a source of fuel is not new but it is now being taken seriously because of the extinguishing petroleum resources and, more significantly, the emerging concern about global warming that is associated with burning fossil fuels.
[005] Microalgae comprise a vast group of unicellular photosynthetic, heterotrophic
organisms which have an extraordinary potential for cultivation as energy crops. Microalgae are

the great source of many highly valuable products such as polyunsaturated fatty acids, astaxanthin and bioactive compounds.
[006] Microalgae can be grown in two different modes: Photoautotrophic and
Heterotrophic mode of growth. Large-scale production of these products, however, has hindered by an ability to obtain high cell densities and productivities in photoautotrophic systems because of light penetration issues and uncontrolled growth conditions. High cell density processes suitable for heterotrophic cultures of microalgae may provide an alternative means for large-scale production of algal products of high value. The heterotrophic growth of algae holds many practical applications in industrial scale especially in a controlled manner to obtain highest biomass as well as lipid productivity.
[007] In heterotrophic conditions algae can be grown on organic carbon sources, such as
sugars and organic acids, . This mode of culture eliminates the requirement for light and therefore, offers the possibility of greatly increased cell density and productivity. Some microalgae show rapid heterotrophic growth. Heterotrophic algal cultivation has been reported to provide not only a high algal biomass productivity, but high cellular oil content as well. Addditionally the culture suffers from the contamination by undesired microbes . However, to date, the very few reports of such processes for microalgal cultivation have mostly been on lab-scale work/plant scale.
[008] Xu et al 2006 (Han Xu, Xiaoling Miao and Qingyu Wu High quality biodiesel
production from a microalga Chlorella protothecoides by heterotrophic growth in fermenters. Journal of Biotechnology Volume 126, Issue 4, 1 December 2006, Pages 499-507) discussed high quality biodiesel production from a microalga Chlorella protothecoids through the technology of transesterification. The technique of metabolic controlling through heterotrophic growth of C. protothecoides was applied, and the heterotrophic C. protothecoides contained the crude lipid content of 55.2%. To increase the biomass and reduce the cost of alga, corn powder hydrolysate instead of glucose was used as organic carbon source in heterotrophic culture medium in fermenters. The result showed that cell density significantly increased under the heterotrophic condition, and the highest cell concentration reached 15.5 g L-l. Large amount of microalgal oil was efficiently extracted from the heterotrophic cells by using n-hexane, and then transmuted into biodiesel by acidic transesterification. The biodiesel was characterized by a high

heating value of 41 MJ kg-1, a density of 0.864 kg L-l, and a viscosity of 5.2 * 10-4 Pa s (at 40 °C). The method has great potential in the industrial production of liquid fuel from microalga.
[009] Li et al. 2007 reported ( Li XF, Xu H, Wu QY (2007) Large-scale biodiesel
production from microalga Chlorella protothecoides through heterotrophic cultivation in bioreactors. Biotechnol Bioeng 98:764-771) an integrated approach of biodiesel production from heterotrophic Chlorella protothecoides focused in bioreactors. Through substrate feeding and fermentation process controls, the cell density of C. protothecoides achieved 15.5 gL-1 in 5 L, 12.8 gL-1 in 750 L, and 14.2 g L-1 in 11,000 L bioreactors, respectively. Resulted from heterotrophic metabolism, the lipid content reached 46.1%, 48.7%, and 44.3% of cell dry weight in samples from 5 L, 750 L, and 11,000 L bioreactors, respectively.
[010] Liang et al (2009) reported (Liang Y, Sarkany N, Cui Y 2009 Biomass and lipid
productivities of Chlorella vulgaris under autotrophic, heterotrophic and mixotrophic growth conditions. Biotechnology Letters Jul;31(7): 1043-9) biomass and lipid productivities of Chlorella vulgaris under different growth conditions. While autotrophic growth did provide higher cellular lipid content (38%), the lipid productivity was much lower compared with those from heterotrophic growth with acetate, glucose, or glycerol. Optimal cell growth (2 g 1(-1)) and lipid productivity (54 mg 1(-1) day(-l)) were attained using glucose at 1% (w/v) whereas higher concentrations were inhibitory. Growth of C. vulgaris on glycerol had a similar dose effects as those from glucose. Overall, C. vulgaris is mixotrophic.
[011] US patent application 2009/0211150A1 discloses a method to produce biodiesel
from algae using a strain of microalga chlorella protothecoids, by screening a specific strain with characteristics of high yield of biomass and high oil content, cultivating the screened strain for high-cell-density growth for up to 108 grams of dry cell weight per liter of the suspension in a bioreactor using solutions containing carbohydrates as feed, harvesting and drying the high density cultivated algal cells to extract oil from the dried algal cells, and producing the biodiesel by catalyzed transesterification using the extracted oil as feedstock.

In the prior art few microalgal strains have been cultured to produce lipids for biodiesel. However, lipids produced from these microalgal strains are mostly rich in unsaturated fatty acids which makes them unsuitable for biodiesel production. Therefore, there exists a need to have increased saturated fatty acids content in lipids from micro-algal strain with higher biomass oil content using various cheap carbon sources for cultivation which ultimately makes the process more cost effective and applicable in terms of its industrial success. OBJECT OF THE INVENTION
[012] The principal object of the present invention is to provide a process to produce suitable lipids from heterotrophic cultivation of microalgae for biodiesel.
[013] Another object is to provide a process where lipids are produced from microalgal strain with higher biomass and oil content.
[014] Yet another object of the invention is to provide a process where lipids is produced from the microalgae which can withstand high temperature and high pH.
[015] Still another object of the invention is to provide a process for production of bio-fuel where the microalgae is fed cheap source of carbohydrates like wheat flour, hydrolysate of lignocellulosic biomass, organic waste water streams like sewage treatment plant, water from distillery, fruit processing industry, dairy industry etc.
SUMMARY OF THE INVENTION
[016] Accordingly, the present invention provides a novel and cost effective method to
produce oil feedstock for the production of biofuel by heterotrophic growth of green microalgae in a bioreactor. The process of the present invention comprises the steps of isolation of high oil producing green algae with characteristics of high yield of biomass and high oil content; screening of the same for heterotrophic growth, inoculating the strain in a bioreactor for algal-seed-cells cultivation; transferring the cultivated algal-seed-cells into a second bioreactor for high-cell-density cultivation; feeding a second solution containing carbohydrates into the second bioreactor; harvesting the high density cultivated algal cells from the second bioreactor; drying the high density cultivated algal cells; extracting oil from dried algal cells; and producing the

biodiesel by reaction of transesterification using the extracted oil as feedstock or using the biomass for gasification, fermentative biohydrogen, bioethanol, and biomethane production. The high-cell-density cultivation of the present invention further comprises heterotrophic cultivation of Chlorella vulgaris, C. kessleri, Botrococcus bruni, Dunaliella salina and Nannochloris oculata high oil content, preferably up to 58% dry cell weight. The carbohydrates solutions include but not limit to glucose or other monosaccharides, and/or disaccharides, or polysaccharides preferably with the concentration of glucose or other monosaccharides, disaccharides, polysaccharides, or hydrolysates of corn starch, wheat flour, hydrolysate of lignocellulosic biomass e.g. cheaper lignocellulosic biomass belonging to Lemna, baggase, sugar cane top, pine needle, wheat straw, rice straw etc, organic waste water streams like sewage treatment plant, water from distillery and fruit processing industry, dairy industry containing organic sugars, mollassses preferably with concentration of the carbohydrates solutions being controlled between 0.01 and 100 gL.sup.-l.
DETAILED DESCRIPTION OF THE INVENTION
[017] The present invention comprises the steps of isolation of high oil producing green
alga with characteristics of high yield of biomass and high oil content; screening of the same for heterotrophic growth, inoculating the strain in a bioreactor for algal-seed-cells cultivating; transferring the cultivated algal-seed-cells into a second bioreactor for high-cell-density cultivation; feeding a second solution containing carbohydrates into the second bioreactor; harvesting the high density cultivated algal cells from the second bioreactor; drying the high density cultivated algal cells; extracting oil from dried algal cells; and producing the biodiesel by reaction of transesterification using the extracted oil as feedstock or using the biomass for gassification, fermentative biohydrogen, bioethanol, and biomethane production.
[018] The algal strains used for the process are Chlorella vulgaris iOC-1, Chlorella
vulgaris iOC-2, Chlorella kessleri, Botrococcus bruni, Dunaliella salina and Nannochloris oculat or combination thereof. The said algae can be grown separately as well as in different combination providing better yield in terms of biomass and lipid content/composition..These algal strains have been well characterized by their 18s ribosomal nucleic acids. The partial

genomic DNA sequences shows 95% to 100% sequence identities to the nucleic acid sequences selected from the group consisting of Seq. ID I, Seq. ID 2, Seq. ID 3, Seq. ID 4, Seq. ID 5 and Seq. ID 6. and the algal strains shows higher temperature tolerance up to 52°C.
[019] The source of carbohydrates fed in the bioreactor selected from the group
consisting of pure sugar(s), hydrolysates of corn starch, wheat flour, hydrolysate of lignocellulosic biomass, organic waste water streams like sewage treatment plant, water from distillery and fruit processing industry, dairy industry containing organic sugars, molasses etc. The process of the present invention optionally comprises feeding of nitrogen into the bioreactor. The nitrogen is organic nitrogen which may be selected from the group consisting of glycine, yeast powder, yeast extract, peptone, ammonium chloride, urea, KNO3, Ammonium nitrate, ammonia, or corn syrup.
[020] feeding of phosporus into the bioreactor. The phosporus used in the bioreactor
may be selected from the group consisting of di-ammonuim phosphate, K2HPO4 or KH2PO4.
Isolation of Specific algae:
[021] Soil and water samples were collected from different locations e.g. Effluent
treatment plant (ETP), Yamuna River, Agra, agricultural soil. The water and soil sample were inoculated in 0.8% agar medium was prepared using media containing KH.sub.2PO.sub.4: 0.7 g/L, K.sub.2HPO.sub.4: 0.3 g/L, MgSO.sub.4.7H.sub.20: 0.3 g/L, FeSO.sub.4.7H.sub.20: 3 mg/L, Glycine: 0.1 g/L, vitamin B.sub.l: 0.01 mg/L, A5 trace mineral solution 1.0 ml/L, wherein the A5 trace mineral solution comprises H.sub.3BO.sub.3, Na.sub.2Mo0.sub.4.2H.sub.20, ZnSO.sub.4.7H.sub.20, MnCl.sub.2.4H.sub.20, and CuSO.sub.4.5H.sub.20. A preferred A5 trace mineral solution comprises:H.sub.3BO.sub.3: 2.86 g/L, Na.sub.2Mo0.sub.4.2H.sub.20: 0.039 g/L,ZnSO.sub.4.7H.sub.20: 0.222 g/L, MnCl.sub.2.4H.sub.20: 1.81 g/L, CuSO.sub.4.5H.sub.20: 0.074 g/L. 1 g L-l peptone, 2 g L-l yeast extract, 4 g L-l glucose, and antibiotics including ampicillin (sodium form), streptomycin sulfate, and kanamycin sulfate (100 mg L-l each). After inoculation, the plates were wrapped and stored at 26°C for 2-5 days. Single green colonies were picked and carefully transferred to a new plate. The purified colonies

are selectively picked up and inoculated into flasks containing growth medium including but not limiting to components of basal medium under light conditions, for further culture .
Screening for heterotrophic growth:
[022] The micro-algal strains were inoculated into a 500-mL Erlenmeyer flasks
containing 100-mL medium at 28 °C under continuous shaking at 180 rpm. Glucose with a concentration of 30 g/L and yeast extract with a concentration of 4 g/L are added into the basal medium. The heterotrophic media was incubated in the dark. The cell growth rates and cellular oil contents in different culture are then compared with each other to determine a specific strain with characteristics of the highest oil content and a high cell growth rate. The selected strain having ability to utilize sugar as carbon source and grow in heterotrophic conditions were selected for evaluation of their pH tolerance, temperature tolerance, ability to grow in wastewater, ability to grow in presence of different contaminants like hydrocarbon, heavy metals etc and strains having ability to grow in stringent condition with high cell density and higher lipid accumulation were selected for further study.
Identification and characterization of algal strains:
[023] The selected algal strains were identified by their physiological, morphological
characteristics. The 18S rRNA gene sequences as well as some specific morphological characteristics have been extensively studied by the present inventors. The resulting 18S rRNA gene sequences were aligned insilico and compared to the nucleotide sequences of some known
microalge in GenBank database of the National Center for Biotechnology Information by using
® Basic Local Alignment Search Tool (BLAST ).
The partial genomic DNA sequences shows 95% to 100% sequence identities to the nucleic acid sequences selected from the group consisting of Seq. ID 1, Seq. ID 2, Seq. ID 3, Seq. ID 4, Seq. ID 5 and Seq. ID 6.
Algal-Seed-Cells Cultivation
[024] The autotrophically grown cells of selected strain inoculated in the bioreactor
aseptically containing culture medium for algal-seed-cells cultivation. The components of basal culture medium are: (mg/1 ) Glucose - 9000, KN03 - 1011.1, NaH2P04.H20 - 621,

Na2HP04.2H20 - 89, MgS04.7H20 - 246.5, EDTA - 9.3,H3B03 - 0.061, CaCl2.2H20 - 14.7, FeS04.7H20 - 6.95, ZnS04.7H20 - 0.287, MnS04.H20 - 0.169, (NH4)6Mo7024.4H20 - 0.01235, CuS04.5H20 - 0.00249, 1 g L-l peptone, 2 g L-l yeast extract, 4 g L-l glucose, and antibiotics including ampicillin (sodium form), streptomycin sulfate, and kanamycin sulfate (100 mg L-l each).The bioreactor was operated 28°C in dark at 480 rpm. The pH maintained for pH range 6-7 and sampling was done every day to estimate the dry cell weight, chlorophyll content and lipid content regularly. Algal cell yield can be determined using various methods, including but not limiting to light intensity measurement of the cell suspension, such as OD540 nm of cell suspension. Preferable conditions such as glucose concentration, different nitrogen sources in the basal medium, temperatures, and shaking rate during algal-seed-cells cultivation in shaking flasks are determined by real-time light intensity measurement of the cell suspension. A preferable glucose concentration in a range of 2 to 40 g/L glucose is added in the basal medium. A preferable yeast extract in a range of 05 to 15 g/L yeast extract is added in the basal medium. A temperature in incubator is set between 10-50 °C, preferably at 30 °C. The shaking rate is controlled between 50 to 700 rpm, preferably at 300 rpm. The cells are harvested till the culture of algal seed cell enters into late-exponential-phase. The cell harvesting time before reaching the late exponential-phase is approximately at 120 hours.
High-Cell-Density Cultivation
[025] The late-exponential-phase algal-seed-cells in the small bioreactor are transferred
to a second bioreactor of 200 L containing 150 L media, for high-cell-density cultivation by process control and optimization. Glucose and yeast extract solutions are added into the basal culture medium initiate in the second bioreactor, preferably with 2 to 80 g/L glucose and 0.5 to 15 g/L yeast extract, further preferably with 45 g/L glucose and 6 g/L yeast extract. Parameters, such as the amount of inoculum, substrate (organic carbon and nitrogen) feeding, oxygen supply, stirring rate, temperature, pH, and time of cell harvest, and adjusted to optimize cell growths in the second bioreactor. Among the parameters, dissolved oxygen (DO) in the fermentation suspension for high-cell-density cultivation of heterotrophic algal cells in the bioreactor can be used to monitor the growth conditions, such as organic carbon sources in the reactor, biomass and accumulation of lips. On-line monitoring of the DO parameter is preferably used to monitor the growth conditions, and to adjust agitation speed and aerating rate. The carbohydrates

solutions include but not limit to glucose or other monosaccharides, and/or disaccharides, or polysaccharides, preferably with the concentration of glucose or other monosaccharides, disaccharides, polysaccharides, or hydrolysates of corn starch, wheat flour, hydrolysate of lignocellulosic biomass, organic waste water streams like sewage treatment plant, water from distillery and fruit processing industry, dairy industry containing organic sugars, molasses preferably with concentration of the carbohydrates solutions being controlled between 0.01 and 100gL.sup.-l.
[026] The conditions for high-cell-density heterotrophic cultivation of the different
strains were automatically monitored and set as follows:
Inoculum amount of seed algal cells (V/V): 10-30%, preferably of 20%;
Temperature at 15-52 °C, preferably at 30±.0.5°C; Aeration 100-200 L/h
(l:lwm), preferably at 180 L/h;
pH 6.0 to 9.0, preferably at 6.3.±.0.1;
Concentration of glucose in medium: 20 g/L; DO over 20% controlled by increasing agitation and airflow, gradually increasing agitation speed from 100 to 600 rpm after a period of cultivation for about 88 hours, to maintain the dissolved oxygen at above 20% of saturation;
[027] When the cell density and/or the oil content reach desired values, preferably with the dry cell density reaching 24 g/L and the oil content reaching 58% of dry cell weight, the growth of the cells in the second reactor is terminated. The growth duration in said second bioreactor lasts about 120 hours.
The extreme conditions of pH and high temperature provide an advantage of inhibiting the growth of undesired microbes and obtaining less unsaturated fatty acids.
Harvesting the High Density Microalgal Cells from Bioreactor
[028] After determining a sample of the high-cell-density heterotrophic cultivation to
reach a desired dry biomass concentration, preferable between 12 to 24g/L, dry biomass of the algal cell suspension from bioreactor is separated using a separation process, including but not

limited to flocculation, filtration or centrifuge. The separated dry biomass may be in a form of powder or other solid forms.
Extracting the Oil from Dried Algal Cells
[029] Lipids (oil) in heterotrophic cell powder are subsequently extracted by any well
known solvent extraction methodology, e.g. the Soxhlet method, wherein N-hexane is used as
the standard Soxhlet solvent for extracting oil from cells.. Extraction is achieved by washing the
cells repeatedly with pure solvent until no lipid is left in cells. Then the solvent in the extract is
removed under reduced pressure. In an embodiment the selected microalgae was cultivated at
temperature as high as 40-50 °C. The lipid extracted from the algae on analysis for fatty acid
composition were found to have more than 70% fatty acids saturated as compared to only 40% at
30 °C for the same algae.
The selected algae have the ability to grow at extreme pH i.e., pH 5-9 and at temperature as high as upto 52 degree C.
Producing the Biodiesel from Microalgal Oil
[030] These extracted microalgal oil can then be converted into biodiesel by known
methods of transesterification, e.g. the enzymatic transeterification and/or acids and/or base
catalyst.
EXAMPLE
Isolation and selection of heterotrophic algal strains
[031] In the present invention, the soil and water samples were collected from Effluent
Treatment Plant (ETP) of hydrocarbon processing industry . The collected water and soil
samples were inoculated in 0.8% agar medium. The preparation was made using media
containing KH2.sub.2PO.sub.4: 0.7 g/L, K.sub.2HPO.sub.4: 0.3 g/L, MgSO.sub.4.7H.sub.20:
0.3 g/L, FeSO.sub.4.7H.sub.20: 3 mg/L, Glycine: 0.1 g/L, vitamin B.sub.l: 0.01 mg/L, A5 trace
mineral solution 1.0 ml/L, wherein the A5 trace mineral solution comprises H.sub.3BO.sub.3,
Na.sub.2Mo0.sub.4.2H.sub.20, ZnSO.sub.4.7H.sub.20, MnCl.sub.2.4H.sub.20, and
CuSO.sub.4.5H.sub.20. A preferred A5 trace mineral solution comprises:H.sub.3BO.sub.3: 2.86
g/L, Na.sub.2Mo0.sub.4.2H.sub.20: 0.039 g/L,ZnSO.sub.4.7H.sub.20: 0.222 g/L,

MnCl.sub.2.4H.sub.20: 1.81 g/L, CuSO.sub.4.5H.sub.20: 0.074 g/L. 1 g L-l peptone, 2 g L-l yeast extract, 4 g L-l glucose, and antibiotics including ampicillin (sodium form), streptomycin sulfate, and kanamycin sulfate (100 mg L-l each). After inoculation, the plates were wrapped. and stored at 26°C for 2-5 days. Single green colonies were picked and carefully transferred to a new plate. The purified colonies are selectively picked up and inoculated into flasks containing growth medium, including but not limited to components of basal medium, for further culture.
[032] The selected algal strains were characterized according to their 18S rRNA gene
sequences, as well as some morphological characteristics. Six algae having six different
sequences for 18S rRNA gene were obtained. These sequences were named as Seq ID1, Seq ID2,
Seq ID3, Seq ID4, Seq ID5, Seq ID6. Seq. ID 1 represents DNA sequence of Chlorella vulgaris
IOC-1 18S ribosomal RNA gene; Seq. ID 2 represents DNA sequence of Chlorella vulgaris
IOC-2 18S ribosomal RNA gene; Seq. ID 3 represents DNA sequence of Chlorella kessleri 18S
ribosomal RNA gene; Seq. ID 4 represents DNA sequence of Botryococcus braunii 18S
ribosomal RNA gene; Seq. ID 5 represents Dunaliella salina 18S ribosomal RNA gene and Seq.
ID 6 represents Nannochloris oculata 18S small subunit ribosomal RNA gene.
[033] The resulting 18S rRNA gene sequences were aligned and compared to the
nucleotide sequences of some known microalge in GenBank database of the National Center for Biotechnology Information by using Basic Local Alignment Search Tool (BLAST®). Five potential culture having ability to grow in hetrotrophic conditions and accumaute high lipid content and higher biomass was identified as Chlorella vulgaris, Chlorella kessleri, Botrococcus brunii, Dunaliella salina and Nannochloris oculata.
Heterotrophic growth in bioreactor:
[034] The selected strain inoculated in the bioreactor aseptically containing culture
medium for algal-seed-cells cultivation. The components of basal culture medium are: (Mg/1) Glucose - 9000, KN03 - 1011.1, NaH2P04.H20 - 621, Na2HP04.2H20 - 89, MgS04.7H20 -246.5, EDTA - 9.3,H3B03 - 0.061, CaCl2.2H20 -14.7, FeS04.7H20 - 6.95, ZnS04.7H20 - 0.287, MnS04.H20 - 0.169, (NH4)6Mo7024.4H20 - 0.01235, CuS04.5H20 - 0.00249, 1 g L-l peptone, 2 g L-l yeast extract, 4 g L-l glucose, and antibiotics including ampicillin (sodium form), streptomycin sulfate, and kanamycin sulfate (100 mg L-l each).The bioreactor was operated

28°C in dark at 480 rpm. The pH maintained for pH range 6-7 and sampling was done every day to estimate the dry cell weight, chlorophyll content and lipid content regularly. Algal cell yield can be determined using various methods, including but not limiting to light intensity measurement of the cell suspension, such as OD540 nm of cell suspension. Preferable conditions such as glucose concentration, different nitrogen sources in the basal medium, temperatures, and shaking rate during algal-seed-cells cultivation in shaking flasks are determined by real-time light intensity measurement of the cell suspension. A preferable glucose concentration in a range of 2 to 40 g/L glucose is added in the basal medium. A preferable yeast extract in a range of 05 to 15 g/L yeast extract is added in the basal medium. A temperature in incubator is set between 10-50°C, preferably at 30°C. The shaking rate is controlled between 50 to 700 rpm, preferably at 300 rpm. The cells are harvested till the culture of algal seed cell enters into late-exponential-phase. The cell harvesting time before reaching the late exponential-phase is approximately at 168 hours.
[035] The late-exponential-phase algal-seed-cells in the small bioreactor are transferred
to a second bioreactor of 200 L containing 150 L media, for high-cell-density cultivation by process control and optimization. Glucose and yeast extract solutions are added into the basal culture medium initiate in the second bioreactor, preferably with 2 to 80 g/L glucose and 0.5 to 15 g/L yeast extract, further preferably with 45 g/L glucose and 6 g/L yeast extract. Parameters, such as the amount of inoculum, substrate (organic carbon and nitrogen) feeding, oxygen supply, stirring rate, temperature, pH, and time of cell harvest, and adjusted to optimize cell growths in the second bioreactor. Among the parameters, dissolved oxygen (DO) in the fermentation suspension for high-cell-density cultivation of heterotrophic algal cells in the bioreactor can be used to monitor the growth conditions, such as organic carbon sources in the reactor, biomass and accumulation of lips. On-line monitoring of the DO parameter is preferably used to monitor the growth conditions, and to adjust agitation speed and aerating rate. The carbohydrates solutions include but not limit to glucose or other monosaccharides, and/or disaccharides, or polysaccharides, preferably with the concentration of glucose or other monosaccharides, disaccharides, polysaccharides, or hydrolysates of corn starch, wheat flour, hydrolysate of lignocellulosic biomass, organic waste water streams like sewage treatment plant, water from distillery and fruit processing industry, dairy industry containing organic sugars, mollassses

preferably with concentration of the carbohydrates solutions being controlled between 0.01 and 100gL.sup.-l.
[036] The conditions for high-cell-density heterotrophic cultivation of the different
strains were automatically monitored and set as follows:
Inoculum amount of seed algal cells (V/V): 20%;
Temperature at 30.+-.0.5. °C
Aeration 180 L/h;
pH 7.3.±.0.1;
Concentration of glucose in medium: 20% (w/v) DO over 20% controlled by increasing agitation and airflow, gradually increasing agitation speed from 100 to 600 rpm after a period of cultivation for about 88 hours, to maintain the dissolved oxygen at above 20% of saturation;
[037] When the cell density and/or the oil content reach desired values, preferably with
the dry cell density reaching24g/L and the oil content reaching 41% of dry cell weight, the growth of the cells in the second reactor is terminated. The growth duration in said second bioreactor lasts about 120 hours. Cell growth is measured by the absorbance of the suspension at 540 nm and dry cell weight. 1.5 ml of algal culture was taken in pre-weighed Eppendorf tubes, centrifuged at 8000 rpm for 5 minutes. The supernatant media was removal using micropipette and the algae pellet at the bottom was dried at 105°C until the constant weight was achieved. The dry weight of algae biomass was determined gravimetrically and growth was expressed in terms of dry weight. Lipid measurements were made by using a mixture of methanol, chloroform, and water. A culture sample is collected at three points during the experiments for lipid analysis. The culture sample is centrifuged at 3,500rpm for 10 minutes in a large (200ml) plastic centrifuge tube; the pelleted cells along with 35ml of supernatant are then transferred to a plastic centrifuge tube (45ml) to be re-centrifuged again at 5000rpm for 10 minutes. The supernatant is removed by pipette. The pellet is then resuspended with 4ml of DI H2O, then 10ml of methanol and 5ml of chloroform is added, resulting in a 10:5:4 ratio of methanol: chloroform : water. At this ratio, all solvents are miscible and form one layer. After overnight extraction on a shaker table, 5ml of water and 5ml of chloroform are added which results in a 10:10:9 ratio of methanol: chloroform

: water. Tubes are centrifuged for 10 minutes at 5000rpm. At this solvent ratio, two layers are formed, a water methanol upper layer and chloroform lower layer. The chloroform lower layer which contains the extracted lipids is then removed by Pasteur pipette and placed into a pre-weighed vial. After the first extraction, 10ml of additional chloroform is added to conduct a second extraction. The additional 10ml of chloroform again results is a 10:10:9 methanol : chloroform : water ratio and two layers are formed. The tube is centrifuged at 3,500rpm for 10 minutes, and the lower chloroform layer is removed by Pasteur pipette and placed into another pre-weighed vial. The chloroform is evaporated by heating in a 55°C water bath under a constant stream of nitrogen gas. After 1 hour in a 105°C oven, vials are weighed again. The weight difference represents weight of lipids extracted from the culture sample. The extracted lipid was analysed by gas chromatography as per method described in prior art. The lipid showed fatty acid suitable for biodiesel production.


SEQ ID 1 to 6 : [038]. SEQ1
>Chlorella vulgaris for 18S ribosomal RNA strain: IOC-1
TTTC^TTCAMTrrCTGCCCTATCMCTTTrGATGGTAGGATAGAGGCCTACCATGGTGGTAACGGGTG
ACGGAGGATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGC
AGGCGCGCAMTTACCCMTCCTGA<^CAGGGAGGTAGTGAD\ATAAATAACAATACTGGGCCCGATCA
GGTCTGGTMTTGGMTGAGTACMTCTAMCCCC1TAACGAGGATCAATTGGAGGGCAAGTCTGGTGC
C^GCAGCCGCGGTMTTCC^GCTCCMTAGCGTATATTTMGTrGCTG(^GTTAAAMGCTCGTAGTTG
GATTTCGGGTGGGACCTGCCGGTCCGCCGTTTCGGTGTGCACTGGC^GGGCrC^CCTTGTTGCCGGGG
ACGGGCTCCTGGGOT(^CTGACCGGGACTCGGAGTCGGCGCTGTTAaTTGAGTAAATTAGAGTGTT
CAMGCAGGCCTACGCrCTGMTACATTAG^TGGMTMCACGATAGGACTCTGGCCTATCCT
TCTGTAGGACCGGAGTAATGATTAAGAGGGACAGTCGGGGGCATTCGTATTTCATTGTCAGAGGTGAA
ATTCTTGGATTTATGAMGACGMCTACTGCGAMGCATTTGCO^GGATGTTTTCATTMTCMGTCC
GCGAGTTGGGGGCTCGAAGACGATTAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACTAGGGAT
CGGCGGATGI MCI ICGATGACTCCGCCGGCACCTTATGAGAAATCAAAGI 11 11GGGTTCCGGGGGG
AGTATGGTCGO\AGGCTGAMCTTAMGGMTTGACGGMGGGCACCACCAGGCGTGGAGATTCTGGC
TTMTTTGACTCM<^CGGGAAMaTAC(^GGTC<^^
TTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGGTTGCCTTGTCAGGTTGATTCC
GGTAACGAACGAGACCTCAGCCTGCTAAATAGTCACGGTTGGTTCGCCAGCCGGCGGACI ICI I'AGAG
GGACTATTGGCGACTAGCCMTGGMGC^TGAGGCTATMCAGGTCTGTGATGCCCTTAGATGTTCTGG
GCCGCACGCGCGCTACACTGATG(^TTO^CGAGATTAGCCTTGGCCGAGAGGCCCGGGTMTCTTCG
AAACTGCATCGTGATG
[039]. SEQ 2
>Chlorella vulgaris for 18S ribosomal RNA strain: IOC-2
AAMGGCCGACCGGGOTCTGCCCGACTCGCGGTGMTCATGATMCTTCACGMTCGCATGGCCTTGT
GCCGGCGATGI I I CI I ICAMTTTCTGCCCTATCMCTTTTGATGGTAGGATAGAGGCCTACCATGGTG
GTMCGGGTGACGGAGGATTAGGGTTCGATrCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAA
GGMGG(^G(^GGC^CGCAMTTACCCMTCCTGACACAGGGAGGTAGTGACMTAMTAACAATACTG
GGCOTGTCAGGTCTGGTMTrGGMTGAGTACMTCTAMCCCaTAACGAGGATCAATTGGAGGGCA
AGTCTGGTGC^GC^GCCGCGGTMmCAGCTCCMTAGC^
CTCGTAGTTGGATTTCGGGTGGGACCTGCCGGTCCGCCGTrrCGGTGTGCACTGGC^GGGCTCACCTT
GTTGCCGGGGACGGGCTCCTGGGCTTCACTGTCCGGGACTCGGAGTCGGCGCTGTTACTTTGAGTAAA
TTAGAGTGTTO\MGCAGGCCTACGCTCTGMTACATTAGCATCGMTMC^CGATAGGACTCTGGC^^
ATCCTGTTGGTCTGTAGGACCGGAGTMTGATTMGAGGGAC^GTCTGGGGCATTCGTATTTGATTGTC
AGAGGTGAMTTCTTGGATTOTGAMGACGMCTACTGCCCTAGC^^
ATCMGMCGAMGTTGGGGGCTCGMGACGATTAGATACCGTCCTAGTCTCAAGCATAAACGATGCCG
ACTAGGGATCGGCGGATGI MCI ICGATGACTCCGCCGGCACCTTATGAGATATCAAAGI I I I IAGCTT
CCGGGGGGAGTATGGTCGO\AGGCTGAMCTTAAAGGAATTGACGGAAGGGCACCACCAGGCGTGGAG

CCTGCGGCTTMGGAGACTCMCACGGGAAMCTTACGAGGTCCAGAC^TAGTGAGGATTGACAGATTG AGAGCTCI MCI IGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGGTTGCCTTGTCAGG TTGATTCCGGTMCGMCGAGACCT^GCCTGCTAMTAGTCACGGTTGGTTCGCCAGCCGGCGGACTT CTTAGAGGGAAATGCCTAGTAAGCGC
[040]. SEQ3
>Chlorella kessleri 18S ribosomal RNA
CGTAMTCCCGACTTCTGGMGGGACGTATTTATTAGATTTAAGGCCGACCCGGCTCTGCCGGTCTCGC
GGTGMTC^TGATMCTTCACGAATCGCATGGCCTTGCGCCGGCGATGTTTCATTCI I I 11 ICTGCCCT
ATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTGGTAACGGGTGACGGAGGATTAGGGTrCGAT
TCCGGAGAGGGAGCCTGAGAMCGGCTACCACATCCAAGGAAGCCAGCAGGCGCGCAAATTACCCAAT
CCTGACAC^GGGAGGTAGTGACMTAMTTTCMTACCGGGCCTTTTCAGGTCTGGTAATTGGAATGAG
TACMTCTAMCCCaTMCGAGGATCMTTGGAGGGCMGTCTGGTGCO\GCAGCCGCGGTAATTCCA
GCTCCMTAGCGTATATTTMGTTGCTG<^GTrAAAMGCTCGTAGTTGGATTrCGGGCGGGGCCTGCC
GGTCCGCCGTTTGGGTGTGCACAGGCAGGGCCCGCCTTGTTGCCGGGGACGGGCTCCTGGGCTTCACT
GTCCGGGACTCGGAGTTGGCGCTGTTACTTTGAGTAMTTAGAGTGTTDVMGCAGGCCTACGCTCTGA
ATGCATTAGCATGGAATAACACGATAGGACTCTGGCCTATCCTGTTGGTCTGTAGGACCGGAGTAATGA
TTMGAGGGAC^GTCGGGGGCATTCGTATTTCGATGTCAGAGGTGAMTTCTrGGATTTTCGAAAGAC
GMCTACTGCGAMGCATTTGCO^GGATGTriTCATTMTCAAGAACGAAAGATGGGGGCTCGAAGAC
GATTAGATACCGTCCTAGTCTCAACCATAAACGATGCCGACTAGCGATCGGCGGATGI MCI ICGATGA
CTCCGCCGG(^CCTTATGAGAMTCAMGTTTTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAA
CTTGGGGGMTTGACGGMGGGCACCAC^TGCGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGA
AAACTTACCAGGTCCAGACATAGTGCGGATTGACAGATTGAGAGCTCI MCI IGATTCTATGGGTGGTG
GTGCATGGCCGTTCTTAGTTGGTGGGTTGCCTTGTCAGGTTGATTCCGGTAACGAACGAGACCTCAGC
CTGCTAAATCGTCACGGCCTCCTCGGGGGCCGGCAGACI ICI IAGAGGGACTATTGGCGACTAGCCAAT
GGMTCATGAGGCMTM(^GGTCTGTGATGCCCTTAGATGCCCTGGGCCGCACGCGCGCTACTCTGAT
GCAATCAACGAGCCTAGCCTTGG
[041]. SEQ4
> Botryococcus braunii 18S ribosomal RNA gene
TATTTATTAGATAAMGGCTGACCGGGCTCGCCCGACTCTTGCTGACTCATGATAACTCGACGGATCGC
ACGGGCTTGTCCCGGCGACGTTTC^TTCGCTTTTCTGCCCTATCAACTGTCGATGGTACGGTAGTGGCC
TACCATGGTGTTCACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAGACGGCGA
CCACATCCAAGGCCGGCAGCAGGCGCGCAAATTACCCAATCCTGACACAGGGAGGTAGTGACAATAAAT
MCMTATCGGGGTTTCCAMCTCTGATMTTGGMTGAGTACMTCTAAMTCCTTAACGAGGATCAAT
TGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATACCCAAGI IGIIGCA
GTTAAGCTGCTCGTAGTCGGACTTCGGGTGGGGGCCGGCGGTCCGCCGACTGGTGTGCCATGCCGGGC
CCCGCCTTGCTGCCGGAGATGGGATCCTGGGCTTCGCTGTCCGGGACCCGGACTCGGCGTGGTTACTr

TGAGTAMTTAGAGTGTTCAAAGCAGGCCTACGCTCTGAATATGTTAGCATGGMTAACGCGATAGGAC
TCTGGCCTATU IGI IGGTCTGTGGGACCGGAGTAATGATTAAGAGGGACAGTCGGGGGCATTCGTAT
TT^TTGTCAGGGGTGAMTTCrTGGATTTATGAMGACGGACTACTGCGAAAGCATTTGCCAAGGATG
TTTTCATTGATD\AGMCGAMGT7X3GGGGCTCGMGACGATTAGATACCGTCCTAGTCTCAACCATAA
ACGATGCCGACTAGGGATTGGTGGGTGTTCTTTTGACGACCCCTCCAGCACCTTATGAGAAATCAAAGT
TTTTGGGTTCCGGGGCGAGTATGGTCGTAAGGCTGGAACTTAAAGGAATTGACGGAAGGGCACCACCA
GGCGTGGAGCCTGCGGCTTMTTTGACTCAACACGGGAAAACTTACCAGGTCCAGACATAGTGAGGATT
GACAGATTGAGAGCTCTTCCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGGTTGG
CTTGTCAGGTTGATTCCGGTAACGAACGAGACCTCAGCCTGCTAAATAGTCCGACCAGGTTCGCCCAGG
CCGCCGACI ICI IAGAGGGACTCTCGGCGACTAGCCGGAGGAAGTGTGAGGCGATAACAGGACTGTG
[042]. SEQ5
> Dunaliella salina 18S ribosomal RNA gene
ATTAGATGGTACCTTTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCGTAAATCCCGACTTCT* GGMGGGACGTATTTATTAGATAAAAGGCCAGCCGGGCTTGCCCGACTCTTGGCGAATCATGATAACTT MCGMTCGCACGGCTTTATGCCGGCGATGTTTCATTCAMTTTCTGCCCTATCMCTTTCGATGGTAG GATAGAGGCCTACGVTGGTGGTAACGGGTGACGGAGGATTAGGGTTCGACCCCGGAGAGGGAGCCTGA GATTCGGCTACG\AATCCCAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCAACACGGGGATGTAGT GACMTAMTMCMTACCGGGCATTTTTGTCTGGTMTTGGAATGAGTACAATCTAAATCCCrTAACGA GTATC(^TTGGAGGGCMGTCTGGTGAAAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATGTAAG TTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGTAGCGGTC^GCCTTTGGTTAGTACT GCTACGGCCTACCTTTCTGCCGGGGACGAGCTCCTGGGCTTAACTGTCCGGGACTCGGAATCGGCGAG GTTACTCTGAGTAMTTAGAGTGTTCAAAGCAAGCCTACGCTCTGAATACATTAGCATGGAATAACACG ATCGGACTCTGGCTTATCI IGI IGGTCTGTAAGACCGGAGTAATGATTAAGAGGGACAGTCGGGGCCA TTCGTATTTCACTGTCAGAGGTGAMTTCTTGGATTTTGAMGACGMCTTCCrGCGAMGCATTTGCC MGGATGTTTTGVTTAATCCAAGAACGAAAGTTGGGGGCTCGAAGACGATTAGATACCAGTCGTAGTCT CMCCATAMCGATGCCGACTTAGGGATTGG(^GGTGTTrCGTTGATGACCCTGCCAG(^CCTTTATGA GAAATCACAGI I I I I IGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGA AGGGCACCACCAGGCGTGGAGCATGCGGCTTAATTAGACTCAACACGGGAAAACrTACCAGGTCCAGAC ACGGGGAGGATTGACAGATTGAGAGCTCII ICI IGATTCTGTGGGTGGTGGTGCATGGCCGI ICI I AG TTGGTGGGTTGCCTTGTCAGGTTGATTCCGG
[043]. SEQ6
> Nannochloris oculata 18S small subunit ribosomal RNA gene
TATAMCTG(XITATACTATGAMCTGCGMTGGCTCATTAMTC^GTTATAGTTTATrTGATGGTACCT ACTTACTCGGATMCCGTAGTMTTCTAGAGCTAATACGTGCGCACATCCCGACTTCTGGAAGGGACGT ATTTATTAGATAAMGGCCGACCGGATTTTTCCGACTCGCGGTGACTCATGATAACTTCACGAATCGCA TGGCCTCGTGCCGGCGATGTTTC^TTaW\TTTCTGCCCTATCGGCTTTTGATGGTAGGATAGAGGCCT

ACCATGGTGGTAACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTAC
CACATCCAAGGAAGGCAGCAGGCGCGCAAATrACCCAATCCTGACACAGGGAGGTAGTGACMTAAATA
AOVATACCGGGCOTTGGTCTGGTMTTGGMTGAGTAO^CCTAAACACCTTAACGAGGATCAA"1TGG
AGGGCMGTCTGGTGCCAGCAGCCGCGGTMTTCCAGCTCCMTAGCGTATATrrMGTTGCTGCAGTT
AAAAAGCrCGTAGTTGGATTACGGGTGGGGCCTGCCGGTCCGCCGTTTCGGTGTGCACTGGCCGGGCC
CACCTTGTTGCCGGGGACGGGCTCCTGGGCTrCGCTGTCCGGGACCCGGAGTCGGCGAGGTTACTTTG
AGTAAMTAGAGTGTTCAMGCAGGCCTACGCTCTGMTAATTAGCATGGAATAACACGATAGGACTCA
GGCCTATCCTGTTGGTCTGTAGGACCGGAGTAATGATTAAGAGGGACAGTCGGGGGCATTCGTATTTC
ATTGTCAGAGGTGAAATTCTTGGATTTATGAMGACGMCTACTGCGAMGCATTTGCCAAGGATGTTT
TCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATTAGATACCGTCCTAGTCTCAACCATAAACG
ATGCCGACTAGGGATCGGCGGGTGI I I I I I IGATGACCCCGCCCCCACCTTATGAGAAATCAAAGTTTT
TGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGC
GTGGAGCCTGCGGCTTMTTTGACTCAACACGGGAAAACTTACCAGGTCCAGACATAGTGAGGATTGAC
AGATTGAGAGCTU I IU IGATTCTATGGGTGGTGGTGCATGGCCGTrCTTAGTTGGTGGGTTGCCTT
GTCAGGTTGATTCCGGTGACGAACGAGACCTCAGCCTGCTAACTAGTCACGCGTGCTCCGGCACGCGG
CGGAU ILI IAGAGGGACTATTGGCGACTAGCCAATGGATGCATGAGGCAATAACAGGTCTGTGATGC
CCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGCATTCAACGAGCCTATCCITGGCCGAGAGG

WE CLAIM:
1. A process for producing bio-fuels, comprising:
selecting a microalgae or a combination thereof having 95-100% similarity with 18s ribosomal nucleic acids nucleotide sequences (rDNA) given for Seq. ID 1, Seq. ID 2, Seq. ID 3, Seq. ID 4, Seq. ID 5 and Seq. ID 6.
- obtaining high cell density of microalgae by culturing the said microalgae heterotrophically at pH and temperature conditions suitable to inhibit growth of undesired microbes and to obtain lipid with less unsaturated fatty acids.
- extracting oil from the harvested algal cells to produce biodiesel.

2. The process as claimed in claim 1, wherein pH value is maintained between 5.0 and 9.0 and the temperature is maintained between 10 to 60 °C.
3. The process as claimed in claim 1, wherein said cell-density is between 11 to 24 g/L (dry cell weight basis) and 100-200g/l (wet weight basis).
4. The process as claimed in claim 1, wherein the oil content ranges from 22-58% dry cell weight.
5. The process as claimed in claim 1, wherein the culture medium comprises of at least one carbon source , one nitrogen source and one phosphorus source.
6. The process as claimed in claim 5, wherein the carbon source is selected from a group comprising of pentoses, hexoses sugar or other monosaccharide, disaccharides and polyschharides
7. The process as claimed in claim 5, wherein the concentration of said at least one of hexoses or pentoses or other monosaccharides, disaccharides, and polysaccharides, in bioreactor is controlled between 0.01 and 100 g/L.
8. The process as claimed in claim 5, wherein the source of carbon is selected from the group consisting of pure sugar(s), hydrolysates of corn starch, wheat flour, hydrolysate of lignocellulosic biomass along with , organic waste water streams like sewage treatment plant, wasterwater from crude oil refining industry containing hydrocarbons , water from distillery.fruit processing industrydairy industry,, molasses,and organic material etc.

9. The process as claimed in claim 5, wherein the nitrogen selected from the group consisting of glycine, yeast powder, yeast extract, peptone, ammonium chloride, urea, KNO3, ammonium nitrate, ammonia, or corn syrup and nitrogen containing compounds present in said wastewater stream.
10. The process as claimed in claim 1, wherein initial inoculum for heterotrophic growth is preferably prepared under phototrophic conditions and then inoculated in a bioreactor maintained under heterotrophic condition.
11. The process as claimed in claim 10, wherein amount of inoculum in the bioreactor is between 0.01% and 50% by volume, preferably 20%.
12. The process as claimed in claim 1, wherein the medium in reactor is agitated with a speed of between 5 to 1,000 rpm, preferably 700 rpm.

Documents

Application Documents

# Name Date
1 1315-KOL-2011-(12-10-2011)-SPECIFICATION.pdf 2011-10-12
2 1315-KOL-2011-(12-10-2011)-GPA.pdf 2011-10-12
3 1315-KOL-2011-(12-10-2011)-FORM-3.pdf 2011-10-12
4 1315-KOL-2011-(12-10-2011)-FORM-2.pdf 2011-10-12
5 1315-KOL-2011-(12-10-2011)-FORM-1.pdf 2011-10-12
6 1315-KOL-2011-(12-10-2011)-DESCRIPTION (PROVISIONAL).pdf 2011-10-12
7 1315-KOL-2011-(12-10-2011)-CORRESPONDENCE.pdf 2011-10-12
8 1315-KOL-2011-(08-10-2012)-FORM-5.pdf 2012-10-08
9 1315-KOL-2011-(08-10-2012)-FORM-2.pdf 2012-10-08
10 1315-KOL-2011-(08-10-2012)-DESCRIPTION (COMPLETE).pdf 2012-10-08
11 1315-KOL-2011-(08-10-2012)-CORRESPONDENCE.pdf 2012-10-08
12 1315-KOL-2011-(08-10-2012)-CLAIMS.pdf 2012-10-08
13 1315-KOL-2011-(08-10-2012)-ABSTRACT.pdf 2012-10-08
14 1315-KOL-2011-FORM-18.pdf 2013-08-26
15 Fresh Form 1.pdf 2013-12-05
16 Form 26.pdf 2013-12-05
17 Form 13 - 1315-KOL-2011.pdf 2013-12-05
18 1315-KOL-2011-FER.pdf 2017-12-06
19 1315-KOL-2011-PETITION UNDER RULE 137 [05-06-2018(online)].pdf 2018-06-05
20 1315-KOL-2011-PETITION UNDER RULE 137 [05-06-2018(online)]-1.pdf 2018-06-05
21 1315-KOL-2011-OTHERS [05-06-2018(online)].pdf 2018-06-05
22 1315-KOL-2011-FER_SER_REPLY [05-06-2018(online)].pdf 2018-06-05
23 1315-KOL-2011-COMPLETE SPECIFICATION [05-06-2018(online)].pdf 2018-06-05
24 1315-KOL-2011-CLAIMS [05-06-2018(online)].pdf 2018-06-05
25 1315-KOL-2011-ABSTRACT [05-06-2018(online)].pdf 2018-06-05
26 1315-KOL-2011-PatentCertificate06-12-2019.pdf 2019-12-06
27 1315-KOL-2011-IntimationOfGrant06-12-2019.pdf 2019-12-06
28 1315-KOL-2011-RELEVANT DOCUMENTS [16-03-2020(online)].pdf 2020-03-16
29 1315-KOL-2011-RELEVANT DOCUMENTS [07-10-2021(online)].pdf 2021-10-07
30 1315-KOL-2011-RELEVANT DOCUMENTS [07-09-2022(online)].pdf 2022-09-07

Search Strategy

1 patseer_05-12-2017.pdf

ERegister / Renewals

3rd: 12 Dec 2019

From 12/10/2013 - To 12/10/2014

4th: 12 Dec 2019

From 12/10/2014 - To 12/10/2015

5th: 12 Dec 2019

From 12/10/2015 - To 12/10/2016

6th: 12 Dec 2019

From 12/10/2016 - To 12/10/2017

7th: 12 Dec 2019

From 12/10/2017 - To 12/10/2018

8th: 12 Dec 2019

From 12/10/2018 - To 12/10/2019

9th: 12 Dec 2019

From 12/10/2019 - To 12/10/2020

10th: 30 Sep 2020

From 12/10/2020 - To 12/10/2021

11th: 06 Oct 2021

From 12/10/2021 - To 12/10/2022

12th: 07 Oct 2022

From 12/10/2022 - To 12/10/2023

13th: 09 Oct 2023

From 12/10/2023 - To 12/10/2024

14th: 25 Sep 2024

From 12/10/2024 - To 12/10/2025

15th: 10 Oct 2025

From 12/10/2025 - To 12/10/2026