Sign In to Follow Application
View All Documents & Correspondence

A Starch Conversion Process For Producing Syrup

Abstract: ABSTRACT This invention relates to a starch conversion process for producing syrup. Starch is liquified at a pH between 4.5 and 6.5 at a temperature of 70 to 110°C for 30 to 180 minutes. Liquified starch is saccharified at a temperature of 50 to 80°C in the presence of glucoamylase. The syrup produced is recovered therefrom. Isoamylase derived from a strain of Rhodothermus is added during the saccharification step.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
17 January 2001
Publication Number
38/2008
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
Parent Application

Applicants

NOVO NORDISK A/S
NOVO ALLE, 2880 BAGSVARED

Inventors

1. NORIKO TSUTSUMI
3-2-17 HIGASHISUGANO, ICHIKAWA-SHI, CHIBA-KEN 272
2. HENRIK BISGARD FRANTZEN
C/O NOVO NORDISK A/S, NOVO ALLE, DK-2880 BAGSVAERD
3. ALLAN SVENDSEN BITH
C/O NOVO NORDISK A/S, NOVO ALLE, DK-2880 BAGSVAERD

Claims

1. A starch conversion process for producing syrup comprising the steps of: (a) liquefying starch at a pH value between 4.5 and 6.5 at temperatures of 70-110C for between 30 and 180 minutes, (b) saccharifying the liquefied starch obtained from step (a) at a temperature from 50-80C, at a pH in the range from pH4.5-6.5 for a period of 24-72 hours in the presence of AMG (glucoamylase); (c) recovering the syrup; wherein an isoamylase derived from a strain of Rhodothermus is added during the saccharification step (b).

2. The process as claimed in claim 1, wherein the isoamylase derived from the genus of Rhodothermus is derived from a strain of Rhodothermus marinus, especially Rhodothermus marinus DSM 4252.

3. The process as claimed in claims 1 or 2, wherein calcium is added during liquefaction in amounts of from 0.75 to 1.25 mM, such as around ImN.

4. The process as claimed in any one of claims 1 to 3, wherein the liquefying alpha-amylase is inactivated before the saacharification step.

5. The process as claimed in any one of claims 1 to 4, wherein the alpha-amylase is a Bacillus licheniformis alpha-amylase or a Bacillus stearothermophilus alpha-amylase or a Pyrococcus furiosus alpha-amylase.

6. The process as claimed in any one of claims 1 to 5, wherein the saccharification step is followed by an isomerization step.

7. The process as claimed in any one of claims 1 to 6, wherein the isoamylase is obtained from a strain of the genus Rhodothermus and has (i) isoamylase activity in the pH range of 3.5 to 6.5 and an optimum at around pH 5, measured at 50C, (ii) a molecular mass of about 80 kDa, as determined by SDS-PAGE; (iv) an isoelectric point (pI) in the range of 5.2-5.8.

8. The process as claimed in claim 7, wherein the strain is Rhodothermus marinus, especially Rhodothermus marinus DSM 4252.

9. The process as claimed in claims 1 to 8, wherein the isoamylase is selected from the group consisting of: (a) a polypeptide encoded by the isoamylase enzyme encoding part of the DNA sequence cloned into plasmid pUC19 percent in Escherichia coh DSM 11971; (b)a polypeptide comprising an amino acid sequence as shown in positions 1-726 of SEQ ID NO:4; (c) an analogue of the polypeptide defined in (a) or (b) which is at least 70% homologous with said polypeptide; and a fragment of (a),(b)or(c).

10. A starch conversion process for producing syrup substantially as herein described.

Specification

This invention relates to a starch conversion process for producing syrup,
BACKGROUND OF THE INVENTION
Starches such as corn, potato, wheat, manioc and rice starch are used as the starting material in commercial large scale production of sugars, such as high fructose syrup, high maltose syrup, maltodextrins amylose, trehalose, G2-G8 oligo¬saccharides (including functional oligosaccharides) and other carbohydrate products such as fat replacers.
Degradation of starch
Starch usually consists of about 80% amylopectin and 20% amylose. Amylopectin is a branched polysaccharide in which lin¬ear chains a-1,4 D-glucose residues are joined by a-1,6 gluco-sidic linkages. Amylopectin is partially degraded by a-amylase which hydrolyze the 1,4-a-glucosidic linkages into branched and linear oligosaccharides. Prolonged degradation of amylopec¬tin by a-amylase results in the formation of so-called a-limit dextrins which are not susceptible to further hydrolysis by the a-amylase. Branched oligosaccharides can be hydrolyzed into linear oligosaccharides by a debranching enzyme. The remaining branched oligosaccharides can slowly be depolymerized to D-glucose by glucoamylase. Glucoamylase hydrolyse linear oligo¬saccharides fast into D-glucose.
Amylose is a linear polysaccharide built up of D-glucopyranose units linked together by a-1,4 glucosidic link¬ages. Amylose is degraded into linear oligosaccharides by a-aniylase which are fast depolymerized into D-glucose by glu¬coamylase .

Enzymes
a-amylase
a-amylase (E.G. 3.2.1.1) with the systematically name 1,4-a-D-glucan glucanohydrolase is capable of hydrdlysing starch and other linear and branched 1,4-glucosidic oligo- and polysaccharides, a-amylase acts on the substrate in a random manner. The reducing groups are liberated in the a-configuration.
Debranching enzymes
Debranching enzymes, which can attack amylopectin are di¬vided into two classes: isoamylases (E.G. 3.2.1.68) and pullu-lanases (E.G. 3.2.1.41), respectively. Isoamylase hydrolyses a-1,6-D-glucosidic branch linkages in amylopectin and P-limit dextrins and can be distinguished from pullulanases by the in¬ability of isoamylase to attack pullulan, and by the limited action on a-limit dextrins.
Glucoamylase
Glucoamylase or glucan 1,4-a-glucosidase (E.G. 3.2.1.3) hydrolyzes the terminal 1,4-linked a-D-glucose residues successively from the non-reducing ends of the chains with release of (3-D-glucose. The enzyme can also slowly hydrolyze 1,6-a-D-glucosidic bonds in isomaltose, panose and related oligosaccharides.
Starch conversion
A "traditional" starch conversion process degrading starch to lower molecular weight carbohydrate components such as sug¬ars or fat replacers includes a debranching step.
Starch to sugar conversion
In the case of converting starch into a sugar the starch is depolymerized. A such depolymerization process consists of a pretreatment step and two or three consecutive process steps, viz. a liquefaction process, a saccharification process and

dependent on the desired end product optionally an isomeriza-tion process.
Pre-treatment of native starch
Native starch consists of microscopic granules which are insoluble in water at room temperature. When an aqueous starch slurry is heated, the granules swell and eventually burst, dispersing the starch molecules into the solution. During this "gelatinization" process there is a dramatic increase in viscosity. As the solids level is 30-40% in a typically industrial process, the starch has to be thinned or "liquefied" so that it can be handled. This reduction in viscosity is today mostly obtained by enzymatic degradation.
Liquefaction
During the liquefaction step, the long chained starch is degraded into branched and linear shorter units (maltodextrins) by an a-amylase (e.g. Termamyl^). The liquefaction process is
carried out at 105-110°C for 5 to 10 minutes followed by 1-2 hours at 95°C. The pH lies between 5.5 and 6.2. In order to ensure an optimal enzyme stability under these conditions, 1 mM of calcium is added (40 ppm free calcium ions). After this treatment the liquefied starch will have a "dextrose equiva¬lent" (DE) of 10-15.
Saccharification
After the liquefaction process the maltodextrins are converted into dextrose by addition of a glucoamylase (e.g. AMG^) and a debranching enzyme, such as an isoamylase (US Pat¬ent 4,335,208) or a pullulanase (e.g. Promozyme^) (US Patent
4,560,651) . Before this step the pH is reduced to a value below 4.5, maintaining the high temperature (above 95°C) to inacti¬vate the liquefying a-amylase to reduce the formation of short oligosaccharide called "panose precursors" which cannot be hydrolyzed properly by the debranching enzyme.
The temperature is lowered to 60°C, and glucoamylase and debranching enzyme are added. The saccharification process

proceeds for 24-72 hours.
Normally, when denaturing the a-amylase after the liquefaction step about 0.2-0.5% of the saccharification prod¬uct is the branched trisaccharide 6^-a-glucosyl maltose (panose) which cannot be degraded by a pullulanase. If active amylase from the liquefaction step is present during sacchari-fication (i.e. no denaturing), this level can be as high as 1-2%, which is highly undesirable as it lowers the saccharifica¬tion yield significantly.
Isomerization
When the desired final sugar product is e.g. high fructose
syrup the dextrose syrup may be converted into fructose. After the saccharification process the pH is increased to a value in the range of 6-8, preferably pH 7.5, and the calcium is removed by ion exchange. The dextrose syrup is then con¬verted into high fructose syrup using, e.g., an immmobilized
glucoseisomerase (such as Sweetzyme™).
Starch to fat replacer conversion
A "fat replacer" is a fat-like carbohydrate which is used as a functional replacement of fat in foods. Fat-replacers typically consist of short chained amylose of linear polymers containing from about 15 to 65 anhydroglucose units linked by a-1,4-D-glucosidic bonds. Such fat replacers may be produced by enzymatic debranching of starch. Methods for degrading the a-l,6-D-glucosidic bonds of starch to form short chain low mo¬lecular weight amylose by the use of debranching enzymes are described in e.g. US patent no. 3,730,840 (Sugimoto), US patent
no. 3,881,991 (Kurimoto) and US patent no. 3,879,212 (Yoshida). A further method of producing short chained amylose to be used as a fat replacer is described in EP 0,486,936-Al (National Strach and Chemical Investment Holding Corporation).
In traditional starch conversion processes, such as starch depolymerization processes, the formation of the undesired side product, panose, has a significant influence on the overall saccharification yield. It is therefore desirable to reduce the

formation of panose to increase the saccharification yield.
SUMMARY OF THE INVENTION
It is the object of the present invention to provide a starch conversion process of the type which includes a de-branching step which results in a reduced formation of the un-desired trisaccharide panose. The invention also relates to a novel thermostable isoamylase suitable for use in the starch conversion process of the invention.
According to the invention the term "starch conversion process" include all processes where starch is degraded into carbohydrate components with a lower molecular weight.
The present inventors have found that the achievement of the above-mentioned object of the invention requires an isoamy¬lase debranching enzyme which is active at the process condi¬tion prevailing.
In the first aspect the invention relates to a starch conversion process of the type which includes a debranching step wherein an isoamylase being active at the process condi¬tions prevailing is used for debranching the starch.
In the second aspect the invention relates to the use of a thermostable isoamylase in starch conversion processes.
BRIEF DESCRIPTION OF THE DRAWING
Figure 1 shows the restriction enzyme map of pRI5A, the plasmid comprising the Rhodothermus marinus isoamylase.
Figure 2 shows the pH curve of R. marinus isoamylase.
Figure 3 shows the temperature curve of R. marinus isoamylase.
Figure 4 shows the expression vector, pFSI82.
Figure 5 shows the pH curve of Sulfolobus acidocaldarius
isoamylase.
Figure 6 shows the temperature curve of S. acidocaldarus
isoamylase.
Figure 7 shows the effect of adding the R. marinus isoamylase
during starch conversion on the DPI, DP2, DP3 and DP4+ yields.

DETAILED DESCRIPTION OF THE INVENTION
It is the object of the present invention to provide a starch conversion process of the type which includes a de-branching step which results in a reduced formation of the un-desired trisaccharide panose. The invention also relates to a novel thermostable isoamylase suitable for use in the starch conversion process of the invention.
The present inventors have found that the achievement of the above-mentioned object of the invention requires an isoamy¬lase debranching enzyme which is active at the process condi¬tion prevailing.
In the case of a starch depolymerization process the isoamylase should be active during liquefaction. This means that the isoamylase are substantially active at liquefaction temperatures, which lies from 95-110°C, especially around 105°C, at a pH in the range from 4.5 to 6.5, especially around pH 5.5.
In the context of the invention "substantially active" means that the relative enzymatic activity of the isoamylase is at least 50%, in particular at least 60%, especially at least 70%, such as at least 90%, or at least 95%, such as at least 99%, at 100°C at pK 5.5 in comparison to the relative activity at the temperature optimum.
When the debranching takes place during liquefaction to¬gether with the action of an a-amylase the formation of panose precursors is reduced. By reducing the formation of panose precursors less panose will be present in the final product increasing the overall saccharification yield.
A thermostable isoamylase makes it possible to perform the liquefaction and the debranching at the same time before the saccharification step.
Specific examples of thermostable debranching enzymes are the thermostable isoamylases derived from the thermophilic bacteria such as Sulfolobus acidocaldarius ATCC 33 909 (Maruta,
K. et al., Biochimica et Biophysica Acta 1291, p. 177-181 (1996)), Sulfolobus solfataricus ATCC 35092 (accession number-.

Y08256) and Rhodothermus marinus DSM 4252 as will be described further below.
The process
In the first aspect the invention relates to a starch conversion process of the type which includes a debranching step wherein an isoamylase being active at the process condi¬tions prevailing is used for debranching the starch.
In an embodiment of the invention the starch conversion process is a starch depolymerization process wherein the isoamylase is active during the liquefaction step together with an a-amylase.
In a preferred embodiment the debranching enzyme being active at the process conditions prevailing is a thermostable isoamylase.
According to the invention the enzymatic degradation pattern in the traditional starch depolymerization process has been changed. Such an enzyme process change has not been possi¬ble before since all known isoamylases have been thermolabile and is inactivated at temperatures above 60°C.
According to the invention the liquefaction step is carried out at pH values adjusted to between 4.5 and 6.5, preferred 5.5 to 6.2, with e.g. sodium hydroxide, at tempera¬tures of 95-110°C for a period of 1 to 3 hours, preferably around 2 hours.
Optionally, if the a-amylase is calcium dependent calcium may be added in amounts of from 3 0 to 50 ppm, such as around 40 ppm (or 0.75 to 1.25 mM, such as around 1 mM), in the liquefac¬tion step to stabilise the enzyme.
According to the invention the a-amylase need not be inactivated after the liquefaction step to reduced the panose formation.
Examples of specific a-amylases which can be used in the liquefaction step include Bacillus licheniformis a-amylases, such as the commercially available products Termamyl®, Spezyme® AA, Spezyme* Delta AA, Maxamyl®, Kleistase® and the a-amylase

mutants described in WO 96/23874 (Novo Nordisk) and PCT/DK97/00197 (Novo Nordisk).
Isoamylases which can be used according to the invention include the thermostable isoamylase derived from the thermophilic archaebacteria Sulfolobus acidocaldarius, Sul-
folobus solfataricus and the thermophilic eubacterium Rhodo-
thermus marinus (as will be described in details below).
According to the invention the saccharification step is carried out at temperatures from 55 to 65°C preferably around 60°C by a glucoamylase for 24-72 hours.
Examples of suitable glucoamylases include Aspergillus niger glucoamylases, such as AMG from e.g. Novo Nordisk.
In the case of the desired final sugar product is e.g. a
high fructose syrup of approx. 50% fructose syrup the formed D-glucose is isomerized by an isomerase at a pH around 6-8, preferably pH 7.5.
Calcium is removed if added before the liquefaction step.
An examples of a suitable isomerases is an glucose isomerase such as the glucose isomerase derived from Streptomy-
ces murinus. The isomerase may be an immmobilized glucose
isomerase, such as Sweetzyme® (from Novo Nordisk)
Use
In the second aspect the invention relates to the use of a thermostable isoamylase in starch conversion processes, including fructose syrup conversion processes and for producing fat replacers.
In the case of the starch conversion process is a starch depolymerization process the thermostable isoamylase is used in combination with an a-amylase during the liquefaction step. The thermostable isoamylase may be derived from the thermo¬philic archaebacteria Sulfolobus acidocaldarius or Sulfolobus
solfataricus or from Rhodothermus marinus.
The thermostable isoamylase may be used during the

liquefaction step of a starch to glucose syrup or fructose syrup conversion process. The thermostable isoamylase may also be used in processes for producing fat replacers from starch.
Advantages of the invention
Several advantages are obtained by the addition of a thermostable isoamylase.
For instance, when the debranching of the starch takes place together with a-amylase in the liquefaction step of starch depolymerization, it is possible to extend the liquefac¬tion process time without risking formation of large amount of panose precursors.
As the debranching enzyme is a thermostable isoamylase the debranching by a pullulanase during saccharification can be left: out. This is advantageous as pullulanase tends to condense maltose into a panose precursor, 6^-a-maltosylmaltose which is hydrolysed into panose by glucoamylase.
By prolonging the liquefaction step the DE is increased from 10-15 to e.g. 15-20 reducing the need for glucoamylase
(e.g. AMG^). This reduced glucoamylase requirement is advanta¬geous as the formation of isomaltose is reduced. Isomaltose is formed from D-glucose resulting from depolymerization of linear oligosaccharides by glucoamylase which removes D-glucose from the non-reducing chain-ends. All together less glucoamylase ac¬tivity results in an increased glucose yield.
Further, the saving of glucoamylase in the process of the invention enables the saccharification step to be carried out at a higher substrate concentration which is advantageous as the evaporation costs can be reduced.
Furthermore, when using the process of the invention for depolymerization the a-amylase used in the liquefaction proc¬ess needs not be inactivated/denatured.
The saccharification reaction time can also be reduced significantly thereby increasing production capacity.
The aim of the present invention is to reduce the formation of panose.
In starch depolymerization processes this increases the

saccharification yield as the addition of an isoamylase being active during the liquefaction step reduces the amount of formed panose precursors.
When using a thermostable isoamylase up front in the liq¬uefaction process the process is less dependent of the speci¬ficity of the a-amylase and the formation of the panose pre¬cursors. This change allows an increased process time for the liquefaction and a higher DX than the normal value of DX 10-12 is obtained. If a more intensive liquefaction is allowed and a higher DX value is obtained by the use of a thermostable de-branching enzyme its possible to increase the concentration of Dry Substance (DS) from the normal 30-35% to a higher percent¬age. Such an increase in %DS is advantageous as the evaporation costs are reduced significantly downstream in the High Fructose Corn Syrup (HFCS) process.
How to identify suitable thermostable isocunylases
Suitable thermostable isoamylases may be identified as described in Example 1 by first identifying conserved regions of amino acid sequence by aligning isoamylase sequences avail¬able. On the basis of the conserved regions PCR primers are de¬signed. Genomic DNA stocks of a number of bacterial strains are then subjected to PCR, and strains yielding a fragment of the expected size are selected. The fragments are purified, se¬quenced, and aligned to confirm the homology with published isoamylase sequences. Among the strains identified, ones with the highest optimum growth temperature are further selected.
Using this approach isoamylases from Rhodothermus warinus
DSM 4252 and Rhodothermus obamensis JCM 9785 were selected, and R. marinus isoamylase was further cloned as described in Exam¬ple 2 . •
Novel isoamylase obtained from Rhodothermus marinus DSM 4252.
As also indicated above the present inventors have found that an enzyme exhibiting isoamylase activity may be obtained from a strain of the genus Rhodothermus, more specifically
Rhodothermus marinus, especially Rhodothermus marinus DSM 4252,

and have succeeded in cloning a DNA sequence encoding said enzyme.
Comparison with prior art
A homology search with the isoamylase of the invention against nucleotide and protein databases was performed.
Origins of isoamylase genes identity
DNA a.a.
Pseudomonas amyloderamosa*! 50.4 % 33.0%
Pseudomonas sp. SMP1*2 50.4 % 33.0%
Flavojbacterium sp.*3 54.0 % 34.1%
Flavobacterium odoratum*4 54.8 % 36.6%
Sulfolobus acidocaldarius*5 51.8 % 54.2%
Sulfolobus solfataricus*6 51.1 % 55.0%
*1: Table 1, 1 *2: Table 1, 2 *3: Table 1, 3 *4: Table 1, 4 *5: Table 1, 5 *6: GenBank: Accession number; Y08256
The homology search showed that the most related known sequence(s) were isoamylases from Sulfolobus acidocaldarius and
Sulfolobus solfataricus. The DNA sequence of the invention (SEQ
ID NO: 3) encoding an isoamylase shows about 51-52% DNA homology to the known isoamylase sequences from Sulfolobus
acidocaldarius and Sulfolobus solfataricus and the
corresponding amino acid sequence of the isoamylase of the invention (SEQ ID NO: 4) shows about 54-55% homology to a deduced amino acid sequence based on the known DNA sequence above.
This shows that a DNA and/or an amino acid sequence of a isoamylase of the invention indeed is distant from any known DNA and/or the amino acid sequence(s) encoding an isoamylase.
The calculation of homology was done as described later in this specification.

DEFINITIONS
Prior to discussing this invention in further detail, the following terms will first be defined.
"A cloned DNA sequence"; The term "A cloned DNA sequence", refers to a DNA sequence cloned in accordance with standard cloning procedures used in genetic engineering to relocate a segment of DNA from its natural location to a different site where it will be reproduced. The cloning process involves excision and isolation of the desired DNA segment, insertion of the piece of DNA into the vector molecule and incorporation of the recombinant vector into a cell where multiple copies or clones of the DNA segment will be replicated.
The "cloned DNA sequence" of the invention may alternatively be termed "DNA construct" or "isolated DNA sequence".
"Obtained from": For the purpose of the present invention the term "obtained from" as used herein in connection with a specific microbial source, means that the enzyme is produced by the specific source, or by a cell in which a gene from the source have been inserted.
"An isolated polypeptide": As defined herein the term, "an isolated polypeptide" or "isolated isoamylase", as used about the isoamylase of the invention, is an isoamylase or isoamylase part which is at least about 20% pure, preferably at least about 40% pure, more preferably about 60% pure, even more preferably about 80% pure, most preferably about 90% pure, and even most preferably about 95% pure, as determined by SDS-PAGE. The term "isolated polypeptide" may alternatively be termed "purified polypeptide".
"Homologous impurities": As used herein the term "homologous impurities" means any impurity (e.g. another
polypeptide than the enzyme of the invention) which originate from the homologous cell where the enzyme of the invention is originally obtained from. In the present invention the homologous cell may e.g. be a strain of Rhodothermus.
"Isoamylase encoding part": As used herein the term "isoamylase encoding part" used in connection with a DNA

sequence means the region of the DNA sequence which corresponds to the region which is translated into a polypeptide sequence.
In the DNA sequence shown in SEQ ID NO: 3 it is the region between the first "ATG" start codon ("AUG" codon in mRNA) and che following stop codon ("TAA", "TAG" or "TGA"). In others words this is the translated polypeptide.
"isoamylase" in the present context isoamylase is defined according to the Enzyme classification (EC), as having the EC-number: 3.2.1.68.
Characterisation of the novel thermostable Isocunylase from
RhodothezTttus marinus
Isolated isoamylase
Accordingly, in a third aspect the invention relates to an isolated polypeptide having isoamylase activity which is obtained from a strain of the genus Rhodotheirmus and has
i) isoamylase activity in the pH range of 3.5 to 6.5 and an optimum at around pH 5, measured at 50°C;
ii) a molecular mass of abcut 80 kDa, as determined by SDS-PAGE ; an isoelectric point (pi) in the range of 5.2-5.8.
An isoamylase of the invention obtained from a Rhodothermus
sp. has been intensively characterised.
In a preferred embodiment the enzyme according to the first aspect of the invention is obtained from a strain of Rhodothermus marinus, especially Rhodothermus marinus DSM 4252.
In a preferred embodiment the enzyme according to the first aspect has the mature amino acid sequence shown as position 1-726 in SEQ ID NO: 4.
Isolated enzyme
In a fourth aspect the invention relates to an isolated enzyme exhibiting isoamylase activity selected from the group consisting of:
(a) a polypeptide encoded by the isoamylase enzyme encoding part of the DNA sequence cloned into plasmid pUC19 present in Escherichia coli DSM 11971;

(b) a polypeptide comprising an amino acid sequence as shown in positions 1-726 of SEQ ID NO: 4;
(c) an analogue of the polypeptide defined in (a) or (b) which is at least 70 % homologous with said polypeptide; and
(d) a fragment of (a), (b) or (c).
The enzyme according this aspect of the invention may be obtained from a microorganism such as a bacteria, a yeast or a filamentous fungus. Preferably it is obtained from a bacteria.
Examples of suitable ones are given in the section "Microbial sources" {vide infra).
Cloned DNA sequence from Rhodothezmus marinus
In its fifth aspect the invention relates to a cloned DNA sequence encoding an enzyme exhibiting isoamylase activity, which DNA sequence comprises:
I a) the isoamylase encoding part of the DNA sequence cloned into plasmid pUC19 present in Escherichia coli DSM 11971;
(b) the DNA sequence shown in positions 1-2178 in SEQ ID NO: 3 or its complementary strand;
\c) an analogue of the DNA sequence defined in (a) or (b) which is at least 70% homologous with said DNA sequence;
(d) a DNA sequence which hybridises with a double-stranded DNA
probe comprising the sequence shown in positions 1-2178
(encoding the mature part of the enzyme) in SEQ ID NO: 3 at low stringency;
(e) a DNA sequence which, because of the degeneracy of the
genetic code, does not hybridise with the sequences of (b) or
,d), but which codes for a polypeptide having the same amino acid sequence as the polypeptide encoded by any of these DNA sequences; or
(f) a DNA sequence which is a fragment of the DNA sequences
specified in (a), (b), (c), (d), or (e).
It is presently believed that the isoamylase encoding part of the DNA sequence cloned into plasmid pUC19 present in strain DSM 11971 is identical to the isoamylase encoding part of the DNA sequence presented in SEQ ID NO: 3.
Accordingly, the terms "the isoamylase encoding part of the DNA sequence cloned into plasmid pUC19 present in DSM

11971" and "the isoamylase encoding part of the DNA sequence presented in SEQ ID NO: 3" may be used interchangeably.
The DNA sequence may be of genomic, cDNA, or synthetic origin or any combination thereof.
The present invention also encompasses a cloned DNA sequence which encodes an enzyme exhibiting isoamylase activity having the amino acid sequence set forth as the mature part of SEQ ID NO: 4 (i.e. position 1-726), which DNA sequence differs
from SEQ ID NO: 3 by virtue of the degeneracy of the genetic code.
The DNA sequence shown in SEQ ID NO: 3 and/or an analogue DNA sequence of the invention may be obtained from a microorganism such as a bacteria, a yeast or a filamentous fungus. Preferably it is obtained from a filamentous fungus and examples of suitable ones are given in the section "Microbial sources" (vide infra) .
Alternatively, the analogous sequence may be constructed on the basis of the DNA sequence presented as the isoamylase encoding part of SEQ ID NO: 3, e.g. be a sub-sequence thereof
and/or be constructed by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the isoamylase encoded by the DNA sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme, or by introduction of nucleotide substitutions which may give rise to a different amino acid sequence (i.e. a variant of the isoamylase of the
invention).
When carrying out nucleotide substitutions, amino acid changes are preferably of a minor nature, i.e. conservative
amino acid substitutions that do not significantly affect the folding or activity of the protein, small deletions, typically of one to about 3 0 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification, such as a poly-histidine tract; an antigenic epitope or a binding domain.
Examples of conservative substitutions are within the group of basic amino acids, such as arginine, lysine, histi-

dine; acidic amino acids, such as glutamic acid and aspartic acid; polar amino acids, such as glutamine and asparagine; hydrophobic amino acids, such as leucine, isoleucine, valine; aromatic amino acids, such as phenylalanine, tryptophan, ty¬rosine; and small amino acids, such as glycine, alanine, se¬rine, threonine, methionine. For a general description of nucleotide substitution, see e.g. Ford et al., (1991), Protein
Expression and Purification 2, 95-107.
It will be apparent to persons skilled in the art that such substitutions can be made outside the regions critical to the function of the molecule and still result in an active polypeptide. Amino acids essential to the activity of the poly¬peptide encoded by the cloned DNA sequence of the invention, and therefore preferably not subject to substitution may be ' identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (cf. e.g. Cunningham and Wells, (1989), Science 244, 1081-1085). In
the latter technique mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological (i.e. isoamylase) activity to identify amino
acid residues that are critical to the activity of the molecule. Sites of substrate-enzyme interaction can also be determined by analysis of crystal structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photo affinity labelling (cf. e.g. de Vos et
al., (1992), Science 255, 306-312; Smith et al., (1992), J. Mol. Biol. 224, 899-904; Wlodaver et al., (1992), FEES Lett. 309, 59-64) .
Polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleic acid sequence (or a portion thereof) encoding another polypeptide to a nucleic acid sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art, and include, ligating the coding sequences encoding the polypeptides so that

. they are in frame and that expression of the fused polypeptide is under control of the same promoter(s) and terminator.
Homology of DNA sequences
The DNA sequence homology referred to above is determined as the degree of identity between two sequences indicating a derivation of the first sequence from the second. The homology may suitably be determined by means of computer programs known in the art, such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711)(Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453). Using GAP with the following settings for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3, the coding region of the analogous DNA sequences referred to above exhibits a degree of identity preferably of at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97% with the isoamylase encoding part of the DNA sequence shown in SEQ ID NO: 3.
Hybridization:
The hybridization conditions referred to above to define an analogous DNA sequence as defined in d) above which hybridizes to a double-stranded DNA probe comprising the sequence shown in positions 1-2178 in SEQ ID NO: 3 (i.e. the isoamylase encoding
part of SEQ ID NO: 4), under at least low stringency conditions, but preferably at medium or high stringency conditions are as described in detail below.
Suitable experimental conditions for determining hybridization at low, medium, or high stringency between a nucleotide probe and a homologous DNA or RNA sequence involves presoaking of the filter containing the DNA fragments or RNA to hybridize in 5 x SSC (Sodium chloride/Sodium citrate, Sambrook et al. 1989) for 10 min, and prehybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution (Sambrook et al. 1989), 0.5 % SDS and 100 ^g/ml of denatured sonicated salmon

sperm DNA (Sambrook et al. 198S), followed by hybridization in the same solution containing a concentration of lOng/ml of a random-primed (Feinberg, A. P. and Vogelstein, B. (1983) Anal.
Biochem. 132:6-13), "P-dCTP-labeled (specific activity > 1 x
10' cpm//^g ) probe for 12 hours at ca. 45°C. The filter is then washed twice for 30 minutes in 2 x SSC, 0.5 % SDS at least *
55°C (low stringency), more preferably at least 60°C (medium stringency), still more preferably at least 65°C (medium/high stringency), even more preferably at least 70°C (high stringency), and even more preferably at least 75°C (very high stringency).
Molecules to which the oligonucleotide probe hybridizes under these conditions are detected using a x-ray film.
It has been found that it is possible to theoretically i predict whether or not two given DNA sequences will hybridize under certain specified conditions.
Accordingly, as an al::ernative to the above described experimental method the determination whether or not an analogous DNA sequence will hybridize to the nucleotide probe described above, can be based on a theoretical calculation of the Tm (melting temperature; at which two heterologous DNA sequences with known sequences will hybridize under specified conditions (e.g. with respect to cation concentration and
temperature).
In order to determine the melting temperature for heterologous DNA sequences (Tmihetero)) it is necessary first to determine the melting temperature (Tm(homo)) for homologous DNA sequences.
The melting temperature Tm(homo) between two fully complementary DNA strands (homoduplex formation) may be determined by use of the following formula,
Tm(homo) = 81.5°C + 16.6(log M) + 0.41(%GC) - 0.61 (% form) -500/L ("Current protocols in Molecular Biology". John Wiley and Sons, 1995), wherein
"M" denotes the molar cation concentration in wash
buffer,
"%GC" % Guanine (G) and Cytosine (C) of total number of
bases in the DNA sequence,

"% form" % formamid in the wash buffer, and
"L" the length of the DNA sequence.
Using this formula and the experimental wash conditions given above, Tm(homo) for the homoduplex formation of the nucleotide probe corresponding to the DNA sequence shown in SEQ ID NO: 3, i.e. nucleotides 1-2178 is:
Tm(homo) = 81.5 + 16.6 (log 0.30) + 0.41(65) - 0.61(0) -(500/2178) Tm(homo) = 99.2°C
"M": 2 X SSC corresponds to a cation cone, of 0.3M.
"%GC" The %GC in SEQ ID NO: 3 is 65.
"% form": There is no formamid in the wash buffer.
"L": The length of SEQ ID NO: 3 is 2178.
The Tm determined by the above formula is the Tm of a homoduplex formation (Tm(homo)) between two fully complementary DNA sequences. In order to adapt the Tm value to that of two heterologous DNA sequences, it is assumed that a 1% difference in nucleotide sequence between the two heterologous sequences equals a 1°C decrease in Tm •, "Current protocols in Molecular Biology". John Wiley and Sons, 1995). Therefore, the Tm(hetero) for the heteroduplex formacicn is found by subtracting the homology % difference between the analogous sequence in question and the nucleotide probe described above from the Tm(homo). The DNA homology percentage to be subtracted is calculated as described herein {vide supra) .
With the experimental conditions above and a wash temperature of *55°C (low stringency) , an analogous sequence with 55.8% (200 - (99.2 - 55) = 55.8) homology will be
considered to hybridize to the nucleotide probe described above. With the more preferably wash temperature at 65°C (medium stringency) an analogous sequence with 65.8% homology will hybridize etc.
Homology to amino acid sequences:
The polypeptide homology referred to above (property (c)) of the polypeptide of the invention is determined as the degree of identity between two sequences indicating a derivation of the first sequence from the second. The homology may suitably

• be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453). Using GAP with the following settings for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP extension penalty of 0.1, the mature part of a polypeptide encoded by an analogous DNA sequence of the invention exhibits a degree of identity preferably of at least 70%, more preferably at: least 80%, more preferably at least 90%, more preferably at least 95%, and especially at least 97% with the mature part of the amino acid sequence shown in SEQ ID NO: 4, i.e. posirion 1-726 in SEQ ID NO: 4.
The present invention is also directed to isoamylase variants which have an amino acid sequence which differs by no more than three amino acids, preferably by no more than two amino acids, and mere preferably by no more than one amino acid from the mature part of the amino acid sequence set forth in SEQ ID NO: 4.
Immunological cross-reactivity
Antibodies to ce used in determining immunological cross-reactivity may be prepared by using a purified enzymX. More specifically, antiserum against the enzymX of the invention may be raised by immunizing rabbits (or other rodents) according to the procedure described by N. Axelsen et al. in A Manual of Quantitative Immuncelectrophoresis, Blackwell Scientific Publications, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publications, 1982 (more specifically p. 27-31). Purified immunoglobulins may be obtained from tr.e antiserum obtained, for example by salt precipitation ((NH, - SO^) , followed by dialysis and ion exchange chromatography, e.g. on DEAE-Sephadex. Immunochemical characterization of proteins may be performed either by Outcherlony double-iiffusion analysis (0. Ouchterlony in: Handbook of Experi-ental Immunology (D.M. Weir, Ed.), Blackwell Scientific Publications, 1967, pp. 655-706), by crossed.

Immunoelectrophoresis (N. Axelsen et al., supra. Chapters 3 and 4), or by rocket Immunoelectrophoresis (N. Axelsen et al., Chapter 2).
Microbial Sources
At the priority date of the present invention, the taxonomy applied below are in accordance with the World Wide web (WWW) NCBI taxonomy browser.
It is expected that a DNA sequence coding for a homologous enzyme, i.e. an analogous DNA sequence, is obtain-able from
other micro-organisms. For instance, the DNA sequence may be derived by similarly screening a cDNA/genomic DNA library of another micro-organism, in particular a bacteria, such as a strain of a Rhodothermus sp., in particular a strain of R.
marinus or R. obamensis, Sulfolobus acidocaldarius, especially
R. marinus DSM 4252.
Deposited strain
The complete full length DNA sequence encoding the isoamylase cloned from Rhodothermus marinus DSM 4252 has been
transformed into a strain of the bacterium E. coli DH12S, com¬
prised in the plasmid pUC19. Said transformant has been
deposited by the inventors according to the Budapest Treaty on
the International Recognition of the Deposit of Microorganisms
for the Purposes of Patent Procedure at the Deutshe Sammlung
von Mikroorganismen und Zellkulturen GmbH., Mascheroder Weg lb,
D-38124 Braunschweig Federal Republic of Germany, (DSM).
Deposit date: 29.01.98
Depositor's ref.: NN049374 DSM designation : Escherichia coli DSM 11971
Being an International Depository Authority under the Buda-pest Treaty, Deutshe Sammlung von Mikroorganismen und Zell-kulturen GmbH., affords permanence of the deposit in accordance with the rules and regulations of said treaty, vide in particular Rule 9. Access to the two deposits will be avail¬able during the pendency of this patent application to one determined by the Commisioner of the United States Patent and

Trademark Office to be entitled thereto under 3 7 C.F.R. Par. 1.14 and 3 5 U.S.C. Par. 122. Also, the above mentioned deposits fulfill the requirements of European patent applications relating to micro-organisms according to Rule 28 EPC.
The above mentioned deposit represents a substantially pure culture of the isolated bacteria. The deposit is available as required by foreign patent laws in countries wherein counter-parts of the subject application, or its progeny are filed. However, it should be understood that the availability of the deposited strain does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
The DNA sequence of the invention, having the nucleotide sequence shown in SEQ ID NO: 3, can be cloned from the above mentioned strain Escherichia coli DSM 11971 using standard
cloning techniques e.g. as described by Sambrook et al.,
(1989), Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab.; Cold Spring Harbor, NY.
The DNA sequence of the invention can also be cloned by any general method involving
• cloning, in suitable vectors, a genomic DNA library from any organism expected to produce the isoamylase of interest,
• transforming suitable E.coli host cells with said vectors,
• culturing the host cells under suitable conditions to ex¬press any enzyme of interest encoded by a clone in the genomic DNA library, and
• isolating the enzyme encoding DNA from such clones.
A more detailed description of the screening method is given in a working example herein {vide infra) .
Alternatively, the DNA encoding an isoamylase of the invention may, in accordance with well-known procedures, conveniently be cloned from a suitable source, such as any of organisms mentioned in the section "Microbial Sources", by use of hybridization to synthetic oligonucleotide probes prepared ^ on the basis of a DNA sequence disclosed herein. For instance, a suitable oligonucleotide probe may be prepared on the basis of or preferably be the isoamylase encoding part of the

nucleotide sequences presented as SEQ ID NO: 3 or any suitable sub-sequence thereof, or the basis of the amino acid sequence SEQ ID NO: 4.
Alternatively, the DNA sequence may be cloned by use of PCR primers prepared on the basis of the DNA sequence disclosed herein.
Recombinant expression vectors
A recombinant vector comprising a DNA construct encoding the enzyme of the invention may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as
an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome in part or in its entirety and replicated together with the chromosome(s) into which it has been integrated.
The vector is preferably an expression vector in which the DNA sequence encoding the enzyme of the invention is operably linked to additional segments required for transcription of the DNA. In general, the expression vector is derived from plasmid or viral DNA, or may contain elements of both. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence coding for the enzyme.
The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
Examples of suitable promoters for use in bacterial host cells include the promoter of the Bacillus stearothermophilus
maltogenic amylase gene, the Bacillus licheniformis alpha-
amylase gene, the Bacillus amyloliquefaciens alpha-amylase
gene, the Bacillus subtilis alkaline protease gen, or the

Bacillus pumilus xylosidase gene, or the phage Lambda P^ or P^ promoters or the E. coli lac, trp or tac promoters.
The DNA sequence encoding the enzyme of the invention may also, if necessary, be operably connected to a suitable terminator.
The recombinant vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
The vector may also comprise a selectable marker, e.g. a
gene the product of which complements a defect in the host cell, or a gene encoding resistance to e.g. antibiotics like
kanamycin, chloramphenicol, erythromycin, tetracycline, spectinomycine, or the like, or resistance to heavy metals or herbicides.
To direct an enzyme of the present invention into the secretory pathway of the hosL cells, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) may be provided in the recombinant vector. The secretory signal sequence is joined to the DNA sequence encoding the enzyme in the correct reading frame. Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the enzyme. The secretory signal sequence may be that normally associated with the enzyme or may be from a gene encoding another secreted protein.
The procedures used to ligate the DNA sequences coding for the present enzyme, the promoter and optionally the terminator and/or secretory signal sequence, respectively, or to assemble these sequences by suitable PCR amplification schemes, and to insert them into suitable vectors containing the information necessary for replication or integration, are well known to persons skilled in the art (cf., for instance, Sambrook et al., op.cit.).
Host cells
The DNA sequence encoding the present enzyme introduced into the host cell may be either homologous or heterologous to the host in question. If homologous to the host cell, i.e. pro¬duced by the host cell in nature, it will typically be oper-

ably connected to another promoter sequence or, if applicable, another secretory signal sequence and/or terminator sequence than in its natural environment. The term "homologous" is intended to include a DNA sequence encoding an enzyme native to the host organism in question. The term "heterologous" is intended to include a DNA sequence not expressed by the host cell in nature. Thus, the DNA sequence may be from another organism, or it may be a synthetic sequence.
The host cell into which the DNA construct or the recombinant vector of the invention is introduced may be any cell which is capable of producing the present enzyme and includes bacteria, yeast, fungi and higher eukaryotic cells.
Examples of bacterial host cells which, on cultivation, are capable of producing the enzyme of the invention are gram-positive bacteria such as strains of Bacillus, such as strains
of B. subtilis, B. lichenifcrmis, B. lentus, B. brevis, B.
stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B.
coagulans, B. circulans, B. lautus, B. megatherium or B.
thuringiensis, or strains of Streptomyces, such as S. lividans
or S. murinus, or gram-negative bacteria such as Echerichia
coli. The transformation of the bacteria may be effected by
protoplast transformation, electroporation, conjugation, or by using competent cells in a :nanner known per se (of. Sambrook et al., supra) .
When expressing the enzyme in bacteria such as E. coli,
the enzyme may be retained in the cytoplasm, typically as insoluble granules (known as inclusion bodies), or may be directed to the periplasmic space by a bacterial secretion sequence. In the former case, the cells are lysed and the granules are recovered and denatured after which the enzyme is refolded by diluting the denaturing agent. In the latter case, the enzyme may be recovered from the periplasmic space by disrupting the cells, e.g. by sonication or osmotic shock, to
release the contents of the periplasmic space and recovering the enzyme.
When expressing the enzyme in gram-positive bacteria such as Bacillus or Streptomyces strains, the enzyme may be retained

in the cytoplasm, or may be directed to the extracellular medium by a bacterial secretion sequence. In the latter case, the enzyme may be recovered from the medium as described below. Suitable eukaryotic cells are in particular fungal cells such as yeasts. Examples of suitable yeast cells include cells of Saccharomyces
spp., in particular strains of Saccharomyces cerevisiae, Sac¬charomyces kluyveri, Sacchromyces uvarum, or Schizosaccharomyces spp., such as Schizosaccharomyces pombe.
Methods for transforming yeast cells with heterologous DNA and producing heterologous polypeptides there from are de¬scribed, e.g. in US pacenc no. 4,599,311, US patent no.
4,931,373, US patent no. 4,870,008, US patent no. 5,037,743, and US patent no. 4,845,075, all of which are hereby incorporated by reference. Transformed ceils are selected by a phenotype deter¬mined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient, e.g.
leucine. A preferred vector for use in yeast is the POTl vector disclosed in US patent no. 4,931,3 73. The DNA sequence encoding the polypeptide of the invention may be preceded by a signal se¬quence and optionally a leader sequence , e.g. as described
above.
Further examples of suitable yeast cells are strains of Can¬dida spp., such as Candida utilis, Candida hoidinii, or strains of Kluyveromyces spp., such as K. lactis, or strains of Han-senula spp., e.g. H. polymcrpha, or strains of Pichia spp., e.g. Pichia methanolica, Pichia angusta, Pichia pastoris or Pichia anomala, Yarrowia spp., such as Yarrowia lipolytica (cf. Gleeson
et al., J. Gen. Microbiol. 132, 1986, pp. 3459-3465; US patent no. 4,882,279).
Method of producing isoamylase
The present invention provides a method of producing an isolated enzyme according to the invention, wherein a suitable host cell, which has been transformed with a DNA sequence encoding the enzyme, is cultured under conditions permitting

the production of the enzyme, and the resulting enzyme is recovered from the culture.
When an expression vector comprising a DNA sequence encoding the enzyme is transformed into a heterologous host cell it is possible to enable heterologous recombinant production of the enzyme of the invention.
Thereby it is possible to make a highly purified isoamylase composition, characterized in being free from homologous impurities.
According to the present invention the heterologous host cell may e.g. be a strain of E. coli, Bacillus spp.,
Saccharomyces, Candida, Pichia, Hansenula.
The medium used to culture the transformed host cells may be any conventional medium suitable for growing the host cells in question. The expressed isoamylase may conveniently be secreted into the culture medium and may be recovered therefrom by well-known procedures including separating the cells from the medium by centrifugation or filtration, precipitating proteinaceous components of the medium by means of a salt such as ammonium sulphate, followed by chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.
Isolated pure culture
The invention also relates to an isolated substantially pure biological culture of the Escherichia coli strain DSM
11971 harboring an isoamylase encoding DNA sequence (the isoamylase encoding part of the DNA sequence cloned into plasmid pUC19 present in Escherichia coli DSM 11971) obtained
from a strain of the bacteria Rhodothermus (it will be
understood that any mutant of said E.coli strain having
retained the isoamylase encoding capability is considered to be included in the present invention); and to an isolated substantially pure biological culture of Rhodothermus marinus
DSM 4252 (it will be understood that any mutant of said Rhodothermus marinus strain having retained the isoamylase
encoding capability is considered to be included in the present

invention),from which the DNA sequence presented as SEQ ID NO: 3 has been obtained.
Cloning of a DNA secnience from a strain of Sololobus
The invention also relates to a cloned DNA sequence encoding an enzyme with isoamylase activity derived from a strain of Sulfolobus. The DNA sequence may be derived from a
strain of Sulfolobus acidocaldarius or Sulfolobus solfataricus.
The sequences may be the DNA sequences encoding an isoamylase from Sulfolobus acidocaldarius disclosed in Biochim.
Biophys. Acta, 1291, p.177-181 (1996), it may be the DNA sequence from Sulfolobus solfataricus available in GeneBank
under the Accession no. ¥08256.
The invention further relates to a recombinant expression vector comprising a cloned DNA sequence derived from Sofolobus as described above, in particular the DNA sequence
disclosed in Biochim. Biophys. Acta, 1291, p.177-181 (1996) and GeneBank, Accession no. Y08256.
Furthermore the invention relates to a host cell comprising a cloned DNA sequence from Sofolobus of the invention or a
recombinant expression vector comprising a DNA sequence from Sofolobus of the invention.
The host of the invention may be a eukaryotic cell, in particular a fungal cell, such as a yeast cell or a filamentous fungal cell.
Specifically the host cell may be selected within the group in¬cluding a strain of Saccharomyces, Candida, Pichia, Hansenula,
Fusarium, Aspergillus, Trichoderma, in particular a strain of
Saccharomyces cerevisiae, Candida utilis, Candida boidinii,
Pichia methanolica, Pichia an-gusta, Pichia pastoris, Pichia
anomala, Fusarium ATTC 20334, Aspergillus niger, Asper-gillus
oryzae, Trichoderma harzianum or Trichoderma reesei.
Finally the invention relates to method of producing an enzyme exhibiting isoamylase activity encoded by a cloned DNA sequence of the invention, the method comprising culturing a host cell of the invention, under conditions permitting the

production of the enzyme, and recovering the enzyme from the culture.
Cloning of the Sulfolohus acidocaldarius DNA sequence
disclosed in Biochim. Biophys. Acta, 1291, p.177-181 (1996) is described below.
MATERIALS AND METHODS
Enzymes:
Promozyme®: Pullulanase (available from Novo Nordisk) derived
from Bacillus acidopullulyticus (described in EP 63,909).
AMG: Aspergillus niger glucoamylase (available from Novo
Nordisk A/S)
SP935 a-amylase: Bacillus licheniformis a-amylase having the
following mutations:
A1*+N2*+L3V+M15T+R2 3K+S2 9A+A30E+Y31H+A33S+E34D+H35I+H15 6Y+A181T+
N190F+A209V+Q264S (see WO 97/41213 from Novo Nordisk A/S).
Deposited micro-organism(s): Transformant strain:
An E. coli DH12S comprising the full length isoamylase
cloned from Rhodethermus marinus DSM 4252 has been deposited
according to the Budapest Treaty at the Deutshe Sammlung von
Mikroorganismen und Zellkulturen GmbH., Mascheroder Weg lb, D-
38124 Braunschweig Federal Republic of Germany, (DSM).
Deposit date : 29.01.98
Depositor's ref. : NN049374
DSM designation : Escherichia coli DSM 11971
E.coli Top 10 (Invitrogen)
Plasmid:
pBAD/Myc-His A,B,C (Invitrogen)
pUC19
Solutions and Media
LB medium: 1 % bacto tryptone, 0.5 % bacto yeast extract, 1%
NaCl, pH 7.

SOB medium: 2 % bacto tryptone, 0.5 % yeast extract, 0.05 % NaCl, 2.5 mM KCl, 10 mM MgS04, pH 7.
Iodine solution: 2 ml of distilled water, 40 ml of 0.2 % I^, 2.0 % KI and 0.2 % H^SO,.
Methods:
General molecular biology methods:
Unless otherwise mentioned the DNA manipulations and transformations were performed using standard methods of molecular biology (Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab.. Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.) "Current protocols in Molecular Biology". John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990).
Enzymes for DNA manipulations were used according to the specifications of the suppliers.
Enzymes for DNA manipulations
Unless otherwise mentioned all enzymes for DNA manipula¬tions, such as e.g. restriction endonucleases, ligases etc.,
are obtained from New England Biolabs, Inc.

Accordingly the present invention provides a starch conversion process for producing syrup comprising the steps of:
(a) liquefying starch at a pH value between 4.5 and 6.5 at temperatures of 70-110®C for between 30 and 180 minutes,
(b) saccharifying the Uquefied starch obtained from step (a) at a temperature from 50-80°C, at a pH in the range from pH4.5-6.5 for a period of 24-72 hours in the presence of AMG (glucoamylase)
(c) recovering the syrup;
wherein an isoamylase derived from a strain of Rhodothermus is added during tiie saccharification step (b).

EXA24PLES
Example 1
PCR screening for isoamylase a) PCR conditions
To provide thermostable isoamylases an alignment of five known isoamylases of which the protein sequence data is avail¬able was made (see table 1).



Two conserved regions (see i6 and i7 below) without too much degeneration were identified. i6: RFNPNKL(V)L (residues 136-143 of Pseudomonas amyloderamosa
isoamylase)
i7: NYWGYMT (residues 272-278 of Pseudomonas amyloderamosa
isoamylase)
PCR primers were designed based on said conserved regions, primer iso 6:
5'-gitt(tc)aa(tc)cciaa(tc)aa(ag)(teg)ti(tc)t-3' (SEQ ID NO: 1)
primer iso 7: 5'-gtcat(ga)taicccca(ag)ta(ga)tt -3' (SEQ IDN0:2)
Genomic DNA stocks of a number of bacterial strains were
prepared with the method described in "Current Protocols in Mo¬
lecular Biology, unit 2.4 Preparation of Genomic DNA from Bac¬
teria". PCR conditions are shown follows,
Genomic DNA 2 0 0ng
primer iso 6 2|al of 100 pmole/fil (200 pmole)
primer iso 7 2|LI1 of 100 pmole/fal (200 pmole)
2 . 5mM dNTP mixture 2 |al 10 X Gene-Taq buffer 10 ^il Gene-Taq DNA polymerase 2 units HoO was added to a total of 100 f^l
PCR cycles were run at the following program: 94°C for 5 min, 50°C for 1.5 min, 72°C for 3 minutes, and 94°C for 1.5 min, 50°C for 1.5 min, 72°C for 3 min repeat 24 times, and then 94°C for 1.5 min, 50°C for 1.5 min, 72°C for 15
min.
Ten ml aliquots of each PCR are applied on an 1.5% agarose gel to visualise the expected 450 bp fragment.

b) Sequencing of positives
The purified fragments were ligated to T-vector (Novagen) with DNA ligation kit (Takara Ver2.).
Using the ligated mixture, the transformation of competent E. coli JM109 were carried out by Hanahan's method. The trans-formants bearing the fragments were cultivated and the plasmids were prepared with QIAgen miniprep kit. The purified plasmids are utilized as the template DNA in cycle sequencing reaction (PRISM Dyedeoxy Terminator Cycle Sequencing Mix) of both strands using Universal primers. The seequence was determined with ABI PRISM 310 Genetic Analyzer (Perkin Elmer) and they were aligned with the software MEgAlign (DNA Star, Laser gene).
Five strains yielded fragments of the expected size of about 450 bp, and these were purified, sequenced, and aligned. The fragments had homology with published isoamylase sequences as Table 2. The calculation of homology was done as described previously in this specification.

Among the five, Rhodothermus marinus DSM 4252 and Rhodo-thermus obamensis JCM 9785 with the highest optimum growth tem¬perature (65-70°C) were selected. As the two fragment se¬quences are almost identical, only one of them, Rhodothermus
marinus DSM 4252, was further employed for cloning and expres¬sion.
Example 2
Cloning of a gene encoding a thermostable isoamylase and its expression in E.coli

Using the PCR screening method for isoamylase described above it was found that Rhcdothermus marinus, having a growth
temperature above 60°C, has a gene encoding an isoamylase. The isoamylase gene from Rhcdothermus marinus DSM 4252 was
cloned with colony hybridisation technique as follows: a!Southern hybridisation
Rhodothermus marinus genomic DNA was prepared according
to the methods described in "Current Protocols in Molecular Bi¬ology, unit 2.4 Preparation of Genomic DNA from Bacteria". Southern blotting was carried out with the methods described in "Current protocols in Molecular Biology, unit 2.9.1 Southern blotting". The membrane with genomic DNA fragments was prehy-bridised in a hybridisation solution (5 x SSC, 0.5% blocking reagent (Boehringer Mannheim), 0.1% N-lauroylsarcosine, and 0.02% SDS) at 68° C for 1 hour. Then it was hybridised in the hybridisation solution including lOng/ml of the probe which was the fragment obtained by PCR screening labeled by DIG DNA la¬beling Mix (Boehringer Mannheim) at 68°C for 12 hours. Then the probe was detected by DIG Nucleic Acid Detection Kit (Boehringer Mannheim).
Southern hybridisation showed that about 7 kbp EcoRI di¬gested fragment of genomic DNA hybridized with the probe. The EcoRI digested genomic DNA i6 to 8 kbp) were extracted from 1% agarose gel with Gel extraction kit (QIAgne).
b)Colony hybridisation
The fragments digested by EcoRI was ligated into pUC 19 to make a genomic DNA library. It was transformed to E.coli
DH12S Electromax (GIBCO BRL) by electroporation and plated onto LB plate including 200 mg/ml ampicillin. After overnight culti¬vation at 37° C these colonies were replicated to a nylon mem¬brane. It was soaked into denaturing solution (1.5 M NaCl and 0.5 M NaOH) for 7 min and then neutralising solution (1.5 M NaCl, 0.5M Tris-HCl pH 7.2), and O.OOIM EDTA). Hybridisation conditions were same as southern hybridisation.
Among 10 0 0 transformants that were screened by colony hy¬bridisation, 3 colonies hybridised with the probe.

c)Analysis by restriction of positive clones
Plasmids were prepared from 3 transformants, and southern hybridization showed that these 3 transformants had the same insertion of a 7 kbp EcoRI fragment which hybridised with the probe.
The restriction enzyme map of one of the positive clones named pRI5A, was determined and it is shown in Figure 1.
a)Sequencing of Isoamylase gene
The isoamylase gene nucleotide sequence was determined using ABI PRISMTM 310 Genetic Analyzer. The sequencing reaction was carried out using dye terminator cycle sequencing FS ready reaction kit (P/N 402153). The reaction was followed by the protocol mentioned by PE Applied Biosystems.
Primers were designed from the determined sequence of the probe location. Determined 2178 bp of ORF and the deduced amino acid sequence are shown in SEQ ID NO: 3. The sequence of the probe for hybridisation is nt.342-770 of SEQ ID NO:3.
e)Expression vector
pBAD/Myc-His B was used for expression.
f;Cloning of Isoamylase gene for expression
The R. marinus isoamylase gene was cloned by PCR from
pRI5A. The primers
Primer N: gtcagtagcccatggcacattagcgc (SEQ ID NO: 5)
Primer BX2: ctcggccggactagatctgtcttc (SEQ ID NO: 6)
Ncol site was designed in the primer N. ATG of the Ncol site was used as the start codon. Due to the Ncol site ;ccatgg), the second amino acid Serine changed to Alanine. In the primer BX2, the Xbal site was designed behind the stop codon.
PCR was carried out the following conditions using primer N and primer BX2.
Genomic DNA lOOng
sense primer 1 ml of 100 pmole/ml (100 pmole)
antisense primer 1 ml of 100 pmole/ml (lOOpmole)

2.5mM dNTP mixture 2 ml
lOx buffer 5 ml
Taq DNA polymerase 1 unit
H20 was added to total up to 50 ml
PCR cycles were run at the following program.
94°C 5 min, 60°C 1.5 min, 72°C 3 min, then 94°C 1.5 min, 60°C
1.5 min, 72°C 3 min, repeat 24 times, and 94°C 1.5 min, 60°C 1.5
min, 72°C 15 min.
The obtained fragment (about 2kbp) was treated with Ncol
and Xbal , then it was ligated with pBAD/Myc-His B and trans-
formant harbouring the plasmid named pBX2 was obtained. The
host for expression was E.coli ToplO.
g)Expression condition
The transformant with pBX2 was cultivated in 100 ml of LB medium, including 200 mg/ml ampicillin at 37°C for overnight. One ml seed culture was inoculated to 100 ml of SOB medium in¬cluding 200 mg/ml ampicillin and was cultivated at 37°C for 2.5 hours. Then 100 ml of 20% arabinose was added to induce the re¬combinant proteins. The cultivation was continued at 37°C over¬night. Next day, the cells were harvested by centrifugation. The cells were washed with 50 mM Sodium citrate buffer (pH 5.0). Then the cells were suspended with the same buffer in¬cluding 1 mg/ml of lysozyme and stored at 4°C for 1 hour. After lysozyme treatment the cells were disrupted by ultrasonication. The supernatant was obtained by centrifugation at 18,000 rpm for 30 minutes. The debris was disrupted by ultrasonication again. The ultrasonication treatment was repeated once more. Finally, the supernatant was gathered and it was heated at 70°C for 1 hour to remove the proteins from the host strain. Cen¬trifugation at 18,000 rpm for 30 minutes was carried out and the supernatant constituted the crude isoamylase sample.
Example 3
Characterisation of the cloned Rhodothermus marinus isoamylase
a)Assay method
Isoamylase character was investigated by the following as¬say method. 2 50 ml of 1% amylopectin from waxy rice and 50 ml of 50 mM citrate buffer were pre-incubated for 5 minutes. The

reaction was started by adding 50 ml of enzyme solution. After 10 minutes of incubation, 40 ml of reaction mixture was put into the Iodine solution (2 ml of D.W. and 40 ^1 of 0.2 % l^, 2.0 % KI and 0.2 % H^SOJ . Then its OD600 value was measured. Distilled water was added instead of enzyme solution in the blank.
b)pH optimum at 5 0°C
The pH optimum of the Rhodothermus isoamylase was deter¬mined. The reaction was carried out at 50°C. The pH optimum was determined to pH 5.0. The pH curve is shown in Figure 2.
c)Temperature optimum at pH 5.0
Temperature optimum of the Rhodothermus isoamylase was
determined. The reaction was carried out at pH 5 at between 30° - 8 9°C. The optimum temperature was determined to be around 85°C. The temperature curve is shown in Figure 3.
d)Molecular weight and pi
The M„ of Rhodothermus was determined by SDS PAGE. SDS
PAGE was carried out using Phast system with gradient gel 10-15 (Pharmacia Biotech). The M„ of the recombinant protein was cal¬culated to 80 kDa.
e)N-terminal acmino acid sequence of the recombinant protein
N-terminal amino acid sequence of the recombinant protein was determined. The result was identical with the deduced amino acid sequence from nucleotide sequence (Serine was changed to Alanine because of primer N).
Example 4
Starch conversion using the Rhodothermus isoamylase
To test the effect of the Rhodothermus marinus isoamylase
on the glucose yield in starch conversion processes a standard two step starch conversion process was performed with/without adding isoamylase in the liquefaction and saccharification
steps.

The standard starch convention process
A 30% w/w DE 10 maltodextrin prepared from common corn starch
was used as the starting material.
The liquefaction step was carried out at 80°C, pH 5.5, for 90 minutes in the presence of an a-amylase variant (8 mi-crogram/gram Dry Solid).
The saccharification step was carried out at 60°C, pH 4.5, for a period of 48 hours in the presence of AMG (0.18 AGU/ gram Dry Solid) with/without addition of a pullulanase (Promozyme®) (0.06 PUN/gram Dry Solid).
In Table 3 shown in Figure 7 the tests performed and ef¬fect of the isoamylase on the DPI, DP2, DP3 and DP4+ yields are listed.
Addition of isoamylase in the liquefaction step
As can be seen from said Table 50 or 200 micrograms/gram Dry Solid Rhodothermus marinus isoamylase was added in TEST
3,4,8 and 9 during liquefaction. In TEST 1, 5 and 7 the a-amylase was inactivated after 90 minutes of liquefaction by ad¬justing the pH to 3.0 for 15 minutes at 80°C.
In all tests where isoamylase is added a lower DP4+ yield is obtained. This indicate that the substrate has been more ac¬cessible to the a-amylase and the AMG.
By comparing TEST 2 (i.e. no isoamylase added) with 3 and 4
(i.e. isoamylase added) it can be seen that the DP3 (i.e.
panose) yield is reduced from 1.2% to 1.0% and 0.9%, respec¬tively, and that the DPI (i.e. glucose) yield is increased from
96.3% to 96.5% and 96.8%, respectively.
Addition of isoamylase in the saccharification step
In TEST 7 isoamylase was added during the saccharifica¬tion step. By comparing TEST 7 with TEST 5, it can be seen that the DP3 (i.e. panose) yield is reduced from 0.5% to 0.4%, and
that the DPI (i.e. glucose) yield is increased from 93.2% to
94.8%

Conclusion:
The addition of the Rhodothermus marinus isoamylase dur¬ing starch conversion results in an increased glucose yield.
Example 5
Cloning and expression of Sulfolobus acidocaldarius isoamylase
gene
a)Cloning of isoamylase gene
The isoamylase gene from Sulfolobus acidocaldarius was
cloned by PCR. The primers were designed based on the sequence shown in the article of Table 1.
primer SINE:
5'-gtatatcaaagcttatgaaagatcgaccattaaagcctg-3' (SEQ ID NO:7)
primer SICX:
5'-ggttgtctagatcactggaactctatcctcctgta-3' (SEQ ID NO:8)
PCR was carried out by the procedure described in Example 2-f.
The right size fragment (about 2kb) was obtained and it was purified using PCR purification kit (QIAgen). The purified frag¬ment was treated with Hindlll and Xba I.
b)Constraction of expression vector
Expression vector was constracted from pJS026 which has TPI promoter (Annals New York Academy of Sciences, vol782, p202 J.S.Okkels). pJSOHX was made from pJS026 to delete BamHI site and add Hindlll site using following 2 oligonucleotide as casset, gatcaagcttggaattcgctcgagct (SEQ ID NO: 9) and ctagagctcgagcgaattccaagctt (SEQ ID NO: 10) .
Cloned gene from Sulfolobus acidocaldarius was inserted at
Hind III and Xbal site of pJSOHX and expression vector named pFSI82 was obtained. pFSI 82 was transformed to Saccharomyces
cerevisiae YNG318. pFSI82 map is shown in Figure 4.
b) Expression procedure
The transformant harbouring pFSI82 was cultivated in 100 ml YPD for 2 days. The cells were harvested by centrifugation at

5,000 rpm for 5 min and spheroplast was made with a basic pro¬tocol (Bio manual series 10, Yodosha). The spheloplast was dis¬rupted by ultrasonication and cell extract was heat treated at 70°C for 3 0 min. The debris was removed by centrifugatioin at 14,000 rpm for 30 min and the supernatant constituted the crude isoamylase sample.
Example 6
Characterizaation of the cloned Sulfolobus acidcaldarius
isoamylase
The recombinant isoamylase was characterized using the as¬say described in Example 3-a.
a) pH optimum at 70°C
The pH optimum of the Sulfolobus acidocaldarius isoamy¬lase was determined. The Reaction was carried out at 70°C. The checked pH was between pH 3.5-7.5. The pH optimum was deter¬mined to pH 5.5. The pH curve is shown in Figure 5.
b) Temperature optimum at pH 5.5
Temperature optimum of the Sulfolobus isoamylase was de¬termined. The reaction was carried out at pH5.5 at between 40° - 90° C. The optimum temperature was determined to be around 70° C. The temperature curve is shown in Figure 6.

This application is divided out of Indian Patent application No.l483/MAS/98 which relates to a starch conversion process for producing syrup. According to that invention, isoamylase together with alpha-amylase is added during the liquefaction stage.
The subject invention relates to addition of isoamylase together with glucoamylase during sacchariflcation stage.

WE CLAIM:
1. A starch conversion process for producing syrup comprising the steps of:
(a) liquefying starch at a pH value between 4.5 and 6.5 at temperatures of 70-110C for between 30 and 180 minutes,
(b) saccharifying the liquefied starch obtained from step (a) at a temperature from 50-80C, at a pH in the range from pH4.5-6.5 for a period of 24-72 hours in the presence of AMG (glucoamylase);
(c) recovering the syrup;
wherein an isoamylase derived from a strain of Rhodothermus is added during the saccharification step (b).
2. The process as claimed in claim 1, wherein the isoamylase derived from the genus of Rhodothermus is derived from a strain of Rhodothermus marinus, especially Rhodothermus marinus DSM 4252.
3. The process as claimed in claims 1 or 2, wherein calcium is added during liquefaction in amounts of from 0.75 to 1.25 mM, such as around ImN.
4. The process as claimed in any one of claims 1 to 3, wherein the liquefying alpha-amylase is inactivated before the saacharification step.

5. The process as claimed in any one of claims 1 to 4, wherein the alpha-amylase is a Bacillus licheniformis alpha-amylase or a Bacillus stearothermophilus alpha-amylase or a Pyrococcus furiosus alpha-amylase.
6. The process as claimed in any one of claims 1 to 5, wherein the saccharification step is followed by an isomerization step.
7. The process as claimed in any one of claims 1 to 6, wherein the isoamylase is obtained from a strain of the genus Rhodothermus and has
(i) isoamylase activity in the pH range of 3.5 to 6.5 and an optimum at around pH 5, measured at 50C,
(ii) a molecular mass of about 80 kDa, as determined by SDS-PAGE; (iv) an isoelectric point (pI) in the range of 5.2-5.8.
8. The process as claimed in claim 7, wherein the strain is Rhodothermus marinus, especially Rhodothermus marinus DSM 4252.
9. The process as claimed in claims 1 to 8, wherein the isoamylase is selected from the group consisting of:

(a) a polypeptide encoded by the isoamylase enzyme encoding part of
the DNA sequence cloned into plasmid pUC19 percent in
Escherichia coh DSM 11971; (b)a polypeptide comprising an amino acid sequence as shown in
positions 1-726 of SEQ ID NO:4; (c) an analogue of the polypeptide defined in (a) or (b) which is at
least 70% homologous with said polypeptide; and a fragment of
(a),(b)or(c).
10. A starch conversion process for producing syrup substantially as herein described.

Documents

Application Documents

# Name Date
1 0052-mas-2001 form-4.pdf 2011-09-02
2 0052-mas-2001 form-3.pdf 2011-09-02
3 0052-mas-2001 form-1.pdf 2011-09-02
4 0052-mas-2001 drawings.pdf 2011-09-02
5 0052-mas-2001 description (complete).pdf 2011-09-02
6 0052-mas-2001 correspondence others.pdf 2011-09-02
7 0052-mas-2001 claims.pdf 2011-09-02
8 0052-mas-2001 abstract.pdf 2011-09-02