Abstract: The present invention provides improved tests for the detection of methicillin-resistant Staphylococcus aureus bearing a variant mecA gene. The tests are particularly useful for eliminating certain false negative results due to the presence of this variant in MRSA in patient samples
Detection of mecA variant strains of methicillin-resistant Staphylococcus aureus
FIELD OF THE INVENTION
[0001] The present invention relates to molecular detection of methicillin-resistant
Staphylococcus aureus (MRSA). More particularly, the present invention relates to an improved
detection of MRSA that includes additional strains bearing a variant of the mecA gene.
BACKGROUND OF THE INVENTION
[0002] A strain of Staphylococcus aureus was shown for the first time in 1961 to be
resistant to methicillin. Today, methicillin-resistant Staphylococcus aureus (MRSA) is one of the
most prevalent antibiotic resistance pathogen causing hospital and community infections. The
emergence of MRSA strains is due to the acquisition and insertion of a mobile genetic element,
the Staphylococcal Cassette Chromosome mec (SCCmec), into the chromosome of susceptible S.
aureus strains. Indeed, this SCCmec element carries the mecA gene, which is responsible for
methicillin resistance (Staphylococcal Cassette Chromosome mec; Ito et al., 2001, Antimicrob.
Agents Chemother. 45(5):1323-1336; Hiramatsu, et al, 2001, Trends Microbiol. 0ct;9(10):486-
93),. The mecA gene encodes for a modified Penicillin Binding Protein called PBP2a or PBP2'.
Contrary to the native PBP, this PBP2a has a low affinity for the b-lactam antibiotics that
permits to continue the synthesis of cell wall even in presence of b -lactam antibiotics.
[0003] SCCmec element can be incorporated into the chromosome of 5. aureus and
other coagulase negative Staphylococci, mainly S. epidermidis and S. haemolyticus. SCCmec is
characterized by the presence of terminal inverted and direct repeats, a set of site-specific
recombinase genes [ccrA and ccrB], and the mecA gene complex (Ito et al., 1999, Antimicrob.
Agents Chemother. 43:1449-1458; Katayama et al., 2000, Antimicrob. Agents Chemother.
44:1549-1555). The site of insertion of this mecA gene cassette SCCmec into the Staphylococcus
aureus genome is known and the sequence conserved (Ito et al., 2001, Antimicrob. Agents
Chemother. 45:1323-1336). After insertion into the S. aureus chromosome, the SCCmec has a
left extremity junction and a right extremity junction (see FIG. 1), with a surrounding left
extremity junction region and right extremity junction region, respectively, that includes the
SCCmec cassette and chromsosomal DNA where the SCCmec sequence is contiguous with the S.
aureus chromosomal sequence. The nucleotide sequence of the regions surrounding the left
and right boundaries of SCCmec DNA (i.e. attL and attR, respectively), as well as those of the
regions around the SCCmec DNA integration site (i.e., attBscc, the bacterial chromosome
attachment site for SCCmec DNA), have previously been analyzed. Sequence analysis of the
integration sites revealed that attBscc is located at the 3' end of a novel open reading frame
(ORF}, orfX. orfX encodes a polypeptide of 159 amino acids annotated recently as a 23S rRNA
methyltransferase (http://www.uniprot.org/uniprot/Q6I7F2 }. Organization of the mecA
region of SCCmec has additionally been studied (Oliveira, D.C., et al., 2000, Antimicrob. Agents
Chemother. 44(7}:1906-1910}.
[0004] Typically, in an MRSA assay in a patient, a nasal swab is taken from the patient
and cultured repeatedly, to determine if an MRSA strain is present. Newer methods are being
developed that allow identification of MRSA directly from a nasal swab and in a much shorter
amount time. Samples are also evolving, and many papers show the interest to sample several
anatomical sites of the same patient to increase the possibility to detect MRSA carriers. The
sites could be nasal plus throat, axilla, groin and or perineum. (Methicillin Resistant
Staphylococcus aureus colonisation at different Body Sites: a Prospective, Quantitative Analysis,
Mermel et al. 2011, Journal of Clinical Microbiology}.
[0005] Amplification is a well known art, and various methods have been developed,
including transcription-based amplification such as transcription-mediated amplification
(TMA; U.S. Pat. Nos. 5,766,849 5,399,491; 5,480,784; 5,766,849; and 5,654,142} and nucleic
acid sequence-based amplification (NASBA; 5,130,238; 5,409,818; 5,654,142; and 6,312,928},
and cycling nucleic acid amplification technologies (thermocycling} such as polymerase chain
reaction (PCR; U.S. Pat. Nos. 4,683,195; 4,965,188; 4,683,202} and ligase chain reaction (LCR;
U.S. Pat. No. 5,792,607}. Known amplification methods also include strand displacement
amplification (SDA}, self-sustained sequence replication (3SR}, Q-b replicase, and cascade
rolling circle amplification (CRCA}.
[0006] Detection methods utilizing nucleic acids are also well known in the art. Nucleic
acids are often labeled for various detection purposes. For example, methods described in U.S.
Patent Nos 4,486,539 (Kourlisky}; 4,411,955 (Ward}; 4,882,269 (Schneider} and 4,213,893
(Carrico}, illustrate preparation of labeled detection probes for detecting specific nucleic acid
sequences. Probe designs for different detection methods, such as target-capture, HPA,
TaqMan, molecular beacons and sandwich hybridization have also been described (e.g., U.S.
Pat. No. 4,486,539, and U.S. Pat. No. 4,751,177; 5,210,015; 5,487,972; 5,804,375; 5,994,076}.
Nucleic acid hybridization techniques and conditions are known to the skilled artisan and have
been described for example, in Sambrook et al. Molecular Cloning A Laboratory Manual, 2nd
Ed. Cold Spring Lab. Press, Dec. 1989; U.S. Patent Nos 4,563,419 (Ranki} and 4,851,330
(Kohne} and in Dunn, et al., Cell 12, pp. 23-26 (1978} among many other publications.
[0007] Earlier molecular methods developed to detect and identify MRSA based on the
detection of the mecA gene and S. aureus-spetific chromosomal sequences have been described.
(Saito et al., 1995, J. Clin. Microbiol. 33:2498-2500; Ubukata et al., 1992, J. Clin. Microbiol.
30:1728-1733; Murakami et al., 1991, J. Clin. Microbiol. 29:2240-2244; Hiramatsu et al., 1992,
Microbiol. Immunol. 36:445-453}. However, in tests based on the detection of the cassette
junction only, false positives have been observed with methicillin-susceptible S. aureus isolates
containing a small fragment of the right extremity of the SCCmec [see Rupp, J. et al., J. Clin.
Microbiol. 44(6}: 2317 (2006}}. Additionally, Ramakrishnan and Riccelli describe a method for
detecting MRSA utilizing oligonucleotide probes having sequences that are complementary to
regions near the left junction of the SCCmec cassette insertion site, including part of the SCCmec
cassette sequence and part of the S. aureus sequence in the region of insertion (the left
extremity junction region} (U.S. patent publication No. US20060057613}.
[0008] Concepts for determining resistance to methicillin carried specifically by
S. aureus have been published:
the SCCmec right extremity junction amplification concept (Hiramatsu et al.
W097/31125; EP 0 887 424; U.S. Pat. No. 6,156,507; and further, Huletsky and Rossbach
WO02/099034 (2002}; Huletsky et al. Clin.Microbiol. 42(5}: 1875-1884 (2004}}
the immuno-enrichment concept described by Francois and co-workers (Francois, P et
al. .J.Clin.MicrobiolAl[iy.254-260 (2003}; WO02082086}, in which the immunoenrichment
is followed by amplification of three markers [mecA gene, S. awrews-specific
marker, and S. epidermidis-specific marker}
- the combination of SCCmec right extremity junction amplification and mecA
amplification (Jay, et al. US20090203013; WO2009085221, which are incorporated by
reference in their entirety}.
[0009] The SCCmec right extremity junction concept is based on the amplification of a
region covering the right extremity junction region of the SCCmec integration site. The
principle is the following: the SCCmec cassette always integrates the S.aureus chromosome
upstream of a S.aureus specific open reading frame called orfi{ ; the amplification (e.g., PCR]
assay combines multiple forward primers located on the right part of the cassette ("right
extremity junction region" of SCCmec cassette], one reverse primer and a probe, both located in
the S.aureus chromosomal orfX, i.e., downstream of the right extremity junction of SCCmec with
orfX ("right extremity junction region" of or . Hiramatsu et al. describe a test with two
forward primers in the right extremity junction region of the cassette to amplify the main
SCCmec types described at that time (one primer for SCCmec types I and II and a second primer
for type III}. Huletsky et al set forth that several MRSA strains were not detected if only the two
forward primers described by Hiramatsu were used, and they determined new types of
cassettes named as MREJ types having sequence variations in the right part of the SCCmec
cassette. A commercially available (Infectio Diagnostics Inc.] test combines five forward
primers located in the right part of the cassette (one primer was designed for the detection of
MREJ types i and ii and the four others for the MREJ types iii, iv, v and vii], one reverse primer
located in the orfX, and three generic probes covering the same portion of the orfX region and
required to identify the orfX variants identified. This test is performed in real-time PCR.
However, the specificity of this test as reported (Huletsky et al. 2004} shows that 4.6 % of
MSSA (26 out of 569 tested] were misidentified. False-positive result has also been reported
with another commercial test using a single-locus (right extremity SCCmec cassette-or/X '
junction] PCR assay (Rupp, J, et al. . Clin. Microbiol. (44]6: 2317 (2006]].
[0010] US20090203013 addressed primary sources of MRSA false positives and
provided an improved test to detect MRSA that had not been previously addressed by thenavailable
tests. This application provided that the identification of false positives by the
previous molecular methods can be explained in some instances by the presence in MSSA
strains of a residual SCCmec right extremity fragment following the deletion of a chromosomal
region containing mecA or the presence of an SCCmec which does not contain mecA.
Additionally, it provided that some portion of the false positives can be due to non specific
amplification; indeed, because the reverse primer and the probes are located in the orfX which
is common to both MRSA and MSSA, non specific annealing of the forward primer(s] on MSSA
chromosome will lead to amplification and detection of MSSA. The application addressed both
sources of false positives and provided an improved test. An assay utilizing this principle is
marketed (NucliSENS EasyQ® MRSA, bioMerieux, SA, Marcy l'Etoile, France}.
[0011] Previously, in assays for detection of methicillin resistance in S. aureus, either
the mecA gene was determined to be present in the SCCmec cassette leading the strain to be
resistant to methicillin or the mecA gene was determined to be absent (excision from the
cassette or no cassette] wherein it was concluded that the strain was susceptible to methicillin.
Taking into account the numerous sequences available in public databanks for mecA gene, from
MRSA or from other methicillin-resistance pathogens, the mecA gene was shown as wellconserved,
only some particular mutations were found.
[0012] Recently a methicillin-resistant S.aureus was detected that was found to lack
mecA by conventional PCR and microarray sequencing (Shore, A.C. et al., Antimicrob. Agents
Chemother. Doi:10.1128/AAC.00187-ll (2 June 2011} and Garcia-Alvarez, L. et al., Lancet
doi:10.1016/S1473-3099(ll}70126-8 (3 June 2011} Methicillin-resistant Staphylococcus
aureus with a novel mecA homologue in human and bovine population in the UK and Denmark:
a descriptive study.}. Whole-genome sequencing revealed a 30kb SCCmec element having a
highly divergent blaZ-mecA-mecRI-mecI, and indicated that the mec element present in the
SCCmec element had 70% sequence identity to S.aureus mecA homologues; further, the SCCmec
element was almost identical to SCCmec type XI previously identified (sequence type 425
bovine MRSA strain LGA251 listed on the website of the International Working Group on the
Classification of Staphylococcal Cassette Chromosome Elements}. The SCCmec element is
integrated at the same nucleotide position within orf as all other SCCmec elements. The strain
additionally included a class E mec complex a type 8 cassette chromosome recombinase ccf
complex consisting of ccrAl-ccrB3, an arsenic resistance operon and flanking direct repeats.
Present detection methods would not identify this strain as MRSA.
[0013] Shore et al. used the FR823292 strain as reference strain and used
c4_M10/ 0061 primers. Garcia-Alvarez et al. studied a divergent mecA in the LGA251
genome, this mecA variant being located in a novel cassette designated "type-XI SCCmec". They
used the LGA251 strain as reference strain and used mecA_LGA2Sl primers. In fact, the 2
publications refer to the same subject. Both mecA variants shared a very high similarity
percentage (99%} and in the same time show a weak overall similarity to all mecA sequences
known so far.
[0014] As new subtypes and strains are identified, means to detect such subtypes and
strains becomes necessary. This is particularly important when a currently existing assay does
not fortuitously already detect it and thus can result in false negative results. The present
invention fills this need regarding detection of strains containing variant mecA by providing an
assay that can detect such strains. Further, this new invention confirms in the same assay the
presence of both a S. aureus strain and a methicillin-resistance gene. This assay can be used
alone or in combination with existing assays for other SCCmec types.
SUMMARY OF THE INVENTION
[0015] The present invention provides a method of amplifying in a sample a methicillinresistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette
within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a
mecA variant element, the method comprising:
performing on the sample an amplification reaction utilizing an oligonucleotide set comprising:
a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant,
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified.
[0016] The present invention additionally provides a method of amplifying in a sample
a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an
SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises mecA or a mecA variant element, the method comprising:
performing on the sample an amplification reaction utilizing
a. a first oligonucleotide set comprising:
1} a first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of a mecA variant element, and
2} a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of a mecA variant element; and
b. a second oligonucleotide set comprising:
1} a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2} a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified.
[0017]The present invention further provides a kit for amplifying a methicillin-resistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA
variant element, the kit comprising a first oligonucleotide set comprising:
a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant.
[0018] Additionally, the present invention provides a kit for amplifying in a sample a
methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec
cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises mecA or a mecA variant element, the kit comprising:
a] a first oligonucleotide set comprising:
1} a first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of a mecA variant element, and
2} a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of a mecA variant element; and
b a second oligonucleotide set comprising:
1} a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2} a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 shows generally the region of MRSA chromosome with the inserted
SSCmec cassette, indicating the left and right extremity junctions.
[0020] Figure 2 demonstrates generally the region of MRSA chromosome with an
inserted SCCmec cassette bearing a mecA variant ( mecA Si .
DETAILED DESCRIPTION OF THE INVENTION
[0021] As discussed herein, the present invention provides the identification of strains
of methicillin-resistant S. aureus which include a variant meeA gene (typically not detected with
presently commercially-available MRSA detection kits] and which are structurally arranged
such that a single amplification reaction can amplify both a relevant portion of meeA and an
extremity junction at the insertion point of a SCCmec cassette into the S. aureus chromosome.
The present invention addresses a newly-discovered source of false negative results and
provides an improved test.
[0022] Unless defined otherwise, all technical and scientific terms used herein have the
same meanings as commonly understood by one of skill in the art to which the disclosed
invention belongs. Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the present invention, the preferred
methods, devices, and materials are as described.
[0023] As used herein and in the appended claims, the singular forms "a", "an", and
"the" include plural reference unless the context clearly dictates otherwise.
[0024] The strains identified by the present invention are methicillin-resistant, but they
do not harbour the classical meeA gene known to be well-conserved so far. Methicillin
resistance is conferred in this case by a new meek variant gene. One documented meeA variant
is referred to in publications variously as mecA w/oo , meeA homologue, and
mecAnew variant (this variant has more recently been proposed to be renamed "mecC" [Ito, T. et
al., Guidelines for Reporting Novel meeA Gene Homologues, Agents Chemother.
doi:10.1128/AAC.01199-12]} ; however, other meeA variants maybe detected with the present
invention. As used in the specification and the claims, the term "meeA variant" will be used to
refer to any meeA variant gene that confers methicillin resistance and can be detected by a
claimed method, in particular, in an amplification reaction that, with a single primer set,
amplifies a region that includes both a relevant portion of a meeA variant (i.e., sufficient to
identify it as a meeA variant] and an extremity junction at the insertion point of a SCCmec
cassette into the S. aureus chromosome. It is noted that, as amplification technologies are
further developed, longer amplicons may become possible such that primer sets for detection
of a mecA variant gene may be designed to hybridize farther from this target region comprising
a relevant portion of a mecA variant gene and an extremity junction of SCCmec cassette.
[0025] The size of the SCCmec cassettes in previously studied MRSA strains is divergent,
but generally the mecA gene has been found to be about 8000 to 15,000 bp from the S. aureus
chromosome in the direction of orfX (sometimes herein referred to as "downstream"} and
longer in the other direction [see Fig.l and Fig. 2a}. In the new SCCmec type XI, the mecA
variant gene has been found to be positioned closer to orfX, with the distance only about 1500
bp [see Fig. 2b}. While application of traditional MRSA amplification designs might have
predicted an assay design of two parts- detection of the mecA variant gene in addition to
detection of the junction- applicants instead considered and recognized the potential utility of
the shorter distance from mecA variant gene to orfX. Thus, the present invention
advantageously amplifies the region between the mecA variant gene and an S.aureus
chromosomal extremity junction region (i.e., across an extremity junction} directly using a
primer in the mecA variant gene and another in the S. aureus chromosome region in an
extremity junction region [see FIG 2, e.g., across the right extremity junction}. While still an
unconventionally long amplicon, applicants have found that this design works surprisingly
well. Additionally, this new invention resolves the problem of poor specificity because only one
amplification is needed and this amplification confirms in the same reaction the presence both
of S. aureus strain and of variant methicillin-resistance gene.
[0026] The present invention provides a method of amplifying in a sample a methicillinresistant
Staphylococcus aureus (MRSA} which comprises an insertion of an SCCmec cassette
within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a
mecA variant element, the method comprising:
performing on the sample an amplification reaction utilizing an oligonucleotide set comprising:
a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region , and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant,
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified. The region of chromosomal S. aureus DNA can be in a right
extremity junction region.
[0027] Oligonucleotides of the present invention that specifically hybridize with a
target can be selected as those which selectively hybridize, at the selected hybridization
conditions, with their target, i.e., which bind with their intended target(s} but not with nontargets.
Hybridization/ amplification conditions can be selected for appropriate stringency to
achieve selectivity, as is known in the art (e.g., Sambrook and Russell, Molecular Cloning: A
Laboratory Manual (Cold Spring Harbor Laboratory Press; 3rd edition (2001}}. Minor
modifications can be made to select oligonucleotides as long as the reaction conditions allow
the modified oligonucleotide to specifically hybridize to the target(s}.
[0028] A first oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction
region and a second oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a region of a mecA variant each can function as a primer, and each is oriented
such that, upon hybridization to its specific target nucleic acid, and upon initiation of an
amplification reaction including the primer, an amplicon is formed that includes the region of
the MRSA between the hybridizing region of the first oligonucleotide and the hybridizing
region of the second oligonucleotide. Such a reaction is designed to amplify across an
extremity junction of SCCmec at its insertion into the S. aureus chromosome [i.e., to be in
sufficiently close proximity of the junction so that an amplification reaction can extend across
the junction}. Thus a primer pair for mecA variant useful for amplifying a junction will typically
hybridize to two regions, one in the mecA variant and one in an S. aureus chromosomal region,
in effect surrounding the junction, and each primer will be oriented to hybridize such as to be
capable of directing amplification in a 5'-3' direction toward the junction. Typically, the primer
for mecA variant would be designed to hybridize within 1600nt, 1550nt, 1500 nt, 1450 nt,
1400 nt, 1350 nt, 1300 nt, 1200 nt, 1100 nt, 1000 nt, 900 nt, 800 nt, 700 nt, 600nt, 500nt,
400nt, 350nt, 300nt, 250nt, 200nt 150nt, lOOnt, 50nt, 30nt, 25nt, 20nt, etc. of the junction;
however, as new technologies allow longer amplicons, primers can be designed that hybridize
farther distances from the junction. The primer having a nucleic acid sequence capable of
specifically hybridizing to a region of a mecA variant will typically be designed to hybridize
farther from the junction than the primer having a nucleic acid sequence capable of specifically
hybridizing to a region of chromosomal Staphylococcus aureus DNA in an extremity junction
region because of the organization of the SCCmec having a mecA variant gene and the distance
of the mecA variant gene from the junction.
[0029] The oligonucleotide set for amplification of orfX-mecA variant can further
comprise a third oligonucleotide capable of specifically hybridizing within a region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide, and, wherein if the sample contains the MRSA, hybridization of the
third oligonucleotide is detected. Such an oligonucleotide can function as a probe for detecting
an amplification product and is therefore selected to be capable of specifically hybridizing to a
region between the hybridizing region of the first oligonucleotide and the hybridizing region of
the second oligonucleotide. In certain embodiments, such a probe can specifically hybridize to a
region of chromosomal Staphylococcus aureus DNA, such as a region of orfX. In another
embodiment, a probe can specifically hybridize to a region of a right extremity junction region
of SCCmec cassette DNA (e.g., within blaZ sequences], and in a further embodiment, a probe can
specifically hybridize to a region of the mecA variant. Amplification can be detected by any
means selected. For example, this third oligonucleotide can be labeled by any of several means
and with any of several methods. Thus, if the sample contains the MRSA, amplification of the
nucleic acid between the two primers occurs, and the third oligonucleotide, which can be a
labeled probe, can hybridize to the amplicon. Hybridization of the third oligonucleotide can be
detected by any known means. Alternatively, an intercalating dye can be used to detect
amplification from the two primers. If a probe is used, the probe can be designed to specifically
hybridize to a region of a right extremity junction region of SCCmec cassette DNA. For example,
the probe can be designed to specifically hybridize to a region of chromosomal Staphylococcus
aureus DNA such as a region of orf o chromosomal Staphylococcus aureus DNA. Alternatively,
a probe can be designed to specifically hybridize to a region of the mecA variant.
[0030] The presence or absence of any target within the present invention can be
determined by performing whatever analysis provides detection of the product, e.g., if a labeled
probe is used, detection of the hybridized label by the appropriate detection device. In such an
embodiment, lack of a detectable signal indicates the absence of the target; perception of a
detectable signal indicates presence of the target.
[0031]Examples of a first oligonucleotide, or primer, capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region can include,
but are not limited to, an oligonucleotide that specifically hybridizes in the orfX region.
Examples of such an oligonucleotide include SEQ ID NOs: 9 and 10. Examples of a second
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a region of
a mecA variant can include, but are not limited to, a nucleic acid sequence selected from the
group consisting of: SEQ ID NOs: 6, 7, 16, 17 and 21. These specific examples are particularly
useful as forward primers (i.e., for directing amplification toward the right extremity junction
of SCCmec}. Examples of a third oligonucleotide, which can be used as a probe, capable of
specifically hybridizing within a region of the MRSA between the hybridizing region of the first
oligonucleotide (hybridizing within in chromosomal Staphylococcus aureus DNA] and the
hybridizing region of the second oligonucleotide (hybridizing within a region of a mecA variant
} can include, but is not limited to, a nucleic acid sequence set forth as SEQ ID NO: 8, 18 and 19.
[0032] The genomic structure of MRSA has been characterized previously. As used in
the claims, the "SCCmec cassette" (sometimes referred to as "mecDNA," e.g., in Hiramatsu U.S.
Pat. No. 6,156,507} has the definition as known in the art, i.e., an integrated adventitious DNA
existing on a chromosome of MRSA or MR-CNS and including the mec gene complex, a set of
site-specific recombinase genes [ccrA and ccrB), and terminal inverted and direct repeats (at
both 3' and 5' ends}; as used in the specification, this term includes any variation of SCCmec
found in strains harboring a mecA variant. "mecA gene" includes all sequences necessary to
confer methicillin resistance (i.e., to encode PBP2a or PBP2' (Penicillin Binding Protein}}.
[0033] As known in the art, insertion of the SCCmec cassette into the S. aureus
chromosome creates two junctions, and two corresponding junction regions, of SCCmec DNA
with S. aureus chromosomal DNA, wherein the SCCmec sequence is contiguous with the S.
aureus chromosomal sequence. The junctions, therefore, are located at the left and right
extremities of the SCCmec cassette [see Fig 1}. These two regions are named "Right SCCmec-
Chromosome Junction" and "Chromosome-Left SCCmec junction" by Ito et al .(Antimicrob.
Agents Chemother. May 2001 45(5}: 1323-1336, "Structural Comparison of three Types of
Staphylococcal Cassette Chromosome mec Integrated in the chromosome in Methicillin-
Resistant Staphylococcus aureus"), and termed herein as "right extremity junction" and "left
extremity junction," respectively. At the right extremity junction, the S. aureus genomic
sequence abutting the SCCmec cassette is the gene orfX, which is in some literature referred to
as "IntM." As used in the claims, "extremity junction region" is a region of either SCCmec
cassette or S. aureus chromosomal nucleic acid within distance of either the right or the left
extremity junction, or insertion site, such that a primer that hybridizes in either SCCmec (e.g..,
J3 region] or orfX can, in a primer extension reaction or a transcription-type (e.g., NASBA or
TMA] reaction, be extended across that junction, e.g., within 600nt, 550nt, 500nt, 450nt, 400nt,
350nt, 300nt, 250nt, 200nt, 150nt, lOOnt, or 50nt (in either direction] of the junction. Useful
distances may vary depending upon the amplification technology used. "Extremity junction
region," therefore, depending upon context used, can refer to a region within the SCCmec DNA
or a region within the S. aureus chromosomal DNA; both uses refer to such DNA within distance
of the junction such that an appropriately selected primer that hybridizes in either SCCmec
(e.g.., J3 region] or orfX could, under appropriate, standard extension or amplification
conditions, be extended, or transcribed, from it, in the direction of the junction, across the
junction. That is, "an extremity junction region of the SCCmec cassette" would be a region
within the SCCmec DNA near its abutment, or integration site, with the S. aureus chromosomal
DNA; and "an extremity junction region of or ' would be a region within the orfX DNA near an
abutment with SCCmec DNA (an SCCmec integration site]. Similarly, "an extremity junction
region of chromosomal S. aureus DNA" would be a region within the chromosomal S. aureus
DNA near an abutment with SCCmec DNA. Alternatively, this region may also be referred to as
chromosomal S. aureus DNA in the region of the SCCmec extremity junction. Thus, "right
extremity junction region" refers to the region surrounding the junction on the right (or
downstream] side of the SCCmec cassette, and "left extremity junction region" refers to the
region surrounding the junction on the left (or upstream] side of the SCCmec cassette (see
Figure 1].
[0034] Advantageously, one can perform an amplification reaction to detect both the
presence of previously characterized MRSA strains (containing the originally-described mecA
gene], using known methods, such as one comprising detecting a SCCmec insertion junction
and mecA sequences (i.e., Jay, et al , along with an amplification to detect the newly discovered
strains harboring a mecA variant. Such an amplification and detection reaction can be
performed, e.g., in separate containers or in a single container as a multiplex reaction. Thus, in
addition to the reaction detecting a mecA variant, an assay can include a reaction to detect, e.g.,
a junction region of a standard (i.e., as described for SCCmec types I-X] SCCmec cassette
insertion, a standard (i.e., as described for SCCmec types I-X] mecA gene, and/or an S. aureusspecific
chromosomal region.
[0035] By "amplifying a portion of mecA DNA" is meant performing an amplification
reaction on a sample that produces an amplification product that includes sequences
corresponding to any portion of a mecA gene, for example, the region between primers
comprising a nucleic acid sequence set forth in SEQ ID NOs: 12 and 13. For example, a primer
can comprise a nucleic acid sequence as set forth in SEQ ID NOs: 12 and 13. Primers
comprising these sequences and primers consisting essentially of these sequences can be
utilized as well as primers consisting of these sequences. Amplification can be detected, for
example, utilizing a probe comprising a nucleic acid sequence between the target nucleic acids
of the primers, or using an intercalating dye. Primers and probes can be readily designed for
hybridization to the known mecA sequence.
[0036] Junction. The present inventive method, in addition to amplifying the mecA
variant, if present, can further comprise amplifying a methicillin-resistant Staphylococcus
aureus (MRSA] which comprises an insertion of an SCCmec cassette within Staphylococcus
aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by utilizing in an
amplification reaction a second oligonucleotide set for amplification of a right extremity
junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the second
oligonucleotide set comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette of the
MRSA comprising a mecA,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions, if the sample contains the MRSA comprising
a mecA, the right junction is amplified. The second oligonucleotide set can further comprise a
third junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing
within a region of the MRSA between the hybridizing region of the first junction
oligonucleotide and the hybridizing region of the second junction oligonucleotide, wherein if
the sample contains the MRSA comprising the right extremity junction, hybridization of the
third junction oligonucleotide is detected.
[0037] The third junction oligonucleotide can be a probe. The third junction
oligonucleotide can have a nucleic acid sequence capable of specifically hybridizing within a
region of a right extremity junction region of the SCCmec cassette, or it can have a nucleic acid
sequence capable of specifically hybridizing within orfX. Alternatively, a method of detection
such as use of an intercalating dye can be performed. The first junction oligonucleotide, which
can function as an amplification primer, can have a nucleic acid sequence capable of specifically
hybridizing within orfX.
[0038] Primers and probes used in any reaction of this invention are capable of
specifically hybridizing with a target nucleic acid. Specific hybridization is known in the art,
and, typically, specific hybridization is achieved through nucleic acid identity or high similarity
of the primer/probe with the target nucleic acid and/or through use of stringent hybridization
conditions (e.g., stringent temperature and/or salt conditions}. Specific hybridization provides
selective hybridization to the target within the reaction.
[0039] Typically, for amplification reactions other than that to amplify orfX-mecA
variant nucleic acids (such as to amplify a junction, a non-variant mecA and/or an S.aureus
chromosomal region], the primer is selected such that amplification product synthesized
utilizing it and a second primer (located in an S. aureus genomic sequence] will be of
approximately 100 to 350nt in length. While PCR amplification can be designed to generate
longer or shorter amplicons (e.g., 50, 100, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900,
lOOOnt or longer], preferred amplicon lengths for either transcription-based (e.g., NASBA or
TMA] or PCR-type reactions for detection of mecA, junction or chromosomal S. aureus genes in
the present invention will be within about 100 to 300nt (e.g. 150, 200, 250, 300nt] in length.
Additionally, for a multiplex amplification reaction, whether transcription-based or PCR-based,
an amplicon in the range of 100 to 300nt or shorter is preferable for these targets, to enhance
sensitivity of the test. It is noted that the amplification utilizing a first oligonucleotide having a
nucleic acid sequence capable of specifically hybridizing to a region of chromosomal
Staphylococcus aureus DNA in an extremity junction region and a second oligonucleotide
having a nucleic acid sequence capable of specifically hybridizing to a region of a mecA variant
will have a longer amplicon than that typically used in other amplifications that can form part
of the present assay. It is also noted that, as amplification methods are further developed and
refined, longer amplicons may become possible and eventually routine and are encompassed
by the present invention.
[0040] A primer oriented such that, "under amplification conditions, the junction is
amplified" includes a primer oriented such that, upon hybridization to its specific target nucleic
acid, and upon initiation of an amplification reaction including the primer, an amplicon is
formed that includes the junction. Such a reaction is designed to amplify across the junction
(i.e., to be in sufficiently close proximity of the junction so that a typical amplification reaction
would extend across the junction}. Thus a primer pair useful for amplifying a junction will
typically hybridize to two regions that surround the junction and each primer will be oriented
to hybridize in a 5'-3' direction toward the junction. Typically, the primer would be designed to
hybridize within 600nt, 500nt, 400nt, 350nt, 300nt, 250nt, 200nt 150nt, lOOnt, 50nt, 30nt,
25nt, 20nt, etc. of the junction. A probe for detecting an amplification product is therefore
selected to be capable of specifically hybridizing within a region of a right extremity junction
region of the SCCmec cassette between the target sequences of the primers. For example, the
probe can hybridize within S. aureus genomic sequences (e.g., orfX, between the target
sequence of the S.aureus probe and the junction] or within SCCmec (between the target
sequence of the SCCmec primer and the junction] or across the junction. In certain
embodiments, such a probe can specifically hybridize fully within or primarily within SCCmec
cassette. In one embodiment, in which the probe specifically hybridizes primarily within
SCCmec cassette, the region to which the probe hybridizes can additionally include the junction
and, therefore, at least one, or two or three or a few nucleotides of orfX that abut the junction.
Typically, the primer is selected such that amplification product synthesized utilizing it and a
second primer (located in an S. aureus genomic sequence] will be of approximately 100 to
350nt in length. While PCR amplification can be designed to generate longer amplicons (e.g.,
150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, lOOOnt or longer], preferred amplicon
lengths for either transcription-based (e.g., NASBA or TMA] or PCR-type reactions for detection
of mecA, junction or chromosomal S. aureus genes in the present invention will be within about
100 to 300nt (e.g. 150, 200, 250, 300nt] in length. Additionally, for a multiplex amplification
reaction, whether transcription-based or PCR-based, an amplicon in the range of 100 to 300nt
or shorter is preferable for these targets, to enhance sensitivity of the test. Specific primers
useful for amplifying extremity junction regions can readily be designed, given the teachings
herein and knowledge and skill in the art.
[0041] As used in the claims, "amplification conditions" are those appropriate for a
selected amplification reaction, as are known to those of skill in the art, such as are utilized in
various amplification reactions. Such conditions can be optimized for a specific reaction,
primers, etc. as also known by the skilled artisan. As is known, such amplification conditions
include contact with the required reagents for the amplification, e.g., nucleotides and enzymes,
as well as the appropriate selected temperature, salt and pH conditions, among other aspects.
Furthermore, as used in the claims, a primer or probe may be a primer or probe set, i.e.,
multiple primers or probes. Such primer/probe sets can be utilized in a reaction in which
more than one type or subtype of MRSA is desired to be amplified and/or detected, and
wherein the nucleic acid sequence of the target MRSA region selected for hybridization of the
primer and/or probe varies among types and/or subtypes. Individual primers/probes can be
designed for each type or subtype, as exemplified herein.
[0042] mecA. The present method can additionally comprise amplifying a
Staphylococcus aureus comprising mecA by utilizing in an amplification reaction a third
oligonucleotide set for amplification of a mecA element comprising:
a. a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of mecA; and
b. a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within mecA, wherein each of the first mecA oligonucleotide
and the second mecA oligonucleotide is oriented such that, under amplification conditions, a
portion of the mecA is amplified. The third oligonucleotide set can further comprise a third
mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within
a region of the mecA between the hybridizing region of the first mecA oligonucleotide and the
hybridizing region of the second mecA oligonucleotide
wherein if the sample contains the MRSA comprising mecA, hybridization of the third mecA
oligonucleotide is detected. Alternatively, a method of detection such as use of an intercalating
dye can be used. Examples of primers for mecA can include SEQ ID NOs: 12 and 13.
[0043] By amplifying a portion of mecA DNA is meant performing an amplification
reaction on a sample that produces an amplification product that includes sequences
corresponding to any identifying portion of a mecA gene, for example, the region between
primers comprising a nucleic acid sequence set forth in SEQ ID NO: 12 and 13. Amplification
can be detected using a probe that hybridizes between the target nucleic acids of the primers or
using an intercalating dye. Primers and probes can be readily designed for hybridization to the
known mecA sequence.
[0044] S. aureus chromosome. The present method can further comprise utilizing a
fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal
DNA comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions, a portion of the S. aureus -specific DNA is
amplified. The fourth oligonucleotide set can further comprise a third S. aureus oligonucleotide
having a nucleic acid sequence capable of specifically hybridizing within a region of the S.
aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the
hybridizing region of the second S. aureus oligonucleotide, wherein if the sample contains the
region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide
and the hybridizing region of the second S. aureus oligonucleotide, hybridization of the third
oligonucleotide is detected. Such third S. aureus oligonucleotide can function as a probe. The
Staphylococcus aureus -specific chromosomal DNA can be any known S.aureus- specific
genomic region, such as within the genes spa, orfX or nuc. Examples of primers for spa can
include SEQ ID NOs: 24 and 25, and probe, SEQ ID NO: 26. Examples of primers for orfX can
include SEQ ID NOs: 9 and 10, and probe, SEQ ID NO: 11. Examples of primers for nuc can
include SEQ ID NOs: 27, 28 and 30, and probe, SEQ ID NO: 29. Alternatively, a method of
detection such as use of an intercalating dye can be performed.
[0045] The present invention comprises a method of amplifying in a sample a
methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec
cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises mecA or a mecA variant element, the method comprising performing on the sample
an amplification reaction utilizing
a. a first oligonucleotide set comprising:
1} a first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of a mecA variant element, and
2} a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of a mecA variant element; and
b. a second oligonucleotide set comprising:
1} a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2} a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA, wherein each of the first oligonucleotide and the
second oligonucleotide is oriented such that, under amplification conditions, if the sample
contains the MRSA, the region of the MRSA between the hybridizing region of the first
oligonucleotide and the hybridizing region of the second oligonucleotide is amplified. The first
oligonucleotide set can further comprise a third mecA variant oligonucleotide capable of
specifically hybridizing within a region of the MRSA between the hybridizing region of the first
mecA variant oligonucleotide and the hybridizing region of the second mecA variant
oligonucleotide, and wherein if the sample contains the MRSA comprising a mecA variant
element, hybridization of the third mecA variant oligonucleotide is detected. The second
oligonucleotide set can further comprise a third mecA oligonucleotide capable of specifically
hybridizing within a region of the MRSA between the hybridizing region of the first mecA
oligonucleotide and the hybridizing region of the second mecA oligonucleotide, and wherein if
the sample contains the MRSA comprising mecA, hybridization of the third mecA
oligonucleotide is detected. Such third oligonucleotide can be a probe. Alternatively, a method
of detection such as use of an intercalating dye can be performed. By way of example, the first
mecA variant oligonucleotide can comprise a nucleic acid sequence selected from the group
consisting of: SEQ ID NOs: 6, 7, 14, 15 and 20. The second mecA variant oligonucleotide can
comprise a nucleic acid sequence selected from the group consisting of: SEQ ID Nos: 16, 17 and
1. The third mecA variant oligonucleotide can comprise a nucleic acid sequence selected from
the group consisting of: SEQ ID Nos: 8, 18 and 19. In such a method, the mecA variant can be
or it can be another mecA variant.
[0046] Junction. The method of amplifying in a sample a methicillin-resistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a
mecA variant element, can further comprise amplification of additional MRSA and/or S. aureus
elements. For example, the method can comprise amplifying a methicillin-resistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by
utilizing in an amplification reaction a second oligonucleotide set for amplification of a right
extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the
second oligonucleotide set comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette of the
MRSA comprising a mecA,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions, if the sample contains the MRSA
comprising a mecA, the right junction is amplified. The third oligonucleotide set can further
comprise a third junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of the MRSA between the hybridizing region of the first junction
oligonucleotide and the hybridizing region of the second junction oligonucleotide, wherein if
the sample contains the MRSA comprising the right extremity junction, hybridization of the
third junction oligonucleotide is detected. The third junction oligonucleotide can have a nucleic
acid sequence capable of specifically hybridizing within a region of a right extremity junction
region of the SCCmec cassette. The first junction oligonucleotide can have a nucleic acid
sequence capable of specifically hybridizing within orfX. The third junction oligonucleotide can
have a nucleic acid sequence capable of specifically hybridizing within orfX. Alternatively, a
method of detection such as use of an intercalating dye can be performed.
[0047] S. aureus. The method of amplifying in a sample a methicillin-resistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA or a
mecA variant element, can further comprise utilizing a fourth oligonucleotide set for
amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions, a portion of the S. aureus -specific DNA is
amplified. The fourth oligonucleotide set can further comprise a third S. aureus oligonucleotide
having a nucleic acid sequence capable of specifically hybridizing within a region of the S.
aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the
hybridizing region of the second S. aureus oligonucleotide,
wherein if the sample contains the region of the S. aureus DNA between the hybridizing region
of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus
oligonucleotide, hybridization of the third oligonucleotide is detected. Such third S. aureus
oligonucleotide can function as a probe. Alternatively, a method of detection such as use of an
intercalating dye can be performed. The Staphylococcus aureus -specific chromosomal DNA
can be selected from, for example, spa, orfX and nuc; however, other S. aureus-specific
chromosomal DNA targets, as may be known to those of skill in the art, may be used.
[0048] It is to be recognized that, in addition to the amplification reaction detecting the
presence of mecA variant, the invention includes that one can additionally amplify one or more
additional relevant sequences, such as the SCCmec junction for SCCmec types other than those
bearing mecA variant, mecA (non-variant], and an S. aureus- specific chromosomal sequence.
One can combine any or all of these additional amplification reactions, in a multiplex reaction
or in individual reactions.
[0049] A multiplex amplification reaction means that the specific reagents for
amplification of more than one target are contacted together, such that more than one
amplification can occur within the same reaction container. Additionally, detection reagents
for more than one target can be included. Thus one can conduct a multiplex amplification and
detection reaction by placing into contact all of the specific reagents for amplification and
detection of more than one target. Thus, in a multiplex reaction, one can amplify multiple target
regions in the same reaction. Multiple amplification reactions can also be run sequentially.
Simultaneous amplification can also be utilized, if a multiplex is not desired or feasible, wherein
individual reactions are allowed to proceed at the same time, but the reagents for more than
one amplification reaction are not necessarily all within the same reaction container or tube,
but rather are carried out in separate reaction containers. It is understood that, even in a
multiplex amplification reaction, each reaction will occur at whatever pace the individual
reactions proceed under the provided conditions. Detection can also be "simultaneous,"
meaning that, if appropriate probes for each reaction in the reaction container are included,
under the appropriate conditions, detection of more than one target can be achieved in either a
single reaction container (multiplex] or in more than one reaction container (appropriate
probes distributed to the relevant reaction container]. Such detection can be performed, if
desired, in the same reaction container as the multiplex or simultaneous amplification reaction,
and, further, can be performed while amplification reactions continue [i.e., real-time]. In the
single container can be included all components of a reaction mixture, tailored to the specific
amplification and detection method utilized. Thus, a "reaction mixture" can include all the
necessary reagents for performing a reaction, which may include, but not be limited to,
buffering agents to maintain pH at a selected level during a reaction, salts, co-factors,
scavengers, and the like.
[0050] As used in the claims, "amplification conditions" are those appropriate
for a selected amplification reaction, as are known to those of skill in the art, such as are
utilized in various amplification reactions. Such conditions can be optimized for a specific
reaction, primers, etc. as also known by the skilled artisan. As is known, such amplification
conditions include contact with the required reagents for the amplification, e.g., nucleotides
and enzymes, as well as the appropriate selected temperature, salt and pH conditions, among
other aspects. Furthermore, as used in the claims, a primer or probe may be a primer or probe
set, i.e., multiple primers or probes. Such primer/probe sets can be utilized in a reaction in
which more than one type or subtype of MRSA is desired t o be amplified and/or detected, and
wherein the nucleic acid sequence of the target MRSA region selected for hybridization of the
primer and/or probe varies among types and/or subtypes. Individual primers/probes can be
designed for each type or subtype, as exemplified herein.
[0051] As used herein, an oligonucleotide "having" a nucleic acid sequence included in a
portion of target DNA means the sequence has sufficient identity to the target DNA sequence,
or its complement, to specifically and selectively hybridize to that target DNA under stringent
hybridization conditions. It includes nucleic acid sequences having full sequence identity to the
sequence.
[0052] Generally, amplification reactions producing amplicons (the product of a
polynucleotide amplification reaction] are "template-driven" in that base pairing of reagents,
either nucleotides or oligonucleotides, have complements in a template polynucleotide that are
required for the creation of reaction products. In one aspect, template-driven reactions are
primer extensions with a nucleic acid polymerase or oligonucleotide ligations with a nucleic
acid ligase. Amplification can include any known or newly designed method of amplification,
including those used in published methods (e.g., transcription-based amplification such as
transcription-mediated amplification (TMA] and nucleic acid sequence-based amplification
NASBA (as exemplified herein], and cycling nucleic acid amplification technologies
(thermocycling] such as polymerase chain reaction (PCR], reverse transcriptase PCR (RT-PCR],
and ligase chain reaction (LCR], and any method of amplification, e.g., sustained sequence
replication (3SR], strand displacement amplification (SDA], branched DNA (bDNA], cycling
probe technology (CPT], solid phase amplification (SPA], rolling circle amplification technology
(RCA], solid phase RCA, anchored SDA and nuclease dependent signal amplification (NDSA], all
of which are known to the skilled artisan. An amplification reaction may be a "real-time"
amplification if a detection chemistry is available that permits a reaction product to be
measured as the amplification reaction progresses, e.g. real-time PCR or real-time NASBA.
Thus this invention includes the use of any nucleic acid amplification method or any other
procedure which may be used to increase the sensitivity and/or the rapidity of nucleic acidbased
diagnostic tests. The present invention also includes the use of any detection technology
including post-amplification detection technologies, any amplification technology combined
with detection, any hybridization nucleic acid chips or array technologies, and any
amplification chips or combination of amplification and hybridization chip technologies.
Detection and identification by any nucleotide sequencing method is also within the present
invention.
[0053] A variety of detection methods can be utilized in this invention.
Detection methods utilizing nucleic acid probes are well known in the art. Probes of the
present kits and/or for use in the present methods can be labeled by any selected label suitable
for the detection method chosen, many of which are known in the art, such as a phosphatase
[e.g., alkaline phosphatase], biotin, avidin, a peroxidase [e.g., horseradish peroxidase],
digoxigenin, a fluorescent dye (such as Cy3 and Cy5 dyes, fluorescein, FAM, ROX], a
chemiluminescent label, a chromophoric label, a radioactive label [e.g., a radioisotope] and a
ligand. Probe designs for different detection methods can be used, such as target-capture, HPA,
TaqMan, molecular beacons, scorpions and sandwich hybridization. Hybridization conditions
can be selected in accordance with the type of probe and the type of detection reaction
selected. Additionally, intercalating dyes can be utilized. An intercalating dye is one that binds
specifically to double-stranded DNA fluoresce brightly upon such binding; in the absence of
double stranded DNA, with nothing to bind to they only fluoresce at a low level. Detection is
monitored by measuring the increase in fluorescence throughout the amplification cycle. An
intercalating dye can, if desired, be used with melt analysis, as is known in the art. Examples of
intercalating dyes can include, but are not limited to, ethidium bromide, SYBR® Green, LC
Green, LC Green Plus, ResoLight, EvaGreen, Chromofy and SYTO 9. Others will be known to
those of skill in the art and new such dyes may become available.
[0054] The present method further provides useful kits for use in such amplification
and detection methods. Specifically, the present invention provides a kit for amplifying a
methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec
cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises a mecA variant element, the kit comprising a first oligonucleotide set comprising:
a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant. Such kit can further comprise a third oligonucleotide capable of
specifically hybridizing within a region of the MRSA between the hybridizing region of the first
oligonucleotide and the hybridizing region of the second oligonucleotide. Such third
oligonucotide can be a probe. In a preferred embodiment, the first oligonucleotide comprises a
nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10. Also in a
preferred embodiment, the second oligonucleotide comprises a nucleic acid sequence selected
from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21. Further, in another
preferred embodiment, the third oligonucleotide comprises a nucleic acid sequence set forth as
SEQ ID NO: 8. : 8, 18 and 19. The mecA variant for which this kit is useful to detect can be
e cA GA i or another mecA variant.
[0055] A kit of the present invention, for amplifying a methicillin-resistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA
variant element, can further comprise one or more additional elements, including
oligonucleotide sets for detection of additional MRSA and MSSA elements. Though sometimes
described herein as "second," "third" or "fourth" oligonucleotide sets, choice of an additional
nucleotide set is independent of the other options. For example, the kit can include
oligonucleotide sets for amplification of one or more of the SCCmec junction for SCCmec types
other than those bearing mecA variant, mecA (non-variant], and a S. aureus chromosomal
sequence. In one example, a kit can comprise a second oligonucleotide set comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette. In
another example, the kit can comprise a third oligonucleotide set for amplification of a mecA
element comprising:
a. a first mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing
within a region of mecA DNA; and
b. a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within mecA DNA. Another example provides that the kit
can comprise a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific
chromosomal DNA comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus-specific chromosomal DNA.
[0056] Another kit of the present invention provides a kit for amplifying in a sample a
methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec
cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises mecA or a mecA variant element, wherein the SCCmec cassette comprises mecA or a
mecA variant element.
a] a first oligonucleotide set comprising:
1} a first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of a mecA variant element, and
2} a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of a mecA variant element; and
b a second oligonucleotide set comprising:
1} a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2} a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA. The kit can further comprise in the first
oligonucleotide set a third mecA variant oligonucleotide capable of specifically hybridizing
within a region of the MRSA between the hybridizing region of the first oligonucleotide and the
hybridizing region of the second oligonucleotide. It can comprise in the second oligonucleotide
set a third mecA oligonucleotide capable of specifically hybridizing within a region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide. In a specific example, the first mecA variant oligonucleotide can
comprise a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
In another example, the second mecA variant oligonucleotide comprises a nucleic acid
sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21. In
another embodiment, in the first oligonucleotide set, the third mecA variant oligonucleotide
comprises a nucleic acid sequence set forth as SEQ ID NO: 8. : 8, 18 and 19. In any such kit, the
mecA variant can preferably be m ecA however, it can be another mecA variant.
[0057] A kit of this invention can further comprise a third oligonucleotide set
comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and b. a second junction oligonucleotide having a nucleic acid sequence
capable of specifically hybridizing within a region of a right extremity junction region of the
SCCmec cassette comprising mecA, wherein each of the first junction oligonucleotide and the
second junction oligonucleotide is oriented such that, under amplification conditions in the
presence of the MRSA wherein the SCCmec cassette comprises mecA, an SCCmec cassette right
insertion junction is amplified. The third oligonucleotide set can further comprise a third
junction oligonucleotide having a nucleic acid sequence capable of specifically hybridizing
within a region of the MRSA between the hybridizing region of the first junction
oligonucleotide and the hybridizing region of the second junction oligonucleotide.
[0058] A kit of this invention can further comprise a fourth oligonucleotide set
comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions in the presence of an MRSA, a portion of S.
aureus -specific DNA is amplified. The fourth oligonucleotide set can further comprise a third
S. aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing
within a region of the S. aureus DNA between the hybridizing region of the first S. aureus
oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide
[0059] Probes of this invention, including those included in such kits, can
advantageously be labeled for detection, as known by persons of skill in the art. Labels can
appropriately be selected for the specific design and type of amplification reaction to be
performed. Primer and probe reagents can be provided in any of several states, including
dried, lyophilized, pelleted, spray-dried, or in liquid.
[0060] Kits of this invention can include additional elements, such as reagents for a
selected amplification method (e.g., amplification enzymefs], bufferfs], and/or restriction
enzymefs], among others], controls], reaction containers], and the like. If an intercalating dye
is to be used, such can be included in the kit. Additionally, a kit of the present invention can
comprise a container comprising a kit as described herein. Elements can be provided in a
single container or in more than one container. Such kits can be useful for performing multiplex
amplifications.
[0061] It is noted that references to primer and probe sequences that include thymidine
can be readily adapted to utilize uridine in substitution for thymidine, where useful for the
particular assay. Furthermore, nucleotides may be modified by addition of chemical groups, or
substitution of individual residues by analogues (e.g., 2'-0-methoxy versions}. Additional such
modified nucleotides are known in the art; some examples include hydroxymethyl nucleotides,
methylated nucleotides, fluorinated nucleotides, alpha thio phosphate nucleotides, aminemodified
nucleotides, methoxy nucleotides, carboxymethyl nucleotides, thio nucleotides,
inosine, dihydrouridine, pseudouridine, wybutosine, queuosine, C7dGTP. Additional modified
nucleotides are found in U.S. Pat. Nos 5,405,950 and 5,633,364 (both, Mock and Lovern}.
Furthermore, a probe can comprise DNA, RNA, modified DNA or RNA, PNA, other synthetic
nucleic acids or nucleic acid substitutes that use nucleotide bases as means of selectively
hybridizing to a target.
[0062] The present method can be utilized on any selected sample, such as a
direct patient sample, e.g., nasal or inguinal swab, perineum swab, axilla swab, throat swab,
rectal swab, samples from wounds, all particularly suitable for screening, as well as particularly
suitable for diagnosis, bronchoalveolar lavage or blood (e.g., septicemia or blood culture}. Such
samples typically contain a mixed population of organisms. Additionally, if desired, this
method can be applied to a sample having only a single bacterial species or strain, e.g., samples
utilizing isolation, culture, capture, and/or enrichment of MRSA.
[0063] Additional aspects of the inventions are described herein below.
[0064] The invention also relates to a method of amplifying in a sample a methicillinresistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette
within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a
mecA variant element, the method comprising:
performing on the sample an amplification reaction utilizing an oligonucleotide set comprising:
a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant,
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified.
[0065] Optionally, the extremity junction region of chromosomal S. aureus DNA is a
right extremity junction region.
[0066] Optionally, the oligonucleotide set further comprises a third oligonucleotide
capable of specifically hybridizing within a region of the MRSA between the hybridizing region
of the first oligonucleotide and the hybridizing region of the second oligonucleotide, and
wherein if the sample contains the MRSA, hybridization of the third oligonucleotide is
detected.
[0067] Optionally, the method according to the invention further comprises contacting
the amplified sample with an intercalating dye, wherein if the sample contains the MRSA,
intercalation of the dye into an amplification product is detected.
[0068] Optionally, the third oligonucleotide specifically hybridizes to a region of
chromosomal Staphylococcus aureus DNA.
[0069] Optionally, the third oligonucleotide specifically hybridizes to a region of orfX of
chromosomal Staphylococcus aureus DNA.
[0070] Optionally, the third oligonucleotide specifically hybridizes to a region of a right
extremity junction region of SCCmec cassette DNA
[0071] Optionally, the third oligonucleotide specifically hybridizes to a region of the
mecA variant.
[0072] Optionally, the first oligonucleotide specifically hybridizes to a region of orfX of
chromosomal Staphylococcus aureus DNA.
[0073] Optionally, the mecA variant is mecAiGA25i-
[0074] Optionally, the first oligonucleotide comprises a nucleic acid sequence selected
from the group consisting of: SEQ ID NOs: 9 and 10.
[0075] Optionally, the second oligonucleotide comprises a nucleic acid sequence
selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15 16, 17, 20 and 21.
[0076] Optionally, the third oligonucleotide comprises a nucleic acid sequence set forth
as SEQ ID NO: 8, 11, 18 and 19.
[0077] Optionally, the method according to the invention, further comprises amplifying
a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an
SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises a mecA, by utilizing in an amplification reaction a second oligonucleotide set for
amplification of a right extremity junction of SCCmec cassette with Staphylococcus aureus
chromosomal DNA, the second oligonucleotide set comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette of the
MRSA comprising a mecA,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions, if the sample contains the MRSA comprising
a mecA, the right junction is amplified.
[0078] Optionally, the second oligonucleotide set further comprises a third junction
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the MRSA between the hybridizing region of the first junction oligonucleotide and the
hybridizing region of the second junction oligonucleotide,
wherein if the sample contains the MRSA comprising the right extremity junction,
hybridization of the third junction oligonucleotide is detected.
[0079] Optionally, the third junction oligonucleotide has a nucleic acid sequence
capable of specifically hybridizing within a region of a right extremity junction region of the
SCCmec cassette.
[0080] Optionally, the third junction oligonucleotide has a nucleic acid sequence
capable of specifically hybridizing within orfX.
[0081] Optionally, the first oligonucleotide has a nucleic acid sequence capable of
specifically hybridizing within orfX.
[0082] Optionally, the method according to the invention further comprises amplifying
a Staphylococcus aureus comprising mecA by utilizing in an amplification reaction a third
oligonucleotide set for amplification of a mecA element comprising:
a. a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of mecA DNA; and
b. a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within mecA DNA,
wherein each of the first mecA oligonucleotide and the second mecA oligonucleotide is oriented
such that, under amplification conditions, a portion of the mecA DNA is amplified.
[0083] Optionally, the third oligonucleotide set further comprises a third mecA
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the mecA between the hybridizing region of the first mecA oligonucleotide and the
hybridizing region of the second mecA oligonucleotide
wherein if the sample contains the MRSA comprising mecA, hybridization of the third mecA
oligonucleotide is detected.
[0084] Optionally, the method according to the invention further comprises utilizing a
fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal
DNA comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions, a portion of the S. aureus -specific DNA is
amplified.
[0085] Optionally, the fourth oligonucleotide set further comprises a third S. aureus
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide
and the hybridizing region of the second S. aureus oligonucleotide,
wherein if the sample contains the region of the S. aureus DNA between the hybridizing region
of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus
oligonucleotide, hybridization of the third oligonucleotide is detected.
[0086] Optionally, the Staphylococcus aureus -specific chromosomal DNA is selected
from the group consisting of spa, orf and nuc.
[0087] The invention also relates to a method of amplifying in a sample a methicillinresistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette
within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA
or a mecA variant element, the method comprising:
performing on the sample an amplification reaction utilizing
a. a first oligonucleotide set comprising:
1} a first mecA variant oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing to a first region of a mecA variant element, and
2} a second mecA variant oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing to a second region of a mecA variant element; and
b. a second oligonucleotide set comprising:
1} a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2} a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified.
[0088] Optionally, the first oligonucleotide set further comprises a third mecA variant
oligonucleotide capable of specifically hybridizing within a region of the MRSA between the
hybridizing region of the first mecA variant oligonucleotide and the hybridizing region of the
second mecA variant oligonucleotide, and
wherein if the sample contains the MRSA comprising a mecA variant element, hybridization
of the third mecA variant oligonucleotide is detected.
[0089] Optionally, the second oligonucleotide set further comprises a third mecA
oligonucleotide capable of specifically hybridizing within a region of the MRSA between the
hybridizing region of the first mecA oligonucleotide and the hybridizing region of the second
mecA oligonucleotide, and
wherein if the sample contains the MRSA comprising mecA, hybridization of the third mecA
oligonucleotide is detected.
[0090] Optionally, the method according to the invention further comprises contacting
the amplified sample with an intercalating dye, wherein if the sample contains the MRSA,
intercalation of the dye into an amplification product is detected.
[0091] Optionally, the first mecA variant oligonucleotide comprises a nucleic acid
sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15 and 20.
[0092] Optionally, the second mecA variant oligonucleotide comprises a nucleic acid
sequence selected from the group consisting of: SEQ ID Nos: 16, 17 and 21.
[0093] Optionally, the third mecA variant oligonucleotide comprises a nucleic acid
sequence selected from the group consisting of: SEQ ID Nos: 8, 18 and 19.
[0094] Optionally, the mecA variant is mecA .
[0095] Optionally, the method according to the invention further comprises amplifying
a methicillin-resistant Staphylococcus aureus (MRSA] which comprises an insertion of an
SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette
comprises a mecA, by utilizing in an amplification reaction a second oligonucleotide set for
amplification of a right extremity junction of SCCmec cassette with Staphylococcus aureus
chromosomal DNA, the second oligonucleotide set comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette of the
MRSA comprising a mecA,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions, if the sample contains the MRSA comprising
a mecA, the right junction is amplified.
[0096] Optionally, the third oligonucleotide set further comprises a third junction
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the MRSA between the hybridizing region of the first junction oligonucleotide and the
hybridizing region of the second junction oligonucleotide,
wherein if the sample contains the MRSA comprising the right extremity junction,
hybridization of the third junction oligonucleotide is detected.
[0097] Optionally, the third junction oligonucleotide has a nucleic acid sequence
capable of specifically hybridizing within a region of a right extremity junction region of the
SCCmec cassette.
[0098] Optionally, the first junction oligonucleotide has a nucleic acid sequence capable
of specifically hybridizing within orfX.
[0099] Optionally, the third junction oligonucleotide has a nucleic acid sequence
capable of specifically hybridizing within orfX.
[00100] Optionally, the method according to the invention further comprises
utilizing a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific
chromosomal DNA comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions, a portion of the S. aureus -specific DNA is
amplified.
[00101] Optionally, the fourth oligonucleotide set further comprises a third S.
aureus oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within
a region of the S. aureus DNA between the hybridizing region of the first S. aureus
oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide,
wherein if the sample contains the region of the S. aureus DNA between the hybridizing region
of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus
oligonucleotide, hybridization of the third oligonucleotide is detected.
[00102] Optionally, the Staphylococcus aureus -specific chromosomal DNA is selected
from the group consisting of spa, orfX and nuc.
[00103] Another object of the invention is a kit for amplifying a methicillin-resistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA
variant element, the kit comprising a first oligonucleotide set comprising:
a. a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant.
[00104] Optionally, the kit according to the invention further comprises a third
oligonucleotide capable of specifically hybridizing within a region of the MRSA between the
hybridizing region of the first oligonucleotide and the hybridizing region of the second
oligonucleotide.
[00105] Optionally, the first oligonucleotide comprises a nucleic acid sequence selected
from the group consisting of: SEQ ID NOs: 9 and 10.
[00106] Optionally, the second oligonucleotide comprises a nucleic acid sequence
selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21.
[00107] Optionally, the third oligonucleotide comprises a nucleic acid sequence set forth
as SEQ ID NO: 8, 18 and 19.
[00108] Optionally, the mecA variant is mecAiGA25i-
[00109] Optionally, the kit according to the invention further comprises a second
oligonucleotide set comprising:
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette.
[00110] Optionally, the kit according to the invention further comprises a third
oligonucleotide set for amplification of a mecA element comprising:
a.a first mecA oligonucleotide having a nucleic acid sequence capable of specifically hybridizing
within a region of mecA DNA; and
b. a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within mecA DNA.
[00111] Optionally, the kit according to the invention further comprises a fourth
oligonucleotide set for amplification of a Staphylococcus aureus- specific chromosomal DNA
comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA.
[00112] Another object of the invention is a kit for amplifying in a sample a methicillinresistant
Staphylococcus aureus (MRSA] which comprises an insertion of an SCCmec cassette
within Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises mecA
or a mecA variant element, the kit comprising:
a] a first oligonucleotide set comprising:
1} a first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of a mecA variant element, and
2} a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of a mecA variant element; and
b a second oligonucleotide set comprising:
1} a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2} a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA,
each set oriented such that, when a sample is placed under amplification conditions with the
oligonucleotide set, if the sample contains the MRSA, amplification can occur.
[00113] Optionally, the kit according to the invention further comprises in the first
oligonucleotide set a third mecA variant oligonucleotide capable of specifically hybridizing
within a region of the MRSA between the hybridizing region of the first oligonucleotide and the
hybridizing region of the second oligonucleotide.
[00114] Optionally, the kit according to the invention further comprises in the second
oligonucleotide set a third mecA oligonucleotide capable of specifically hybridizing within a
region of the MRSA between the hybridizing region of the first oligonucleotide and the
hybridizing region of the second oligonucleotide.
[00115] Optionally, the first mecA variant oligonucleotide comprises a nucleic acid
sequence selected from the group consisting of: SEQ ID NOs: 9 and 10.
[00116] Optionally, the second mecA variant oligonucleotide comprises a nucleic acid
sequence selected from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21.
[00117] Optionally, the third mecA variant oligonucleotide comprises a nucleic acid
sequence set forth as SEQ ID NO: 8, 18 and 19.
[00118] Optionally, the mecA variant is
[00119] Optionally, the kit according to the invention further comprises a third
oligonucleotide set comprising
a. a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette
comprising mecA,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions in the presence of the MRSA wherein the
SCCmec cassette comprises mecA, an SCCcassette right insertion junction is amplified.
[00120] Optionally, the third oligonucleotide set further comprises a third junction
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the MRSA between the hybridizing region of the first junction oligonucleotide and the
hybridizing region of the second junction oligonucleotide.
[00121] Optionally, the kit according to the invention further comprises a fourth
oligonucleotide set comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions in the presence of an MRSA, a portion of S.
aureus -specific DNA is amplified.
[00122] Optionally, the fourth oligonucleotide set further comprises a third S. aureus
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide
and the hybridizing region of the second S. aureus oligonucleotide.
[00123] The present invention is exemplified in the following examples. As
taught throughout the specification, detection of mecA variant can be combined in any desired
combination, in multiplex or multiple simplex form, with another desired assay, such as
primers and/or probe s for mecA, genomic S. aureus and / or SCCmec junction.
EXAMPLES
AMPLIFICATION CONDITIONS
[00124] Amplifications using PCR can be performed under standard conditions.
Such conditions can include:
MIX preparation (reaction performed in
Am lification c cle on Biorad CFX96
OLIGONUCLEOTIDE DESIGN
[00125] Oligonucleotides dedicated to amplification or detection and belonging to
genomic regions described herein can be utilized whatever the method used for their design.
Among these methods which can be used are, for example (without being limited], design by
hand (human expertise in oligonucleotide design] or design using computer means (scripts,
programs, software] (e.g., http://www.ncbi.nlm.nih.gov/pubmed/1476746 Eberhardt NL, A
shell program for the design of PCR primers using genetics computer group (GCG] software
(7.1] on VAX/VMS systems, Biotechniques. 1992 Dec;13(6):914-7);
http://www.ncbi.nlm.nih.gov/pubmed/8887007 Mitsuhashi M., Technical report: Part 1. Basic
requirements for designing optimal oligonucleotide probe sequences. J Clin Lab Anal.
1996;10(5]:277-84].
EXAMPLE 1 : Design of mecA variant Primers and Probes
[00126] Experiments were designed to develop a PCR amplifying the
Staphylococcus aureus orfX-mecA variant region. Initially, to design primer(s] on the orfX side of
the SCCmec junction, two primers and one probe were designed in the orfX region. A mecA
variant -specific set of oligos (for mecAiGA25i, also described in literature as mecAMio/ooei, mecA
homologue, and mecA ew variant] were also designed. As the mecA variant orientation was initially
unknown, we designed mecA variant divergent primers in order to obtain a mecA variant -orfX
amplicon. Further candidates on both ends of mecA variant gene have been designed to
develop specific PCR of Staphylococcus aureus. The PCR assay selected for mecA variant
amplification across the SCCmec junction should generate an amplicon about 1300 nt long. The
PCR assay selected for detection of the mecA variant element itself may vary from this
amplicon size; for example, it may produce a shorter amplicon.
[00127] A mecA variant reference sequence was found on NCBI with the following
accession number: FR823292 and utilized for initial primer design. A first step was to design
mecA variant -specific oligos. As the mecA variant orientation was initially unknown, mecA
variant divergent primers (both at 5' and 3' ends of the mecA variant gene] were designed in
order to obtain a mecA variant -orf amplicon.
Design on 5' end of mecA variant gene
Standard PCR conditions, as described above, were utilized, unless noted differently.
Primer Design
[00128] Many primers were designed (data not shown}; two were selected based
on thermodynamic characteristics:
Table 1 : 5'_forward rimers characteristics
Probe Design
[00129] Many probes for the 5' end of mecA variant were designed (data not
shown], and three were selected based on thermodynamic characteristics:
Table 2 : 5' ro es characteristics
mecAv-orfX-3 mecAv-orfX-4 mecAv-orfX-5
(SEQ ID NO:3) (SEQ ID NO:4) (SEQ ID NO:5)
FR823292, 5' end 3657 3655 3653
position
Sequence (5'->3') ATAACTTGGTTATT ACTTGGTTATTCAA TGGTTATTCAAAGA
CAAAGATGACGATA AGATGACGATATTG TGACGATATTGAGA
TT A
Oligo length 30 nt 29 nt 28 nt
T (Apollo PCR 69 °C 68°C 67°C
default)
% GC 26% 31% 32%
Hairpin formation NO- NO- NOrisk
assessment Intra-molecular Intra-molecular Intra-molecular
(intramolecular structure stable structure stable structure stable
Folding workflow)
Primer Dimer risk NO Primer-dimer NO Primer-dimer NO Primer-dimer
assessment risk predicted risk predicted risk predicted
(Hybridization
workflow)
Design on 3' end of mecA variant gene
Primer Design
[00130] Many forward primers for 3'end of mecA variant gene were designed
(data not shown), and two of them were selected based on thermodynamic characteristics:
Table 3 :mecA variant 3 ''forward rimers characteristics
Probe Design
[00131] Many probes for 3'end of mecA variant gene were designed [see Table 4;
additional data not shown], and one was selected based on thermodynamic characteristics:
Table 4 :mecA variant 3' robe characteristics
Oligos compatibility
[00132] Input parameters: Temperature: 63°C; [Na+]: 0.05 M; [Mg2+]: 0.005 M;
Strand concentration: 0.00001 M
Table 5 : mecA variant oligonucleotide compatibility; Free Energy Unit is
[00133] All the above oligonucleotides were found to be compatible together and
also compatible with oligonucleotides designed and selected in the orp( (see below}. These
experiments provided the orientation of mecA variant gene and conclude that oligos designed
in 3'-end of mecA variant be used for a mecA variant-orfX amplification reaction.
EXAMPLE 2 :mecA variant-orfX amplification reaction
Standard PCR conditions, as described above, were utilized, unless noted differently.
EXAMPLE 2a: Selection of primers
[00134] Tests were performed on one mecA variant (+} strain (Internal collection
strain number 1156001} at lOng/ mI, and one mecA{+) strains (ATCC 43300 strain} at lOng/ mI.
Primers tested were:
orfX MRSA primers:
mecAv-orfX-9 (SEQ ID NO: 9}: 10mM
mecAv-orfX-10 (SEQ ID NO:10 }: 10mM
mecA variant 3'-end primers:
mecAv-orfX-6 (SEQ ID NO: 6}: 10mM
mecAv-orfX-7 (SEQ ID NO: 7}: 10mM
[00135] Conditions for all PCR reactions for primer selection were as follows:
PCR format: 45m1MIX + 5m1target
PCR conditions: 4 conditions have been tested (see below}
Expand High Fidelity PCR system (Roche, ref 11732650001, Lot Number 11398326}
GeneAmp PCR system 9700
Table 6 :PCR 4 tested conditions:
Table 6a:
Condition 1/thermo
n°20555
Temperature Time Cycle
95°C 2 min 1 cycle
95°C 30s
55°C 20s 30 cycles
72°C 30s
72°C 7 min 1 cycle
4°C infinite 1 cycle
Table 6b:
Condition 2/thermo
n°20556
Temperature Time Cycle
94°C 2 min 1 cycle
94°C 15s
55°C 30s 30 cycles
72°C 45s
72°C 7 min 1 cycle
4°C infinite 1 cycle
Table 6c:
Condition 3/thermo
n°20557
Temperature Time Cycle
95°C 5 min 1 cycle
95°C 30s
55°C 45s 3 cycles
72°C 1 min
72°C 7 min 1 cycle
4°C infinite 1 cycle
Table 6d:
Condition 4/thermo
n°20596
TemperatureTime Cycle
95°C 5 min 1 cycle
95°C 1 min
55°C 1'30 3 cycles
72°C 2 min
72°C 7 min 1 cycle
4°C infinite 1 cycle
[00136] The following primers that selectively hybridize in mecA variant
were tested in the listed specific conditions:
MIX 1 : positive control for mecA variant
MIX 2 : test oligo mecAv-orfX-6 (SEQ ID NO: 6 } in mecA variant (amplicon 1498 nt
long]
MIX 3 : test oligo mecAv-orfX-7 (SEQ ID NO: 7} in mecA variant (amplicon 1484 nt
long]
Table 7a: Positive Control
MIX 1 : Positive Control
Table 7c: orfX- mecA variant Assay
Results/Conclusions of Assay:
Table 8 Results of orfX- mecA variant Assay:
[00137] All conditions are found to be working: positive results were obtained for
mecA variant and negative results were obtained for mecA. Both mecA variant primers were
effective in amplifying the mecA variant-orfii amplicon and therefore for use in an assay to
detect mecA variant- bearing MRSA strains. Details of an orfX-mecA variant PCR using orfX
primer mecAv-orfX-9, mecA variant primer mecAv-orfX-7 and orfX primer mecAv-orfX-10 that
was prepared and conducted is provided below. Successful amplification of the mecA variant
was achieved.
Table 9 : Orpi-mecA variant PCR:
MIX: PCR orfX-mecA variant
4 in inite cyc e
EXAMPLE 2b: Amplification with probe in orfX and probe in the mecA variant gene
[00138] Next, probe was added and the PCR was tested on Bio-Rad instrument
(real time PCR system}. Tests were done with TaqMan probe either in the orfX (mecAv-orfX-11
(SEQ ID NO: 11}} or in the mecA variant gene mecA GA25i 3' end} (mecAv-orfX-8 (SEQ ID NO:
8}} (see below}. The fluorophore used for both Taqman probes is FAM. DNA from five samples
(lOng/ mI}was tested.
[00139] Amplifications were performed under the following conditions:
PCR format: 45m1MIX + 5m1target
PCR conditions: 2 probes were tested at 2 concentrations (0,3 mM and 0,6 mM}
Expand High Fidelity PCR system (Roche, ref 11732650001, lot number 11398326}
The following combinations of primers and probes (all, 10mM} were utilized.
MIX 1 : mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-11 at 0.6 mM
MIX 2 : mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-11 at 0.3 mM
MIX 3 : mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-8 at 0.6 mM
MIX 4 : mecAv-orfX-9/ mecAv-orfX-10/ mecAv-orfX-7/ mecAv-orfX-8 at 0.3 mM
Results were as follows
[00140] The results indicate that ideal probe concentration, under these
conditions, can be around 0.3 mM. Results with probe in orfX or in mecA variant gene both gave
good results. In general, under these conditions, the test seems to be more specific with probe
in mecA variant gene; however, one can adjust the parameters, such as conducting the
annealing step at 55°C, to optimize the assay. Further optimization can also be done, for
example, one can increase the number of cycles, add a FAM read after the last step at 72°C,
and/or increase the annealing temperature. This experiment shows that on MRSA strains, a
specific real time PCR is feasible between the orfX and mecA variant gene despite very long
amplicons generated (around 1484 bp .
EXAMPLE 3 : Amplification of SCC ec: r unction Region of non-typeXI and of mecA
[00141] An assay can be performed in combination with an assay for SCCmec
typeXI to additionally detect the presence or absence of non-typeXI SCCmec-carrying MRSA
strains (those that harbor mecA). An assay can also be performed in combination with an assay
for other sequences, such as S. aureus genomic region(s] and/or mecA to additionally
characterize the organism(s) present in a sample. These assays can be performed in multiplex
or separately.
EXAMPLE 3a: Detection of Right Extremity lunction Region.
[00142] For detection of the right extremity junction in SCCmec types other than
type XI, one can utilize, either in a multiplex with an assay to detect typeXI or separately,
primers located in the right part of the SCCmec cassette and in the orfX. This reaction can use
probes located either in the right part of the cassette or in the orfX. MRSA and MSSA strains
can be tested using a lysate as target corresponding to 105 CFU per amplification reaction or as
directed for a specific kit. For example, commercially available kits that can be utilized to
detect this junction include:
Additionally, primers can be designed using Path-MRSA or Path-MRSA std (both, Genesig).
EXAMPLE 3b: Multiplex amplification and detection of mecA gene and cassette insertion
(junction) region
[00143] As shown in this example, simultaneous amplification and detection of
both the insertion cassette region and the mecA gene can be utilized to reduce detection of
certain strains (false MRSA positive) for non-typeXI strains. As described and exemplified in
Jay, et al. (US20090203013; WO2009085221, incorporated by reference) and available
commercially (NucliSens EasyQ® MRSA (bioMerieux, Marcy l'Etoile, France)), this strategy can
be used for a multiplex amplification for detection of both the mecA gene and the cassette
junction region in the same tube. In one example, the assay uses 5 SCCmec cassette-specific
forward primers in SCCmec right extremity junction region, 1 reverse primer in orfX, and 5
labeled SCCmec cassette-specific probes for the cassette junction region in combination with 1
forward primer, 1 reverse primer and 1 labeled probe for mecA. The results of such an assay
show that, in the case of an MSSA possessing the insertion cassette region without the mecA
gene, this portion of the assay can properly provide a "MRSA negative" result [SCCmec junction
(+ plus mecA (- .
EXAMPLE 4 : Amplification of MRSA genomic region [spa)
Standard PCR conditions, as described above, are utilized, unless noted differently.
[00144] The S. aureus spa gene is a gene encoding the protein A, which is a
surface protein found specifically in the cell wall of Staphylococcus aureus bacteria. One part of
spa gene, the polymorphic region X, is highly variable and is used for the spa typing permitting
to differentiate several S. aureus. However more conservative areas are also present in spa gene
and are used as specific markers to detect all the S. aureus strains. [Kuhn, JCM 2007, Doublelocus
sequence typing using clfB and spa, a fast and simple method for epidemiological typing
of methicillin-resistant Staphylococcus aureus].
[00145] After building a multiple sequence alignment (from a collection of
sequences from proprietary and/or public databanks], the oligonucleotides were designed in
the conservative area of the gene. The resulting amplification and/or detection of the spa
region demonstrate that S. aureus is present in the sample.
Oligonucleotides are as follows:
EXAMPLE 5 : Amplification of MRSA genomic region [nuc]
[00146] The nuc gene encodes the S. aureus thermostable nuclease also called
thermonuclease. This gene is S. aureus specific and is highly conserved [Bragstad et al. JCM
1992, Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc
gene].
[00147] After building a multiple sequence alignment (from a collection of
sequences from proprietary and/or public databanks], the oligonucleotides were designed in
the conservative area of the gene. The resulting amplification and/or detection of the nuc
region, under standard PCR conditions as described herein, demonstrates that S. aureus is
present in the sample.
Oligonucleotides are as follows:
EXAMPLE 6 : Amplification of mecA and mecA variant
Standard PCR conditions, as described above, can be utilized, unless noted differently.
[00148] mecA encodes for the PBP2a (Penicillin Binding Protein 2a), which Is a
modified PBP. mecA variant discovered recently also encodes for a protein belonging to the
PBP2a fa y. After building a multiple sequence alignment (from a collection of sequences
from proprietary and/or public databanks], the oligonucleotides were designed in conservative
areas of the gene. Oligonucleotides can be designed in order to amplify and detect both mecA
and mecA variant either in the same simplex reaction or i several distinct simplex reactions or
in multiplex reaction. The resulting amplification and/or detection of mecA and/or mecA
variant (in simplex or multiplex] demonstrate that the meth c ll n resistance gene is present n
the sample.
[00149] mecA can be assayed by amplification using the following
oligonucleotides, under standard PCR conditions:
Oligo SEQ ID Sequence
NO
Fwd Primer 12 ACCTTCTACACCTCCATATCAC(22n )
mecA-1
Rev Primer 13 CGTTACGGATTGCTTCACTG(20n )
mecA-2
[00150] mecA variant can be assayed by amplification using the fc
oligonucleotides to detect mecA variant sequences:
Oligo SEQ ID Sequence
NO
Fwd Primer 14 AACACTGATGGTTTTAAGGTATCCA(25nt)
mecAv-1
Fwd Primer 15 AAGGTATCCATTGCAAATACTTATGACAA(29n )
mecAv-2
Rev Primer 16 TACCAGATCCATCGTCATTTTTCATATGT(29n )
mecAv-3
Rev Primer 17 TACCAGATCCATCGTCATTTTTCATAT(27n )
mecAv-4
Probe 18 ATTGGAGAAAAAGGCTGAAAACGGAA(26n )
mecAv-5
Probe 19 ATTGGAGAAAAAGGCTGAAAACGGAAAAGA(30n )
mecAv-6
Fwd Primer 20 CCAGATATAGTAGCATTATA(20n )
mecAv-7
Rev Primer 21 AAAGATGACGATATTGAG (18n )
Probe
mecAv-8
[00151] Alternatively, mecA variant can be determined using a mecA variant-orfX
assay. One such assay is exemplified above in Example 2.
[00152] An assay to detect both mecA and mecA variant is described below.
Primer/probe sequences are selected in a region common to both mecA and mecA variant.
mecA +mecA variant can be amplified usin the followin oligonucleotides:
[00153] Publications cited herein and the material for which they are cited are
specifically incorporated by reference. Nothing herein is to be construed as an admission that
the invention is not entitled to antedate such disclosure by virtue of prior invention.
[00154] It is understood that the disclosed invention is not limited to the
particular methodology, protocols, and reagents described as these may vary. It is also to be
understood that the terminology used herein is for the purpose of describing particular
embodiments only, and is not intended to limit the scope of the present invention which will be
limited only by the appended claims.
[00155] Those skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific embodiments of the
invention described herein. Such equivalents are intended to be encompassed by the following
claims.
SEQUENCE LISTING
Oligonucleo SEQ ID Target Sequence
tide NO
mecAv-orfX- 1 MecA ATGAAGCAATATCAAAGGA(19n )
1 variantorfX
mecAv-orfX- 2 MecA TGAAGCAATATCAAAGGAA(19n )
2 variantorfX
mecAv-orfX- 3 MecA ATAACTTGGTTATTCAAAGATGACGATATT(30n )
3 variantorfX
mecAv-orfX- 4 MecA ACTTGGTTATTCAAAGATGACGATATTGA(29nt]
4 variantorfX
mecAv-orfX- 5 MecA TGGTTATTCAAAGATGACGATATTGAGA(28nt
5 variantorfX
mecAv-orfX- 6 MecA ATCCTAATATGTTAATGGCGA(21nt]
6 variantorfX
mecAv-orfX- 7 MecA ATGGCGATTAATGTTAAAGA(20nt]
7 variantorfX
mecAv-orfX- 8 MecA TGGCCAGCTATAATGCTACTATATCTGGA(29nt]
8 variantorfX
mecAv-orfX- 9 MecA TCAGCAAAATGACATTTCCACATCA(25nt]
9 variantorfX
mecAv-orfX- 10 MecA TCAGCAAAATGACATTCCCACATCA(25n )
10 variantorfX
mecAv-orfX- 11 MecA TGATGCGGGTTGTGTTAATTGARCAAGTG(29n )
11 variantorfX
mecA-1 12 mecA ACCTTCTACACCTCCATATCAC(22nt]
mecA-2 13 mecA CGTTACGGATTGCTTCACTG(20nt]
mecAv-1 14 mecA AACACTGATGGTTTTAAGGTATCCA(25n )
variant
mecAv-2 15 mecA AAGGTATCCATTGCAAATACTTATGACAA(29nt]
variant
Oligonucleo SEQ ID Target Sequence
tide NO
mecAv-3 16 mecA TACCAGATCCATCGTCATTTTTCATATGT(29n )
variant
mecAv-4 17 mecA TACCAGATCCATCGTCATTTTTCATAT(27n )
variant
mecAv-5 18 mecA ATTGGAGAAAAAGGCTGAAAACGGAA(26n )
variant
mecAv-6 19 mecA ATTGGAGAAAAAGGCTGAAAACGGAAAAGA(30nt)
variant
mecAv-7 20 mecA CCAGATATAGTAGCATTATA (20n )
variant
mecAv-8 2 1 mecA AAAGATGACGATATTGAG(18n )
variant
mecA- 22 mecA + TCACCAGGTTCAACYCAAAA (20n )
mecAv-1 mecA
variant
mecA- 23 mecA + CCTGAATCWGCTAATAATATTTC(23n )
mecAv-2 mecA
variant
S.aureus-1 24 spa CACCTGCTGCAAATGCTG (18n )
S.aureus-2 25 spa CGTTGATCAGCRTTTAAGTTAGGCATATT(29n )
S.aureus-3 26 spa CGCAACACGATGAAGCTCAACAAAATGC(28nt]
S.aureus-4 27 nuc GGTGTAGAGAAATATGGTCCTGAAGC(26n )
S.aureus-5 28 nuc GTCCTGAAGCAAGTGCATTTACG(23n )
S.aureus-6 29 nuc GGACGTGGCTTAGCGTATATTTATGCTGATG(31n )
S.aureus-7 30 nuc GCAACTTTAGCCAAGCCTTGAC(22n )
WHAT IS CLAIMED IS:
1. A method of amplifying in a sample a methicillin-resistant Staphylococcus aureus
(MRSA) which comprises an insertion of an SCCmec cassette within Staphylococcus aureus
chromosomal DNA, wherein the SCCmec cassette comprises a mecA variant element, the
method comprising:
performing on the sample an amplification reaction utilizing an oligonucleotide set comprising:
a . a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant, and, optionally,
c . a third oligonucleotide capable of specifically hybridizing within a region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide,
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified and wherein if the third oligonucleotide is used, then if the
sample contains the MRSA, hybridization of the third oligonucleotide is detected.
2. The method of claim 1, wherein the extremity junction region of chromosomal S. aureus
DNA is a right extremity junction region.
3. The method of claim 1, wherein the third oligonucleotide specifically hybridizes to:
a region of chromosomal Staphylococcus aureus DNA; a region of orfli of chromosomal
Staphylococcus aureus DNA; a region of a right extremity junction region of SCCmec cassette
DNA ; or a region of the mecA variant.
4. The method of claim 1, wherein the first oligonucleotide specifically hybridizes to a region of
orfiCof chromosomal Staphylococcus aureus DNA.
5. The method of claim 1, wherein:
- the first oligonucleotide comprises a nucleic acid sequence selected from the group
consisting of: SEQ ID NOs: 9 and 10; and/or
- the second oligonucleotide comprises a nucleic acid sequence selected from the group
consisting of: SEQ ID NOs: 6, 7, 14, 15 16, 17, 20 and 2 1 and/or
- if the third oligonucleotide is used, said third oligonucleotide comprises a nucleic acid
sequence set forth as SEQ ID NO: 8, 11, 18 and 19.
6. The method of any of claims 1 to 5, further comprising amplifying a methicillin-resistant
Staphylococcus aureus (MRSA) which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by
utilizing in an amplification reaction a second oligonucleotide set for amplification of a right
extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the
second oligonucleotide set comprising:
a . a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region;
b. a second junction oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing within a region of a right extremity junction region of the SCCmec
cassette of the MRSA comprising a mecA, and, optionally,
c . a third junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of the MRSA between the hybridizing region of the first junction
oligonucleotide and the hybridizing region of the second junction oligonucleotide,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions, if the sample contains the MRSA comprising
a mecA, the right junction is amplified,
and wherein if the third junction oligonucleotide is used, then if the sample contains the MRSA
comprising the right extremity junction, hybridization of the third junction oligonucleotide is
detected.
7. The method of claim 6, wherein the third junction oligonucleotide has a nucleic acid sequence
capable of specifically hybridizing within:
- a region of a right extremity junction region of the SCCmec cassette, or
- orfX.
8. The method of claim 6, wherein the first oligonucleotide has a nucleic acid sequence capable
of specifically hybridizing within orfi .
9. The method of any of claims 1to 8, further comprising amplifying a Staphylococcus aureus
comprising mecA by utilizing in an amplification reaction a third oligonucleotide set for
amplification of a mecA element comprising:
a . a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of mecA DNA; and
b. a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within mecA DNA,
wherein each of the first mecA oligonucleotide and the second mecA oligonucleotide is oriented
such that, under amplification conditions, a portion of the mecA DNA is amplified
and wherein, optionally, the third oligonucleotide set further comprises a third mecA
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the mecA between the hybridizing region of the first mecA oligonucleotide and the
hybridizing region of the second mecA oligonucleotide,
wherein if the third mecA oligonucleotide is used, then if the sample contains the MRSA
comprising mecA, hybridization of the third mecA oligonucleotide is detected.
10. The method of any of claims 1 to 9, further comprising utilizing a fourth oligonucleotide set
for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
a . a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions, a portion of the S. aureus -specific DNA is
amplified
and wherein, optionally, the fourth oligonucleotide set further comprises a third S. aureus
oligonucleotide having a nucleic acid sequence capable of specifically hybridizing within a
region of the S. aureus DNA between the hybridizing region of the first S. aureus
oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide,
wherein if the third . aureus oligonucleotide is used, then if the sample contains the region of
the S. aureus DNA between the hybridizing region of the first S. aureus oligonucleotide and the
hybridizing region of the second S. aureus oligonucleotide, hybridization of the third
oligonucleotide is detected.
11. A method of amplifying in a sample a methicillin-resistant Staphylococcus aureus (MRSA)
which comprises an insertion of an SCCmec cassette within Staphylococcus aureus
chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element,
the method comprising:
performing on the sample an amplification reaction utilizing
a . a first oligonucleotide set comprising:
1) a first mecA variant oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing to a first region of a mecA variant element, and
2) a second mecA variant oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing to a second region of a mecA variant element; and, optionally
3) a third mecA variant oligonucleotide capable of specifically hybridizing within a
region of the MRSA between the hybridizing region of the first mecA variant oligonucleotide
and the hybridizing region of the second mecA variant oligonucleotide, wherein if the sample
contains the MRSA comprising a mecA variant element, hybridization of the third mecA variant
oligonucleotide is detected; and
b. a second oligonucleotide set comprising:
1) a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA,
2) a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA, and, optionally,
3) a third mecA oligonucleotide capable of specifically hybridizing within a region of the
MRSA between the hybridizing region of the first mecA oligonucleotide and the hybridizing
region of the second mecA oligonucleotide, wherein if the sample contains the MRSA
comprising mecA, hybridization of the third mecA oligonucleotide is detected;
wherein each of the first oligonucleotide and the second oligonucleotide is oriented such that,
under amplification conditions, if the sample contains the MRSA, the region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide is amplified.
12. The method of claim 11, wherein:
- the first mecA variant oligonucleotide comprises a nucleic acid sequence selected from
the group consisting of: SEQ ID NOs: 6, 7, 14, 15 and 20; and/or
- the second mecA variant oligonucleotide comprises a nucleic acid sequence selected
from the group consisting of: SEQ ID Nos: 16, 17 and 2 1 and/or
- if the third mecA variant oligonucleotide is used, said mecA variant oligonucleotide
comprises a nucleic acid sequence selected from the group consisting of: SEQ ID Nos: 8, 18 and
19.
13. The method of any of claims 1 to 11, wherein the mecA variant is
14. The method of claim 11, further comprising amplifying a methicillin-resistant
Staphylococcus aureus (MRSA) which comprises an insertion of an SCCmec cassette within
Staphylococcus aureus chromosomal DNA, wherein the SCCmec cassette comprises a mecA, by
utilizing in an amplification reaction a third oligonucleotide set for amplification of a right
extremity junction of SCCmec cassette with Staphylococcus aureus chromosomal DNA, the
second oligonucleotide set comprising:
a . a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette of the
MRSA comprising a mecA ,
wherein each of the first junction oligonucleotide and the second junction oligonucleotide is
oriented such that, under amplification conditions, if the sample contains the MRSA comprising
a mecA, the right junction is amplified, and optionally,
c . a third junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of the MRSA between the hybridizing region of the first junction
oligonucleotide and the hybridizing region of the second junction oligonucleotide,
wherein if the sample contains the MRSA comprising the right extremity junction, hybridization
of the third junction oligonucleotide is detected.
15. The method of claim 14, wherein the third junction oligonucleotide:
- has a nucleic acid sequence capable of specifically hybridizing within a region of a
right extremity junction region of the SCCmec cassette, or
- has a nucleic acid sequence capable of specifically hybridizing within orpC.
16. The method of claim 14, wherein the first junction oligonucleotide has a nucleic acid
sequence capable of specifically hybridizing within orfiC.
17. The method of any of claims 11to 14, further comprising utilizing a fourth oligonucleotide
set for amplification of a Staphylococcus aureus- specific chromosomal DNA comprising:
a . a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within Staphylococcus aureus -specific chromosomal DNA,
wherein each of the first S. aureus oligonucleotide and the second S. aureus oligonucleotide is
oriented such that, under amplification conditions, a portion of the S. aureus -specific DNA is
amplified, and, optionally
c . a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S.
aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide,
wherein if the sample contains the region of the S. aureus DNA between the hybridizing region
of the first S. aureus oligonucleotide and the hybridizing region of the second S. aureus
oligonucleotide, hybridization of the third oligonucleotide is detected.
18. The method of any of claims 10 to 17, wherein the Staphylococcus aureus -specific
chromosomal DNA is selected from the group consisting of spa, orfiC and nuc.
19. The method of any of claims 1 to 18, further comprising contacting the amplified sample
with an intercalating dye, wherein if the sample contains the MRSA, intercalation of the dye into
an amplification product is detected.
20. A kit for amplifying a methicillin-resistant Staphylococcus aureus (MRSA) which comprises
an insertion of an SCCmec cassette within Staphylococcus aureus chromosomal DNA, wherein
the SCCmec cassette comprises a mecA variant element, the kit comprising a first
oligonucleotide set comprising:
a . a first oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to a
region of chromosomal Staphylococcus aureus DNA in an extremity junction region, and
b. a second oligonucleotide having a nucleic acid sequence capable of specifically hybridizing to
a region of a mecA variant,
and optionally
c . a third oligonucleotide capable of specifically hybridizing within a region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide.
21. The kit of claim 20, wherein:
- the first oligonucleotide comprises a nucleic acid sequence selected from the group consisting
of: SEQ ID NOs: 9 and 10; and/or
- the second oligonucleotide comprises a nucleic acid sequence selected from the group
consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21, and/or
- if the third oligonucleotide is present, said third oligonucleotide comprises a nucleic acid
sequence set forth as SEQ ID NO: 8, 18 and 19.
22. The kit of claim 20 or claim 2 1, further comprising one or more of the following
oligonucleotide sets:
- a second oligonucleotide set comprising:
a . a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing within a region of a right extremity junction region of the SCCmec
cassette; and/or
- a third oligonucleotide set for amplification of a mecA element comprising:
a. a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of mecA DNA; and
b. a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a second region within mecA DNA; and/or
- a fourth oligonucleotide set for amplification of a Staphylococcus aureus- specific
chromosomal DNA comprising:
a. a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing within a second region within Staphylococcus aureus -specific
chromosomal DNA.
23. A kit for amplifying in a sample a methicillin-resistant Staphylococcus aureus (MRSA)
which comprises an insertion of an SCCmec cassette within Staphylococcus aureus
chromosomal DNA, wherein the SCCmec cassette comprises mecA or a mecA variant element,
the kit comprising:
a) a first oligonucleotide set comprising:
1) a first mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of a mecA variant element, and
2) a second mecA variant oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of a mecA variant element; and, optionally,
3) a third mecA variant oligonucleotide capable of specifically hybridizing within a region of the
MRSA between the hybridizing region of the first oligonucleotide and the hybridizing region of
the second oligonucleotide; and
b) a second oligonucleotide set comprising:
1) a first mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a first region of mecA, and
2) a second mecA oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing to a second region of mecA; and, optionally,
3) a third mecA oligonucleotide capable of specifically hybridizing within a region of the MRSA
between the hybridizing region of the first oligonucleotide and the hybridizing region of the
second oligonucleotide,
each set oriented such that, when a sample is placed under amplification conditions with the
oligonucleotide set, if the sample contains the MRSA, amplification can occur.
24. The kit of claim 23, wherein:
- the first mecA variant oligonucleotide comprises a nucleic acid sequence selected from
the group consisting of: SEQ ID NOs: 9 and 10, and/or
-the second mecA variant oligonucleotide comprises a nucleic acid sequence selected
from the group consisting of: SEQ ID NOs: 6, 7, 14, 15, 16, 17, 20 and 21, and/or
-the third mecA variant oligonucleotide comprises a nucleic acid sequence set forth as
SEQ ID NO: 8, 18 and 19.
25. The kit of any of claims 20 to 24, wherein the mecA variant is e 4LGA_SI -
26. The kit of claim 23, further comprising one or more of the following oligonucleotide sets:
- a third oligonucleotide set comprising:
a . a first junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of chromosomal Staphylococcus aureus DNA in a right extremity
junction region; and
b. a second junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of a right extremity junction region of the SCCmec cassette
comprising mecA,wherein each of the first junction oligonucleotide and the second junction
oligonucleotide is oriented such that, under amplification conditions in the presence of the
MRSA wherein the SCCmec cassette comprises mecA, an SCCmec cassette right insertion
junction is amplified; and, optionally,
c . a third junction oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of the MRSA between the hybridizing region of the first junction
oligonucleotide and the hybridizing region of the second junction oligonucleotide; and/or
- a fourth oligonucleotide set comprising:
a . a first S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region within Staphylococcus aureus -specific chromosomal DNA; and
b. a second S. aureus oligonucleotide having a nucleic acid sequence capable of
specifically hybridizing within a second region within Staphylococcus aureus -specific
chromosomal DNA, wherein each of the first S. aureus oligonucleotide and the second S. aureus
oligonucleotide is oriented such that, under amplification conditions in the presence of an
MRSA, a portion of S. aureus -specific DNA is amplified,
and, optionally,
c . a third S. aureus oligonucleotide having a nucleic acid sequence capable of specifically
hybridizing within a region of the S. aureus DNA between the hybridizing region of the first S.
aureus oligonucleotide and the hybridizing region of the second S. aureus oligonucleotide.
| # | Name | Date |
|---|---|---|
| 1 | Sequence List.pdf | 2014-07-23 |
| 2 | Form 5.pdf | 2014-07-23 |
| 3 | Form 3.pdf | 2014-07-23 |
| 4 | Drawings.pdf | 2014-07-23 |
| 5 | CS.pdf | 2014-07-23 |
| 6 | 304.pdf | 2014-07-23 |
| 7 | 5831-DELNP-2014.pdf | 2014-07-26 |
| 8 | 5831-DELNP-2014-Correspondence-Others-(28-07-2014).pdf | 2014-07-28 |
| 9 | 5831-DELNP-2014-Assignment-(28-07-2014).pdf | 2014-07-28 |
| 10 | 5831-delnp-2014-Correspondence-Others-(29-08-2014).pdf | 2014-08-29 |
| 11 | 5831-delnp-2014-GPA-(02-09-2014).pdf | 2014-09-02 |
| 12 | 5831-delnp-2014-Correspondence-Others-(02-09-2014).pdf | 2014-09-02 |
| 13 | 5831-delnp-2014-Form-3-(30-12-2014).pdf | 2014-12-30 |
| 14 | 5831-delnp-2014-Correspondence Others-(30-12-2014).pdf | 2014-12-30 |
| 15 | 5831-delnp-2014-Form-3-(22-05-2015).pdf | 2015-05-22 |
| 16 | 5831-delnp-2014-Correspondence Others-(22-05-2015).pdf | 2015-05-22 |
| 17 | Form 3 [03-11-2016(online)].pdf | 2016-11-03 |
| 18 | 5831-DELNP-2014-FORM 3 [03-11-2017(online)].pdf | 2017-11-03 |
| 19 | 5831-DELNP-2014-FORM 3 [31-10-2018(online)].pdf | 2018-10-31 |
| 20 | 5831-DELNP-2014-FER.pdf | 2019-01-18 |
| 21 | 5831-DELNP-2014-FORM 3 [13-06-2019(online)].pdf | 2019-06-13 |
| 22 | 5831-DELNP-2014-SEQUENCE LISTING [17-07-2019(online)].txt | 2019-07-17 |
| 23 | 5831-DELNP-2014-OTHERS [17-07-2019(online)].pdf | 2019-07-17 |
| 24 | 5831-DELNP-2014-FER_SER_REPLY [17-07-2019(online)].pdf | 2019-07-17 |
| 25 | 5831-DELNP-2014-DRAWING [17-07-2019(online)].pdf | 2019-07-17 |
| 26 | 5831-DELNP-2014-CORRESPONDENCE [17-07-2019(online)].pdf | 2019-07-17 |
| 27 | 5831-DELNP-2014-CLAIMS [17-07-2019(online)].pdf | 2019-07-17 |
| 28 | 5831-DELNP-2014-Annexure [17-07-2019(online)].pdf | 2019-07-17 |
| 29 | 5831-DELNP-2014-OTHERS-230719.pdf | 2019-07-27 |
| 30 | 5831-DELNP-2014-Correspondence-230719.pdf | 2019-07-27 |
| 31 | 5831-DELNP-2014-HearingNoticeLetter-(DateOfHearing-13-02-2020).pdf | 2020-01-20 |
| 32 | 5831-DELNP-2014-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [10-02-2020(online)].pdf | 2020-02-10 |
| 33 | 5831-DELNP-2014-ExtendedHearingNoticeLetter-(DateOfHearing-17-03-2020).pdf | 2021-10-17 |
| 1 | SEARCH_16-01-2019.pdf |