Sign In to Follow Application
View All Documents & Correspondence

D Psicose 3 Epimerase Mutant And Uses Thereof

Abstract: The present invention provides a D-psicose-3-epimerase mutant for efficient and effective production of D-allulose (also known as D-psicose) from D- fructose. The invention represents an advancement in the field of enzyme engineering. The mutant enzyme has increased thermo-stability, operational stability and is functional at wide range of pH as compared to enzymes existing in the prior art and can be used for obtaining high yield of D-allulose with minimum downstream processing cost. Further, the invention relates to nucleic acid encoding the said protein, expression cassettes, vectors, recombinant host cells for preparing the mutant enzyme and processes for preparing the mutant enzyme and processes for production of D-allulose from D-fructose using the mutant enzyme.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
23 December 2016
Publication Number
31/2020
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
hyderabad@knspartners.com
Parent Application
Patent Number
Legal Status
Grant Date
2024-05-16
Renewal Date

Applicants

PETIVA PRIVATE LIMITED
8-2-248, Lakshmi Tower, Nagarjuna Hills, Punjagutta, Hyderabad-500082, Telangana, India

Inventors

1. Banibrata Pandey
PETIVA PRIVATE LIMITED of 8-2-248, Lakshmi Tower, Nagarjuna Hills, Punjagutta, Hyderabad-500082, Telangana, India

Claims

1. A D-psicose-3-epimerase mutant comprising the amino acid sequence of SEQ ID NO:5.

2. A modified nucleic acid encoding the D-psicose 3-epimerase mutant as claimed in claim 1.

3. The modified nucleic acid as claimed in claim 2, wherein the modified nucleic acid comprises the nucleotide sequence of SEQ ID NO: 3.

4. A modified nucleic acid comprising the nucleotide sequence of SEQ ID NO:2, wherein the nucleic acid encodes D-psicose-3-epimerase.

5. An expression cassette comprising the modified nucleic acid as claimed in claim 2, wherein the nucleic acid is operably linked to a constitutive or an inducible promoter.

6. The expression cassette as claimed in claim 5, wherein the constitutive promoter is GroE promoter and the inducible promoter is chosen from a group comprising T7 promoter and arabinose inducible promoter.

7. A vector comprising the expression cassette as claimed in claim 5.

8. The vector as claimed in claim 7, wherein the vector is selected from a group comprising pETll, pET23, pBE-S, pBAD, pK18mobSacB and pHT43.

9. A recombinant host cell comprising the vector as claimed in claim 7.

10. The recombinant host cell as claimed in claim 9, wherein the recombinant host cell is a prokaryotic or eukaryotic host cell.

11. The recombinant host cell as claimed in claim 10, wherein the prokaryotic host cell is selected from a group comprising Escherichia coli, Bacillus subtilis, Pseudomonasputida and Corynebacterium glutamicum, and the eukaryotic host cell is chosen from a group comprising Saccharomyces cerevisiae, Pichiapastoris and Hansenulapolymorpha.

12. The recombinant host cell as claimed in claim 11, wherein the host cell is selected from a group comprising MTCC 25108, MTCC 25063, MTCC 25064 and MTCC 25065.

13. A process for preparation of mutant D-psicose-3-epimerase, said process comprising the steps of: a. culturing recombinant host cells as claimed in claim 9 in a suitable culture medium; b. harvesting the recombinant host cells by centrifugation and tangential flow filtration; c. subjecting the recombinant host cells to mechanical or chemical lysis; and d. purifying mutant D-psicose-3-epimerase expressed from the host cells, wherein the D-psicose-3-epimerase is subjected to full purification or partial purification.

14. The process as claimed in claim 13, wherein the process for partial purification comprises the steps of: a. adding MnCb to the cell lysate; b. subjecting the cell lysate to heat treatment at a temperature in the range of 60°C- 65°C for a period of 10-20 minutes; and c. subjecting the cell lysate to centrifugation to recover D-psicose-3-epimerase.

15. A process for production of D-allulose from D-fructose, the said process comprising the steps of: a. preparing a reaction mixture comprising 10% to 90% (w/v) D-fructose solution; b. contacting the D-psicose-3-epimerase mutant as claimed in claim 1 with the reaction mixture in a bioreactor; and c. harvesting D-allulose from the solution.

16. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the bioreactor is chosen from a group comprising packed bed reactor, stirred tank reactor and enzyme membrane reactor.

17. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the temperature of the reaction mixture is in the range of 40°C-80°C.

18. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the pH of the reaction mixture is in the range of 4.0-9.5.

19. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the D-psicose-3-epimerase mutant is immobilized on an immobilization matrix.

Specification

FIELD OF INVENTION
The present invention pertains to the field of enzyme engineering. More particularly, the invention relates to a D-psicose 3-epimerase mutant and uses thereof. BACKGROUND OF THE INVENTION
D-Allulose (known as D-Psicose) is a rare sugar and C-3 epimer of fructose. It is an ideal sugar substitute and has sweetness similar to dextrose and sucrose. Allulose is considered to be a potential reduced energy sugar because it suppresses hepatic lipogenic enzyme activity and does not contribute to calorie production. Allulose provides bulking, browning, smooth texture, favorable mouthfeel, long-time storage stability in addition to sweetness in food products and has the potential be used by food and beverage manufacturers who are looking to significantly reduce calories. Further, Allulose has been found to exhibit high antioxidant activity and is Generally Recognized as Safe (GRAS) by the U.S. Food and Drug Administration (FDA) for use as a food ingredient and in conjunction with other sweeteners.
Various enzymatic and chemical synthesis approaches have been used for production of D-allulose. Amongst enzymatic methods, D-allulose has been produced by using native as well as genetically modified enzymes encoding for epimerases having ability to convert ketose sugars to their corresponding epimeric form. However, the approaches which have been used till date suffers from some limitations and drawbacks such as:
• low expression level of epimerase
• additional cost in isolating the enzyme produced
• difficulties in identifying appropriate immobilization method for retaining the activity of the enzyme
• instability of the enzyme
• bioconversion activity being restricted to a narrow range of pH and temperature.
For the first time, the inventors have identified the above issues and addressed the same by employing a unique enzyme engineering approach wherein a D-psicose 3-epimerase mutant has been invented. Apart from other advantages, the mutant enzyme has increased thermo-stability and operational stability as compared to enzymes existing in the prior art. Further, the inventors have disclosed a method for continuously producing D-allulose using such the mutant at higher temperature. Consequently, the invention provides for high yield of Allulose with minimum downstream processing cost.

The present invention thus overcomes the problems of the prior art to solve a long-standing problem of providing enzymes for efficient and cheap production of D-allulose. As overconsumption of sugar is potentially linked to many diseases, the invention would help in the prophylaxis of a large number of diseases by providing an extremely suitable sugar substitute. SUMMARY OF THE INVENTION
In one aspect, the invention provides for a D-psicose-3-epimerase mutant comprising the amino acid sequence of SEQ ID NO: 5.
In another aspect, the invention provides for a modified nucleic acid encoding the D-psicose 3-epimerase mutant.
In one embodiment, the modified nucleic acid comprises the nucleotide sequence of SEQ ID NO: 3.
In another aspect, the invention provides for a modified nucleic acid comprising the nucleotide sequence of SEQ ID NO:2, wherein the nucleic acid encodes D-psicose-3-epimerase.
In yet another aspect, the invention provides for an expression cassette comprising the modified nucleic acid operably linked to a constitutive or an inducible promoter.
In one embodiment, the constitutive promoter is GroE promoter and the inducible promoter is chosen from a group comprising T7 promoter and arabinose inducible promoter.
In yet another aspect, the invention provides for a vector comprising the expression cassette.
In one embodiment the vector is selected from a group comprising pETl 1, pET23, pBE-S, pBAD, pK18mobSacB and pHT43.
In yet another embodiment, the invention provides for a recombinant host cell comprising the vector.
In one embodiment, the recombinant host cell is a prokaryotic or eukaryotic host cell.
In yet another embodiment, the prokaryotic host cell is selected from a group comprising Escherichia coli, Bacillus subtilis, Pseudomonas putida and Corynebacterium glutamicum, and the eukaryotic host cell is chosen from a group comprising Saccharomyces cerevisiae, Pichia pastor is and Hansenula polymorpha.
In a further embodiment, the recombinant host cell is selected from a group comprising MTCC 25108, MTCC 25063, MTCC 25064 and MTCC 25065.

In another aspect, the invention provides a process for preparation of mutant D-psicose-3-epimerase, said process comprising the steps of culturing recombinant host cells in a suitable culture medium, harvesting the recombinant host cells by centrifugation and tangential flow filtration, subjecting the recombinant host cells to mechanical or chemical lysis, and fully or partially purifying mutant D-psicose-3-epimerase expressed from the host cells.
In one embodiment, the process for partial purification comprises the steps of adding MnCb to the cell lysate, subjecting the cell lysate to heat treatment at a temperature in the range of 60°C-65°C for a period of 10-20 minutes, and subjecting the cell lysate to centrifugation.
In yet another aspect, the invention provides a process for production of D-allulose from D-fructose, the said process comprising the steps of preparing a reaction mixture comprising 10% to 90% (w/v) D-fructose solution, contacting the D-psicose-3-epimerase mutant with the reaction mixture in a bioreactor and harvesting D-allulose from the solution
In one embodiment, the bioreactor is chosen from a group comprising packed bed reactor, stirred tank reactor and enzyme membrane reactor.
In another embodiment, the temperature of the reaction mixture is in the range of 40°C-
80°C.
In another embodiment, the pH of the reaction mixture is in the range of 4.0-9.5.
In yet another embodiment, the D-psicose-3-epimerase mutant is immobilized on an immobilization matrix. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts a pETll recombinant expression vector (pETll-DPE) comprising modified nucleotide sequence encoding for D-psicose 3-epimerase derived from Agrobacterium tumefaciens.
Figure 2 depicts a pET23 recombinant expression vector (pET23-DPE) comprising modified nucleotide sequence encoding for D-psicose 3-epimerase for intracellular expression in Bacillus subtilis or Escherichia coli.
Figure 3 illustrates amino acid sequence alignment analysis of the mutant D-psicose-3-epimerase with the corresponding wildtype sequence.
Figure 4 illustrates nucleotide sequence alignment analysis of the modified nucleic acid encoding D-psicose-3-epimerase with the corresponding wildtype sequence.

Figure 5 illustrates nucleotide sequence alignment analysis of the modified nucleic acid encoding D-psicose-3-epimerase with the nucleic acid encoding mutant D-psicose-3-epimerase.
Figure 6 depicts a pBE-S recombinant expression vector (pBE-C-P3E) comprising a nucleotide sequence encoding for mutant D-psicose 3-epimerase for constitutive intracellular expression in Escherichia coli and Bacillus subitilis.
Figure 7 depicts the extracellular expression pattern of mutant D-psicose 3-epimerase in Bacillus subtilis. Lane 1 to 6 shows cell supernatant of recombinant strain from 3rd hr, 4th hr, 4hr 30 min, 5th hr, 5 hr 30 min, 6th hr respectively, Lane 7 shows control psicose-3-epirmerase, Lane 8 shows protein molecular weight marker, Lane 9 to 13 shows cell supernatant after heat shock at 40°C for 30 min, 1 hr, lhr 30min, 2 hrs, 2hr 30 min respectively, Lane 14 shows cell supernatant of control strain.
Figure 8 depicts a pHT43 recombinant expression vector (pBE-I-P3E) comprising a nucleotide sequence encoding for mutant D-psicose 3-epimerase for inducible extracellular expression in Bacillus subitilis.
Figure 9 depicts a pETll recombinant expression vector (DPE-M_pETlla) comprising nucleotide sequence encoding for mutant D-psicose 3-epimerase for expressing mutant D-psicose 3-epimerase and T7 promoter.
Figure 10 depicts a pBAD recombinant expression vector (pBAD_DPE-M) comprising nucleotide sequence encoding for mutant D-psicose 3-epimerase for expressing mutant D-psicose 3-epimerase and arabinose inducible promoter.
Figure 11 depicts a pK18mobSacB recombinant expression vector (Ara Del-DPE-M_pK18) comprising nucleotide sequence encoding for mutant D-psicose 3-epimerase for stable integration of marker-free epimerase expression cassette in Escherichia coli genome.
Figure 12 depicts a schematic diagram for homologous recombination by double cross over event for stable integration of marker-free epimerase expression cassette in Escherichia coli genome.
Figure 13 depicts the expression pattern of mutant D-psicose 3-epimerase in Escherichia coli. Figure 13A depicts expression using pETll vector (induced by IPTG) and Fig 13B depicts expression using pBAD vector (induced by arabinose). (T: Total amount of lysate; S: Supernatant; P: Pellet)

Figure 14 depicts identity confirmation for mutant D-psicose 3-epimerase. Lane 1 and 2 are uninduced and induced total cell lysate of control strain. Lane 3 and 4 are uninduced and induced total cell lysate of recombinant strain. Lane 5 and 6 are cell supernatant and pellet of recombinant strain after one hrs of induction. Lane 7 and 8 are cell supernatant and pellet of recombinant strain after two hrs of induction. Lane 9 and 10 are cell supernatant and pellet of recombinant strain after four hrs of induction. Lane 11 shows control psicose-3-epirmerase affinity purified from recombinant E. coli (with pET23-DPE). Abbreviations M: protein molecular weight marker.
Figure 15 depicts the intracellular expression pattern of mutant D-psicose 3-epimerase in Escherichia coli. Figure 15A depicts the expression pattern at different temperatures. Figure 15B depicts the expression pattern of DPEase at different time points of growth (1 to 10 hrs). Figure 15C depicts that shock or stress from 40°C to 42°C boosts the intracellular expression. Abbreviations: (C: Crude/Total amount of lysate; S: Supernatant; P: Pellet; HS: Hours)
Figure 16 depicts the expression pattern of purified mutant D-psicose 3-epimerase. Lane 1 shows control DPEase, Lane 2 shows crude lysate, Lane 3 shows flow through, Lane 4 shows wash 1, Lane 5: wash 2, Lane 6: elution fraction and Lane 7: wash 3.
Figure 17 depicts the expression pattern of partially purified mutant D-psicose 3-epimerase. Figure 17 A: Partial purification of DPEase from total cell lysate by temperature treatment. Figure 17 B: Purification of DPEase from partial purified DPEase. Lane 1: load, Lane 2: Flow through, Lane 3: 25mM NaCl wash, Lane 4: 70mM NaCl wash, Lane 5: 120mM NaCl wash, Lane 6: 1M NaCl wash.
Figure 18 is a graph depicting temperature optimum profile of a wild type and mutant D-psicose 3-epimerase.
Figure 19 is a graph depicting thermostability of D-psicose 3-epimerase mutant at different temperature ranges.
Figure 20 depicts the temperature optima of immobilized D-psicose 3-epimerase mutant compared to free enzyme. Figure 20 A depicts the temperature optimum profile of immobilized DPEase. Figure 20 B depicts the temperature optimum profile of free or soluble DPEase.
Figure 21 depicts the pH optimum of mutant D-psicose 3-epimerase. Figure 21A depicts the pH optimum profile of mutant DPEase. Figure 2 IB depicts the pH optimum profile of wild type DPEase.

Figure 22 is a graph depicting operation stability of D-psicose 3-epimerase mutant (A) at a reaction temperature of 55°C of a packed bed reactor compared to wild-type epimerase (B).
Figure 23 depicts the conversion kinetics of mutant D-psicose 3-epimerase present in free and immobilized state.
Figure 24 depicts the conversion rate and percentage of D-allulose production by D-psicose 3-epimerase mutant in a range of contact time.
Figure 25 depicts HPLC analysis substrate to product conversion by D-psicose-3-epimerase. A: Allulose and fructose sample; B: Allulose standard; and C: Fructose standard. BRIEF DESCRIPTION OF SEQUENCE LISTING
SEQ ID NO:l is the nucleotide sequence of wild type D-psicose 3-epimerase derived from Agrobacterium tumefaciens
SEQ ID NO:2 is the modified nucleotide sequence encoding D-psicose 3-epimerase of Agrobacterium tumefaciens
SEQ ID NO:3 is the nucleotide sequence of mutant D-psicose 3-epimerase
SEQ ID NO:4 is the amino acid sequence of wild type D-psicose 3-epimerase
SEQ ID NO: 5 is the amino acid sequence of mutant D-psicose 3-epimerase
SEQ ID NO:6 is the forward primer for amplification of nucleotide sequence coding for Ara A and D of the BAD operon.
SEQ ID NO:7 is the reverse primer for amplification of nucleotide sequence coding for Ara A and D of the BAD operon.
SEQ ID NO:8 is the forward primer for amplification of nucleotide sequence encoding for D-psicose 3-epimerase gene expression cassette including Ara BAD promoter and rrnB terminator.
SEQ ID NO:9 is the Reverse primer for amplification of nucleotide sequence encoding for D-psicose 3-epimerase gene expression cassette including Ara BAD promoter and rrnB terminator. DEFINITIONS
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods belong. Although any methods and compositions similar or equivalent to those described herein can also be used in the practice or testing of the methods and compositions, representative illustrative methods and compositions are now described.

Where a range of values is provided, it is understood that each intervening value between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within by the methods and compositions. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within by the methods and compositions, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the methods and compositions.
It is appreciated that certain features of the methods, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the methods and compositions, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub¬combination. It is noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.
As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other embodiments without departing from the scope or spirit of the present methods. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.
The term "host cell" includes an individual cell or cell culture which can be, or has been, a recipient for the subject of expression constructs. Host cells include progeny of a single host cell. Host cell can be any expression host including prokaryotic cell such as but not limited to Escherichia coli, Bacillus subtilis, Pseudomonas putida, Corynebacterium glutamicum or eukaryotic system, such as, but not limited to Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha.
The term "recombinant strain" refers to a host cell which has been transfected or transformed with the expression constructs or vectors of this invention.

The term "expression cassette" denotes a gene sequence used for cloning in expression vectors or in to integration vectors or integrated in to coding or noncoding regions of chromosome of the host cell in a single or multiple copy numbers, where the expression cassette directs the host cell's machinery to make RNA and protein encoded by the expression cassette.
The term "expression vector" refers to a vector, plasmid or vehicle designed to enable the expression of an inserted nucleic acid sequence following transformation into the host.
The term "promoter" refers a DNA sequences that define where transcription of a gene begins. Promoter sequences are typically located directly upstream or at the 5' end of the transcription initiation site. RNA polymerase and the necessary transcription factors bind to the promoter sequence and initiate transcription.
The term "constitutive promoter" is more commonly defined the promoter which allows continual transcription of its associated genes as their expression is normally not conditioned by environmental and developmental factors. Constitutive promoters are very useful tool in genetic engineering because constitutive promoters drive gene expression under inducer-free conditions and often show better characteristics than commonly used inducible promoters.
The term "inducible promoter" refers the promoters that are induced by the presence or absence of biotic or abiotic and chemical or physical factors. Inducible promoters are a very powerful tool in genetic engineering because the expression of genes operably linked to them can be turned on or off at certain stages of development or growth of an organism or in a particular tissue or cells.
The term "transcription" refers the process of making an RNA copy of a gene sequence. This copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein, which it encodes.
The term "translation" refers the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding amino acid sequence that it encodes. In the cell cytoplasm, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein.
The term "expression" refers to the biological production of a product encoded by a coding sequence. In most cases a DNA sequence, including the coding sequence, is transcribed to form a messenger-RNA (mRNA). The messenger-RNA is then translated to form a polypeptide product

which has a relevant biological activity. Also, the process of expression may involve further processing steps to the RNA product of transcription, such as splicing to remove introns, and/or post-translational processing of a polypeptide product.
The term "modified nucleic acid encoding D-psicose-3-epimerase" is used to refer to a nucleic acid containing encoding D-psicose-3-epimerase of Agrobacterium tumefaciens, wherein the nucleic acid contains the preferred codons for enhanced expression in Escherichia coli.
The term "mutant D-psicose-3-epimerase" or "D-psicose-3-epimerase mutant" or "mutant enzyme" or "modified D-psicose-3-epimerase" is used to refer to a modified D-psicose-3-epimerase Agrobacterium tumefaciens wherein the serine residue at position 8 of the wild type D-psicose-3-epimerase is substituted with an alanine residue, the histidine residue at position 12 of the wild type D-psicose-3-epimerase is substituted with a glutamine residue, the serine residue at position 15 of the wild type D-psicose-3-epimerase is substituted with a glutamic acid residue and the isoleucine residue at position 33 of the wild type D-psicose-3-epimerase is substituted with a leucine residue. The mutant D-psicose-3-epimerase is represented by SEQ ID NO: 5.
The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to two or more amino acid residues joined to each other by peptide bonds or modified peptide bonds. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymer. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. Likewise, "protein" refers to at least two covalently attached amino acids, which includes proteins, polypeptides, oligopeptides and peptides. A protein may be made up of naturally occurring amino acids and peptide bonds, or synthetic peptidomimetic structures. Thus "amino acid", or "peptide residue", as used herein means both naturally occurring and synthetic amino acids. "Amino acid" includes imino acid residues such as proline and hydroxyproline. The side chains may be in either the (R) or the (S) configuration. DETAILED DESCRIPTION OF THE INVENTION
The present invention discloses modified D-psicose-3-epimerase and a mutant D-psicose-3-epimerase for efficient and effective production of D-allulose (also known as D-psicose) from

D- fructose. Further, the invention relates to nucleic acid encoding the said proteins, expression cassettes for constitutive and inducible expression, vectors and recombinant host cells for preparing the mutant enzyme. The invention also provides process for preparing the mutant enzyme and process for production of D-allulose from D-fructose.
The inventors have contemplated a unique approach by substituting certain amino acids of wild-type D-psicose-3-epimerase of Agrobacterium tumefaciens. The mutant epimerase is highly thermostable, has high operation stability, has a high pH optima and activity. Effectiveness of mutant D-psicose-3-epimerase over other epimerases
For the first time, the inventors have been able to generate a D-psicose-3-epimerase which is highly thermostable and effective. A comparative chart exhibiting the enzyme properties and kinetic parameters of the present invention compared with related family enzymes for D-allulose production is provided in Table 1.

Table 1: Comparative chart of D-psicose-3-epimerase related family enzymes
The inventive approach used in the present invention has led to the development of an enzyme having superior properties. Further, the enzyme can facilitate cheap production of D-allulose as the production cost for the enzyme is cheap as partially purified enzyme is equally effective. Moreover, the enzyme has high operation stability and can withstand high temperature which is a pre-requisite for industrial scale production.
Before the mutant D-psicose-3-epimerase, nucleic acid, expression cassettes, vectors, host cells and methods of the present disclosure are described in greater detail, it is to be understood that the invention is not limited to particular embodiments and may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the methods and compositions will be limited only by the appended claims.
In one embodiment, the present invention provides a D-psicose 3-epimerase mutant, wherein the mutant comprises an amino acid sequence in which serine residue at position 8 of the amino acid sequence of a wild type D-psicose 3-epimerase from Agrobacterium tumefaciens is substituted with alanine residue.
In another embodiment, the present invention provides a D-psicose 3-epimerase mutant, wherein the mutant comprises an amino acid sequence in which histidine residue at position 12 of the amino acid sequence of a wild type D-psicose 3-epimerase from Agrobacterium tumefaciens is substituted with glutamine residue.

In another embodiment, the present invention provides a D-psicose 3-epimerase mutant, wherein the mutant comprises an amino acid sequence in which serine residue at position 15 of the amino acid sequence of a wild type D-psicose 3-epimerase from Agrobacterium tumefaciens is substituted with glutamic acid residue.
In another embodiment, the present invention provides a D-psicose 3-epimerase mutant, wherein the mutant comprises an amino acid sequence in which isoleucine residue at position 33 of the amino acid sequence of a wild type D-psicose 3-epimerase from Agrobacterium tumefaciens is substituted with leucine residue.
In yet another embodiment, the present invention provides a D-psicose 3-epimerase mutant, wherein the mutant comprises the substitutions in the following amino acids of a wild type D-psicose 3-epimerase from Agrobacterium tumefaciens:
1. 8th position - The serine residue at position 8 of the wild type D-psicose-3-epimerase is substituted with an alanine residue.
2. 12th position - The histidine residue at position 12 of the wild type D-psicose-3-epimerase is substituted with a glutamine residue.
3. 15th position - The serine residue at position 15 of the wild type D-psicose-3-epimerase is substituted with a glutamic acid residue.
4. 33rd position - The isoleucine residue at position 33 of the wild type D-psicose-3-epimerase is substituted with a leucine residue.
In another embodiment, the D-psicose 3-epimerase mutant is represented by SEQ ID NO: 5.
In one embodiment, the invention provides for a modified nucleic acid encoding D-psicose-3-epimerase of Agrobacterium tumefaciens. The nucleic acid has been artificially synthesized using artificial gene synthesis approach and contains the preferred codons for enhanced expression in Escherichia coli.
In one embodiment, the nucleotide sequence of the nucleic acid is represented as SEQ ID NO: 2.
In another embodiment, the invention provides for a nucleic acid encoding for mutant D-psicose-3-epimerase. The nucleic acid encodes D-psicose 3-epimerase mutant, wherein the serine residue at position 8 of the wild type D-psicose-3-epimerase is substituted with an alanine residue, the histidine residue at position 12 of the wild type D-psicose-3-epimerase is substituted with a

glutamine residue, the serine residue at position 15 of the wild type D-psicose-3-epimerase is substituted with a glutamic acid residue and the isoleucine residue at position 33 of the wild type D-psicose-3-epimerase is substituted with a leucine residue.
In yet another embodiment, the nucleotide sequence of the nucleic acid is represented as SEQIDNO: 3.
In another embodiment, the present invention provides for an expression cassette comprising the nucleic acid encoding for D-psicose-3-epimerase or mutant D-psicose-3-epimerase. The nucleic acid in the expression cassette is operably linked to a constitutive or inducible promoter.
In another embodiment, the constitutive promoter in the expression cassette is GroE promoter.
In yet another embodiment, the inducible promoter in the expression cassette is a T7 based promoter or arabinose inducible promoter.
In another embodiment, the present invention provides for a vector comprising the expression cassette.
In one embodiment, the vector is chosen from a group comprising pETl 1, pET23, pBE-S, pBAD, pK18mobSacB and pHT43.
In another embodiment, the vector is a shuttle vector which can be expressed in both prokaryotic as well as eukaryotic hosts.
In another embodiment, the vector is a pETll expression vector. The modified nucleic acid, as represented by SEQ ID NO:2, is cloned using Ndel and BamHI restriction enzyme sites to generate pETll-DPE. Psicose-3-epimerase (DPE) gene is flanked by Bglll, Xbal and Ndel at 5' end, and BamHI at 3' end. During cloning procedure Nhel site was removed. The vector contains a T7 promoter, a T7 terminator and an ampicillin resistance marker.
In another embodiment, the vector is a pET23 expression vector. The modified nucleic acid, as represented by SEQ ID NO:2, is cloned using BamHI and Hind III restriction enzymes to generate pET23-DPE-HIS construct expressing D-psicose-3-epimerase with C-terminal 6x Histidine tag.
In yet another embodiment, the vector is a pBE-S vector. The vector can be used for constitutive intracellular expression of mutant D-psicose-3-epimerase protein in prokaryotic as well as eukaryotic host cells. The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE),

represented by SEQ ID NO: 3, was cloned into pBE-C vector using Nhel and BamHI sites to generate pBE-C-P3E. D-Psicose-3-epimerase (DPE) gene is flanked by Spel, Aflll, Mlul at 5' end, and EcoRI, Hindlll, Sail at 3' end. During cloning procedure Ndel, Sad, Xhol site was removed. The vector contains a GroE promoter, Ampicillin and Kanamycin resistance marker and 6X HIS tag.
In yet another embodiment, the vector is a pHT43 vector. The vector can be used for inducible extracellular expression of D-psicose-3-epimerase protein in prokaryotic as well as eukaryotic host cells. The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pHT43 vector using BamHI and Xbal sites. The recombinant vector was named pBE-I-P3E. Psicose-3-epimerase (DPE) gene is flanked by BamHI at 5' end and Smal, Xmal at 3' end. The plasmid contains a GroE promoter, Ampicillin and Chloramphenicol resistance marker and AmyQ signal sequence.
In another embodiment, the vector is a pETl 1 vector. The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pETl la using Ndel and BamHI sites. Psicose-3-epimerase (DPE) gene is flanked by Bglll, Xbal and Ndel at 5' end, and BamHI at 3' end. During cloning procedure Nhel site was removed. The vector contains a T7 promoter, T7 terminator and Ampicillin resistance marker.
In yet another embodiment, the vector is a pBAD vector. The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pBAD using Ndel and EcoRI sites. D-Psicose-3-epimerase (DPE) gene is flanked by Ndel at 5' end, and EcoRI, Hindlll, Seal, Pvul, PstI and Bgll at 3' end. The vector contains an arabinose inducible promoter, ara terminator and ampicillin resistance marker.
In another embodiment, the vector is a pK18mobSacB vector. The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pK18mobSacB vector. The vector can be used for homologous recombination of BAD promoter and AraA*-D genes by double cross over event to integrate the epimerase expressing gene expression cassette under control of arabinose promoter while inactivating the gene responsible for arabinose metabolism. The vector can be used for development of a marker-free recombinant host cell in which the expression cassette expressing the mutant D-psicose-3-epimerase is integrated into the host genome.

In one embodiment, the recombinant host cell comprises the vector encoding modified or mutant D-psicose-3-epimerase. Any suitable recombinant host cell can be used for the process.
In another embodiment, the recombinant host cell is a prokaryotic host. The prokaryotic host cell can be chosen from a group comprising Escherichia coli, Bacillus subtilis, Pseudomonas putida and Corynebacterium glutamicum.
In another embodiment, the recombinant host cell is an eukaryotic host. The eukaryotic host cell can be chosen from a group comprising Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha.
The Escherichia coli K12 strain (procured from Promega Corporation), has been used to develop MTCC 25063 recombinant host cell containing modified nucleic for expression of wild type D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 13th August, 2015.
The Escherichia coli K12 strain (procured from Promega Corporation), has been used to develop MTCC 25108 recombinant host cell for IPTG-induced expression of mutant D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 13th November, 2016.
The Escherichia coli K12 strain (procured from Promega Corporation), has been used to develop MTCC 25064 recombinant host cell for constitutive expression of mutant D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 13th August, 2015.
The Bacillus subtilis RTK1285 (procured from Takara Bio), has been used to develop MTCC 25065 recombinant host cell for constitutive expression of mutant D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 13th August, 2015.
In another embodiment, invention provides a process for preparation of mutant D-psicose-3-epimerase. The process comprises the steps of culturing recombinant host cells in a suitable culture medium, harvesting recombinant host cells, subjecting the host cells to lysis and purifying mutant enzyme.
In one embodiment, the recombinant host cells are cultured in modified terrific broth. The modified terrific broth contains soy peptone, yeast extract, H2PO4, KHPO4, MgS04 and glycerol.

In another embodiment, terrific broth (TB) is used for production of D-psicose-3-epimerse. The components of the terrific broth are tryptone and/or peptone, yeast extract, H2PO4, KHPO4, MgS04 and glycerol.
In yet another embodiment, defined media is used for the production of D-psicose-3-epimerse. The components of the defined media are diammonium hydrogen phosphate, potassium dihydrogen phosphate, citric acid, metal ions, trace elements and EDTA. Glucose was used as carbon source and liquor ammonia was used as an alkali and nitrogen source.
Additionally, nutrients, carbon sources, essential metals, minerals, buffering agents, selection agents such as antibiotics, gelling agents and other suitable components known in the art which are required for efficient production can be used for recombinant expression of the mutant enzyme.
In one embodiment, the recombinant host cells are harvested by centrifugation and tangential flow filtration.
In yet another embodiment, the harvested cells are subjected to cell lysis by mechanical or chemical methods known in the art.
In one embodiment, the cell lysate is passed through high pressure homogenizer for disruption and cell lysis.
In yet another embodiment, the purification is done chromatographic techniques known in the art. The chromatographic techniques used gives a high purity of enzymes as recommended by the industrial standards and norms.
In one embodiment, purification is done using an anion exchange chromatographic resin, specifically Q-Sepharose. The purified mutant enzyme obtained has a very high degree of purity and can be used for sensitive assays.
In yet another embodiment, the purification is partially done by subjecting the cell lysate to heat treatment. Partially purified mutant enzyme has a high significance as the process for obtaining the same is cheap and hence an economic advantage is obtained. Further, the mutant enzyme is highly thermostable and can withstand heat treatment without any sort of denaturation.
In one embodiment, the heat treatment is given for 10-20 minutes at 60°C-65°C. The heat treatment precipitates most of the proteins of the host cell and leaves largely D-psicose-3-epimerase mutant in the solution.

The partially purified proteins can be used as free enzymes or can be immobilized on solid matrices for effective and efficient conversion of D-fructose to D-allulose.
The mutant D-psicose-3-epimerase enzyme obtained is highly thermostable and has high temperature optima which is an extremely useful for industrial scale production of D-Allulose. It is seen that the wild-type D-psicose-3-epimerase has temperature optima at 55°C while the mutant D-psicose-3-epimerase has temperature optima at around 66°C.
Further, it is observed that the mutant enzyme is able retain more than 80% of its activity for more than 384 hours, while the wild type enzyme was able to retain only 20% of its activity after 24 hours.
Further, immobilization imparts higher temperature optima to the enzyme and the immobilized enzyme has temperature optima at 74°C.
Further, the mutant enzyme has pH optima in the range of 7.5-9.5 and can show a high level of activity in the range of pH 4.0-9.5.
Additionally, it was found that the mutant enzyme has a high operation stability and was able to retain more than 60% of its activity even after 50 days of operation at 55°C in a packed bed reactor. On the contrary, wild type enzyme was not able to retain even 25% of its activity even after 15 days of operation in a packed bed reactor at similar conditions.
In yet another embodiment, the invention provides a process for production of D-allulose from D-fructose, the said process comprising the steps of preparing a reaction mixture comprising 10%) to 90%) (w/v) D-fructose solution, contacting the D-psicose-3-epimerase mutant with the reaction mixture in a bioreactor and harvesting D-allulose from the solution
In one embodiment, the bioreactor is chosen from a group comprising packed bed reactor, stirred tank reactor and enzyme membrane reactor.
In another embodiment, the temperature of the reaction mixture is in the range of 40°C-80°C.
In another embodiment, the pH of the reaction mixture is in the range of 4.0-9.5.
In yet another embodiment, the D-psicose-3-epimerase mutant is immobilized on an immobilization matrix.
In yet another embodiment of the invention, the enzyme activity of the mutant D-psicose-3-epimerase enzyme is in ranges of 120 to 140 IU/mg. EXAMPLES

The following examples particularly describe the manner in which the invention is to be performed. But the embodiments disclosed herein do not limit the scope of the invention in any manner. Example 1: Recombinant expression and analysis of D-psicose 3-epimerase
Gene encoding D-psicose 3-epimerase enzyme was modified for enhanced expression in Escherichia coli. The gene has been artificially synthesized using artificial gene synthesis approach known in the prior art. The modified gene sequence contains the preferred codons for enhanced expression in Escherichia coli and is represented as SEQ ID NO: 2. The nucleotide sequence of the native gene is represented by SEQ ID NO:l. The native gene is D-psicose 3-epimerase encoding gene of Agrobacterium tumefaciens.
The polynucleotide sequence represented in SEQ ID NO: 2 was cloned into pUC57 using EcoRV restriction enzyme site to generate pUC57-DPE. The cloned gene sequence was confirmed by restriction digestion and sequencing analysis.
The modified nucleic acid, as represented by SEQ ID NO:2, encoding for D-psicose-3-epimerase was PCR amplified using gene specific primers, and sub cloned into pETl la using Ndel and BamHI restriction enzyme sites to generate pETl 1-DPE. Psicose-3-epimerase (DPE) gene is flanked by Bglll, Xbal and Ndel at 5' end, and BamHI at 3' end. During cloning procedure Nhel site was removed. The properties of the plasmid are: T7 promoter, T7 terminator and Ampicillin resistance marker. The vector map of the recombinant plasmid is represented in Figure 1.
Subsequently, the D-psicose-3-epimerase coding region was PCR amplified without stop codon using gene specific primers and sub cloned into Escherichia coli expression vector pET23a using BamHI and Hind III restriction enzymes to generate pET23-DPE-HIS construct expressing D-psicose-3-epimerase with C-terminal 6x Histidine tag. The vector map of the recombinant pET23a plasmid encoding D-psicose-3-epimerase with 6X Histidine tag is represented in Figure 2.
The recombinant plasmids carrying D-psicose-3-epimerase encoding gene (pETl 1-DPE and pET23-DPE) was confirmed by restriction digestion analysis and followed by DNA sequencing.
The pET23-DPE vector was cloned into Escherichia coli K12 strain (procured from Promega Corporation) and has been used to develop MTCC 25063 recombinant host cell containing modified nucleic for expression of wild type D-psicose-3-epimerase. The strain was

deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 1st January, 2017.
D-psicose-3-epimerase was expressed by recombinant expression. Subsequently, the structure of the protein was analyzed by using a general-purpose protein structure analysis program, PyMol. A combination of mutants developed by random mutagenesis were studied. Subsequently, specific sites were selected for substitution of amino acids responsible for improved thermo-tolerance and operational stability of enzyme without affecting the epimerase activity. Example 2: Development of mutant D-psicose 3-epimerase
After structural analysis of the wild-type D-psicose-3-epimerase enzyme, the following residues were replaced for developing the mutants:
1. 8th position - The serine residue at position 8 of the wild type D-psicose-3-epimerase is substituted with an alanine residue.
2. 12th position - The histidine residue at position 12 of the wild type D-psicose-3-epimerase is substituted with a glutamine residue.
3. 15th position - The serine residue at position 15 of the wild type D-psicose-3-epimerase is substituted with a glutamic acid residue.
4. 33rd position - The isoleucine residue at position 33 of the wild type D-psicose-3-epimerase is substituted with a leucine residue.
The substituted amino acid residues as compared to the native residues are depicted in Figure 3.
The specific amino acids were replaced by site directed mutagenesis approach and the mutations were confirmed by sequencing. In order to confirm the expression and activity of the D-psicose 3-epimerase variant, the modified gene sequence was cloned into an expression vector, which was then transformed into Escherichia coli K12 strain by the method known in art (heat shock method or electroporation method).
Transformed strains carrying the expression constructs for D-psicose 3-epimerase variants were grown in LB or TB medium containing 75 ug/ml of Ampicillin for 6-8 hrs at 37°C. A portion of cultures were transferred to a medium containing 75 ug/ml of Ampicillin and 0.1 mM of IPTG (Isopropyl-P-thiogalactopyranoside), and incubated for 6 hrs at 25 to 37°C.
After 6 hours of induction the culture solution was heat treated at 60°C for 5 to 10 min and 2 to 3% of D-fructose solution was added to the final concentration, followed by addition of 0.5

mM manganese, thereby the causing the reaction at 60°C for 30 minutes. The amount of D-psicose formed is measured by HPLC analysis using zorbax carbohydrate column. As the result of measurement, it was confirmed that the D-psicose-3-epimease mutant of the present invention exhibited high thermotolerance upto the reaction temperature of 66°C. Example 3: Sequence Alignment Studies
The nucleic acid sequences as well as the amino acid sequences were subjected to sequence alignment studies using a multiple sequence alignment tool, ClustalW2. The nucleotides of the modified gene sequences were marked as (.) and homology shared to native sequence was marked as (*).
Figure 3 illustrates amino acid sequence alignment analysis of the mutant D-psicose-3-epimerase with the corresponding wildtype sequence.
Figure 4 illustrates nucleotide sequence alignment analysis of the modified D-psicose-3-epimerase with the corresponding wildtype sequence.
Figure 5 illustrates nucleotide sequence alignment analysis of the modified D-psicose-3-epimerase with the mutant D-psicose-3-epimerase. Example 4: Constitutive expression of D-psicose-3-epimerase in Bacillus subtilis
The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pBE-S vector using Nhel and BamHI sites to generate pBE-C-P3E. D-Psicose-3-epimerase (DPE) gene is flanked by Spel, Aflll, Mlul at 5' end, and EcoRI, Hindlll, Sail at 3' end. During cloning procedure Ndel, Sad, Xhol site was removed. The properties of the plasmid are: GroE promoter, Ampicillin and Kanamycin resistance marker and 6X HIS tag. The vector map of pBS-C-P3E is represented by Figure 6. This vector can be used for constitutive intracellular expression of mutant D-psicose-3-epimerase protein in prokaryotic as well as eukaryotic host cells.
The pBE-C-P3E expression construct was transformed into Bacillus subtilis expression host for production of D-pisocse 3-epimerase. The vector was cloned into Bacillus subtilis strain (procured from Takara Bio) and has been used to develop MTCC 25065 recombinant host cell for constitutive expression of mutant D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 1st January, 2017.
The constitutive production of mutant D-psicose-3-epimerase by recombinant Bacillus subtilis (MTCC 25065) was performed. Transformed clones (carrying [pBE-C-P3E]) were grown

on Luria-Bertani or defined media containing kanamycin (50 ug/ml) for overnight at 37°C. Overnight culture was re-inoculated into 0.1 OD600 in LB (Kan+) media and grown up to 0.8-1 OD600 and the cells were subjected to heat shock at 40°C for 2 hrs and brought back to 37°C for 12 to 16 hrs for production of epimerase constitutively. The expression pattern after constitutive expression of D-psicose-3-epimerase is depicted in Figure 7. Example 5: Inducible expression of D—psicose-3-epimerase in Bacillus subtilis by IPTG
The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pHT43 vector using BamHI and Xbal sites. The recombinant vector was named pBE-I-P3E. Psicose-3-epimerase (DPE) gene is flanked by BamHI at 5' end and Smal, Xmal at 3' end. The properties of the plasmid are: Pgrac promoter, Ampicillin and Chloramphenicol resistance marker and AmyQ signal sequence. The vector map of pBE-I-P3E is represented by Figure 8. This vector can be used for inducible extracellular expression of D-psicose-3-epimerase protein in prokaryotic as well as eukaryotic host cells.
The production of mutant D-psicose-3-epimerase was recombinant Bacillus subtilis is induced by addition of IPTG during fermentation process.
For inducible production, the pBE-I-P3E expression construct was transformed into B. subtilis expression host for production of D-pisocse 3-epimerase. Transformed clones (carrying [pBE-C-P3E]) were picked and grown on Luria-Bertani or defined media containing Chloramphenicol (20 ug/ml) for overnight at 37°C. Overnight culture was re-inoculated into 0.1 OD600 in LB or defined media with chloramphenicol and grown up to 0.8 - 1 OD600 and cells were induced by addition of 0.5 mM IPTG and incubated at 37°C for production of epimerase. Example 6: Development of recombinant Escherichia coli strain for expression of D-psicose-3-epimerase
The nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pETl la using Ndel and BamHI sites. Psicose-3-epimerase (DPE) gene is flanked by Bglll, Xbal and Ndel at 5' end, and BamHI at 3' end. During cloning procedure Nhel site was removed. The properties of the plasmid are: T7 promoter, T7 terminator and Ampicillin resistance marker. The vector map is represented by Figure 9.
After amplification, the nucleic acid encoding for mutant D-psicose-3-epimerase (DPE), represented by SEQ ID NO: 3, was cloned into pBAD using Ndel and EcoRI sites. D-Psicose-3-epimerase (DPE) gene is flanked by Ndel at 5' end, and EcoRI, Hindlll, Seal, Pvul, PstI and Bgll

at 3' end. The properties of the plasmid are: Arabinose inducible promoter, ara terminator and Ampicillin resistance marker. The vector map of the recombinant plasmid is represented in Figure 10.
The nucleotide sequence coding for Ara A and D of the BAD operon was amplified using the primers EcAraAFp (GCCCGGGAGATCTATGACGATTTTTGATAATTATG) represented by SEQ ID NO: 6 and EcAraDR (GCGGAATTCTTACTGCCCGTAATATGCCT) represented by SEQ ID NO:7, from Escherichia coli with amplicon size of 2.483Kb. Subsequently, it is digested with BamHI and EcoRI to yield 1.153kb size fragment and cloned at BamHI and EcoRI sites of pK18mobSacB plasmid (obtained from ATCC) to get the intermediate integration plasmid pK18-araD.
The D-psicose 3-epimerase gene expression cassette from pBAD-DPE-M including Ara
BAD promoter and rrnB terminator was amplified using primers BADpro-Nhel-fw
(CCGGGCTAGCGAAGAAACCAATTGTCCATATTGCATC) represented by SEQ ID NO: 8
and rrnBterm-Sall-rev (CCGGGTCGACAGAGTTTGTAGAAACGCAAAAAGGCC)
represented by SEQ ID NO: 9 with amplicon size of 1.65kb. Subsequently, it was digested and cloned at Nhel and Sail sites upstream of partial A*-D sequence in pK18 vector to yield the final plasmid pK18_araDel-DPE-M. The vector map of the recombinant plasmid pK18_araDel-DPE-M is represented in Figure 11.
Plasmid pK18_araDel-DPE-M was transformed into Escherichia coli JM109 (DE3) cells by Electroporation. Selection was done on the basis of Kanamycin auxotrophy. Finally, the homologous recombination at BAD promoter and AraA*-D genes by double cross over event was done to integrate the epimerase expressing gene expression cassette under control of arabinose promoter while inactivating the gene responsible for arabinose metabolism. The mechanism of double cross over to integrate the epimerase expressing gene is illustrated in Figure 12. Example 7: Expression of D-psicose-3-epimerase in Escherichia coli induced by IPTG
The DPE-M-pETlla expression construct was transformed into Escherichia coli expression host for production of mutant D-pisocse 3-epimerase. The vector was cloned into Escherichia coli K12 strain (procured from Promega Corporation) and has been used to develop MTCC 25108 recombinant host cell for IPTG-induced expression of mutant D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 13th November, 2016.

The production of mutant D-psicose-3-epimerase in recombinant Escherichia coli (MTCC 25108) is induced by addition of IPTG during fermentation process.
Conditions for optimum fermentation of recombinant Escherichia coli JM109 [pETll-DPE] and production of D-psicose-3-epimerase were tested using different media components at shake flask level.
Modified terrific broth (TB) was used for production of psicose-3-epimerse in fermenters. The components of the terrific broth are soy peptone, yeast extract, H2PO4, KHPO4, MgS04 and glycerol.
Alternatively, terrific broth (TB) or defined media (DM) is also used for production of psicose-3-epimerse in fermenters. The components of the terrific broth are tryptone, yeast extract, H2PO4, KHPO4, MgSC-4 and glycerol.
The components of the defined medium were diammonium hydrogen phosphate, potassium dihydrogen phosphate, citric acid, metal ions, trace elements and EDTA. Glucose was used as carbon source and liquor ammonia was used as an alkali and nitrogen source. Ampicillin or kanamycin was used as antibiotic in inoculum development and during fermentation process. The fermenter was maintained at 37°C with an agitation rate of 250 -700 rpm, aeration rate of 0.6 - 2.4 scfm, pressure of 5 psi and the dissolved oxygen was maintained at >40%.
The cell culture was induced when the OD600 reaches 40 by addition of 0.1 - 0.5 mM IPTG and incubated at 25°C for 12-16 hrs for the production of soluble epimerase enzyme.
The expression pattern is depicted in Figure 13 A. Example 8: Expression of D-psicose-3-epimerase in Escherichia coli induced by arabinose
The production of mutant D-psicose-3-epimerase in recombinant Escherichia coli is induced by addition of arabinose during fermentation process.
For optimum fermentation of recombinant E. coli JM109 [pBAD-DPE] and production of mutant D-psicose-3-epimerase were tested using different media components at shake flask level.
Modified terrific broth (TB) was used for production of psicose-3-epimerse in fermenters. The components of the terrific broth are soy peptone, yeast extract, H2PO4, KFIPO4, MgS04 and glycerol.
Alternatively, terrific broth (TB) or defined media (DM) is also used for production of psicose-3-epimerse in fermenters. The components of the terrific broth are tryptone, yeast extract, H2PO4, KHPO4, MgS04 and glycerol.

Ampicillin or kanamycin was used as antibiotic in inoculum development and during fermentation process. The fermenter was maintained at 37°C with an agitation rate of 250 -700 rpm, aeration rate of 0.6 - 2.4 scfm, pressure of 5 psi and the dissolved oxygen was maintained at >40%. The cells were induced when the OD600 reaches 40 by addition of 0.1 - 0.5 arabinose and incubated at 25°C for 12-16 hrs for the production of soluble epimerase enzyme.
The expression pattern is depicted in Figure 13B. Example 9: Constitutive expression of D-psicose-3-epimerase in Escherichia coli
The pBE-C-P3E expression construct was transformed into Escherichia coli expression host for production of mutant D-pisocse 3-epimerase. The vector was cloned into Escherichia coli K12 strain (procured from Promega Corporation) and has been used to develop MTCC 25064 recombinant host cell for constitutive expression of mutant D-psicose-3-epimerase. The strain was deposited at The Microbial Type Culture Collection and Gene Bank, Chandigarh, India on 13th August, 2015.
Production of D-psicose-3-epimerase in Escherichia coli constitutively was performed by simple heat treatment without any addition of inducer during fermentation process. In this example the pBS-C-P3E expression construct was transformed into E. coli expression host JM109 (DE3) for production of D-pisocse 3-epimerase. Transformed clones (JM109 [pBE-C-DPE]) were picked and grown on Luria-Bertani media or terrific broth containing Ampicillin (100 ug/ml) for overnight at 37°C. Overnight culture was re-inoculated into 0.1 OD600 in LB Amp+ media and grown up to 0.6 - 1 OD600 and the cells were subjected to heat shock at 40°C for 2 hrs and brought back to 37°C for 12-18 hrs for production of epimerase.
The expression pattern of mutant D-psicose-3-epimerase was analyzed under different conditions.
Figure 14 depicts identity confirmation for mutant D-psicose 3-epimerase.
Figure 15A depicts the intracellular expression pattern in Escherichia coli at different temperatures.
Figure 15B depicts the expression pattern with different amounts of eluents.
Figure 15C depicts that shock or stress from 40°C to 42°C boosts the intracellular expression. Example 10: Preparation of D-psicose-3-epimerase

The mutant D-psicose-3-epimerase was harvested after fermentation by centrifugation and tangential flow filtration (TFF). The cells harvested were resuspended in lysis buffer and subj ected to cell lysis or disruption by passing the cells twice through a high-pressure homogenizer at 18-20 KPsi. The cells can be lysed by any other mechanical or chemical lysis methods known in the art. The cell lysate was clarified by centrifugation at 20000xg for 45 min at 4°C. Supernatant of the cell lysate containing the psicose-3-epimerase were further purified or partially purified and used for immobilization for continuous bioconversion of fructose into allulose. Example 11: Purification of psicose-3-epimerase
The clarified cell lysate was captured onto an anion exchange chromatographic resin, specifically Q-Sepharose. The column packed with resin is pre-equilibrated with 50 mM Tris-HCl buffer at pH 8.0 with a linear flow rate of 30 crn/h which corresponds to 10 ml/min.
The unbound proteins were washed until A280 nm reached zero. The target protein was eluted with 120 mM NaCl step gradient. The activity of DPEase clarified lysate of all eluted fraction was checked and analysed by HPLC. The purity and protein degradation were analysed by SDS-PAGE and Western blot using anti protein antibody.
The active fractions were pooled, and membrane filtered through 0.22 um cut off diafiltration device. The buffer was exchanged against 50 mM Tris-HCl buffer at pH 8.0 and concentrated the protein to 10 mg ml"1 by TFF system using 10 kDa membrane cassettes.
Alternatively, borate buffer, specifically tetra-borate buffer can be used instead of Tris-HCl buffer.
The purified D-psicose-3-epimerase enzymes were subjected to gel electrophoresis and visualized after western blot. The expression pattern is depicted in Figure 16. Example 12: Partial Purification of psicose-3-epimerase
The clarified cell lysate containing modified epimerase variants were subjected to heat treatment between 60°C to 65°C for 10-20 min. The heat treatment precipitates most of the Escherichia coli proteins and leaves mutant D-psicose-3-epimerase variants in the solution, which is having temperature optimum of 65°C and has free enzyme thermostability for more than a day at its optimum temperature.
Addition of MnCb prior to heat treatment has positive effect in the stability of modified epimerase. The precipitated junk Escherichia coli proteins were removed by centrifugation at 20000 X g for 30 min at room temperature. The supernatant containing partially purified

epimerase was used for immobilization on solid matrices or subjected to further purification using ion exchange chromatography.
The partially purified D-psicose-3-epimerase enzymes were subjected to gel electrophoresis and visualized after western blot. The expression pattern is depicted in Figure 17. Example 13: Immobilization of psicose-3-epimerase
The D-psicose 3-epimerase enzyme produced in this invention was immobilized on solid matrices. The solid matrix used for immobilization of D-psicose 3-epimerase is Duolite A568 (Dow chemicals) resins, which is highly porous granular weak base anion exchange resin. Prior to immobilization the resin was sieved to remove fine particles, washed and equilibrated with 20 mM Tris-HCl buffer pH 8.5.
To the equilibrated resin purified or partially purified epimerase enzyme pre-charged with MnCb in 50 mM Tris-Hcl, pH 8.5 buffer and was added stirred tank reactor and the bead and enzyme mix were kept under mild stirring conditions at 4 -10°C for up to 12 hrs. The unbound enzymes were removed from the resin and the immobilized resin by washing the matrix.
Alternatively, purified or partially purified epimerase enzyme is pre-charged with MnCb in 50 mM Tris-Hcl, pH 8.5 buffer and was passed on to the column packed with Duolite A568 matrix and equilibrated in same buffer. Alternatively, borate buffer, specifically tetra-borate buffer can be used instead of Tris-HCl buffer.
The flow rate of the enzyme solution is maintained between 10 to 100 min of residence time according to the column size. The amount of epimerase in the unbound and wash fractions was checked by Braford's method or using A280 nm. Example 14: Production of Allulose by free or immobilized D-Psicose 3- epimerase
The D-psicose-3-epimerase prepared from Escherichia coli was immobilized using techniques disclosed in the invention or directly contacted with fructose for production of allulose.
The bioconversion conditions comprise maintaining the fructose substrate concentration between 10% and 90% (W/V). Bioconversion reaction was carried out in 20 mM Tris-HCl buffer containing 0.2 - 0.5 mM MnCb at pH 8.0 to 9.5 at temperature between 45-66°C. Alternatively, borate buffer, specifically tetra-borate buffer can be used instead of Tris-HCl buffer.
The conversion of D-fructose to D-allulose reached saturation at higher substrate concentration of more than 50%, 60%, 70%, 80% or 90% (WAV) with enzyme concentration at 100 to 1000 units of enzyme with reaction time of about 3 to 6 hrs.

The conversion of D-fructose to D-allulose reached saturation of more than 50%, 60%, 70%), 80%o or 90%) (WAV) when the substrate solution is passed in to packed bed reactor with residence time of 5 to 25 min. The conversion rapidly reached the equilibrium with 30-31 % of D-allulose as a percentage of D-allulose produced form D-fructose.
Example 15: Production of allulose by whole cells Escherichia coli having D-Psicose-3-epimerase
Optimum fermentation of recombinant E. coli (JM109 [pBE-C-P3E]) for production of psicose-3-epimerase, different media components and conditions were tested at shake flask level. Terrific broth or defined media was used for production of psicose-3-epimerse in fermenters.
The components of the terrific broth are Tryptone, yeast extract, KH2PO4, KHPO4, MgS04 and glycerol. The components of the defined medium were diammonium hydrogen phosphate, potassium dihydrogen phosphate, citric acid, metal ions, trace elements and EDTA and glucose was used as carbon source and liquor ammonia was used as an alkali and nitrogen source.
Ampicillin or kanamycin was used as antibiotic in inoculum development and during fermentation process. The fermenter was maintained at 37°C with an agitation rate of 250 -700 rpm, aeration rate of 0.6 - 2.4 scfm, pressure of 5 psi and the dissolved oxygen was maintained at >40%>. The cells were incubated at 25°C for 10-12 hrs for the production of soluble epimerase enzyme. The whole cells containing the D-psicose 3-epimerase was incubated or contacted with fructose solution for production of allulose. The bioconversion conditions comprise maintaining the fructose substrate concentration of up to 20% (w/v).
Bioconversion reaction was carried out in 20 mM Tris-HCl buffer containing 5 mM MnCb at pH 8.0 at temperature 60°C for 5 hrs. Alternatively, borate buffer, specifically tetra-borate buffer can be used instead of Tris-HCl buffer.
The conversion reached the equilibrium with 19 % of D-allulose as a percentage of D-allulose produced form D-fructose.
Example 16: Production of Allulose by whole cells of Bacillus subtilis encoding D-Psicose 3-epimerase
For optimum fermentation of recombinant Bacillus subtilis ([pBE-C-P3E]) for production of D-psicose-3-epimerase, different media components and conditions were tested at shake flask level. Minimal media was used for production of psicose-3-epimerse in fermentors. The components of the minimal medium were ammonium sulphate, potassium dihydrogen phosphate,

dipotasium hydrogen phosphate, sodium citrate, magnesium sulphate, casamino acids, glucose, calcium chloride, magnesium chloride and EGTA. Kanamycin was used as antibiotic in inoculum development and during fermentation process.
The fermentor was maintained at 37°C with an agitation rate of 250 -700 rpm, aeration rate of 0.6 - 2.4 scfm, pressure of 5 psi and the dissolved oxygen was maintained at >20%. The cells were incubated at 37°C for 6 hrs for the production of soluble P3Ease enzyme. The D-psicose 3-epimerase prepared by subjecting recombinant B. subtilis (carrying pBE-C-DPE) whole cells to enzyme assay by directly contacting with fructose for production of allulose. The bioconversion conditions comprise maintaining the fructose substrate concentration at 20% (W/V).
Bioconversion reaction was carried out in 20 mM Tris-HCl buffer containing 5 mM MnCb at pH 8.0 at temperature 60°C for 5 hrs. Alternatively, borate buffer, specifically tetra-borate buffer can be used instead of Tris-HCl buffer.
The conversion of fructose to allulose reached saturation at higher substrate concentration of more than 70%, 80%, 90 or 95% (WAV) at enzyme concentration at 100 to 1000 units of enzyme with reaction time of about 6 hrs. The conversion reached the equilibrium with 25 % of D-allulose as a percentage of D-allulose produced form D-fructose. Example 17: Temperature optima and thermo-stability of D-psicose-3-epimerase mutant
The temperature optima and thermostability of the mutant D-psicose-3-epimerase was studied and compared with the wild type enzyme. It was found that the wild-type D-psicose-3-epimerase had temperature optima at 55°C while the mutant D-psicose-3-epimerase has temperature optima at around 66°C. The results are depicted in Figure 18.
Further, the thermo-stability and the half-life of the mutant enzyme was studied. It was found that the mutant enzyme was able retain more than 80% of its activity for more than 384 hours, while the wild type enzyme was able to retain only 20% of its activity after 24 hours. The results of the thermos-stability studies are depicted in Figure 19.
Further, the temperature optima of immobilized and free D-psicose-3-epimerase enzyme was studied and compared. It was found that immobilization imparts higher temperature optima to the enzyme and the immobilized enzyme has temperature optima at 74°C. The results are depicted in Figure 20.

The results depict that the mutant enzyme can work at higher temperature and has a higher thermos-stability as compared to wild-type enzymes. Further, the enzyme is amenable to vigorous industrial conditions and can show a high level of activity at higher temperatures. Example 18: pH optima of D-psicose-3-epimerase mutant
The pH optima of the mutant D-psicose-3-epimerase was studied with different buffers. It was found that the mutant enzyme has pH optima in the range of 7.5-9.5. Further, the mutant enzyme can show a high level of activity in the range of pH 4.0-9.5. The results are depicted in Figure 21.
The results depict that the mutant enzyme can show a high activity level over a wide range of pH and is extremely suitable for industrial use. Example 19: Operation Stability of D-psicose-3-epimerase mutant
The operation stability of the mutant D-psicose-3-epimerase was studied and compared with the wild type enzyme.
It was found that the mutant enzyme was able to retain more than 60% of its activity even after 50 days of operation at 55°C in a packed bed reactor. On the contrary, wild type enzyme was not able to retain even 25% of its activity even after 15 days of operation in a packed bed reactor at similar conditions. The results are depicted in Figure 22.
The results depict that the mutant enzyme has a higher operation stability as compared to wild-type enzymes.
Example 20: Conversion kinetics and conversion rate of the mutant D-psicose-3-epimerase enzyme
The conversion kinetics of the free and immobilized mutant D-psicose-3-epimerase enzyme was studied. It was found that the immobilized enzyme is equally effective as compared to the free enzyme. The results are depicted in Figure 23.
Further, the conversion rate at different residence times were calculated. It was found that the amount of allulose increases with the increase in the residence time. The results are depicted in Figure 24.
Subsequently, a HPLC analysis was conducted to check the conversion of D-fructose to D-allulose. The Figure 25 depicts HPLC analysis with standards (Figure 25B and 25C) and reaction mixture (Figure 25 A) with D-fructose and D-allulose.

We claim:
1. A D-psicose-3-epimerase mutant comprising the amino acid sequence of SEQ ID NO:5.
2. A modified nucleic acid encoding the D-psicose 3-epimerase mutant as claimed in claim 1.
3. The modified nucleic acid as claimed in claim 2, wherein the modified nucleic acid comprises the nucleotide sequence of SEQ ID NO: 3.
4. A modified nucleic acid comprising the nucleotide sequence of SEQ ID NO:2, wherein the nucleic acid encodes D-psicose-3-epimerase.
5. An expression cassette comprising the modified nucleic acid as claimed in claim 2, wherein the nucleic acid is operably linked to a constitutive or an inducible promoter.
6. The expression cassette as claimed in claim 5, wherein the constitutive promoter is GroE promoter and the inducible promoter is chosen from a group comprising T7 promoter and arabinose inducible promoter.
7. A vector comprising the expression cassette as claimed in claim 5.
8. The vector as claimed in claim 7, wherein the vector is selected from a group comprising pETll, pET23, pBE-S, pBAD, pK18mobSacB and pHT43.
9. A recombinant host cell comprising the vector as claimed in claim 7.
10. The recombinant host cell as claimed in claim 9, wherein the recombinant host cell is a prokaryotic or eukaryotic host cell.
11. The recombinant host cell as claimed in claim 10, wherein the prokaryotic host cell is selected from a group comprising Escherichia coli, Bacillus subtilis, Pseudomonasputida and Corynebacterium glutamicum, and the eukaryotic host cell is chosen from a group comprising Saccharomyces cerevisiae, Pichiapastoris and Hansenulapolymorpha.
12. The recombinant host cell as claimed in claim 11, wherein the host cell is selected from a group comprising MTCC 25108, MTCC 25063, MTCC 25064 and MTCC 25065.
13. A process for preparation of mutant D-psicose-3-epimerase, said process comprising the steps of:
a. culturing recombinant host cells as claimed in claim 9 in a suitable culture medium;
b. harvesting the recombinant host cells by centrifugation and tangential flow
filtration;
c. subjecting the recombinant host cells to mechanical or chemical lysis; and

d. purifying mutant D-psicose-3-epimerase expressed from the host cells, wherein the D-psicose-3-epimerase is subjected to full purification or partial purification.
14. The process as claimed in claim 13, wherein the process for partial purification comprises
the steps of:
a. adding MnCb to the cell lysate;
b. subjecting the cell lysate to heat treatment at a temperature in the range of 60°C-
65°C for a period of 10-20 minutes; and
c. subjecting the cell lysate to centrifugation to recover D-psicose-3-epimerase.
15. A process for production of D-allulose from D-fructose, the said process comprising the
steps of:
a. preparing a reaction mixture comprising 10% to 90% (w/v) D-fructose solution;
b. contacting the D-psicose-3-epimerase mutant as claimed in claim 1 with the
reaction mixture in a bioreactor; and
c. harvesting D-allulose from the solution.
16. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the bioreactor is chosen from a group comprising packed bed reactor, stirred tank reactor and enzyme membrane reactor.
17. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the temperature of the reaction mixture is in the range of 40°C-80°C.
18. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the pH of the reaction mixture is in the range of 4.0-9.5.
19. The process for production of D-allulose from D-fructose as claimed in Claim 15, wherein the D-psicose-3-epimerase mutant is immobilized on an immobilization matrix.

Documents

Application Documents

# Name Date
1 Sequence listing(PDF) [23-12-2016(online)].pdf 2016-12-23
2 Sequence listing [23-12-2016(online)].txt 2016-12-23
3 Sequence listing [23-12-2016(online)].pdf 2016-12-23
4 Form 3 [23-12-2016(online)].pdf 2016-12-23
5 Form 20 [23-12-2016(online)].pdf 2016-12-23
6 Description(Provisional) [23-12-2016(online)].pdf 2016-12-23
7 Other Patent Document [27-02-2017(online)].pdf 2017-02-27
8 Form 26 [27-02-2017(online)].pdf 2017-02-27
9 Correspondence By Agent_Formal Form1,GPOA_02-03-2017.pdf 2017-03-02
10 201641044105-DRAWING [22-12-2017(online)].pdf 2017-12-22
11 201641044105-CORRESPONDENCE-OTHERS [22-12-2017(online)].jpg 2017-12-22
12 201641044105-COMPLETE SPECIFICATION [22-12-2017(online)].pdf 2017-12-22
13 201641044105-REQUEST FOR CERTIFIED COPY [26-04-2018(online)].pdf 2018-04-26
14 201641044105-REQUEST FOR CERTIFIED COPY [26-04-2018(online)]-1.pdf 2018-04-26
15 201641044105-FORM-26 [26-04-2018(online)].pdf 2018-04-26
16 201641044105-Proof of Right (MANDATORY) [29-05-2018(online)].pdf 2018-05-29
17 201641044105-ENDORSEMENT BY INVENTORS [29-05-2018(online)].pdf 2018-05-29
18 Correspondence by Agent_Form1, Form5_01-06-2018.pdf 2018-06-01
19 201641044105-FORM 18 [23-12-2020(online)].pdf 2020-12-23
20 201641044105-FER.pdf 2023-05-10
21 201641044105-FORM 4(ii) [09-11-2023(online)].pdf 2023-11-09
22 201641044105-FORM 3 [07-12-2023(online)].pdf 2023-12-07
23 201641044105-FER_SER_REPLY [09-12-2023(online)].pdf 2023-12-09
24 201641044105-CORRESPONDENCE [09-12-2023(online)].pdf 2023-12-09
25 201641044105-CLAIMS [09-12-2023(online)].pdf 2023-12-09
26 201641044105-US(14)-HearingNotice-(HearingDate-22-04-2024).pdf 2024-03-26
27 201641044105-FORM-26 [19-04-2024(online)].pdf 2024-04-19
28 201641044105-Correspondence to notify the Controller [19-04-2024(online)].pdf 2024-04-19
29 201641044105-Written submissions and relevant documents [07-05-2024(online)].pdf 2024-05-07
30 201641044105-MARKED COPIES OF AMENDEMENTS [07-05-2024(online)].pdf 2024-05-07
31 201641044105-FORM 13 [07-05-2024(online)].pdf 2024-05-07
32 201641044105-AMMENDED DOCUMENTS [07-05-2024(online)].pdf 2024-05-07
33 201641044105-PatentCertificate16-05-2024.pdf 2024-05-16
34 201641044105-IntimationOfGrant16-05-2024.pdf 2024-05-16

Search Strategy

1 PRODUCTIONOFD-ALLULOSEBYUSINGD-PSICOSE3-EPIMERASEMUTANT-GoogleSearchE_10-05-2023.pdf
2 patseerE_10-05-2023.pdf

ERegister / Renewals

3rd: 16 Aug 2024

From 23/12/2018 - To 23/12/2019

4th: 16 Aug 2024

From 23/12/2019 - To 23/12/2020

5th: 16 Aug 2024

From 23/12/2020 - To 23/12/2021

6th: 16 Aug 2024

From 23/12/2021 - To 23/12/2022

7th: 16 Aug 2024

From 23/12/2022 - To 23/12/2023

8th: 16 Aug 2024

From 23/12/2023 - To 23/12/2024

9th: 16 Aug 2024

From 23/12/2024 - To 23/12/2025