AN L-AMINO ACID-PRODUCING BACTERIUM AND A METHOD FOR PRODUCING AN L-AMINO ACID
BACKGROUND OF THE INVENTION
Technical Field
The present invention relatea to a method for producing an L-amino acid such aa L-cysteine. More precisely, the present invention relates to a bacterium suitable for production of an L-mino acid and a method for producing an L-amino acid utilizing such a bacterium. L-Amino acids are used in the various fields, for example, those of seasonings, food additives, feed additives, chemicals, drugs, and so forth.
Background Art
L-Amino acids are industrially produced by fermentation using microorganisms belonging to the genua BrGvibacteriim, Corynebacterlum, Escherichia, or the like. In such methods, strains are used which are Isolated from nature or artificial variants of Huch strains. Furthermore, microorganism strains can be used which are modified by recombinant DNA techniques so that activity of a baalo L-amino acid biosynthesis enzyme ia Increased, and ao forth (EP 0643135 B, EP 0733712 B, EP 1477565 A, EP 079691i A, EP 0837134 A, WOOl/53459, EP 1170376 A, WO5005/n U)17rt, WO96/17930, WO2006/013807).
Furthermore, L-cysteine, for example, Is obtained by extraction from keratin-containing substances ouch as hairs, horns and feathers or conversion of DL-2-aminothiazoline-4-carboxylic acid as a precursor using « microbial enzyme. It is also planned to produce L-cysteine in a large scale by an immobilized enzyme method utilizing a novel enzyme.
Furthermore, it is also attempted to produce L-
cysteine by fermentation utilizing a bacterium. For example, the inventors of the present invention diacloaed a method for producing L-cysteine using an Escherichia bacterium having a suppressed L~cysteine decomposition system and a serine acetyltransferase (EC 2.3.1.30, henceforth also referred to as "SAT") of which feedback inhibition by L-cysteine is attenuated (Japanese Patent Laid-open (Kokai) No. 11-155571) . Furthermore, as bacteria in which L-cysteine-producing ability is enlianced by suppressing the L-cysteine decomposition system, there are known coryneform bacteria or Escherichia bacteria in which activity of cystathionine-(i~lyase (Japanese Patent Laid-open (Kokai) No. 11-155571), tryptophanaae (Japanese Patent Laid-open No. 2003-169668), or 0-acetylaerine sulfhydrylase B (Japanese Patent Laid-open No. 2005-245311) is attenuated or deleted. A method for producing L-cysteine by using a bacterium in which L-cysteine metabolism is decontrolled by using a DNA sequence coding for SAT that has a specific mutation for attenuating feedback inhibition by L-cysteine is also known (National Publication of Translated Version in Japan (Kohyo) No. 2000-504926).
Furthermore, it is known that the ydeD gene which encodes the YdeD protein (Dabler et al., Mol. Microbiol., 36, 1101-1112 (2000)) and the yfiK gene which encodes the YfiK protein (Japanese Patent Laid-open No. 2004-49237) participate in secretion of the metabolic products of the cysteine pathway. Furthermore, there are also known techniques of enhancing L-cysteine-producing ability by increasing expression of the mar-locus, acr-locus, cmr-locus, inex-gene, ijwir-gene or q3cA~gene, which encode proteins suitable for secreting a toxic substance from cells (U.S. Patent No. 5,972,663), or emrAB, emrKY, yojIH, acrEF, bar or cusA gene (Japanese Patent Laid-open No. 2005-287333).
Moreover, there has also been roporlecl a melhod \'oc producing L-cysteine using a bacterium which overexpniawtifH a gene coding for a protein suitable for releasing an antibiotic or a substance toxic to a bacterium directly from a cell (Japanese Patent Laid-open No. 11-5638:1) .
Moreover, it is known that productivity of bacteria for L-amino acids, not only L-cysteine, can be improved by improving expression of an L-araino acid secretion protein. It is known that, in coryneform bacteria, L-lysine production is improved by increasing expression of an L-lysine secretion carrier, named LysE (Japanese Patent Laid-open No. 2000-189180). Furthermore, for Escherichia bacteria, several membrane proteins expected to be amino acid secretion carriers are known. For example, it has been reported that, by increasing copy number of a gene named rhtB, resistance to high concentration L-homoserine, L-threonine, L-alanine, L-valine, and L-isoleucine is improved, and it is expected that the product of this gene is a secretion carrier of these L-amino acids (Japanese Patent Laid-open No. 2000-189180).
The yeaS gene belongs to the family of the aforementioned rhtB gene, of which product is presumed to be a membrane protein, and it has been reported that, by increasing expression amount of this gene, resistance to high concentration L-threonine, L-homoserine, L-lyaine, L-glutamic acid, L-histidine, L-proline and a-aminobutyric acid is improved as compared to a control strain, and by increasing expression of this gene in an L-amino acid-producing bacterium, productivity for L-valine, L-isoleucine, L-alanine, L-proline, and L-histidino is improved (EP 1013765 Al).
As described above, effect of increase of yeaS gene expression on production of various amino acids has bean investigated (Kutukova et al., FEBS Lett., 579, 4629-4 634 (2005)). However, any mutation of the yeaS gene which
improves L-amino acid productivity is not known.
SUMMARY OF THE INVENTION An aspect of the present invention is to develop novel techniques for improving bacterial L-amino acid-producing ability, and thereby provide an L-amino acid-producing bacterium, and a method for producing an L-amino acid using such a bacterium.
This aspect was achieved by finding that L-awino acid-producing ability of a bacterium can bo improved by introducing a specific mutation into the yeaS gene.
It is an aspect of the present invention to provide a method for producing an li-amino acid comprising:
a) culturing in a medi\jm a bacterium belonging to
the family Enterobacteriaaeae, wlilch has an L-amiiK .ncid™
producing ability, and has been modified to have a mutant
yeaS gene having a mutation selected from the group
consisting of:
(I) a mutation for substitution of an amino acid
residue other than threonine residue for the threonine
residue at position 28 in the protein encoded by the yeaS
gene,
(II) a mutation for substitution of an amino acid
residue other than phenylalanine residue for the
phenylalanine residue at position 137 in the protein
encoded by the yeaS gene, and
(III) a mutation for substitution of an amino acid
residue other than leucine residue for the leucine residue
at position 188 in the protein encoded by the yeaS gene,
and,
b) collecting the L-amino acid from the medium,
wherein the yeaS gene without said mutation or
mutations codes for a protein selected from the group consisting of:
(A) a protein, comprising the amino acid sequence of
SEQ ID NO: 2, and
(B) a protein comprising the amino acid sequence of SEQ I.D NO: 2, but wherein 1 to 10 amino acid residues are substituted, deleted, inserted or added, and the ptotein has an activity of improving an L-cysteine-producing ability in the bacterium belonging to the family Bnterohactexiaceae as compared to a non-modified bacterium when expression of the protein ia increased in the bacterium.
It is a further aspect of the present invention to provide the method as described above, wherein the yeaS gene without said mutation or mutations is selected from the group consisting of:
(a) a DNA comprising the nucleotide sequence of SEQ ID NO: 1, or
(b) a DNA which is able to hybridize with a sequence complementary to the nucleotide sequence of SEQ ID NO: 1 or a probe which can be prepared from the nucleotide sequence under stringent conditions, and wherein siald DNA codes for a protein having an activity of improving an L-cyateine-producing ability in the bacterium beloncjing to the family Enterohacteriaceae as compared to a non-modified strain when expression tha protein is increased in the bacterium.
It is a further aspect of the present invention to provide a method as described above, wherein th« iriutHtionM of (I) to (III) are mutations of the following (I.) to (iii), respectively;
(i) a mutation for subHtitution of an osparwgino residue for the threonine residue at position 2B,
(ii) a mutation for siristitution of a serine, glutamine, alanine, histidine, cysteine or glycine residue for the phenylalanine residue at position 137,
(iii) a mutation for substitution of a glutamine residue for the leucine residue at position 188.
It is a further aspect of the present invention to provide the method as described above, wherein the bacterium has a mutant yeaS gene having the mutation of (ii), and in the protein encoded by this gene, a serine or glutamine residue substitutes for the phenylalanine residue at position 137.
It is a further aspect of the present invention to provide the method as described above, wherein the L-amino acid is selected from the group consisting of L-cysteine, L-leucine, L-threonine, L-serine, L-methionine, L~ histidine, L-valine, L-glutamic acid, L-argtnine, L~ isoleucine, L-phenylalanine, L-tyrosine, L-tryptophan, and L-proline.
It is a further aspect of the present invention to provide the method as described above, wherein the L--amlno acid is L-cysteine.
It is a further aspect of the present invention to provide the method as described above, wherein the bacterium has been modified to increase activity of an L-cysteine biosynthesis system enzyme.
It is a further aspect of tlie present invention to provide the method as described above, wherein the bacterium has been modified to increase the serino acetyltransferase activity.
It is a further aspect of the present invention to provide the method as described above, wherein the bacterium has a mutant serine acetyltransferase in which feedback inhibition by L-cysteine is reduced.
It is a further aspect of the present invention to provide the method as described above, wherein tho bacterium is a Pantoea bacterium.
It is a further aspect of the present invention to provide the method as described above, wherein the bacterium is Pantoea ananatis.
It is a further aspect of the present invention to
provide the method as described above, wherein the bacterium is Escherichia coli.
It is a further, aspect of tluj present inventi.on to provide a bacterium belonging to the family Enterohacteriaceae, which has an L-cysteine-producing ability, and has been modified to have a mutant yeaS gene having a mutation selected from the group consisting of:
(I) a mutation for substitution of an amino acid
residue other than threonine residue for the threonine
residue at position 28 in the protein encoded by the yeaS
gene,
(II) a mutation for substitution of an amino acid
residue other than phenylalanine residue for the
phenylalanine residue at position 137 in the protein
encoded by the yeaS gene, and
(III) a mutation for substitution of an amino acid
residue other than leucine residue for the leucine residue
at position 188 in the protein encoded by the yeaS gene,
and,
wherein the yeaS gene without said mutation or mutations codes for a protein selected from the group consisting of:
(A) a protein comprising the amino acid aeqyence of SEQ ID NO: 2, and
(B) a protein comprising the amino acid sequence of SEQ ID NO: 2, but wherein 1 to 10 amino acid residues are substituted, deleted, inserted or added, and the protein has an activity of improving an L-cysteine-producing ability in a bacterium belonging to the family Enterobacteriaceae as compared to a non-modified bacterium when expression of the protein is increased in the bacterium.
It is a further aspect of the present invention to provide the bacterium as described above, wherein the L-amino acid is L-cysteine.
It is a further aspect of the present invention to provide a DNA which codes for a protein selected from the group consisting of:
(A) a protein comprising the amino acid sequence of SEQ ID NO: 2, and
(B) a protein comprising the amino acid sequence of SEQ ID NO; 2, but wherein 1 to 10 amino acid residues are substituted, deleted, inserted or added, and the protein has an activity of improving an L-cysteine-produclng ability in a bacterium belonging to the family Enterobacteriaceae as compared to M non-modified bad erium when expression of the protein is increased in th« bacterium,
wherein the protein has a mtitatlon selected frctm tho group consisting of:
(I) a mutation for sub.'ititniion of an amino acid
residue other than threonine residue for the threonine
residue at position 28,
(II) a mutation for substitution of an amino acdd
residue other than phenylalanine residue for the
phenylalanine residue at position 137, and
(III) a mutation for substitution of an amino acid
residue other than leucine residue for the leucine residue
at position 188.
According to the present invention, L-amino acid-producing ability of a bacterium belonging to the family Eiiterobacteriaceae can be improved. Moreover, by using the bacterium of the present invention, L-amino acids can be efficiently produced by fermentation.
Moreover, the present invention also provides a novel gene coding for a protein having an activity of improving L-amino acid-producing ability of a host cell compared with a non-modified strain.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the sequence of the promoter Pn.lp.
Fig, 2 shows cysteine resistance of a YeaSF137S-enhanced strain of E. coli MG1655 (growth curve). The symbol O represents the results for a wild-type, and the symbol # represents the results for the F137S mut£(nt strain.
Fig. 3 shows amino acid concentrations in culture media of YeaSWT- and YeaSF137S-enhanced strains of P. ananatis.
Fig. 4 shows amino acid concentrations in culture media of YeaSWT- and YeaSF137S-enhanced strains of E. call,
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS <1> Bacterium
The bacterium in accordances with the presently disclosed subject matter has an It-amino acid-producing ability, and has been modified to have a mutant yeaS gene having a specific mutation.
Although the type of the L-amino acid is not particularly limited, examples include basic amino acids such as L-lysine, L-ornithine, L-arginine, L-histd,dine and L-citrulline, aliphatic amino acida such as L-iaoleucine, L-alanine, L-valine, L-leucine and L-glycine, amino acids which are hydroxy-monoaminocarboKylic acids such as T.-threonine and L-serlne, cyclic amino acids auoh aa L proline, aromatic amino acids such as L-phenylalanino, L-tyrosine and L-tryptophan, sulfur-oontaining amino acids such as L-cysteine, L-cystine and L-methionine, and acidic amino acids such as L-glutamic acid, L-aapartic acid, L-glutamine and L-asparagine. L-Cyateine, L~loucirie, L-threonine, L-serine, L-methionine, L-histidlno, l>val,ine, L-glutamic acid, L-arginine, L-lsoleucine, L-phenylalanine, L-tyrosine, L-tryptophan, and L-proline, and espeoially L-cysteine are particular examples. The bacterium in accordance with the presently disclosed subject matter can
have an ability to produce two or more kinds of amino acids.
L-amino acid includes L-araino acid in a free form and salts thereof such as sulfates, hydrochlorides, carbonates, ammonium salts, sodium salts, and potassium salts.
The L-amino acid-producing ability can mean an ability of the bacterium to produce and cause accumulation of an L-amino acid in a medium or cells of the baaterium in such an amount that the L-amino acid can be collected from the medium or cells when the bacterium is cultured in the medium. A bacterium having an L-amino acid-producing ability can mean a bacterium which can produce and cause accumulation of a larger amount of L-amino acid i.ri a medium as compared to a wild-type or parent strain, and a bacterium which can produce and cause accumulation of an L-amino acid in a medium in an amount of 0.2 g/L or mora, 0.3 g/L or more, or even 0.4 g/L or more.
When the L-amino acid is L-cysteine, a part of L-cysteine produced by a bacterium can change into L-cyatine in a medium by formation of disulfide bond. Furthermore, as described below, S-sulfocysteine can be generated by the reaction of L-cysteine and thiosulfuric acid contained in the medium (Szczepkowski T.W., Nature, vol. 182 (1958)). Furthermore, L-cysteine generated in bacterial cells can be condensed with a ketone, aldehyde, or, for example, pyruvic acid, which exists in the cells, to produce a thiazolidine derivative via a hemithioketal as an intermediate (refer to Japanese )?atent No. 2992010). These thiazolidine derivative and hemithioketal can exist as an equilibrated mixture. Therefore, the L-cysteine-producing ability is not limited to ability to accumulate only L-cysteine in a medium or cells, but also includes an ability to accumulate, in addition to L-cysteine, L-cystine or a derivative thereof such as S-sulfocysteine, a
thiazolidine derivative, or a heinlLhioketal or a nilxl.i.iru thereof in the medium. The "L-cyalwirie" produced by the method in accordance with the preaontly disclosed aubjecl: matter refers to, unless specifically mentioned, reduced type L-cyateine, L-cystine, a derivative such aa t.hoMo mentioned above or a mixture thereof.
The bacterium having an L-amino acid-producing ability can be a bacterium inherently having an l.~amino acid-producing ability, or it can be obtained by modifying a bacterium such aa those described below by mutagenesis or recombinant DNA techniques to have an L-amlno ai'id-producing ability.
The bacterium is not particularly limited so long as the bacterium belongs to the family Enterobacteri&ceae such as those of the genera Escherichia, Enterohacter, Pantoea, Klebsiella, Serratia, Erwinla, Salmonella and Morganella, and has L- cysteine-producing ability. Specifically, those classified into the family Enterobacteriaceae according to the taxonomy used in the NCBI (National Center for Biotechnology Information) database
(http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?i d»91347) can be used. As a parent strain of the family Enterobacteriaceae used for the modification, it is desirable to use, especially, a bacterium of the ijenua Escherichia, Enterobacter, Pantoea, Erwinla, or KIebf.iie.lJa.
Although the Escherichia bacteria are not particularly limited, specifically, those described in the work of Neidhardt et al. (Backmann B.J., 1996, Derivations and Genotypes of some mutant derivatives of Esahacichia coli K-12, p.2460-2488, Table 1, In F.D. Neidhardt (ed.), Escherichia coli and SaimoneJia Cellular and Molecular Biology/Second Edition, American Society for Microbiology Press, Washington, D.C.) can be used. Among these, Escherichia coli is one example. Examples of Escherichia
coll include Escherichia coli W311() (ATCC 27325), Escherichia coli MG1655 (ATCC 47076) and so forth derived from the prototype wild-type strain, K12 strain.
These strains are available from, for example, American Type Culture Collection (Address: 12301 Parklawn Drive, Rockville, Maryland 20852, P.O. Box 1549, Manassa», VA 20108, United States of America). That ia, accaaaion numbers are given to each of the strains, and the .«!trainB can be ordered by using these registration numbers (refer to http://www.atcc.org/). The accession numbers of the strains are listed in the catalogue of the American Type Culture Collection.
Examples of the Enterobactav bacteria include Entaro/Dacter agglomerans, Enterobacter aeroc/enes ind MO forth, and examples of the Pantoufi bacteria includo Pantoea ananatia. Some strains ol RnLerobaalior agglomerans were recently rec'laafiiCied into Pantoaa agglomerans, Pantoea ananatin, or I'antoaa atawartii on the basis of nucleotide sequence analywis of 16fJ rRNA
ed later can be applied,
As the SAT gene, any of gi glutamic acid residue for the valine residue at poMillon 65, a mutation for substitution of an alanine residue for the threonine residue at position 72, a mutation for substitution of a serine residue for the asparagine residue at position 77, a mutation for substitution of an isoleucine residue for the phenylalanine residue at position 85, and a mutation for substitution of a phenylalanine residue for the tyrosine residue at position 86. These mutations are those presumed to b© silent mutations not reducing the activity in Example 2 described later. The conservative mutation is not limited to these, and a gene coding for a YeaS protein having an amino acid sequence including substitutions of one or several amino acid residues but maintaining an activity of Improving an L-amino acid-producing ability when expression thereof ie increased in a bacterium belonging to the family Enterobacteriaceae can be obtained from yeaS genea artificially introduced with random mutations, as shown in Example 2.
Furthermore, the gene having such a conservative mutation as described above can bo a gene oncoding a protein showing a homology of 80% or more, 90% or moro, 95% or more, 97% or more, or even 99% or more, to the entire encoded amino acid sequence, and having an activity of Improving an L-amino acid-producing ability of a bacterium belonging to the family Enterobacteriaceaei as compared to a non-modified strain when expression thereof is increased in the bacterium. Sequence information of genes coding for a protein homologous to such YaaS (yeaS homologues) can be easily obtained from databases opened to public by BLAST searching or FASTA searching using the wild-type yeaS gene of the aforementioned EachQiichia aoli
strain as a query sequence, and a yeaS homologue can be obtained by using oligonucleotides produced based on such known gene sequences as primers. The term "homology" can mean "identity".
The yeaS gene can be a gene which hybridizeo with ai sequence complementary to the aforementioned nucleotide sequences or a probe that can be prepared from the aforementioned nucleotide sequenciea under stringent conditions, so long as it is a gene which encodes a protein having an activity of ira|ii'ovlng an tr-amino acid-producing ability of a bacterium btilonging to tho family EnfceroJbactrerlaceae when expression thereof la incueam'iid In the bacterium. Examples of tlie "stringent conditlonti" include conditions of washing at (lO'C, IxSSC, 0. ;i% B\>ti, preferably 60''C, O.lxssc, 0.1% SDH, once or preferably twice or three times.
The probe used for the aforamentioned hybridization can have a partial sequence of a complementary a«quence of the gene. Such a probe can be prepared by PCR uaJng oligonucleotides prepared based on the known nucleotide sequences of the gene as primers, and a DNA fragment containing these sequences as the template. When a DNA fragment of a length of about 300 bp is used as the probe, the conditions of washing after hybridization can be, for example, 50°C, 2xSSC, and 0,1% SDS,
The activity of improving an L-amino acid-producing ability of a bacterium belonging to the family Enterobacteriaceae as compared to a non-modified atrain when expression thereof is increased in the bacterium can mean an activity of imparting an ability to produce and accumulate a larger amount of an L-amino acid such as L-cysteine in a medium as compared to a non-modified atrain such as a wild-type or parent strain, for example, an activity of imparting an ability to accumulate an J-amino acid in a medium in an amount of 0.1 g/L or more, 0.2 g/L
or more, or even 0,3 g/L or more, to a bacterium btalorujiny to the family Entei'obacteriaceae wlicn expression t|-iei;eo:l! is increased in the bacterium.
Whether a protein has an activity of improving an L-amino acid-producing ability of a bacterium belonging to the family £;/iteroJbacteriaceae as compared to a non-modified strain when expression thereof is increased in the bacterium can be confirmed by preparing a bacterium in which expression of the gene coding for the protein is increased from a wild-type or parent strain, culturing this bacterium in a medium, and quantifying the L-amino acid accumulated in the medium. When the L-amino acid is L-cysteine, examples of the wild-type or parent strain include an E. coli MG1655 strain in which a gene coding for a mutant SAT desensitized to feedback inhibition is enhanced.
It can also be easily confirmed that a certain protein has an activity of improving an L-amino aaid-producing ability of a bacterium belonging to the family Entetobacteriaceae as compared to a non-modified atruin when expression thereof is increased in the bacterium by confirming that growth of a bacterium in which expreasion of the gene is increased becomes more favorable «sj compared to a wild-type or parent fil.rain in a medium containing an L-amino acid at a higher concentraL.I on mi compared to a wild-type or parent iitirain, i.e., Hiiaral.n.lng L-amino acid resistance of the strain. When the L'-aininf) acid is L-cysteine, it can be conlJrmed by, specifi<;«|.ly, inoculating the bacterium in a medium containing about 0,1 to 10 mM L-cysteine, measuring diameters of colonies aftoj: an appropriate period of 10 to 120 hours, and confirming that the value thereof is larger than that observed for the wild type or parent strain. The inventors of the present invention found that there was considerable correlation between the activity of improving L-cysteine-
producing ability of a host cell as compared to a non-modified strain and the L-cysteine resistance.
The "specific mutation" in the mutant yeaS gene is specifically a mutation selected from the following (I) to (III);
(I) a mutation for substitution of an amino acid residue other than threonine residue for the threonine residue at position 28 in the protein encoded by tlie y&aS gene,
(H) a mutation for substitution of an amino acid residue other than phenylalanine residue for the phenylalanine residue at position 137 in the protein encoded by the yeaS gene,
(III) a mutation for substitwtion of an amino acid residue other than leucine residue for the leucine reaidiie at position 188 in the protein encoded by the yeaS gene.
Specific examples of the mutations (I) to (TCI) «ra those of the following (i) to (iii), respectively.
(i) a mutation for substitution of an asparagine residue for the threonine residue at position 28,
(ii) a mutation for substitution of a serine, glutamine, alanine, histidine, cysteine or glycine residue for the phenylalanine residue at position 137,
(iii) a mutation for substitution of a glutamine residue for the leucine residue at position 188.
The mutation can consist of any one kind of the aforementioned mutations, or a combination of arbitrary two kinds or three kinds of the mutations.
Particularly example is the mutation of (ii) corresponding to a mutation for substitution of a serine or glutamine residue for the phenylalanine residue at position 137.
The positions 28, 137, and 188 mentioned in the mutations of (I) to (III) do not necessarily mean absolute positions from the N-terminus of the protein encoded by a
yeaS gene (YeaS), and indicate rHTrit.ive posit..lona wllli respect to the ciraino acid aequencnj of SRQ ID NO: 2. I''i):t example, if one amino acid residue is deleted from trim Yeas protein having the amino acid sequence nhown in MEQ ID NO; 2 at position on the N-tarminus side upatiream o1: position 28, the position 28 then becomes position 27. Even in such a case, the amino acid residue of the position 27 is still regarded as an amino acid residue ol! the "position 28". Absolute position of amino acid substitution can be determined by alignment of amino acid sequence of an objective YeaS protein and the amino acid sequence of SEQ ID NO: 2.
The mutations of (I) to (III) can be introduced into a yeaS gene by introducing a predetermined mutation at a codon corresponding to the mutation of a wild-type yeaS gene by, for example, site-specific mutagenesis method, overlap extension method, or the like. Although the codon used after the introduction of the mutation is not particularly limited, so long as it codes for a predetermined amino acid, it is preferable to use a codon frequently used in the objective bacterium belonging to the family Enterobacteriaceae.
A mutation selected from the mutations of (I) to (III) can be introduced into the yeaS gene on a cliromoaome of bacterium by substituting a mutant yeaS gene containing a mutation point or a fragment thereof for a corr«)ipondirig portion of the yeaS gene on the ohromosoma. It cam MISCI be attained by transforming the bacterium with the mutant. yeaS gene or a vector containing the gen©, In thia aaaa, the mutant yeaS gene can be introduced into a chromo»om« or a plaamid. The wild-type yeaS gene can continue to foe carried on the chromosome, or deleted.
Furthermore, one or two or more copies of the mut«nt yeaS gene can be contained in the bacterium. Furthermore, the promoter for expressing the mutant yeaS gene can be a
promoter of a wild-type yeaS gent:) or another promol;,Br fiiiijli as lac promoter, trp promoter and trc promoter.
Examples of the vector used for transformation include a plasmid which can autonomously replicates in a chosen microorganism. Examples of plasmid autonomously replicable in a microorganism belonging to the family E/iterobacteriaceae include pUC19, pUC18, pBR322, RSriOlO, PHSG299, PHSG298, pHSG399, pHSG398, pSTV28, p3TV29, PTWV228, PTWV229 (pHSG, pSTV and pTWV series vectors are available from Takara Bio), pMWllO, pMWllS, pMW219, pMW218 (pMW series vectors are available from Nippon Gene), and so forth. Furthermore, plasmida for corynaform bactiiria include pAM330 (Japanese I'attint T,i-i.ld-opon No. 58 676«M)) , PHM1519 (Japanese Patent Laid-opan No. 58-77895), pSii'Kfi (Japanese Patent Laid-open No. 2000-262208), pVK7 (U.S. Patent Published Application No. 2003/017591,2), pAJ6'S5, pAJ611, pAJ1844 (Japanese Patent l,«id-open No. 6n-:l 9r!900), pCGl (Japanese Patent Laid-open No. 57-134500), p(:a2 (Japanese Patent Laid-open No. 58-35197), pCG4, pC'Gl I (Japanese Patent Laid-open No. 57-183799), pHK4 (Jfflpan6«ft Patent Laid-open No. 5~7491), and so forth.
Examples of transformation method include treating recipient cells with calcium chloride to increase permeability for DNA, which has been reported for Eschexichia coli K-12 (Mandel, M. and Higa, A., J. MoX. Biol., 1970, 53:159-162), preparing competent cells from cells which are at the growth phase, followed by transformation with DNA, which has been reported for Bacillus svbtilis (Duncan, C.H., Wilson, G.A. and Young, F.E., 1977, Gene, 1:153-167), and so forth. Alternatively, a method of malcing DNA-recipient cells into protoplasts or spheroplasts, which can easily talce up recombinant DNA, followed by introducing a recombinant DNA into the cells, which is known to be applicable to Bacillus subtilis, actinomycetes and yeasts (Chang, S. and
Choen, S.N., 1979, Mol. Gen. Genol:., 168:111-1.1.5; |.libb, M.J., Ward, J.M. and Hopwood, O.A., 1978, Nature, A'M-.'MiW-400/ Hlnnen, A., Hicks, J.B. and Fink, G.R., 197B, IrToc. Natl. Sci., USA, 75:1929-1933) can also be employed. In addition, transformation of microorganisms can alao be performed by the electric pulse method (Japanese Pal ent Laid-open No. 2-207791).
The mutant yeaS gene can alao be introduced into a bacterium by introduction into a chromosome of the host microorganism, as described later for the mutant yaaS gene. The mutant yeaS gene can be introduced into a chromosaojine of a microorganism by a method oC randomly introducing it into a chromosome using a transposon or Mini-Mu (Japanese Patent Laid-open No. 2-109985, U.S. Patent No. 5,082,888, EP 805867 Bl), or by homologous recombination us.irig a sequence present on a chromosomal DNA in a multip.1e copy number as a target. As a sequence present on a chromosomal DNA in a multiple copy number, repetitive DNA, and inverted repeat located at the end of a tranaposabl© element can be used. Alternatively, by using t?ie Red driven integration method (WO2005/010175), it is also possible to introduce an objective gene into a clvi'omosome. Moreover, an objective gene can alno be introduced Into n chromosome by transduction using phages such as Pi phago, or by using a conjugative translrjii: vector. Furthormnre, it is also possible to introduce n mutant yamS gisne using a gene unnecessary for production of an obj«ctive substance as a target, as dewcrlbiiid in WO03/04037 3. One or plural copies of a mutant yaaS gene cab bo introducud into a target sequence by such m«5l.liod9.
Transfer of an object.1.ve gone on a chromoaomu ufiii \m confirmed by Southern hybridization using a probe having H sequence complementary to the objective gene or a pari: thereof, PCR using primers prepared on the basis of t|ie sequence of the objective gene, and so forth.
<2> Method for producing L-amino acid
An L-amino acid can be produced by culturing a bacterium in accordance with the presently disclosed subject matter obtained as described above in a medium, and collecting the L-amino acid l:rom the medium. The L-amino acid can be a derivative of the L-amlno acid. When L-amino acid is L-cysteine, examples of derivative of L-cysteine include S-sulfocysteine, a thiazolidine derivative, a hemithioketal corresponding to the thiazolidine derivative, and so forth, as described abovc-i.
Examples of the medium used for the culture include ordinary media containing a carbon source, nitrogen souroa, sulfur source, inorganic ions, and other organic components as required.
As the carbon source, saccharides such as g.lucoae, fructose, sucrose, glycerol, molasses and starch hydrolysate, and organic acids such as fumaric acid, citric acid and succinic acid can be used.
As the nitrogen source, inorganic ammonium salts such as ammonium sulfate, ammonium chloride and ammonium phosphate, organic nitrogen such as soybean hydrolyaate, ammonia gas, aqueous ammonia and so forth can be used.
As the sulfur source, inorganic sulfur compounds, such as sulfates, sulfites, sulfides, hypoaulfltea and thiosulfates can be used.
As organic trace amount nutrients, it is deairable to add required substances such as vitamin Bj, yeaat extract and so forth in appropriate amounts. Other than these, potassium phosphate, magnejiium sulfate, iron ion«, manganese ions and so forth are added in small amounts.
The culture is preferably performed under awrobJ.o conditions for 30 to 90 hours. The culture temperature is preferably controlled to be at iS'C to 37*0, and pH ia preferably controlled to be 5 to fi during the culture,
For pH adjueitment, inorganic or cinjanic acidic or «,l,k(iiint!» substances, ammonia gas and so foi-l.li can ba uaed.
For collection of L-amino add Eroiri thu inedivnn rtlllei" completion of the culture, any spnclal method is not required. The L-amino acid collected can contsin bacterial cells, medium componentfi, moiaturfl, and by product metabolites of the microorganism in addition to the L-amino acid. Purity of the collected L-amino iicid 1M, for example, 50% or higher, 05% or higher, or evon 95% oi: higher (U.S. Patent No. 5,431,933, Japanese l>atent Publication No. 1-214636, U.S. Patent Nos. 4,956,471, 4,777,051, 4,946,654, 5,840,358, 6,238,714, U.S. Patent Published Application No. 2005/0025878).
The L-amino acid can be collected by a combination of conventionally known ion-exchange resin method (Nrgai, H. et al., Separation Science and Technology, 39(16), 3691-3710), membrane separation method (Japanese Patent Laid-open Nos. 9-164323 and 9-173792), cryatalli/.ation method (WO2008/078448, WO2008/078646), and other methods.
L-Cysteine obtained as described above can be used for production of L-cysteine derivatives. The L-cysteine derivatives include methylcysteine, ethylcyoteino, carbocisteine, sulfocysteine, acetylcysteine, and so foitli.
Furthermore, when a thiazolidine derivative of L-cystelne is accumulated in the medium, L-cysteine can bci produced by changing the reaction equilibrium betwtaen tlu) thiazolidine derivative and L-cysteine to the L-ayMte:ln« side. Furthermore, when S-sulfocyateine is accumiilated lu the medium, it can be converted inl:o L-cyateine by reduction using a reducing agent uuch as dithlothpeitol,
Examples ,
Hereinafter, the present invention will be BKplaiiiod more specifically with reference to examples.
Example 1: L-Cyateine production Increasing effect of enhancement of wild-type YeaS
In order to investigate effect of enhancement of expression of a wild-type yeaS gene in P. ananatis on L-cysteine production, a strain introduced with the gene cysES coding for a mutant SAT (U.S. Patent Published Application No. 2005/0112731) and.having an increanad copy number of the yeaS gene was constructed.
First, a plasmid for constructing the oforemtjntioned strain was constructed. The method for it is deacjibod below.
By PCR using the chromosomfil DNA of E. ooli MG:1.655 (ATCC No. 47076) as a template an weall as PI (agcttjagtcg acccccagga aaaattggtt aataac, SKU IU NO; ;0) nnd P2 (agctgagcat gcttccaact gcgctaatga cgc, SEQ Tl.) NOs 21) i\H primers, a DNA fragment containing u promoter region of the nlpD gone (henceforth wild-type nlpD gene promotm: In referred to as "PnlpO") of about 300 bp was obtained. Al the 5' and 3' ends of the aforem«,)ni.:loned primers, BUOS for the restriction enzymes Sail flnd Pael ware dofligned, respectively. The PCR cycle was as follows: 95"C for 3 minutes, then 2 cycles of 95°C for 60 secondH, 30"C foe 'H) seconds, and 72''C for 40 seconds, 25 cycles of 94 "C foe 20 seconds, 55"C for 20 seconds, and 72''C for 15 seconds, and 72"c for 5 minutes as the final cycle. The obtained fragment was treated with Sail and Pael, and inserted into pMlV-SJS (Japanese Patent Laid-open No. 2000-99668) at the Sail-Pael site to obtain a plasmid pMIV-PnlpO. The nucleotide sequence of the Pael-Sail fragment of the PnlpO promoter inserted into this pMIV-PnlpO plasmid was as shown in SEQ ID NO: 5.
Then, by PCR using the chromosomal DNA of MG1655 as a template, as well as P3 (agctgatcta gaaaacagaa tttgcctggc ggc, SEQ ID NO: 22) and P4 (agctgaggat ccaggaagag tttgtagaaa cgc, SEQ ID NO: 23) aa primers, a
DNA fragment containing a terminator region of the rriiB gene of about 300 bp was obtained. At the 5' endw ol: tlie aforementioned primers, sites for the restriction »nzynie,« Xbal and J3aniHI were designed, respectively, The VCR cyclw was as follows: 95''C for 3 minutea, then 2 cyclea tif Of)"!; for 60 seconds, 50''C for 30 seconds, and 72"C for <|0 seconds, 25 cycles of 94°C for 20 seconds, SQC for 20 seconds, and 72"C for 15 seconds, and 72"C for 5 minutaa as the final cycle. The obtained fragment was treated with Xbal and BamHI, and inserted into pMIV-PnlpO at Ulie Xbal-BamHI site to obtain a plaarnid pMIV-PnlpO-ter.
Then, by PCR using the chromosomal DNA of the MG1655 strain as a template, as wel], as P5 (agctgagtcg acgtgttcgc tgaatacggg gt, SEQ ID NO: 24) and P6 (agctgatcta gagaaagcat caggattgca gc, SEQ ID NO: 25) as primers, a DNA fragment of about 700 bp containing the yeaS gene wa« obtained. At the 5' ends of the aforementioned primers, sites for the restriction enzymes Sail and Xbal were designed, respectively. The PCR cycle was as follows: 95''C for 3 minutes, then 2 cycles of 95°C for 60 Heoonda, SO'C for 30 seconds, and 72"C for 40 secondn, 25 (jycleiH of 9/1 "C for 20 seconds, SSC for 20 seconds, and 72"!:; for 15 seconds, and 72°C for 5 minutes an the final cyclra, The obtained fragment was treated witlj Sail and Xbal, and inserted into pMIV-PnlpO-ter at the Sall-Xbal site to obtain a plasmid pMlV-PnlpO-YeaMU. As described tibove, a yeaS enpreasion unit compriaing the pMIV-SJS ve«t;or on which the nlpD promoter, the yenS gene, and l-he j rn/i terminator were ligated in this fuder was nonstiiuolMd,
In order to modify the -10 region of the nlpD
promoter to make it a stronger promoter, the -10 reijion
was randomized by the following method. The nlpD pi:omol.«j
region contains two of regions presumed to function f4.'i
promoters (Fig, 1), and they are indicated as pnlpl «nd ;
pnlp2, respectively, in the drawing. By PCR Uifiing the
plasmid pMIV-PnlpO as a template aa well as 1?1 and P7 (atcgtgaaga tcttttccag tgttnannag ggtgccttgc acggtnatna ngtcactgg ("n" means that the corresponding residue can be any of a, t, g and c), SEQ ID NO: 26) as primers, a DNA fragment in which the -10 region contained in the 3' end sequence of the nlpD promoter (referred to as -lO(l'nlpl)) was randomized was obtained (Fig. 1) . The PCR cycle was as follows: SB'C for 3 minutes, then 2 cycles of 95''C for 60 seconds, 50*C for 30 seconds, and 72°C for 40 seconds, 25 cycles of 94"'c for 20 seconds, 60°C for 20 seconds, and 72°C for 15 seconds, and 72*0 for 5 minutes as the final cycle.
Furthermore, by PCR using the plasmid pMIV-PnlpO as a template as well as P2 and P8 (tggaaaagat cttcannnnn cgctgacctg eg ("n" means that tho corresponding ie«ir:lue can be any of a, t, g and c), Sb'.Q ID NO; 27) aa prim«r«, a DNA fragment in which the -10 region contained in tlio 5* end sequence of the nlpD promoter (referred to aa ~ 10(Pnlp2)) was randomized was similarly obtained '(Pig. I). The PCR cycle was as follows: 9t)"C for 3 minutes, then 2 cycles of 95"C for 60 seconds, 50"C for 30 secondtt, and 72''C for 40 seconds, 25 cycles of 94°C for 20 aeconda, 60°C for 20 seconds, and 72''C for 15 seconds, and 72''C for 5 minutes as the final cycle.
The obtained 3' and 5' end fragments could bo ligated using the BgJII sites designed in the prlmora P7 and P8, and the full length of the nlpD promoter In which two -10 regions were randomized could be constructed by such ligation. By PCR using this fragment as a twmplate aa well as Pi and P2 as primers, a DNA fragment corresponding to a modified type nlpD promoter of the full length was obtained. The PCR cycle was as followH! 95*0 for 3 minutes, then 2 cycles of 95''C for 60 seconds, iiOC for 30 seconds, and 72"C for 40 seconds, 12 cycles of 94"C for 20 seconds, eOC for 20 seconds, and 72'*C for 15
f
seconds, and 72''C for 5 minutes HH I he fMnal rycle.
The amplified fragment was I i nated wil li the restriction enzymes Sail and Pael, for which witew w«»ra designed In the 5' ends of tlie piJiiiHrs, «nd insej: tsjd Intci the plasmid pMIV-l?nlpO-YeaS3 simLUirly treatad with Sa.U and Pael to substitute the mutant. I'nlp for tho wild-l ypet nlpD promoter region (PnlpO) on l.h«:;i plasmid. From munh plasmids, one having the promoter sequence (Pnlpii) sihowii in Fig, 1 was selected, and designated pMIV-Pnlp(J-yee»S7. The nucleotide sequence of the Pael-Sall fragment of tho Pnlp8 promoter inserted into this plasmid was as ahown in SEQ ID NO: 6. In the same manner, a DNA fragment of the nlpD promoter region containing a mutation was inserted into the plasmid pMIV-PnlpO-ter treated with Sail and Pael to substitute the mutant Pnlp for the nlpD promoter region (region of PnlpO) on the plasmid. One of them was designated pMIV-Pnlp23-ter. The nucleotide sequence of the Pael-5ail fragment of the Pnlp23 promoter inserted into this plasmid was as shown in SEQ ID NO; 7.
Then, from pMW-Pomp-cysE5 (WO2005/007841), the Pomp-cysES cassette portion was excised with Pael and Sad, and inserted into the same site of pMIV-5JS to construct pMIV-Pomp-CysE5. pMW~Pomp-cysE5 was a plasmid obtained by inserting the cy$E5 gene coding for the mutant SA'J' ligatod with the ompC gene promoter into pMWllO. fc"'rom pACYC1.84 (GenBank/RMBL accession number X06403, available llrom NIPPON GENE), the tetracycline renistence gene W«H eKoiftiMd with Xbal and EcodBl, and this gone fragmenl. was I raatwd with the Klanow fragment, and then inserted into iiMTV-Pomp-CysE5 at the Pvul site to conHtruct pMT-Pornp-CyaBlS. Then, pMIV-Pnlp8-YeaS7 was digested with Hindin., blunt-ended with the Klenow fragment, and then digested with Wcol to excise a fragment containing the caaaette of th« PnlpB-YeaS-rrnB terminator and the chloramphenicol resistance marker. This fragment was ligated with a Smal
and Wcol digestion fragment of pMT-l?omp-CysKS similarly having pMIV-5JS as the backbone to construct pMT-lSY2. pMT"EY2 is a plasmid having the I'nlpS-YeaS-rrnB terminator cassette and the Pomp-CysES casaotte on one plasmid.
In order to investigate effect of enhancement of expression of the wild-type yeaS gene on L-cysteine production, pMT-Pomp-CysE5 and pMT-EY2 constructed by the methods described above were introduced into the P. ananatis SC17 strain (U.S. Patent No. 6,596,517), and .'|j-cyj3teine-producing ability of thts obtained tranaformanta was evaluated.
An L-cysteine production modium (compoaition? 16 g/T. of ammonium sulfate, 1.5 g/L of potassium dihydrogenphoaphate, 1 g/L of maijttofjium sulfate heptahydrate, 0.1 g/L of tryptonw, 0.05 g/L of yeast extract, 0.1 g/L sodium chloride, 20 g/L of OHlalum carbonate, 4 0 g/L of glucose, and i!0 mg/L of tetraioyuliuw) was used l;or the culture.
The L-cyateine production ijulture waa porfcjrmod by the following procedure. ThH SCX7/pMT-l?ompCyBE5 atrivln and SC17/pMT-EY2 strain were each applied on the I.U *igai. medium to perform preculture overnight at 34 °C, tlien (!ell.l» corresponding to 1/8 of the plate were scraped wll.li HU inoculation loop, inoculated into 2 ml of the L-cyatoine production medium contained in a large test tube (intern*! diameter: 23 mm, length: 20 cm), and cultured at 32''C with shaking at 220 to 230 rpm, and the culture was terminated after two days. L-Cysteine produced in the medium was quantified by the method described by Galtonde, M.K. (Biochem. J., 1967 Aug., 104 (2) : 627-33) . As showi' In Table 1, it was found that enhancement of expression of the yeaS gene had an effect of increasing L-cysteine production amount. The L-cysteine quantified above include L-cysteine as well as L-cystine, and derivativan thereof such as S-sulfocysteine, thiazolidine derivativow,
hemithioketals, and mixtures thereof, and the same shall apply to L-cysteine quantified in the exampl«8 unleaw particularly indicated.
Example 2 Acquisition of mutant yeaS gene and L-oysteiiho production-increasing effect
Then, in order to obtain a mutant having a higher activity of Improving L~cysteino producing ability of a host cell as compared to a wild-type YeaS, random mutations were artificially introduced into the yeaS geno by error-prone PCR.
(1) Error-prone PCR of yeaS and preparation of mutation Introduction library
First, conditions of error-prone PCR for Introducing 1 to 3 mutations into the yeaS gene were examined on the basis of prior findings (Evert Bokma et al., irHJB8 Letters, saOiSasg-SaO (2000 ; Zao et al., Mat. Biotechnol. Mwr., 16(3):258-61 (1998)). As the DNA polymerase, taq polymerase (produced by QIAGEN) wan used, and the composition of the reaction raixliurfj consisted of lO mM Tris-HCl (pH 8.3), 50 mM KCl, 7 mM MgClj, 0.2 mM clGTP and dATP, 1 mM dCTP and dTTP, and 12. Li |.iM MnCl. As th« primers, P9 (catgccatgg tcgcbgaata cggggttctg, 3ISQ ID NOi 28) and PIO (aactgcagtc aggattgnag cgtcgcc, SEQ ID NO: 7'}), to which Wcol site and the Pstl »\.t& were added, respectively, were used, and thM rtinpli float ion was performed with a PCR cycle consiHhlng of 94"C for b minutes, then 50 cycles of 94*0 for 30 aeconda, 50"C f.oi 45 seconds, and 72°C for 45 seconds, and 72"C for 7
minutes as the final cycle. The reaction was performed An the reaction mixture divided into 16 of independent PCK tubes to obviate biased mutation.
The amplified fragment was digested with Ncol and PstI, ligated with pTrc99-Kmr treated with the same enzymes, and used to transform the E. coii JM109 strain. pTrc99-Kmr was prepared by treating pTrc99A (GenBank/EMBTi accession number M22744, available from Amersham Bioscience) with the restriction enzyme Oral to removes the ampicillin resistance gene, and inserting a kanaraycin resistance gene into that site. The kanamycin reaistanco gene was obtained by amplifying pACyC177 (GenBank/EMBL accession number X06402, available from NIPPON GENE'.) as « template by PCR using Pll (aaagccacgt tgtgtctcaa aatc, BlilQ ID NO: 30) and P12 (ggtgttgctg ijctcatacca ggc, SICQ ID NOt 31) as primers with a program of 91"C for 1 minutn, then 30 cycles of 94"C for 30 second.-;i, bb'C for 30 ueocmda, «i)d 72°C for 75 seconds, and 72°C for b minutes as thn firia.'l cycle.
Selection of the aforementioned transformaul s wens performed on the LB agar medium containing 25 mg/L of kanamycin, and it was confirmed that the transfoirmanta li(S(i yeaS introduced with a mutation by performing PCR iiHing n strain randomly picked up from tho obtained colonies aa u template as well as P13 (gacaattaatcatccggctc g, BEQ ID NO: 32) and P14 (tttatcagac cgcttotgcg, SEQ ID NOj 33) as primer with a program of 94"C for 5 minutes, then 30 cycles of 98"C for 5 seconds, 60"C for 10 seconds, and 72°C for 4 5 seconds, and 72"C for 2 minutes as the final cycle. All the colonies on the plate were Hcrapad, and plasmids were collected with WizardR Plus Midiprapa DNA Purification System