Field Of The Invention
5 The invention relates to antibodies or fragments thereof capable of generating an
immune response against the Hepatitis CVirus (HCV) E2 protein.
Background To The Invention
10 There is an urgent need for a vaccine that will protect from infection with hepatitis C
virus (HCV), which is a leading cause of liver cirrhosis and liver cancer. At present no
such vaccine exists, and HCV infection is a major global public health problem. One of
the obstacles to vaccine development is the high genetic diversity of the viral envelope
glycoproteins.
15
HCV vaccine development has been thwarted by the high genetic diversity of the
envelope glycoproteins and the presence of immunodominant, hypervariable regions
within them. To elicit protective antibodies, the immune response needs to be focused
on conserved, functionally important regions. The epitopes of broadly neutralizing
20 antibodies (bnAbs) are therefore attractive leads for vaccine design.
One such bnAb is known antibody AP33, which binds to a conserved linear epitope
(residues 412-423) on the HCV E2 envelope glycoprotein and potently neutralizes all
genotypes of HCV.
25
The AP33 epitope, which spans residues 412 to 423 of HCV E2, is linear and highly
conserved and encompasses a tryptophan residue that plays a critical role in CD81
recognition. The antibody has been shown to be capable of neutralising HCV across all
the major genotypes. The rational development of immunogens that might mimic such
30 epitopes and elicit AP33-like antibodies has been stymied by a range of factors in the
art including the lack of detailed structural information available for the viral
glycoproteins. Moreover, vaccination with peptides representing the epitope did not
elicit antibodies that recognise E2.
35 It is a problem in the art to elicit antibodies that recognise E2.
The present invention seeks to overcome problem(s) associated with the prior art.
Summary Of The Invention
The generation of broadly neutralising antibodies for Hepatitis Cvirus (HCV) has been
a problem in the art. Conventional approaches such as immunisation with peptides
representing the key epitope of HCV E2 (residues 412 to 423 of E2) has failed to elicit
antibodies that recognise E2.
The inventors rejected conventional approaches based on E2 peptide immunisations.
The inventors instead pursued an anti-idiotypic approach. More specifically, the
inventors have generated anti-idiotype antibodies against the established AP33 broadly
neutralising antibody. Even this approach initially failed, until the inventors applied
insights from a structural analysis of the epitope binding pocket of the AP33 antibody
in order to design a radical selection technique allowing them to obtain the B2.1A antiidiotypic
antibody having remarkable properties.
The present invention is based upon the B2.1A antibody and its unique characteristics.
Thus, in one aspect the invention provides an antibody or antigen binding fragment
thereof capable of binding to the antigen binding pocket of the AP33 antibody, wherein
said antibody or antigen binding fragment thereof comprises VL CDRi (Li), VL CDR2
(L2), and VL CDR3 (L3) consisting of the amino acid sequences of SEQ ID NO:i, SEQ
ID N0 :2 and SEQ ID NO:23 respectively, and comprises VH CDRi (Hi), VH CDR2
(H2), and VH CDR3 (H3) consisting of the amino acid sequences of SEQ ID N0 :24,
SEQ ID NO:25, and SEQ ID NO:26 respectively.
Suitably said antibody or antigen binding fragment thereof comprises VL amino acid
sequence consisting of the amino acid sequence of SEQ IDN0 :20.
Suitably said antibody or antigen binding fragment thereof comprises VH amino acid
sequence consisting of the amino acid sequence of SEQ ID NO:22.
Suitably said antibody or antigen binding fragment thereof comprises VL amino acid
sequence consisting of the amino acid sequence of SEQ ID NO:20 and said antibody or
antigen binding fragment thereof comprises VH amino acid sequence consisting of the
amino acid sequence of SEQ ID NO:22.
In another aspect, the invention relates to an antibody or antigen binding fragment
thereof as described above, wherein the antigen binding fragment thereof is selected
from the group consisting of a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a
scFv, a Fv, a rlgG, and a diabody.
Suitably said antigen binding fragment is a scFv and wherein said scFv comprises the
amino acid sequence of SEQ ID NO:ii or SEQ ID NO:12 or SEQ ID NO: 13.
In another aspect, the invention relates to a nucleic acid comprising a nucleotide
sequence encoding the variable heavy chain domain and/ or the variable light chain
domain of the antibody or antigen binding fragment as described above.
Suitably the nucleic acid comprises one or more nucleotide sequences selected from the
group consisting of SEQ ID NO:i9 and SEQ ID N0:2i.
In another aspect, the invention relates to a nucleic acid comprising a nucleotide
sequence complementary to the nucleotide sequence as described above.
In another aspect, the invention relates to a vector comprising the nucleic acid as
described above.
Suitably the vector further comprises an expression control sequence operatively linked
to the nucleic acid encoding the variable heavy chain domain and/ or the variable light
chain domain.
In another aspect, the invention relates to a host cell containing the vector as described
above.
Suitably the cell is a eukaryotic cell.
Suitably the eukaryotic cell is a Chinese Hamster Ovary (CHO) cell or a human
embryonic kidney (HEK) cell.
In another aspect, the invention relates to a method of producing an antibody or
antigen binding fragment thereof, comprising incubating a host cell as described above
such that the encoded variable heavy chain domain and/or variable light chain domain
is expressed by the cell; and recovering the expressed the antibody or antigen binding
fragment thereof.
Suitably the method further comprises isolating and/or purifying the recovered
antibody or antigen binding fragment thereof.
In another aspect, the invention relates to a composition comprising the antibody or
antigen binding fragment thereof as described above and a pharmaceutically acceptable
carrier or excipient.
In another aspect, the invention relates to a composition as described above further
comprising a carrier protein, the carrier protein preferably selected from the group
consisting of tetanus toxoid and CRM 197 mutant diphtheria toxin.
Suitably said composition further comprises an adjuvant.
In another aspect, the invention relates to a composition as described above formulated
for use in humans.
In another aspect, the invention relates to an antibody or antigen binding fragment
thereof capable of inducing in a mammal an immune response against the hepatitis C
virus E2 protein, wherein said antibody or antigen binding fragment thereof is capable
of binding to the antigen binding pocket of the monoclonal AP33 antibody.
In another aspect, the invention relates to an antibody or antigen binding fragment
thereof capable of inducing in a mammal an immune response against the hepatitis C
virus E2 protein, wherein said antibody or antigen binding fragment thereof comprises
VL CDRi (Li), VL CDR2 (L2), and VL CDR3 (L3) consisting of the amino acid
sequences of SEQ ID NO:i, SEQ ID N0:2 and SEQ ID NO:23 respectively, and
comprises VH CDRi (Hi), VH CDR2 (H2), and VH CDR3 (H3) consisting of the amino
acid sequences of SEQ ID N0:24, SEQ ID NO:25, and SEQ ID NO:26 respectively.
In another aspect, the invention relates to an antibody or antigen binding fragment
thereof capable of binding to the AP33 antibody wherein said antibody or antigen
binding fragment thereof exhibits binding to AP33 antibody mutants FL32A, NL91A,
WL96A, YH33A, YH50A, YH58A, IH95A and YH100A of less than 50% of its binding to
the AP33 antibody.
In another aspect, the invention relates to an antibody that binds to an antibody or
antigen binding fragment thereof as described above, which is not AP33 antibody or a
fragment thereof.
Suitably said antibody is obtained by immunisation of a mammal with an antibody or
antigen binding fragment thereof as described above.
In another aspect, the invention relates to a method of inducing in a mammal an
immune response against the hepatitis Cvirus E2 protein, the method comprising
administering to said mammal an antibody as described above, a nucleic acid as
described above, a vector as described above, or a composition as described above.
In another aspect, the invention relates to an antibody as described above, a nucleic
acid as described above, a vector as described above, or a composition as described
above for inducing in a mammal an immune response against the hepatitis Cvirus E2
protein.
In one aspect, the invention relates to an antibody, a nucleic acid, a vector, or a
composition as described above for use in manufacture of a composition for
immunising against HCV.
In one aspect, the invention relates to an antibody, a nucleic acid, a vector, or a
composition as described above for inducing in a mammal an immune response against
the hepatitis Cvirus E2 protein.
Suitably said immune response induced is a humoral or antibody immune response.
Suitably said antibody induced binds HCV E2, suitably binding is at the 412-423 AP33
epitope. Suitably the antibodies induced bind HCV particles. Suitably the antibodies
induced are neutralising antibodies.
Detailed Description Of The Invention
To obtain a molecule that correctly represents the 3-dimensional binding surface of the
HCV E2 412-423 epitope, we pursued an anti-idiotype approach.
Mice were immunized with AP33 (Abi) to generate a large number of anti-idiotypic
(Ab2) monoclonal antibodies, all of which were able to potently inhibit AP33-E2
binding. The crystal structure ofAP33 Fab complexed with its peptide epitope shows
which amino acid residues comprise the antigen-binding pocket. By individually
replacing these with alanine, we established exactly which residues are required for E2
binding. The AP33 mutants were then used to differentiate between the Ab2s. This
screen identified one Ab2 with a binding profile very similar to that of E2.
When used as an immunogen in mice, this Ab2 induced Ab3 antibodies that recognize
the same epitope and the same residues within it as AP33. The affinity of the Ab3
antibodies for E2 is similar to that of AP33, and they neutralize infectivity of cellculture
infectious HCVwith an IC50 that is about twice that of AP33.
In one aspect the polypeptide of the invention comprises a B2.1A IgG molecule.
A B2.1A IgG molecule is suitably an IgG molecule which comprises amino acid
sequence of the CDRs of B2.1A e.g. the CDRs as shown in SEQ ID NO:s 1, 2, 23, 24, 25
and 26.
Suitably the polypeptide of the invention is a Fab fragment of the B2.1A IgG. The
inventors have surprisingly discovered that the Fab fragment of the B2.1A antibody in
fact performs better than the parent antibody itself. In addition, the Fab fragment is
smaller and easier to handle. In addition, by removing sequences not required for
antigen recognition the Fab fragment presents fewer irrelevant sequences to the
immune system of the recipient, and therefore provides a more efficient antigen for
immunisation.
Suitably the polypeptide of the invention may be a single chain variable fragment (scFv)
derived from the B2.1A antibody sequence. This has the advantage of being of the
smallest possible size whilst retaining the antigen binding activity. scFvs can also be
cheap and efficient to produce by recombinant means.
The polypeptide or antibody or antigen binding fragment thereof of the invention may
take any of the known forms. For example, the polypeptide may comprise an IgG. For
example, the polypeptide may comprise a F(ab')2. For example, the polypeptide may
comprise a Fab'. For example, the polypeptide may comprise a Fab. For example, the
polypeptide may comprise a Fv. For example, the polypeptide may comprise a rlgG.
Aperson skilled in the art can make these or any other antibody variants according to
their choice and/ or the desired application. The production of each of these and any
other antibody variants is enabled by the amino acid sequences of the variable regions
of the B2.1A antibody provided herein, in particular the exact sequences of the CDRs.
For example, in order to produce IgG, the variable region sequences such as the CDRs
(i.e. nucleotide sequence encoding the CDRs or the larger variable regions) may be
inserted into a standard heavy/light chain expression vector.
For example, B2.1A antibody chains may be produced using conventional antibody
expression systems incorporating the CDRs of the B2.1A as disclosed herein. Suitably
a conventional expression system such as the 'antibody generation' system which is
commercially available from InvivoGen at 5, rue Jean Rodier, F-31400 Toulouse,
France may be used.
This vector may then be transfected into any suitable host cell. Suitably the host cell is
eukaryotic such as mammalian. For example, suitable host cells may include CHO
cells, 293T cells, HEK cells or any other suitable cell line. Following transfection, the
host cells are incubated to allow expression of the antibody chains. These are the
collected, for example from the supernatant in which the cells are incubated.
Purification of the antibody chains from that supernatant may be carried out.
Purification may be by any known means such as chromatography, for example affinity
chromatography (e.g. Protein A, Protein G, Protein L, Peptide M etc) or any other
suitable means known in the art.
Thus, when a full IgG is desired, then the expression vector is so chosen so as to express
the chains for a full IgG. If it is desired to produce a Fab fragment from that IgG, then
any standard method known in the art such as papain digestion, pepsin digestion or
ficin digestion may be used to generate that Fab. Most suitably, papain digestion of IgG
is used to generate Fab.
Generation of antibodies or antigen binding fragments thereof, for example via
antibody fragmentation, is well known in the art using commercially available reagents
such as from Pierce (Pierce Protein Biology Products also known as ThermoScientific
(ThermoFisher Scientific) of 3747 N Meridian Rd, Rockford, IL 61101, USA.
Suitably the antibody or antigen binding fragment thereof of the invention may be
administered in conjunction with, or formulated into a composition with, a carrier that
is suitable for use in humans.
Suitably the antibody or antigen binding fragment thereof of the invention may be
administered in conjunction with, or formulated into a composition with, an adjuvant
that is suitable for use in humans
Alum is a most commonly used adjuvant in human vaccination. It is found in numerous
vaccines, including diphtheria-tetanus-pertussis, human papillomavirus and hepatitis
vaccines. Alum provokes a strong Th2 response. Suitably the adjuvant comprises
Alum. Suitably alum means aluminium hydroxide, such as in the form of a wet gel
suspension.
The adjuvant suitably induces both Thi and Th2 responses.
Further guidance on adjuvants is provided by the European Medicines Agency's
(EMEA) committee for medicinal products for human use. In particular, reference is
made to their guideline on adjuvants in vaccines for human use document, which is
incorporated herein by reference.
Suitably the antibody or antigen binding fragment thereof of the invention may be
administered as, or provided as, a formulation that is suitable for use in humans.
Known carrier proteins include Keyhole Limpet Haemocyanin (KLH), self assembling
carrier proteins such as Ferritin or luminaze synthase. There are numerous carrier
proteins that are commonly used in compositions such as human vaccines: suitably the
carrier protein is tetanus toxoid or CRM 197 mutant diphtheria toxin. As will be
apparent to the skilled person, these are vaccines in their own right, against tetanus
and diphtheria, respectively. They are also effective as immunogenic carrier proteins
for molecules such as bacterial polysaccharides, which on their own are poorly
immunogenic.
In principle, any protein molecule that is used in approved human vaccines could be a
suitable carrier. The choice of carrier may be made by the skilled worker and
confirmed either experimentally and/or through clinical trials.
The same principles apply to a suitable adjuvant. There is a limited number of
adjuvants approved for human use, although there are a lot of candidate adjuvants and
ongoing research into better human adjuvants, especially within the pharmaceutical
industry. In principle, any adjuvant approved for use in human vaccines could be
suitable. The choice of adjuvant may be made by the skilled worker and confirmed
either experimentally and/or through clinical trials.
The same principles apply to a suitable vaccination regimen. Suitably a first
administration of the of the antibody or fragment thereof (or nucleic acid or vector or
composition) is provided. This may be referred to as a primary (or 'prime') injection.
This is day o. The immune response, for example as measured by antibody titer, can be
maintained or enhanced ('boosted') in a mammal by providing one or more further or
booster injections of the of the antibody or fragment thereof (or nucleic acid or vector
or composition) at 2 weeks, 1month, 2 months, 3 months, 4 months, 5 months, 6
months, 1year, or more after the primary injection. The primary and further or booster
injections need not be the same. Formulations may be different between injections
such as carrier proteins may change, or nucleic acid maybe alternated with peptide
components as the operator chooses.
The same principles apply to a suitable formulation. In principle, any formulation
suitable for use in human vaccines could be used. The choice of formulation maybe
made by the skilled worker and confirmed either experimentally and/ or through
clinical trials.
The composition may be a pharmaceutical composition.
The composition is suitably a composition suitable for generating an immune response
to the antibody such as B2.1A antibody or fragment thereof as described herein.
Suitably said immune response induced is a humoral or antibody immune response.
Suitably said antibody induced binds HCV E2, suitably binding is at the 412-423 AP33
epitope. Suitably the antibodies induced bind HCV particles. Suitably the antibodies
induced are neutralising antibodies.
Suitably the composition is a vaccine composition, suitably a vaccine composition for
use in humans. Suitably the antibodies induced are protective against HCV infection.
Pharmaceutical compositions useful in the present invention may comprise an amount
of the antibody or fragment thereof effective to induce an immune response in a subject
and a pharmaceutically acceptable carrier, dilutent or excipient (including
combinations thereof).
Pharmaceutical compositions may be for human or animal usage in human and
veterinary medicine and will typically comprise any one or more of a pharmaceutically
acceptable dilutent, carrier, or excipient. Acceptable carriers or diluents for therapeutic
use are well known in the pharmaceutical art, and are described, for example, in
Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985).
Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages
and concentrations employed, and include buffers such as phosphate, citrate, and other
organic acids; antioxidants including ascorbic acid and methionine; preservatives (such
as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride;
benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl
parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-
pentanol; and m-cresol); low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic polymers such as olyvinylpyrrolidone; amino acids such as glycine,
glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides,
and other carbohydrates including glucose, mannose, or dextrins; chelating agents such
as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions
such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic
surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG).
The choice of pharmaceutical carrier, excipient or dilutent may be selected with regard
to the intended route of administration and standard pharmaceutical practice.
Pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient
or dilutent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s) or
solubilizing agent(s).
Preservatives, stabilizers, dyes and even flavoring agents may be provided in
pharmaceutical compositions. Examples of preservatives include sodium benzoate,
sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents
may be also used.
There may be different composition/formulation requirements dependent on the
different delivery systems. Byway of example, pharmaceutical compositions useful in
the present invention may be formulated to be administered using a mini-pump or by a
mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestible
solution, or parenterally in which the composition is formulated by an injectable form,
for delivery, by, for example, an intravenous, intramuscular or subcutaneous route.
Alternatively, the formulation may be designed to be administered by a number of
routes. Most suitably the formulation is designed to be administered by injection via a
route effective in inducing an immune response such as subcutaneously or
intramuscularly.
The formulations to be used for in vivo administration must be sterile. This is readily
accomplished by filtration through sterile filtration membranes.
The antibody or fragment thereof may even be prepared in situ in the subject being
treated. In this respect, nucleotide sequences encoding said antibody or fragment
thereof may be delivered by use of non-viral techniques (e.g., by use of liposomes)
and/or viral techniques (e.g., by use of retroviral vectors) such that the said protein is
expressed from said nucleotide sequence.
The pharmaceutical compositions may be used in any of the methods described herein.
The pharmaceutical composition maybe used among those subjects (e.g., humans)
susceptible to infection with HCV i.e. to prevent or reduce/ decrease the onset of HCV
infection, such as by inducing an immune reaction against HCV.
The pharmaceutical composition maybe used among those subjects (e.g., humans)
already infected with HCV i.e. to treat HCV infection. Such treatment may facilitate
clearance of the virus from those subjects who are acutely or chronically infected
including infected patients undergoing liver transplantation.
Thus, in a further aspect the invention provides a method for the treatment and/or
prevention of hepatitis Cvirus infection, comprising the use of the antibody or the
antibody fragment or the pharmaceutical composition. Suitably, an effective amount of
the antibody or fragment thereof or the pharmaceutical composition is administered to
the subject to induce an immune response.
There is also provided an antibody of a fragment thereof or the pharmaceutical
composition for use in the treatment and/or prevention of hepatitis Cvirus infection in
a subject.
Preferably the administered antibody/ fragments thereof are substantially purified (e.g.,
preferably at least 95% homogeneity, more preferably at least 97% homogeneity, and
most preferably at least 98% homogeneity, as judged by SDS-PAGE).
The active immunisation methods of the invention should allow for the protection or
treatment of individuals against infection with viruses of a range of HCV genotypes,
more suitably any of genotypes 1-6 of HCV, except for very occasional mutant isolates
which contain several amino acid differences to that of the consensus peptide epitope
412-423 of E2.
Construction and operation of standard antibody expression systems as outlined above
is well within the ambit of the skilled reader. Such systems are widely commercially
available and are used as a matter of routine in order to produce antibody molecules
having the desired CDRs.
In one aspect the polypeptide of the invention is a polypeptide comprising at least the
six CDRs of the B2.1A antibody.
Unless otherwise indicated, all discussion of nucleotide and/ or amino acid numbering
herein follows the usual conventions. Numbering for polypeptide or polynucleotide
sequences follows the numbering of the wild type version or the version apparent from
the context. Numbering for antibody polypeptides / residues / mutants etc follows the
established Rabat numbering (Rabat EA, Wu TT, Perry HM, Gottesman RS, Foeller C.
1991. Sequences of proteins of immunological interest, 5th ed. U.S. Department of
Health and Human Services/NIH, Bethesda, MD.).
The polypeptide of the invention maybe fused to another polypeptide such as a carrier
polypeptide, a scaffold polypeptide or any other polypeptide.
It is further surprising that the Fab fragment of B2.1A performed better than the scFv
of B2.1A. It is further surprising that the Fab fragment of B2.1A performed so well,
especially since Fab fragments lose their divalence, but that did not appear to adversely
affect performance.
The inventors took an unusual approach in selection of B2.1A. Firstly, they tried the
conventional approach of immunising with target antibody (AP33) and generating anti-
AP33 anti-idiotypic sera. However, those sera repeatedly failed. In order to address
this problem, the inventors studied the crystal structure of AP33 complexed with its
target, the linear E2 peptide. Based on this crystal structure, the inventors generated
alanine mutants at fifteen different carefully selected sites on the AP33 antibody. In
this manner, the inventors generated a panel of fifteen mutated antibodies based
closely on AP33, each bearing a separate single alanine mutation in the key antigen
binding pocket. The inventors tested the binding of these AP33 mutants to the E2
polypeptide. The inventors found that a single mutation at each of these carefully
chosen sites was enough to abrogate the binding of the AP33 mutants to the AP33
epitope on the E2 polypeptide. In a remarkable new approach, the inventors then took
this panel of mutant antibodies and analysed their binding to a panel of candidate antiidiotype
antibodies generated by immunisation with AP33. The results from this
analysis varied widely. All of the anti-idiotype antibodies studied inhibited E2 binding
to AP33. However, the anti-idiotype antibodies varied widely in their binding to the
panel of fifteen mutant AP33 antibodies. Through a careful analysis of the binding of
the anti-idiotype candidate antibodies to the fifteen alanine mutant AP33 antibodies,
the inventors were able to select the remarkable B2.1A anti-idiotype antibody. This was
the only anti-idiotype antibody in the analysis which showed a binding which was
negatively affected by each of the individual alanine mutated AP33 mutant antibodies.
This striking result is illustrated in Table 1. The key mutated residues in the AP33 light
and heavy chains are highlighted in the "E2" row of the table. These correspond to
eight alanine substitutions that reduce binding to E2 by more than 90%. These
residues were therefore considered crucial to the AP33 - E2 interaction. As can be seen
in the row entitled "B2.1A", this anti-idiotypic antibody also showed a drastically
reduced binding to each of the AP33 alanine mutants bearing substitutions at those
crucial residues. In sharp contrast, all of the other candidate anti-idiotype antibodies
shown in Table 1 maintained a high level of binding to at least one of those AP33-
derived antibodies bearing alanine substitutions at crucial residues. For example,
L1.1A shows 85% binding even to a N91A AP33 mutant antibody. Therefore, B2.1A was
unique amongst all of the candidate anti-idiotypic antibodies analysed in that it showed
a pattern of depressed binding to all of the AP33 mutant antibodies bearing alanine
substitutions at the crucial residues for the AP33 - E2 interaction. This was
interpreted by the inventors as the strongest possible evidence that they had created an
anti-idiotypic antibody whose 3-dimensional structure most closely mimicked the 3-
dimensional structure of the crucial epitope on the E2 polypeptide itself.
For all of these reasons, it is clear that the B2.1A antibody has unique and valuable
characteristics which could not be expected, and which are not shown by any other
known antibody, nor any other candidate antibody studied by the inventors.
A more conventional approach might have been to use all of the candidate anti-idiotype
antibodies to immunise. Resulting sera (anti-Ab2 or anti-(anti-idiotype) sera) which
show antibodies recognising E2 would then be selected. However, when the inventors
followed this approach they experienced problematic rates of failure. In fact, the
inventors did this for 25 candidate anti-Ab2 sera. Although the anti-Ab2 sera showed
inhibition of binding of AP33 to E2 (indicating that they contained anti-Ab2
antibodies), the anti-Ab2 sera did not bind E2, nor did they inhibit HCV in cell culture.
The inventors therefore rethought their approach as described above.
For illustrative/comparative purposes, a selection of the failed sera results are
presented in a comparative example (see below).
It should be noted that the B2.1A antibody was very challenging to produce. For
example, as described above, the inventors initially tried to obtain this antibody using
twenty five separate immune sera generated by immunisation with AP33 antibodies.
As explained above, none of those yielded the successful anti-idiotypic antibody having
the features of B2.1A. In addition, prior attempts to induce anti-HCV E2 412 to 423
antibodies by immunising with E2 peptides, such as peptides comprising the 412 to 423
E2 antigen were unsuccessful. In view of these robust attempts to generate a successful
immunogenic anti-idiotype antibody, the expectation would have been that such an
antibody could not be produced. However, even in the face of this stark scientific
situation, the inventors were able to adapt and make progress over a long period of
arduous research as described herein. The result was the B2.1A antibody which is both
structurally novel in terms of its sequence, in particular the unique and novel sequences
of the CDRs and/or of the VL and/or of the VH chains, and also provides striking and
unique characteristics which are beneficial and render it susceptible of industrial
application/utility. These properties are discussed in more detail below.
More specifically, the fact that the inventors were able to produce an antibody capable
of replicating the key binding characteristics between the broadly neutralising AP33
antibody and its target epitope of residues 412 to 423 of E2 is an unexpected and
extremely valuable achievement.
With reference to Table 1showing the binding properties of E2 and anti-idiotypic
antibodies to wild-type and mutant AP33, by "high" binding is meant binding of the
test polypeptide to AP33 mutants at scores of 50% or higher of the binding of E2 to
wild-type AP33. In particular, the key mutants under consideration are FL32A, NL9iA,
WL96A; YH33A, YH50A, Yh 58A, Ih 95A and YHiooA.
Antibodies
Antibodies are naturally occurring immunoglobulin molecules which have varying
structures, all based upon the immunoglobulin fold. For example, IgG antibodies such
as AP33 have two 'heavy' chains and two 'light' chains that are disulphide-bonded to
form a functional antibody. Each heavy and light chain itself comprises a "constant" (C)
and a "variable" (V) region. The V regions determine the antigen binding specificity of
the antibody, whilst the Cregions provide structural support and function in nonantigen-
specific interactions with immune effectors. The antigen binding specificity of
an antibody or antigen-binding fragment of an antibody is the ability of an antibody or
fragment thereof to specifically bind to a particular antigen.
The antigen binding specificity of an antibody is determined by the structural
characteristics of the V region. The variability is not evenly distributed across the 110-
amino acid span of the variable domains. Instead, the V regions consist of relatively
invariant stretches called framework regions (FRs) of 15-30 amino acids separated by
shorter regions of extreme variability called "hypervariable regions" that are each 9-12
amino acids long. The variable domains of native heavy and light chains each comprise
four FRs, largely adopting a b-sheet configuration, connected by three hypervariable
regions, which form loops connecting, and in some cases forming part of, the b-sheet
structure. The hypervariable regions in each chain are held together in close proximity
by the FRs and, with the hypervariable regions from the other chain, contribute to the
formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of
Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes
of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in
binding an antibody to an antigen, but exhibit various effector functions, such as
participation of the antibody in antibody dependent cellular cytotoxicity (ADCC).
In some embodiments, the hypervariable regions are the amino acid residues of an
antibody which are responsible for antigen-binding. The hypervariable region may
comprise amino acid residues from a "complementarity determining region" or "CDR"
(e.g., around about residues 24-34 (Li), 50-56 (L2) and 89-97 (L3) in the VL, and
around about 31-35B (Hi), 50-65 (H2) and 95-102 (H3) in the VH (Kabat et al.,
Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service,
National Institutes of Health, Bethesda, Md. (1991)) and/or those residues from a
"hypervariable loop" (e.g. residues 26-32 (Li), 50-52 (L2) and 91-96 (L3) in the VL, and
26-32 (Hi), 52A-55 (H2) and 96-101 (H3) in the VH (Chothia and Lesk J . Mol. Biol.
196:901-917 (1987)).
Each V region typically comprises three complementarity determining regions ("CDRs",
each of which contains a "hypervariable loop"), and four framework regions. An
antibody binding site, the minimal structural unit required to bind with substantial
affinity to a particular desired antigen, will therefore typically include the three CDRs,
and at least three, preferably four, framework regions interspersed there between to
hold and present the CDRs in the appropriate conformation. Classical four chain
antibodies, such as AP33, have antigen binding sites which are defined by VH and VL
domains in cooperation. Certain antibodies, such as camel and shark antibodies, lack
light chains and rely on binding sites formed by heavy chains only. Single domain
engineered immunoglobulins can be prepared in which the binding sites are formed by
heavy chains or light chains alone, in absence of cooperation between VH and VL.
Throughout the present specification and claims, unless otherwise indicated, the
numbering of the residues in the constant domains of an immunoglobulin heavy chain
is that of the EU index as in Kabat et al., Sequences of Proteins of Immunological
Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md.
(1991), expressly incorporated herein by reference. The "EU index as in Kabat" refers to
the residue numbering of the human IgGi EU antibody. The residues in the V region
are numbered according to Kabat numbering unless sequential or other numbering
system is specifically indicated.
The antibody or antibody fragment described herein may be isolated or purified to any
degree. As used herein, "isolated" means that that antibody or antibody fragment has
been removed from its natural environment. In some embodiments, contaminant
components of its natural environment are materials which would interfere with
diagnostic or therapeutic or immunisation uses for the antibody, and may include
enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In some
embodiments, the antibody will be purified (1) to greater than 95% by weight of
antibody as determined by the Lowry method, and most preferably more than 99% by
weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal
amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by
SDS-PAGEunder reducing or nonreducing conditions using Coomassie blue or,
preferably, silver stain. Isolated antibody includes the antibody in situ within
recombinant cells since at least one component of the antibody's natural environment
will not be present. Ordinarily, however, isolated antibody will be prepared by at least
one purification step.
"Purified" means that the antibody or antibody fragment has been increased in purity,
such that it exists in a form that is more pure than it exists in its natural environment
and/or when initially synthesized and/or amplified under laboratory conditions. Purity
is a relative term and does not necessarily mean absolute purity.
AP33 Antibody
AP33 is a mouse monoclonal antibody (MAb) that can strongly inhibit the interaction
between E2 (in various forms, including soluble E2, E1E2, and virus-like particles) and
CD81 (Clayton RF, et al. 2002. Analysis of antigenicity and topology of E2 glycoprotein
present on recombinant hepatitis Cvirus-like particles. J . Virol. 76:7672-7682,
Owsianka A, Clayton RF, Loomis-Price LD, McKeating JA, Patel AH. 2001. Functional
analysis of hepatitis Cvirus E2 glycoproteins and viruslike particles reveals structural
dissimilarities between different forms of E2. J . Gen. Virol. 82:1877-1883, Owsianka A,
et al. 2005. Monoclonal antibody AP33 defines a broadlyneutralizing epitope on the
hepatitis Cvirus E2 envelope glycoprotein. J . Gen. Virol. 79:11095-11104).
The AP33 epitope, which spans residues 412 to 423 of HCV E2, is linear and highly
conserved and encompasses a tryptophan residue that plays a critical role in CD81
recognition. Indeed, the antibody has been shown to be capable of potently neutralizing
infection across all the major genotypes.
Any known AP33 antibody may be used in the methods and techniques described
herein. AP33 has been humanised, for example as in WO2009/081285. Suitably
references herein to Ά R33 antibody' refer to the wild type mouse monoclonal AP33
antibody. Most suitably 'AP33 antibody' means an antibody or antigen binding
fragment thereof comprising the AP33 CDRs, more suitably comprising the AP33 VL
and/or VH sequences as described below.
AP33 fWT) vh and vL coding sequences
AP33 WT VH sea
The sequence is arranged Leader-vH.
The Leader sequence is |boxed| .
|ATG GTG TTA AGT CTT CTG TAC CTG TTG ACA GCC CTT CCG GGT ATC CTG TCA| GAG GTG
CAG CTT CAG GAG TCA GGA CCT AGC CTC GTG AAA CCT TCT CAG ACT CTG TCC CTC ACC
TGT TCT GTC ACT GGC GAC TCC ATC ACC AGT GGT TAC TGG AAC TGG ATC CGG AAA TTC
CCA GGG AAT AAA CTT GAG TAC ATG GGA TAC ATA AGT TAC AGT GGT AGC ACT TAC TAC
AAT CTA TCT CTC AGA AGT CGC ATC TCC ATC ACT CGA GAC ACA TCC AAG AAT CAG TAC
TAC CTG CAG TTG AAT TCT GTG ACT ACT GAG GAC ACA GCC ACA TAT TAC TGT GCG CTC
ATT ACT ACG ACT ACC TAT GCT ATG GAC TAC TGG GGT CAA GGA ACC TCA GTC ACC GTC
TCC (SEQ ID NO: 14)
The amino acid sequence is disclosed by virtue of the above coding sequence
which may be translated into the amino acid sequence using the universal
genetic code.
AP33 WT VLse
The sequence is arranged Leader-vL
The Leader sequence is Iboxedl.
ATG GAG ACA GAC ACA CTC CTG CTA TGG GTG CTG CTG CTC TGG GTT CCA GGT
TCC ACA GGT AAC ATT GTG CTG ACC CAA TCT CCA GTT TCT TTG GCT GTG TCT
CTG GGG CAG AGG GCC ACC ATT TCC TGC AGA GCC AGT GAA AGT GTT GAT GGT
TAT GGC AAT AGT TTT CTG CAC TGG TTC CAG CAG AAA CCA GGA CAG CCA CCC
AAA CTC CTC ATC TAT CTT GCA TCC AAC CTA AAC TCT GGG GTC CCT GCC AGG
TTC AGT GGC AGT GGG TCT AGG ACA GAC TTC ACC CTC ACC ATT GAT CCT GTG
GAG GCT GAT GAT GCT GCA ACC TAT TAC TGT CAG CAA AAT AAT GTG GAC CCG
TGG ACG TTC GGT GGA GGC ACC AAG CTG GAA ATC AAA (SEQ ID NO: 15)
The amino acid sequence is disclosed by virtue of the above coding sequence
which may be translated into the amino acid sequence using the universal
genetic code.
The sequences of the CDRs of AP33 are suitably as disclosed by the above nucleotide
coding sequence of the VL and VH regions of AP33 antibody since it is a routine matter
for the skilled worker to identify the CDRs given the VL/VH sequences.
The 'antigen binding pocket of the monoclonal AP33 antibody' is defined as known in
the art, for example in Potter et al 2012 (J. Virol vol 86 No 23 pages 12923-12932
"Toward a Hepatitis CVirus Vaccine: the Structural Basis of HepatitisC Virus
Neutralization by AP33, a Broadly Neutralizing Antibody") which is incorporated
herein by reference for the specific disclosure of the antigen binding pocket, with
particular reference to Figure 3 of Potter et al 2012.
In case any further guidance is required, reference is made to the examples section
herein.
Suitably the 'antigen binding pocket of the monoclonal AP33 antibody' is that part of
AP33 which comprises the AP33 residues shown in Table 1.
Most suitably the 'antigen binding pocket of the monoclonal AP33 antibody' is that part
of AP33 which comprises the AP33 residues highlighted in Table 1 (double underlined
and bold in the head of the table in the 'WT AP33' row).
HCV E2 Protein
The HCV E2 protein is known in the art. For ease of reference representative HCV E2
sequences (both amino acid and nucleotide sequences) are provided in FIGURE 5.
The sequences presented are translation of: HCV strain H77C
The sequence shown is from HCV nucleotides 1to 2600 encoding viral proteins core,
Ei and E2 as annotated. The E2 sequence from amino acid residue 384-746 is
underlined.
B2.1A Antibody
The sequence of B2.1A light and heavy chain variable regions is shown below.
Following convention, the vL CDRs are described as CDRi, CDR2 and CDR3.
Alternatively, the light chain CDRs may be referred to as Li, L2, L3 and heavy chain
CDRs as Hi, H2, H3.
The CDRs are shown in boxed type on the amino acid sequence (the three sections of
boxed type are CDRi, 2 and 3, respectively). These are also shown separately for ease
of reference. Where there is underlining in a particular sequence, any non-underlined
sequences are nucleotides/residues at the beginning of the sequence that did not
appear in our sequencing, i.e. they were missing from the sequence because they were
too close to the primer. They are therefore taken from the germline sequence that
matches the rest of the obtained sequence.
In the preferred sequences:
CDRs defined by Kabat analysis are in boId
CDRs defined by Chothia analysis are underlined
Preferred CDRs based on crystal structure are |boxed.| In all instances, unless otherwise
apparent from the context, reference to the CDRs of the B2.1A antibody (or derivative
thereof) refers to the preferred CDRs as boxed above.
In the heavy chain preferred sequences, the T in italics was originally sequenced as A
but corrected to T. Corresponding codon is ACT.
Heavy chain
Example Sequence Preferred Sequence
B2.1A Heavy CTTCCGGAATTNCAGGTNCA CAGGTTCAGCTGCAGGAGTC
chain GCTGCAGGAGTCTGGGGCTG TGGGACJGAGCTGGTGAAGC
nucleotide AGCTGGTGAAGCCTGGGGCT CTGGGGCTTCAGTGAAGCTG
sequence TCAGTGAAGCTGTCCTGCAA TCCTGCAAGGCTTCTGGCTA
GGCTTCTGGCTACACCTTCAC CACCTTCACCAACTACTGGAT
CAACTACTGGATGCACTGGG GCACTGGGTTAAGCAGAGGC
TTAAGCAGAGGCCTGGACAA CTGGACAAGGCCTTGAGTGG
GGCCTTGAGTGGATTGGAGA ATTGGAGAGATTAATCCTAG
GATTAATCCTAGCGACGGTC CGACGGTCATACTAACTACA
ATACTAACTACAATGAGAAG ATGAGAAGTTCAAGAGCAAG
TTCAAGAGCAAGGCCACACT GCCACACTGACTGTAGACAA
GACTGTAGACAAATCCTCCA ATCCTCCAGCACAGCCTACAT
GCACAGCCTACATGCAACTC GCAACTCAGCAGCCTGACAT
AGCAGCCTGACATCTGAGGA CTGAGGACTCTGCGGTCTAT
CTCTGCGGTCTATTACTGTGC TACTGTGCAAGACCTTGGGC
AAGACCTTGGGCGTTTGGTA GTTTGGTAACTACGGGGCCT
ACTACGGGGCCTGGTTTGCT GGTTTGCTTACTGGGGCCAA
TACTGGGGCCAAGGGACTCT GGGACTCTGGTCACTGTCTC
GGTCACTGTCTCTGCAGCCA TGCA
AAACGACACCCCCATCT (SEQ 21)
10)
B2.1A Heavy QVQLQESGAELVKPGASVKLS QVQLQESGrELVKPGASVKLS
chain amino CKASGYTFTlNYWMHlWVKQ CKASIGYTFTNYWMHWVKO
acid RPGOGLEWIGEl lN P DG
sequence
22)
VH CDRl INYWMH IGYTFTNYWI
(Hi) (SEQ 4) (SEQ 24)
VH CDR2
(H2) (SEQ 5) (SEQ 25)
VH CDR3
(SEQ 6) (SEQ 26)
(H3 )
Regarding the Preferred Sequences compared to the Example Sequences, there are
some minor differences: (l) There are three extra codons at the beginning of the LC
sequence, which code for DIV; (2) extra nucleotides at the 3' end of the LC sequence
that do not code for the aa sequence of the LC variable region have been deleted; (3)
Extra nucleotides at the 5' end of the HC sequence that do not code for the aa sequence
of the HCvariable region have been deleted; (4) The nucleotide given as N within the
coding sequence of the HCis actually a T, i.e. the first two codons are CAG GTT (coding
for aa's QV); (5) The ninth aa of the HCis T, not A. The corresponding codon is ACT,
not GCT.
Regarding the preferred CDR sequences, as the skilled worker will appreciate, there
are various models for assigning/identifying the CDR sequences in antibody VL/VH
chains. The most popular/widely accepted versions are the Chothia and Kabat models,
although others also exist such as the ABM and CONTACTmodels. The 'Example
Sequence' CDR sequences were determined using the Kabat model as is conventional in
the art. Therefore, whilst the Kabat determined CDRs represent a robust
determination, they are in fact only modelled/predicted CDRs. The absolute/correct
CDR sequences are those which are experimentally determined. The inventors have
carried out this labour intensive analysis by creating a crystal structure. The
experimentally determined CDRs are the 'Preferred Sequences'.
Expression of Recom binant Antibodies
Also provided are isolated nucleic acids encoding the antibodies and fragments thereof
described herein such as the B2.1A antibodies, vectors and host cells comprising the
nucleic acid, and recombinant techniques for the production of the antibody. The
antibodies described herein may be produced by recombinant expression.
Nucleic acids encoding light and heavy chain variable regions as described herein are
optionally linked to constant regions, and inserted into an expression vector(s). The
light and heavy chains can be cloned in the same or different expression vectors. The
DNA segments encoding immunoglobulin chains are operably linked to control
sequences in the expression vector(s) that ensure the expression of immunoglobulin
polypeptides. Expression control sequences include, but are not limited to, promoters
{e.g., naturally-associated or heterologous promoters), signal sequences, enhancer
elements, and transcription termination sequences.
Suitably, the expression control sequences are eukaryotic promoter systems in vectors
capable of transforming or transfecting eukaryotic host cells {e.g., COS cells - such as
COS 7 cells - or CHO cells). Once the vector has been incorporated into the appropriate
host, the host is maintained under conditions suitable for high level expression of the
nucleotide sequences, and the collection and purification of the cross-reacting
antibodies.
These expression vectors are typically replicable in the host organisms either as
episomes or as an integral part of the host chromosomal DNA.
Selection Gene Component- Commonly, expression vectors contain selection markers
{e.g., ampicillin-resistance, hygromycin-resistance, tetracycline resistance, kanamycin
resistance or neomycin resistance) to permit detection of those cells transformed with
the desired DNA sequences {see, e.g., Itakura et al., US 4,704,362). In some
embodiments, selection genes encode proteins that (a) confer resistance to antibiotics
or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b)
complement auxotrophic deficiencies, or (c) supply critical nutrients not available from
complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those
cells that are successfully transformed with a heterologous gene produce a protein
conferring drug resistance and thus survive the selection regimen. Examples of such
dominant selection use the drugs neomycin, mycophenolic acid and hygromycin.
Another example of suitable selectable markers for mammalian cells are those that
enable the identification of cells competent to take up the nucleic acid encoding
antibodies or fragments thereof described herein such as the B2.1A antibodies, such as
DHFR, thymidine kinase, metallothionein-I and -III, preferably primate
metallothionein genes, adenosine deaminase, ornithine decarboxylase, etc.
For example, cells transformed with the DHFR selection gene are first identified by
culturing all of the transformants in a culture medium that contains methotrexate
(Mtx), a competitive antagonist of DHFR. An appropriate host cell when wild-type
DHFR is employed is the Chinese hamster ovary (CHO) cell line deficient in DHFR
activity {e.g., ATCCCRL-9096).
Alternatively, host cells (particularly wild-type hosts that contain endogenous DHFR)
transformed or co-transformed with DNA sequences encoding an antibody described
herein, wild-type DHFR protein, and another selectable marker such as aminoglycoside
3'-phosphotransferase (APH) can be selected by cell growth in medium containing a
selection agent for the selectable marker such as an aminoglycosidic antibiotic, e.g.,
kanamycin, neomycin, or G418. See U.S. Pat. No. 4,965,199.
A suitable selection gene for use in yeast is the trpi gene present in the yeast plasmid
YRp7 (Stinchcomb et al., Nature, 282:39 (1979)). The trpi gene provides a selection
marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for
example, ATCCNo. 44076 or PEP4-1. Jones, Genetics, 85:12 (1977). The presence of
the trpi lesion in the yeast host cell genome then provides an effective environment for
detecting transformation by growth in the absence of tryptophan. Similarly, Leu2-
deficient yeast strains (ATCC 20,622 or 38,626) are complemented by known plasmids
bearing the Leu2 gene.
In addition, vectors derived from the 1.6 mpi circular plasmid pKDi can be used for
transformation of Kluyveromyces yeasts. Alternatively, an expression system for largescale
production of recombinant calf chymosin was reported for K. lactis. Van den
Berg, Bio/Technology, 8:135 (1990). Stable multi-copy expression vectors for secretion
of mature recombinant human serum albumin by industrial strains of Kluyveromyces
have also been disclosed. Fleer et al., Bio/Technology, 9:968-975 (1991).
Signal Sequence Component- The antibodies described herein such as the B2.1A
antibodies may be produced recombinantly not only directly, but also as a fusion
polypeptide with a heterologous polypeptide, which is preferably a signal sequence or
other polypeptide having a specific cleavage site at the N-terminus of the mature
protein or polypeptide. The heterologous signal sequence selected preferably is one that
is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell. A signal
sequence can be substituted with a prokaryotic signal sequence selected, for example,
from the group of the alkaline phosphatase, penicillinase, 1pp, or heat-stable
enterotoxin II leaders. For yeast secretion the native signal sequence may be
substituted by, e.g., the yeast invertase leader, a factor leader (including
Saccharomyces and Kluyveromyces a-factor leaders), or acid phosphatase leader, the
C. albicans glucoamylase leader, or the signal described in WO 90/13646. In
mammalian cell expression, mammalian signal sequences as well as viral secretory
leaders, for example, the herpes simplex gD signal, are available.
The DNAfor such precursor region is ligated in reading frame to DNA encoding the
antibodies described herein such as the B2.1A antibodies.
Origin of Replication-Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more selected host cells.
Generally, in cloning vectors this sequence is one that enables the vector to replicate
independently of the host chromosomal DNA, and includes origins of replication or
autonomously replicating sequences. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the plasmid PBR322 is
suitable for most Gram-negative bacteria, the 2m plasmid origin is suitable for yeast,
and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for
cloning vectors in mammalian cells. Generally, the origin of replication component is
not needed for mammalian expression vectors (the SV40 origin may typically be used
only because it contains the early promoter).
Promoter Component- Expression and cloning vectors usually contain a promoter that
is recognized by the host organism and is operably linked to the nucleic acid encoding
an antibody described herein such as a B2.1A antibody. Promoters suitable for use with
prokaryotic hosts include the phoA promoter, b-lactamase and lactose promoter
systems, alkaline phosphatase promoter, a tryptophan (trp) promoter system, and
hybrid promoters such as the tac promoter. However, other known bacterial promoters
are suitable. Promoters for use in bacterial systems also will contain a Shine-Dalgarno
(S.D.) sequence operably linked to the DNA encoding the antibody.
Promoter sequences are known for eukaryotes. Virtually all eukaryotic genes have an
AT-rich region located approximately 25 to 30 bases upstream from the site where
transcription is initiated. Another sequence found 70 to 80 bases upstream from the
start of transcription of many genes is a CNCAATregion where N may be any
nucleotide. At the 3' end of most eukaryotic genes is an AATAAAsequence that may be
the signal for addition of the poly Atail to the 3' end of the coding sequence. All of these
sequences are suitably inserted into eukaryotic expression vectors.
Examples of suitable promoter sequences for use with yeast hosts include the
promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase,
pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and
glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage
of transcription controlled by growth conditions, are the promoter regions for alcohol
dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate
dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable
vectors and promoters for use in yeast expression are further described in EP 73,657.
Yeast enhancers also are advantageously used with yeast promoters.
The transcription of an antibody described herein such as the B2.1A antibody from
vectors in mammalian host cells is controlled, for example, by promoters obtained from
the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as
Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from
heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin
promoter, from heat-shock promoters, provided such promoters are compatible with
the host cell systems.
The early and late promoters of the SV40 virus are conveniently obtained as an SV40
restriction fragment that also contains the SV40 viral origin of replication. The
immediate early promoter of the human cytomegalovirus is conveniently obtained as a
Hindlll E restriction fragment. A system for expressing DNAin mammalian hosts
using the bovine papilloma virus as a vector is disclosed in U.S. Pat. No. 4,419,446. A
modification of this system is described in U.S. Pat. No. 4,601,978. See also Reyes et al.,
Nature 297:598-601 (1982) on expression of human .beta. -interferon cDNAin mouse
cells under the control of a thymidine kinase promoter from herpes simplex virus.
Alternatively, the Rous Sarcoma Virus long terminal repeat can be used as the
promoter.
Enhancer Element Component- Transcription of a DNA encoding the antibody
described herein such as the B2.1A antibody by higher eukaryotes is often increased by
inserting an enhancer sequence into the vector. Many enhancer sequences are now
known from mammalian genes (globin, elastase, albumin, .alpha.-fetoprotein, and
insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus.
Examples include the SV40 enhancer on the late side of the replication origin (bp 100-
270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late
side of the replication origin, and adenovirus enhancers. See also Yaniv, Nature 297:17-
18 (1982) on enhancing elements for activation of eukaryotic promoters. The enhancer
may be spliced into the vector at a position 5' or 3' to the HCVbinding antibodyencoding
sequence, but is preferably located at a site 5' from the promoter.
Transcription Termination Component- Expression vectors used in eukaryotic host
cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for the termination of
transcription and for stabilizing the mRNA. Such sequences are commonly available
from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or
cDNAs. One useful transcription termination component is the bovine growth hormone
polyadenylation region. See WO94/11026 and the expression vector disclosed therein.
The vectors containing the polynucleotide sequences {e.g., the variable heavy and/or
variable light chain encoding sequences and optional expression control sequences) can
be transferred into a host cell by well-known methods, which vary depending on the
type of cellular host. For example, calcium chloride transfection is commonly utilized
for prokaryotic cells, whereas calcium phosphate treatment, electroporation,
lipofection, biolistics or viral-based transfection maybe used for other cellular hosts.
See generally Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Press, 2nd ed., 1989). Other methods used to transform mammalian
cells include the use of polybrene, protoplast fusion, liposomes, electroporation, and
microinjection (see generally, Sambrook et al., supra). For production of transgenic
animals, transgenes can be microinjected into fertilized oocytes, or can be incorporated
into the genome of embryonic stem cells, and the nuclei of such cells transferred into
enucleated oocytes.
When heavy and light chains are cloned on separate expression vectors, the vectors are
co-transfected to obtain expression and assembly of intact immunoglobulins. Once
expressed, the whole antibodies, their dimers, individual light and heavy chains, or
other immunoglobulin forms can be purified according to standard procedures of the
art, including ammonium sulfate precipitation, affinity columns, column
chromatography, HPLC purification, gel electrophoresis and the like (see generally
Scopes, Protein Purification (Springer-Verlag, N.Y., (1982)). Substantially pure
immunoglobulins of at least about 90 to 95% homogeneity are preferred, and 98 to
99% or more homogeneity is most preferred, for pharmaceutical uses.
Constructs
The invention further provides a nucleic acid construct comprising a polynucleotide as
described herein.
Typically the construct will be an expression vector allowing expression, in a suitable
host, of the polypeptide(s) encoded by the polynucleotide. The construct may comprise,
for example, one or more of the following: a promoter active in the host; one or more
regulatory sequences, such as enhancers; an origin of replication; and a marker,
preferably a selectable marker. The host maybe a eukaryotic or prokaryotic host,
although eukaryotic (and especially mammalian) hosts may be preferred. The selection
of suitable promoters will obviously depend to some extent on the host cell used, but
may include promoters from human viruses such as HSV, SV40, RSV and the like.
Numerous promoters are known to those skilled in the art.
The construct may comprise a polynucleotide which encodes a polypeptide comprising
three light chain hypervanable loops or three heavy chain hypervanable loops.
Alternatively the polynucleotide may encode a polypeptide comprising three heavy
chain hypervariable loops and three light chain hypervariable loops joined by a suitably
flexible linker of appropriate length. Another possibility is that a single construct may
comprise a polynucleotide encoding two separate polypeptides - one comprising the
light chain loops and one comprising the heavy chain loops. The separate polypeptides
maybe independently expressed or may form part of a single common operon.
The construct may comprise one or more regulatory features, such as an enhancer, an
origin of replication, and one or more markers (selectable or otherwise). The construct
may take the form of a plasmid, a yeast artificial chromosome, a yeast minichromosome,
or be integrated into all or part of the genome of a virus, especially an
attenuated virus or similar which is non-pathogenic for humans.
The construct may be conveniently formulated for safe administration to a mammalian,
preferably human, subject. Typically, they will be provided in a plurality of aliquots,
each aliquot containing sufficient construct for effective immunization of at least one
normal adult human subject.
The construct may be provided in liquid or solid form, preferably as a freeze-dried
powder which, typically, is rehydrated with a sterile aqueous liquid prior to use.
The construct may be formulated with an adjuvant or other component which has the
effect of increasing the immune response of the subject (e.g., as measured by specific
antibody titer) in response to administration of the construct.
Vectors
The term "vector" includes expression vectors and transformation vectors and shuttle
vectors.
The term "expression vector" means a construct capable of in vivo or in vitro
expression.
The term "transformation vector" means a construct capable of being transferred from
one entity to another entity - which may be of the species or may be of a different
species. If the construct is capable of being transferred from one species to another -
such as from an Escherichia coli plasmid to a bacterium, such as of the genus Bacillus,
then the transformation vector is sometimes called a "shuttle vector". It may even be a
construct capable of being transferred from an E. coli plasmid to an Agrobacterium to
a plant.
Vectors may be transformed into a suitable host cell as described below to provide for
expression of a polypeptide encompassed in the present invention. Thus, in a further
aspect the invention provides a process for preparing polypeptides for use in the
present invention which comprises cultivating a host cell transformed or transfected
with an expression vector as described above under conditions to provide for
expression by the vector of a coding sequence encoding the polypeptides, and
recovering the expressed polypeptides.
The vectors may be for example, plasmid, virus or phage vectors provided with an
origin of replication, optionally a promoter for the expression of the said polynucleotide
and optionally a regulator of the promoter.
Vectors may contain one or more selectable marker genes which are well known in the
art.
There are many known heavy and light chain expression vectors commercially
available. The skilled operator may choose vectors expressing the same constant region
subtype as the original antibody. The sequence of the heavy and light chain variable
regions is then easily placed into the vector accordingly.
Suitably InvivoGen (of 5, rue Jean Rodier, F-31400 Toulouse, France) vectors maybe
used for heterologous expression of antibodies or antigen binding fragments of the
invention. For example, B2.1A may be expressed using pFUSE2ss-CLIg-mk for the K
light chain and pFUSEss-CHIg-mGi for the IgGi heavy chain variable region.
Similarly, there is a wide range of known vectors commercially available for scFV
expression. To make the B2.1A scFv's, suitably vector(s) such as pDisplay or derivatives
thereof may be used.
Host Cells
The invention further provides a host cell - such as a host cell in vitro - comprising the
polynucleotide or construct described herein. The host cell may be a bacterium, a yeast
or other fungal cell, insect cell, a plant cell, or a mammalian cell, for example.
The invention also provides a transgenic multicellular host organism which has been
genetically manipulated so as to produce a polypeptide in accordance with the
invention. The organism maybe, for example, a transgenic mammalian organism {e.g.,
a transgenic goat or mouse line).
E. coli is one prokaryotic host that may be of use. Other microbial hosts include bacilli,
such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia,
and various Pseudomonas species. In these prokaryotic hosts, one can make expression
vectors, which will typically contain expression control sequences compatible with the
host cell (e.g., an origin of replication). In addition, any number of a variety of wellknown
promoters will be present, such as the lactose promoter system, a tryptophan
(trp) promoter system, a beta-lactamase promoter system, or a promoter system from
phage lambda. The promoters will typically control expression, optionally with an
operator sequence, and have ribosome binding site sequences and the like, for initiating
and completing transcription and translation.
Other microbes, such as yeast, maybe used for expression. Saccharomyces is a
preferred yeast host, with suitable vectors having expression control sequences (e.g.,
promoters), an origin of replication, termination sequences and the like as desired.
Typical promoters include 3-phosphoglycerate kinase and other glycolytic enzymes.
Inducible yeast promoters include, among others, promoters from alcohol
dehydrogenase, isocytochrome C, and enzymes responsible for maltose and galactose
utilization.
In addition to microorganisms, mammalian tissue cell culture may also be used to
express and produce the antibodies or fragments thereof as described herein and in
some instances are preferred (See Winnacker, From Genes to Clones, VCH Publishers,
N.Y., N.Y. (1987). For some embodiments, eukaryotic cells (e.g., COS7 cells) maybe
preferred, because a number of suitable host cell lines capable of secreting heterologous
proteins (e.g., intact immunoglobulins) have been developed in the art, and include
CHO cell lines, various Cos cell lines, HeLa cells, preferably, myeloma cell lines, or
transformed B-cells or hybridomas.
In some embodiments, the host cell is a vertebrate host cell. Examples of useful
mammalian host cell lines are monkey kidney C 1line transformed by SV40 (COS-7,

CLAIMS
1. An antibody or antigen binding fragment thereof capable of binding to the
antigen binding pocket of the AP33 antibody, wherein said antibody or antigen binding
fragment thereof comprises VL CDRi (Li), VL CDR2 (L2), and VL CDR3 (L3)
consisting of the amino acid sequences of SEQ ID NO:i, SEQ ID NO:2 and SEQ ID
NO:23 respectively, and comprises VH CDRi (Hi), VH CDR2 (H2), and VH CDR3 (H3)
consisting of the amino acid sequences of SEQ ID NO 24 , SEQ ID NO 25, and SEQ ID
NO:26 respectively.
2. An antibody according to claim 1wherein said antibody or antigen binding
fragment thereof comprises VL amino acid sequence consisting of the amino acid
sequence of SEQ ID N0:20.
3. An antibody according to claim 1wherein said antibody or antigen binding
fragment thereof comprises VH amino acid sequence consisting of the amino acid
sequence of SEQ ID NO:22.
4. An antibody according to claim 1wherein said antibody or antigen binding
fragment thereof comprises VL amino acid sequence consisting of the amino acid
sequence of SEQ ID NO:20 and wherein said antibody or antigen binding fragment
thereof comprises VH amino acid sequence consisting of the amino acid sequence of
SEQ ID N0:22.
5. An antibody or antigen binding fragment thereof according to any preceding
claim, wherein the antigen binding fragment thereof is selected from the group
consisting of a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a scFv, a Fv, a rlgG,
and a diabody.
6. An antibody or antigen binding fragment thereof according to claim 5 wherein
said antigen binding fragment is a scFv and wherein said scFv comprises the amino
acid sequence of SEQ ID NO:ii or SEQ ID N0:i2 or SEQ ID NO:i3.
7. A nucleic acid comprising a nucleotide sequence encoding the variable heavy
chain domain and/ or the variable light chain domain of the antibody or antigen binding
fragment according to any preceding claim.
8. The nucleic acid of claim 7, wherein the nucleic acid comprises one or more
nucleotide sequences selected from the group consisting of SEQ ID NO 19 and SEQ ID
N0:2i.
9. A nucleic acid comprising a nucleotide sequence complementary to the
nucleotide sequence of claim 7 or claim 8.
10. Avector comprising the nucleic acid of claim 7 or claim 8.
11. The vector of claim 10, wherein the vector further comprises an expression
control sequence operatively linked to the nucleic acid encoding the variable heavy
chain domain and/or the variable light chain domain.
12. Ahost cell containing the vector of claim 10 or claim 11.
13. The host cell of claim 12, wherein the cell is a eukaryotic cell.
14. The host cell of claim 13, wherein the eukaryotic cell is a Chinese Hamster
Ovary (CHO) cell or a human embryonic kidney (HEK) cell.
15. A method of producing an antibody or antigen binding fragment thereof,
comprising incubating a host cell according to any of claims 12 to 14 such that the
encoded variable heavy chain domain and/or variable light chain domain is expressed
by the cell; and recovering the expressed the antibody or antigen binding fragment
thereof.
16. The method of claim 15, which further comprises isolating and/ or purifying the
recovered antibody or antigen binding fragment thereof.
17. Acomposition comprising the antibody or antigen binding fragment thereof
according to any of claims 1to 6 and a pharmaceutically acceptable carrier or excipient.
18. Acomposition according to claim 17 further comprising a carrier protein, the
carrier protein preferably selected from the group consisting of tetanus toxoid and
CRM 197 mutant diphtheria toxin.
A composition according to claim 17 or claim 18 further comprising an adjuvant.
20. A composition according to any of claims 17 to 19 formulated for use in humans.
21. An antibody or antigen binding fragment thereof capable of inducing in a
mammal an immune response against the hepatitis Cvirus E2 protein, wherein said
antibody or antigen binding fragment thereof is capable of binding to the antigen
binding pocket of the monoclonal AP33 antibody.
22. An antibody or antigen binding fragment thereof capable of inducing in a
mammal an immune response against the hepatitis Cvirus E2 protein, wherein said
antibody or antigen binding fragment thereof comprises VL CDRi (Li), VL CDR2 (L2),
and VL CDR3 (L3) consisting of the amino acid sequences of SEQ ID NO:i, SEQ ID
N0:2 and SEQ ID NO:23 respectively, and comprises VH CDRi (Hi), VH CDR2 (H2),
and VH CDR3 (H3) consisting of the amino acid sequences of SEQ ID N0:24, SEQ ID
NO:25, and SEQ ID NO:26 respectively.
23. An antibody or antigen binding fragment thereof capable of binding to the AP33
antibody wherein said antibody or antigen binding fragment thereof exhibits binding to
AP33 antibody mutants FL32A, NL91A, WL96A, YH33A, YH50A, YH58A, IH95A and
YH100A of less than 50% of its binding to the AP33 antibody.
24. An antibody that binds to an antibody or antigen binding fragment thereof
according to any of claims 1to 6, which is not AP33 antibody or a fragment thereof.
25. An antibody according to claim 24 which is obtained by immunisation of a
mammal with an antibody or antigen binding fragment thereof according to any of
claims 1to 6.
26. A method of inducing in a mammal an immune response against the hepatitis C
virus E2 protein, the method comprising administering to said mammal an antibody
according to any of claims 1to 6 or 21to 25, a nucleic acid according to any of claims 7
to 9, a vector according to claim 10 or claim 11, or a composition according to any of
claims 17 to 20.
27. An antibody according to any of claims 1to 6 or 21 to 25, a nucleic acid
according to any of claims 7 to 9, a vector according to claim 10 or claim 11, or a
composition according to any of claims 17 to 20 for inducing in a mammal an immune
response against the hepatitis Cvirus E2 protein.