Abstract: The invention comprises an oligonucleotide selected from the group comprising SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6. The invention also comprises a complementary oligonucleotide of the oligonucleotide selected from the group comprising SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6 an oligonucleotide being at least 80% homogolous thereto a truncated portion of any of the aforementioned or a pairing of any of the aforementioned.
THIS INVENTION relates to the diagnosis of tuberculosis (TB). More
particularly, the invention relates to an oligonucleotide that can be used in the
diagnosis of TB, to an in vitro method of diagnosing TB, and to a diagnostic kit
for diagnosing TB.
Tuberculosis (TB) is one of the biggest killers among infectious diseases,
despite the worldwide use of a live attenuated vaccine and several antibiotics.
There are an estimated eight million new cases per year and two million
deaths annually, which are compounded by the emergence of drug resistance
TB and co-infections with HIV.
Despite the enormous burden of TB, conventional approaches to diagnosis
currently used continue to rely on tests that have major drawbacks. Many of
these tests are slow and lack both sensitivity and specificity or require
expensive equipment and trained personnel. For example, sputum smear
microscopy is insensitive; the culture method is technically complex and slow;
chest radiography is non-specific, and the tuberculin skin test is imprecise,
and its results are non-specific; nucleic acid amplification tests and phage
display are rapid but specificity and sensitivity are low. The recently
discovered nucleic acid amplification test called the GeneXpert-, addresses
the problems of time and sensitivity but the machine required is extremely
expensive.
It is accordingly an object of this invention to provide an improved method of
diagnosing TB, with the method being more sensitive and/or more specific
than those of which the Applicant is aware.
According to a first aspect of the invention, there is provided an
oligonucleotide selected from the group comprising SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, a
complementary oligonucleotide thereof, an oligonucleotide being at least 80%
homologous thereto, a truncated portion of any of the aforementioned, or a
pairing of any of the aforementioned.
More specifically, this aspect of the invention may comprise
(i) an oligonucleotide selected from the group comprising SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ
ID NO: 6; and/or
(ii) a complementary oligonucleotide of an oligonucleotide selected from
the group comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6; and/or
(iii) an oligonucleotide being at least 80% homologous to an
oligonucleotide selected from the group comprising SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ
ID NO: 6; and/or
(iv) a truncated portion of an oligonucleotide selected from the group
comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5, and SEQ ID NO: 6; and/or
(v) a pairing of any two oligonucleotides selected from the group
comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO: 5, and SEQ ID NO: 6
SEQ ID NO: 1 to SEQ ID NO: 6 are as set out hereinafter, particularly in Table
1, and in the sequence listing annexed hereto.
The oligonucleotide may be a single stranded oligonucleotide or it may be a
double stranded oligonucleotide. In the preferred embodiment, the
oligonucleotide is a single stranded oligonucleotide.
The oligonucleotide may be an aptamer, a truncated portion of an aptamer, or
a pairing thereof, that binds specifically to a CFP-10.ESAT-6 heterodimer of a
Mycobacterium strain. The aptamer may instead bind to a CFP-10 monomer
of a Mycobacterium strain. More specifically, the aptamer may bind to the
CFP-10. ESAT-6 heterodimer or CFP-10 monomer of the Mycobacterium
tuberculosis (M.tb) strain.
By "a pairing thereof is meant a pairing of two aptamers or a pairing of two
truncated portions of aptamers or a pairing of an aptamer with a truncated
portion of an aptamer; preferably, however, it refers to a pairing of two
aptamers.
The CFP-10. ESAT-6 heterodimer and the CFP-1 0 monomer are early
markers of active tuberculosis (TB). Aptamers are artificial nucleic acid or
nucleotide ligands that can bind any molecular or cellular target of interest
with high affinity and specificity. Thus, in the present invention, it was
surprisingly found that more sensitive and specific diagnosis of TB can be
achieved by means of aptamers, truncated portions of aptamers or pairings
thereof that bind specifically to the CFP-10. ESAT-6 heterodimer and the CFP-
10 monomer.
According to a second aspect of the invention, there is provided an
oligonucleotide which is an aptamer, a truncated portion of an aptamer, or a
pairing thereof, that binds to a CFP-1 0.ESAT-6 heterodimer or to a CFP-10
monomer of a Mycobacterium strain.
This oligonucleotide may be selected from the group comprising SEQ ID NO:
1, SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID
NO: 6, a complementary oligonucleotide thereof, an oligonucleotide being at
least 80% homogolous thereto, a truncated portion of any of the
aforementioned, or a pairing of any of the aforementioned.
In accordance with a third aspect of the invention, there is provided an in vitro
method of diagnosing tuberculosis (TB), said method comprising:
(a) contacting a sample taken from an individual suspected to be
infected with TB with the oligonucleotide according to the first or
second aspects of the invention in a CFP-1 0.ESAT-6
heterodimer binding assay; and
(b) determining whether or not the oligonucleotide has bound to a
CFP-10.ESAT-6 heterodimer in the sample, with binding of the
oligonucleotide to the CFP-10.ESAT-6 heterodimer thus
confirming the presence of the CFP-10.ESAT-6 heterodimer,
and hence TB infection in the sample.
In accordance with a fourth aspect of the invention, there is provided an in
vitro method of diagnosing tuberculosis (TB), said method comprising:
(a) contacting a sample taken from an individual suspected to be
infected with TB with the oligonucleotide according to the first or
second aspects of the invention in a CFP-10 monomer binding
assay; and
(b) determining whether or not the oligonucleotide has bound to a
CFP-10 monomer in the sample, with binding of the
oligonucleotide to the CFP-1 0 monomer thus confirming the
presence of the CFP-10 monomer, and hence TB infection in the
sample.
In accordance with a fifth aspect of the invention, there is provided a nucleic
acid comprising an oligonucleotide sequence selected from SEQ. ID.NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO:
6, a complementary oligonucleotide thereof, an oligonucleotide being at least
80% homologous thereto, a truncated portion of any of the aforementioned, or
a pairing of any of the aforementioned.
It will be appreciated by a person skilled in the art of this invention that the
binding assays may be chemiluminescent assays. In a preferred embodiment,
the assay is a modified ELISA-type assay wherein the antibodies against a
test molecule (CFP-10. ESAT-6 heterodimer or CFP-1 0 monomer) are
replaced with a labelled aptamer of the invention, a truncated portion thereof
or a pairing thereof.
In accordance with a sixth aspect of the invention, there is provided a
diagnostic kit for diagnosing tuberculosis (TB), said kit including:
(a) a device for taking a sample from an individual suspect to be
infected with TB; and
(b) apparatus for applying the method of diagnosing TB according
to the third or fourth aspects of the invention; and
(c) optionally, a positive control and/or a negative control.
It has been found that rational truncation of the original
oligonucleotide/aptamer sequences yield shorter, lower cost molecules that
show comparable activity to the original parent sequences. The truncated
versions of the oligonucleotide/aptamers retain those parts of the original
(parent) oligonucleotide/aptamers which are predicted to play a role in targetbinding.
The truncated aptamers show binding to target proteins, with
affinities comparable to those of the parent sequences.
It has also been found that the original full length olionucleotides can be used
in pairs for further use in a diagnostic setting.
The invention will now be described in more detail with reference to and as
illustrated in the following non-limiting examples and accompanying drawings.
Hereinafter, the aptamers selected from the group comprising SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO:
6, are also referred to as CSIR 2.2, CSIR2.9, CSIR2.1 1, CSIR2.1 5, CSIR2.19
and CSIR2.21 respectively.
In the drawings:
FIGURE 1 shows neighbour joining tree for the aptamer sequences;
FIGURE 2 is a graphical representation of the 24 ssDNA aptamers
(CSIR 2.1 to CSIR 2.24) that significantly (p < 0.05) bound the CFP-1 0.ESAT-
6 M. tb target protein. Statistical significant was determined by a two tailed
Student t-test and the error bars denote standard deviations of experiments
done in triplicate. Each aptamer was tested for binding at least twice, in
independent experiments;
FIGURE 3 shows binding of anti-CFP-10.ESAT-6 biotinylated ssDNA
aptamers to the CFP-10.ESAT-6 heterodimer in the presence (grey shaded
bar graphs) or absence (line hatched bar graphs) of anti-ESAT-6 monoclonal
antibody. Error bars denote standard deviation of triplicates. Each aptamer
was tested in two independent assays;
FIGURE 4 shows binding of the anti-CFP-10.ESAT-6 ssDNA aptamers
to ESAT-6, CFP-1 0, CFP-10.ESAT-6 heterodimer, EsxGH heterodimer and
HIV-1 gp120, respectively, to determine specificity. Error bars show standard
deviations of experiments done in triplicates;
FIGURE 5 shows binding of the solid phase synthesised ssDNA
aptamers to CFP-1 0.ESAT-6 heterodimer, CFP-10 and ESAT-6 monomers,
respectively. Error bars denote standard deviation of triplicates. Each aptamer
was tested in two independent assays;
FIGURE 6 shows a specificity test for CSIR 2.1 1 aptamer. The
specificity was done using lysates from bacterial cultures of the auxotroph
strain of M. tb. M. smegmatis, Pseudomonas, and Streptococcus. Based on a
standard curve run on the plate the cut off was determined to be OD450 = 0.2,
with a 99% confidence interval. Error bars denote standard deviation of
triplicates. Each aptamer was tested in two independent assays;
FIGURE 7 illustrates kinetic studies of 5 of the best aptamers. CFP-10
attached to a CM5 chip was used to capture the respective anti-CFP-
10. ESAT-6 aptamers. The respective aptamers were injected at different
concentrations at a flow rate of 10 m I/min for 5 minutes and allowed to
dissociate for 10 minutes;
FIGURE 8 shows folded versus unfolded aptamer binding. One batch
of CSIR 2.1 1 was refolded and the other was used directly after thawing. The
refolding step is not necessary for the binding of the aptamer to the target
antigens. Thus, no significant difference was seen between the folded and the
unfolded aptamer. Error bars denote standard deviation of triplicates. Each
aptamer was tested in two independent assays;
FIGURE 9 illustrates serial dilutions of CFP-10 on a 96 well micro-titre
plate. The limit of detection for 150 nM of CSIR 2.1 1 is 3 1 ng of CFP-10 M. tb
protein, with an R2 of 0.85. Error bars denote standard deviation of triplicates.
Each aptamer was tested in two independent assays;
FIGURE 10 shows the results of evaluation of clinical samples of
sputum from patients with or without active TB using CSIR 2.1 1 ssDNA
aptamer in an ELONA readout platform. The cut-off for positive was set at an
OD45o above 0.2; denoted by the dotted line. The cut-off was determined by a
99% confidence interval of a known negative sample. CSIR 3.1 3 aptamer
isolated from the same parental library against human CD7 was used as a
negative control. Error bars denote standard deviations of experiments done
in triplicate. Each sample was tested twice in two independent studies. The
coefficient of variance between the two studies was less than 10% for all
samples;
FIGURE 11 shows, for Example 9, an evaluation of sputum samples
using CSIR 2.1 1 as a detection reagent;
FIGURE 12 shows, for Example 10, that truncated aptamers show
binding to target proteins, with affinities comparable to those of the parent
sequences;
FIGURE 13 shows, for Example 11, aptamer sandwich data;
FIGURE 14 shows, for Example 12, a comparison of CSIR 2.1 1 and
CSIR 2.21 using sputum samples;
FIGURE 15 shows, for Example 13, whole bacteria ELONA.
Selection of aptamers
Selection of aptamers has been made possible by the development of a
systematic evolution of ligands by exponential enrichment (SELEX) process.
The SELEX process consists of several rounds of selection of sequences that
bind to a target molecule. Each round consists of three main stages ( 1 )
incubating the oligonucleotide library with the target of interest, (2) separating
bound targets from unbound targets using the desired partitioning method,
and (3) amplifying the bound sequences.
Both single stranded DNA (ssDNA) and RNA libraries are used in different
selections. These libraries typically consist of a random region of nucleotides
that range from 20 to 60 nucleotides, although as few as 8 and as many as
220 random nucleotides can be used.
CFP-10.ESAT-6 heterodimer
There are 23 ESAT-6-like genes in the Mtb H37Rv genome. These genes are
located in 11 genomic loci and are named as EsxA-W. Inspection of the
genetic diversity revealed that five out of eleven cases had the Esx genes are
flanked by blocks of conserved genes. Besides the Esx genes, the other
conserved regions encode proline-glutamic acid (PE) and proline-prolineglutamic
acid (PPE) proteins, adenosine triphosphate (ATP) dependent
chaperones of the ATPases associated with diverse cellular activities (AAA)
family, membrane-bound ATPases, transmembrane proteins and serine
proteases, which are known as mycosins. The 11 genomic regions are
clustered in to five regions namely: region 1 spanning the genes rv3866-
rv3883c; region 2 spanning genes rv3884c-rv3895c; region 3 spanning genes
rv0282-rv0292; region 4 containing the genes rv3444crv3450c; and 5
containing the genes rv1782-rv1798. The genomes of Mtb H37Rv, M. bovis
and M. bovis BCG have been compared, and various regions of difference
(RD) have been identified. One of these regions, designated as RD1 , is a
9500 bp region that is absent in all M. bovis BCG strains. This deletion entirely
removes the genomic fragment from rv3872 to rv3879c. Among the lost genes
are EsxB (rv3874) and EsxA (rv3875), which respectively encode CFP-10 and
ESAT-6 proteins. This deletion is thought to be responsible for the primary
attenuation of M. bovis to M. bovis BCG.
Function of the CFP-10 and ESAT-6
The two proteins are potent T-cell antigens recognised by over 70% of
tuberculosis patients, which has led to their proposed use as a diagnostic
reagent for tuberculosis in both humans and animals.
Functions of the monomer and the heterodimer
ESAT-6 alone or in combination with CFP-1 0 enhances the permeability of
artificial membranes , by disrupting the lipid bilayers and acts as a cytolysin,
while the exposed C-terminal region of CFP-10 may be involved in
interactions with a host cell target protein resulting in stabilisation of the helical
conformation.
Both proteins are important in both pathogenesis and virulence of M. tb as the
CFP-10.ESAT-6 secretion system contributes to the arrest of phagosome
maturation and promotes survival of mycobacteria within macrophages, which
provides a novel link between the CFP-10.ESAT-6 secretion system and
mycobacterial virulence and pathogenesis , however it is unclear as to
whether it is ESAT-6, CFP-10 or the complex which is responsible for the
arrest of phagosome maturation.
Biochemical pathway of the heterodimer
Both CFP-10 and ESAT-6 are secreted by the ESAT-6 system-1 (ESX-1 ), a
dedicated secretion apparatus encoded by genes flanking EsxA and EsxB in
the extended RD1 region. Among the proteins predicted to be involved in this
process are a member of the AAA-family of ATPases (Rv3868) , which may
perform chaperone-like functions by assisting in the assembly and
disassembly of protein complexes and several putative membrane proteins or
ATP binding sites, which could be involved in forming a transmembrane
channel for the translocation of the effector molecules.
Why the heterodimer is important.
The expression characteristics of both proteins, together with their structural
properties, have led RENSHAW, P. S., PANAGIOTIDOU, P., WHELAN, A.,
GORDON, S. V., HEWINSON, R. G., WILLIAMSON, R. A. & CARR, M. D.,
(2002), Conclusive evidence that the major T-cell antigens of the
Mycobacterium tuberculosis complex ESAT-6 and CFP-10 form a tight, 1:1
complex and characterization of the structural properties of ESAT-6, CFP-10,
and the ESAT-6/CFP-1 0 complex. Implications for pathogenesis and
virulence, J Biol Chem, 277, 21598-603, to propose that the biologically active
form is the heterodimer. This implies that ESAT-6, without its partner CFP-10,
might not be active. The virulence of Mtb is reduced by the knockout of either
ESAT-6 or CFP-10; therefore the heterodimer is very important in the
virulence of M. tb. It has also been reported that the CFP-10. ESAT-6 complex
acts as a signalling molecule, which is likely to lead to the heterodimer being a
key player in diagnostics.
Characterisation of the CFP-10.ESAT-6 heterodimer
The characteristics of the heterodimer, affinity of binding, location of the
heterodimer, mechanism
Overall, the surface features of the CFP-10. ESAT-6 complex seem most
consistent with a function based on specific binding to one or more target
proteins. The extensive contact surface between CFP-1 0 and ESAT-6 is
essentially hydrophobic in nature and comprises about 25% of the total
surface area of both proteins. The tight interaction between the two proteins in
the complex appears to be primarily based on extensive and favourable van
der Waals contacts, however, two salt bridges between CFP-10 and ESAT-6
appear to stabilize interactions between the N-terminal end of helix-1 in CFP-
10 and the C-terminal end of the corresponding helix in ESAT-6, and between
the C-terminal region of helix-2 in CFP-1 0 and the N-terminal region of the
equivalent helix in ESAT-6, respectively.
EXAMPLE 1: Isolation of aptamers against CFP-10.ESAT-6 heterodimer
Aptamer library
The first step in the SELEX experiments was to create a pool of variant
sequences from which RNA or DNA aptamers of relatively high affinity for
target proteins could be selected. For the DNA selection a 90-mer ssDNA
randomized at 49 nucleotide positions flanked by primers were custom
synthesized by Integrated DNA Technologies (CA, USA). The primers were:
5'-GCCTGTTGTGAGCCTCCTAAC-3' (forward primer) and 5'-
GGGAGACAAGAATAAGCATG-3' (reverse primer modified with either T7
promoter region (TAATACGACTCACTATA) or a phosphate at the 3' end).
The library used was 5'- GCCTGTTGTGAGCCTCCTAAC (N49)
CATGCTTATTCTTGTCTCCC-3'.
In vitro selection of DNA aptamers
In the first round of selection 500 pmol of ssDNA library was used to obtain a
diversity of at least 1014 molecules of random sequence. The selection was
done by a modification of the SELEX protocol in which the ssDNA-protein
complexes are partitioned and purified using a nitrocellulose membrane.
Before selection, the ssDNA library was incubated with a nitrocellulose
membrane to eliminate any membrane binders.
The ssDNA library was refolded at 95°C for 10 minutes, immediately cooled
on ice for 5 minutes and then left to reach room temperature in the HMCKN
binding buffer (20 mM Hepes (Sigma), 2 mM MgCI2 (Sigma), 2 mM CaCI2
(Sigma), 2 mM KCI (Sigma) and 150 mM NaCI (Sigma), pH 7.4). This was
then either incubated with 1590 nM of CFP-1 0.ESAT-6 heterodimer for 1 hour
at 37°C or immediately used in a no protein control which was directly filtered
on the nitrocellulose membrane. The ssDNA-protein complex was passed
through a nitrocellulose membrane. Non-specifically bound ssDNA was
removed with two washes of HMCKN binding buffer. Bound ssDNA was
eluted by cutting the membrane and placing the pieces in a elution buffer (7M
urea (Sigma), 100mM sodium citrate (Sigma) and 3mM EDTA (Sigma)) and
heated to 100°C for 5 minutes. Then phenol/chloroform was added and left to
incubate for a further 25 minutes before extraction. This was followed by
chloroform extraction and an ethanol precipitation.
Recovered ssDNA was amplified using polymerase chain reaction (PCR)
under mutagenic conditions to increase the diversity of the molecules. This
dsDNA was then used in three different methods to generate ssDNA, the
three methods were then used as three independent selection methods. The
first method was to incorporate a biotin label during PCR using a biotin
labelled reverse primer. The dsDNA was then added to streptavidin magnetic
beads (Invitrogen) and the two strands were separated using 0.3 M HCI
solution or 95°C for 5 minutes. The resulting ssDNA was cleaned and used as
a template for the next round of selection (this method is referred to as 'biotinbased
selection'). The second method used the dsDNA as a template for in
vitro transcription to obtain RNA. The RNA was DNAse treated, cleaned and
precipitated and used as the template for RT PCR to obtain cDNA. The cDNARNA
complex was treated with a 1 M NaOH (Sigma), 0.5 M EDTA (Sigma)
buffer to hydrolyse the RNA. The resulting cDNA was used as a template for
the next round of selection (this method is referred to as T7-based selection').
The third method used to obtain ssDNA by including a phosphate labelled
reverse primer in the PCR. The dsDNA was then cleaned up and treated with
lambda exonuclease (New England Biolabs, Anatech), this results in the
degradation of the reverse strand with the phosphate modification . The
resulting ssDNA was then cleaned up and used as a template for the next
round of selection (this method is referred to as 'exonuclease-based
selection').
Selection of aptamers against the CFP-10.ESAT-6 heterodimer was done
using a modified SELEX protocol. Different approaches for partitioning were
used.
A single stranded DNA library was used for the selection of aptamers. After
each round of selection using the nitrocellulose membrane for partitioning, a
dsDNA PCR was done to optimise the number of cycles needed to convert
ssDNA to dsDNA and amplify the selected pool.
Based on the optimisation of the dsDNA PCR the number of cycles giving a
single band at 90 bp was used to produce dsDNA. The optimised number of
cycles was 12 in both selections. The dsDNA was then used to generate the
ssDNA using one of the three methods (biotin, T7- and exonuclease-based
selections). The ssDNA obtained from each round was run on a native PAGE
gel to ensure that the ssDNA obtained was clean for use in the next round of
selection.
The biotin-based selection failed as the two strands could not be separated
and the dsDNA remained bound to the beads. Due to this, the biotin-based
selection was abandoned after the first round of selection. The T7-based
selection resulted in an enrichment of 54.7% after 6 rounds of selection and
the exonuclease-based selection had an enrichment of 68% after 4 rounds of
selection. The two pools from the two selections were then cloned and
sequenced, respectively.
EEXXAAMMPPLLEE 22:: CClloonniinngg aanndd sseeqguueenncciinngg ooff ssssDDNNAA aappttaammeerrss
TThhee aappttaammeerr ppooooll ffrroomm tthhee 5 tthh ((TT77--bbaasseedd sseelleeccttiioonn)) aanndd 3 rrdd ((eexxoonnuucclleeaassee--
bbaasseedd sseelleeccttiioonn)) SSEELLEEXX rroouunndd wweerree ssuubbjjeecctteedd ttoo a nneeggaattiivvee sseelleeccttiioonn aaggaaiinnsstt
5 tthhee nniittrroocceelllluulloossee mmeemmbbrraannee aalloonnee.. TThhee ppoooollss rreeccoovveerreedd aafftteerr nneeggaattiivvee
sseelleeccttiioonnss wweerree ppuutt tthhrroouugghh a ffiinnaall ((66tthh - TT77--bbaasseedd sseelleeccttiioonn aanndd 4 tthh -
eexxoonnuucclleeaassee--bbaasseedd sseelleeccttiioonn)) SSEELLEEXX rroouunndd.. IInn tthhiiss llaasstt rroouunndd,, bbootthh ppoooollss ooff
ssssDDNNAA wweerree aammpplliiffiieedd ssuubbsseeqquueennttllyy wwiitthh tthhee pphhoosspphhaattee mmooddiiffiieedd rreevveerrssee
pprriimmeerr aanndd lliiggaatteedd iinnttoo tthhee ppGGEEMM--TT eeaassyy vveeccttoorr ((PPrroommeeggaa,, WWhhiitteehheeaadd
1 0 SScciieennttiiffiicc)).. EE..ccoollii TTOOPP11 0 cceellllss ((NNoovvaaggeenn,, MMeerrcckk)) wweerree ttrraannssffoorrmmeedd uussiinngg
tthheessee vveeccttoorr ccoonnssttrruuccttss.. AAfftteerr ttrraannssffoorrmmaattiioonn 224444 ccoolloonniieess wweerree ppiicckkeedd aanndd
sspprreeaadd oonnttoo dduupplliiccaattee LLBB aaggaarr ((SSiiggmmaa)) ppllaatteess ccoonnttaaiinniinngg 110000 m gg//mmll ooff
aammppiicciilllliinn ((FFeerrmmeennttaass,, IInnqqaabbaa BBiiootteecchh)) aanndd IIPPTTGG ((FFeerrmmeennttaass,, IInnqqaabbaa BBiiootteecchh))
ffoorr bblluuee wwhhiittee ccoolloonnyy ssccrreeeenniinngg.. OOnnee ppllaattee wwaass uusseedd ffoorr ccoolloonnyy PPCCRR
1 5 ssccrreeeenniinngg uussiinngg MM1133 pprriimmeerrss ((IIDDTT,, WWhhiitteehheeaadd SScciieennttiiffiicc)) aanndd ttoo pprreeppaarree
oovveerrnniigghhtt ccuullttuurreess ffoorr ggllyycceerrooll ssttoocckkss.. TThhee ootthheerr ppllaattee wwaass sseenntt ttoo IInnqqaabbaa
BBiiootteecchh ffoorr sseeqquueenncciinngg wwiitthh tthhee uunniivveerrssaall MM11 3 pprriimmeerrss ((IInnqqaabbaa BBiiootteecchh))..
SSeeqquueennccee aannaallyyssiiss aanndd aalliiggnnmmeennttss wweerree ppeerrffoorrmmeedd uussiinngg BBiiooeeddiitt.. TThhee
aannaallyyssiiss ooff sseeccoonnddaarryy ssttrruuccttuurree ooff aappttaammeerrss wwaass ppeerrffoorrmmeedd bbyy ffrreeee eenneerrggyy
2200 mmiinniimmiissaattiioonn aallggoorriitthhmm aaccccoorrddiinngg ttoo ZZuukkeerr uussiinngg mmffoolldd
O f the 244 colonies o n the duplicate plates a few were selected for colony
PCR screening using the universal M13 primers t o determine if they had the
2 5 insert o r not. The T 7 selection clones seemed t o all have the insert whereas
the exonuclease clones picked for screening were insert negative. All clones
o n the plates were sequenced.
All 244 clones were sent for sequencing and the sequences were analysed
3 0 using BioEdit . From the 244 sequences, 104 were insert positive ( 1 1 from the
exonuclease selection and 9 3 from the T 7 selection), this confirmed the
results seen in the PCR screen where most o f the exonuclease clones were
insert negative. O f the 1 0 4 sequences that were analysed, 6 6 were unique
and 15 sequences had two or more repeats, 6 aptamers showed significant
binding (Figure 1 and Table 1) .
Table 1: Sequences (5'-3' direction) of ssDNA aptamers that
significantly bound the CFP-10.ESAT-6 M. tb target antigen
EXAMPLE 3 : Binding assay of ssDNA aptamers by ELONA
The assay was modified from an ELISA protocols for determination of
aptamer-protein interactions and has been termed an ELONA. Unique
aptamer clones identified by sequencing were tested for their individual
binding characteristic to the CFP-1 0.ESAT-6 heterodimer using an ELONA.
Each ssDNA aptamer was prepared using the exonuclease method as
described above with minor modifications, in that all aptamers were prepared
with the biotinylated forward primer. For each binding assay, 96 well microtitre
plates (Corning, Adcock Ingram) were coated with the CFP-1 0.ESAT-6
heterodimer in a 10 mM NaHC0 3 buffer pH 8.5 (Sigma) and left overnight at
4°C. The plates were then washed with 1 x phosphate buffered saline
containing 0.005% Tween 20 (PBS-T) pH7 (Sigma) and blocked with a 5% fat
free milk solution for 1 hour at 4°C. The plates were then washed 3 times with
a 1 x PBS after which 150 nM biotinylated aptamer was added and incubated
for 2 hours at room temperature. This was followed by three wash steps with 1
x PBS-T and the addition to HRP-conjugated streptavidin (diluted 1:10000 in 1
x PBS-T) and incubated for two hours at 37°C. The plates were then washed
four more times with 1 x PBS-T, after which a final 3,3',5,5' -
tetramethylbenzidine (TMB) detection substrate (Separations) was added. A
change in colour to blue, which could be observed with a naked eye, indicated
that the aptamers bound to the CFP-10.ESAT-6 heterodimer. The reaction
was stopped with a 2 M sulphuric acid solution (Merck), resulting in a colour
change from blue to yellow. The plates were read on the MultiSkan Go plate
reader (ThermoScientific, AEC-Amersham) at a wavelength of 450 nm. Each
plate had a CFP-1 0.ESAT-6 and an aptamer alone control, which were
averaged and then subtracted from each well to eliminate background noise.
Each aptamer was done in triplicate and the repeats were averaged and the
standard deviation calculated. Each aptamer was tested twice in triplicate to
ensure accuracy. The aptamers were then compared to the aptamer alone
control using a Student t-test statistical analysis to obtain the p value for
significance.
The binding ability of individual aptamers was tested using an ELONA. Out of
the 66 biotinylated ssDNA aptamers screened by ELONA against the CFP-
10.ESAT-6 heterodimer, 24 bound significantly (p<0.05) (Figure 2).
EXAMPLE 4 : Determination of antibody competition binding of
individual ssDNA aptamers by ELONA
Only the 24 aptamers that bound significantly to the heterodimer were used in
further studies. The antibody competition binding was done using the ELONA
method described above with minor modifications. The antibody was bound to
the plate; then blocked followed by the addition of the heterodimer. The
biotinylated aptamer was the added, followed by the HRP-conjugated
streptavidin. Each combination was done in triplicate and repeated in two
independent assays. The antibody competition data was compared with the
binding assay to identify differences in binding capacity of the aptamers in the
presence of the antibody. Although the competition assay and binding assay
were done on different plates, the positive control (protein and aptamer CSIR
2 . 1) were run on both plates with similar results to normalise the data on the
two plates.
The positive control ran on both plates was used to normalise the results
between ELONA experiments. Binding of some ssDNA aptamers such as
CSIR 2.15, CSIR 2.9 and CSIR 2.21 was abrogated by the presence of anti-
ESAT-6 monoclonal antibody while binding of other aptamers such as CSIR
2.2 and CSIR 2.12 was enhanced by the presence of the anti-ESAT-6
monoclonal antibody (Figure 3). Taken together, these data suggest that
some aptamers such as CSIR 2.15, CSIR 2.9 and CSIR 2.21 bind to a similar
epitope on the heterodimer as that recognised by the anti-ESAT-6 monoclonal
antibody while others such as CSIR 2.2 and CSIR 2.12 bind to more distant
and unique epitopes.
EXAMPLE 5 : Determination of monomer binding and specificity of
individual aptamers by ELONA
Selected ssDNA aptamers were tested for binding specificity to the ESAT-6
and CFP-10 monomers. The aptamers were tested for binding using ELONA
to CFP-10, ESAT-6, CFP-10. ESAT-6 heterodimer, a CFP-10. ESAT-6 related
protein in the ESX3 secretion system (EsxGH complex) and a HIV surface
glycoprotein (gp1 20). EsxGH is an ESAT-6 family related protein that is
encoded and secreted by the ESX-3 secretion system and gp1 20 is a HIV
glycoprotein which is unrelated to the Mtb antigens.
CSIR 2.1 1 aptamer was used to test the specificity of the aptamer in relation
to other bacterial lysates. Lysates were obtained by bead beating 100 ml of
cultures of Pseudomonas aeruginosa (Pseudomonas), Streptococcus
pyogenes (Streptococcus), Mycobacterium smegmatis (Smegmatis) and the
auxotroph of Mycobacterium tuberculosis (Auxotroph). The cutoff for
specificity was determined by a 99% confidence interval of a known negative
sample.
The 24 ssDNA aptamers that significantly bind to the heterodimer were tested
for monomer binding and specificity. The proteins used for specificity
screening were the monomers (CFP-1 0 and ESAT-6), the heterodimer (CFP-
10. ESAT-6), an ESAT-6 family heterodimer (EsxGH) and an unrelated protein
(gp120). While most aptamers specifically bound the CFP-1 0.ESAT-6
heterodimer, interestingly, two of the 24 aptamers (CSIR 2.1 and CSIR 2.12)
also bound gp120 to a similar extent or better than the CFP-10.ESAT-6
heterodimer (Figure 4). None of the aptamers were able to detect EsxGH
(Figure 4). It was also interesting to note that while most aptamers also
recognised the CFP-10 monomer in addition to the CFP-10.ESAT-6
heterodimer; none of the 24 aptamers screened recognised the ESAT-6
monomer (Figure 4).
Six of the best aptamers were chosen and custom synthesized by
Independent DNA Technologies (IDT) using the solid phase chemical
manufacturing process. The six aptamers chosen were CSIR 2.2, CSIR 2.9,
CSIR 2.15, CSIR 2.1 9, CSIR 2.21 and CSIR 2.1 1. The binding of these
aptamers to their CFP-10. ESAT-6 M. tb target proteins, as well as to the CFP-
10 and ESAT-6 monomers was repeated to confirm that the aptamers could
be chemically synthesized at an industrial scale with a biotin modification and
still retain their respective activities. Although the readings of all the
synthesized aptamers gave higher readings (Figure 5) when compared to the
in vitro produced aptamers (Figure 4), there was no significant difference
between the aptamers synthesized in house by PCR and those custom
synthesized by Independent DNA Technologies (IDT) using the solid phase
process. The results were consistent because all the six aptamers also
recognized the CFP-10. ESAT-6 heterodimer and the CFP-1 0 monomer but
not the ESAT-6 monomer (Figure 5).
CSIR 2.1 1 was chosen as one of the best aptamers for further specificity test
against other bacterial lysate using the auxotroph strain of Mycobacterium
tuberculosis (M. tb) as a positive control. CSIR 2.1 1 did not recognise
pseudomonas or streptococcus, but recognised the lysate of Mycobacteria
smegmatis (Figure 6). This is not surprising as Mycobacteria smegmatis also
secretes the CFP-10 protein.
EXAMPLE 6 : Determination of the dissociation constant (K ) of an
individual ssDNA aptamer using the BIAcore 3000
To determine the binding affinity of aptamers to the M.tb antigens, all four flow
cells on a CM5 chip (BIAcore, Separations Scientific) were activated with
EDC:NHS (BIAcore, Separations Scientific). CFP-10 was bound to three of
the four flow cells by injecting 50 m I of 50 mg/ml CFP-10 over them.
Ethanolamine (BIAcore, Separations Scientific) was then injected over all four
flow cells to quench any remaining active sites. Partially bound or unbound
protein was removed by a wash with 10 m I of a 10 mM NaOH solution.
Different concentrations of the respective aptamers (0 nM, 3 1 nM, 62 nM, 125
nM, 250 nM, and 500 nM) were randomly injected over all four flow cells at a
flow rate of 10 m I/min for 5 minutes. The respective aptamers, were then
allowed to dissociate for 10 minutes. The flow cell that did not have the
aptamer was used as the blank flow cell to subtract non-specific binding. The
evaluation was done using BiaEvaluation Software (BIAcore) to determine the
K D values for each flow cell. The average dissociation constant was then
determined.
The dissociation constant (KD) of 5 selected aptamers, CSIR 2.2; CSIR 2.1 1;
CSIR 2.15; CSIR 2.19 and CSIR 2.1 9 were determined using the BIAcore
surface plasmon resonance technology . CSIR 2.19 had the lowest KD at
1.6±0.5 nM, while CSIR 2.1 1 had a KD of 8±1 .07 nM and CSIR 2.2 had
comparatively the highest K D at 2 1.5±4.3 nM (Figure 7).
EXAMPLE 7 : Determination of whether aptamer folding affects the
binding to the target
It was important to determine if the aptamers needed to be refolded for further
studies as this would impact on their downstream application. One batch of
CSIR 2.1 1 aptamer was folded as described above while another batch was
used directly after thawing to determine if the aptamer could be used without
the refolding step. An ELONA was preformed with both batches of aptamer
against CFP-1 0. The results show that the aptamer can be used directly from
the freezer without the refolding step (Figure 8).
EXAMPLE 8 : Limit of detection
CFP-10 was bound to a 96 well plate (Corning, Adcock Ingram) in serial
dilutions in a NaHCC>3 buffer and left overnight at 4°C. The plates were then
washed with 1 x phosphate buffer saline solution containing 0.005% Tween
20 (PBS-T) pH7 (Sigma) and blocked with a 5% fat free milk solution for 1
hour at 4°C. The plates were then washed 3 times with a 1 x PBS-T after
which 150 nM biotinylated EA10 aptamer was added and incubated for 2
hours at room temperature. This was followed by three wash steps with 1 x
PBS-T and the addition of HRP-conjugated streptavidin (diluted 1:10000 in 1 x
PBS-T) and incubated for two hours at 37°C. The plates were then washed
four more times with 1 x PBS-T, after which the 3,3',5,5' -
tetramethylbenzidine (TMB) detection substrate (Separations) was added. A
change in colour to blue, which could be observed with a naked eye, indicated
that the aptamers bound to the CFP-1 0 protein. The reaction was stop with a
2 M sulphuric acid solution (Merck), at which point the blue colour observed
changes to yellow. The plates were then read on the MultiSkan Go plate
reader (ThermoScientific, AEC-Amersham) at a wavelength of 450 nm. Each
plate had a CFP-10 and an aptamer alone control, which were averaged and
then subtracted from each well to eliminate background noise. Each dilution
was done in triplicate, the repeats averaged and the standard deviation
calculated.
Serial dilutions of CFP-10 coated on a 96 well micro-titer plate showed that
150 nM of CSIR 2.1 1 aptamer is able to detect as little as 3 1 ng of CFP-10
(Figure 9). The best fit curve had an R2 value of 0.85.
EXAMPLE 9 : Evaluation of clinical samples from patients with or without
active TB
Twenty sputum samples that had been well characterized (Table 2) were
used. Briefly, they included: (a) smear positive - culture positive; (b) smear
negative - culture positive; (c) smear negative - culture negative, quantiferon
positive and TSPOT positive; and (d) smear negative - culture negative,
quantiferon negative and TSPOT negative. These sputum samples had been
liquefied in a 0.1% dithiothreitol (DTT) solution. The sputum samples were
bound to a 96 well micro-titer plate (Corning, Adcock Ingram) in a NaHCO3
buffer and left overnight at 4°C. The plates were then washed with 1 x PBS-T
pH7and blocked with a 5% fat free milk solution for 1 hour at 4°C. The plates
were then washed 3 times with a 1 x PBS-T after which 300 nM biotinylated
EA10 aptamer was added and incubated for 2 hours at room temperature.
This was followed by three wash steps with 1 x PBS-T and the addition of
HRP-conjugated streptavidin (diluted 1: 1 0000 in 1 x PBS-T) and incubated for
two hours at 37°C. The plates were washed four more times with 1 x PBS-T,
after which a final TMB (Separations) detection substrate was added. A
change in colour to blue, which could be observed with a naked eye, indicated
that the aptamers bound to the CFP-10 protein. The reaction was stopped
with a 2 M sulphuric acid solution (Merck) at which point the blue colour
observed changed to yellow. The plates were then read on the MultiSkan Go
plate reader (ThermoScientific, AEC-Amersham) at a wavelength of 450 nm.
Each plate had an aptamer alone control, which were averaged and then
subtracted from each well to eliminate background noise. Each sample was
done in triplicate, averaged and the standard deviation was calculated; the
experiment was repeated twice to determine repeatability of the assay. An
aptamer selected from the same library against a different target was used as
a control (CSIR 3.13). The cutoff for specificity was determined by a 99%
confidence interval of a known negative sample.
Table 2 : Characteristics of sputum samples obtained from patients with
or without active TB. Based on the results of tests used to characterise the
samples, the samples were broadly classified as No TB; Latent TB; or Active
TB as denoted in the parenthesis. Numbers were assigned to the samples
during the study in order to match the patients' numbers.
The CSIR 2.1 1 ssDNA aptamer was able to accurately detect 4 of the 5 smear
positive - culture positive samples as positive (80%), 4 of the 5 smear
negative - culture positive samples as positive (80%); but it also detected one
sample classified as no TB (sample 139, which is all negative for quantiferon,
TSPOT, smear and culture tests), as positive (Figure 10). In addition, CSIR
2.1 1 detected 3 of the 5 samples classified as latent TB (quantiferon and
TSPOT positive but smear and culture negative) as positive (Figure 14). The
control ssDNA aptamer, CSIR 3.1 3, which was derived from the same
parental library but isolated against, and specific for human CD7 was negative
for all the samples, as expected (data shown for only 1 sample on Figure 10).
The cut-off for negative results using the aptamers was determined to be an
OD450 below 0.2 at 99% confidence interval based on a known negative
sample (Figure 10). Taken together, and based on the classification for latent
TB used in characterizing the samples, CSIR 2.1 1 ssDNA aptamer had a
specificity of 60% (i.e. correctly identified 6/10 samples as negative) and a
sensitivity of 80% (i.e. correctly identified 8/10 samples as positive) using the
ELONA readout platform. Notwithstanding, two of the false negatives samples
in this study (samples 36 and 59) were inconclusive because they were on the
border line of the cut-off (Figure 10). If they were taken as positive the
sensitivity of CSIR 2 . 1 would increase from 80% to 00%.
Evaluation of 80 sputum samples using CSIR 2.1 1 as detection reagent was
conducted, the results of which are illustrated in Figure 11. The aptamer was
tested on three groups of samples (A) Definite TB, (B) Latent TB and TB
negative and (C) healthy laboratory volunteers. Using Youden's index, the cutpoint
for positive samples was set at an OD450 of 0.2 and is indicated by the
dotted line. Data are presented as mean ± standard deviation of the mean.
Current diagnostics for TB have many disadvantages, especially when used in
resource-poor settings, which also happen to be high in TB incidence and
prevalence. The current gold standard for TB diagnostics is a combination of
smear microscopy and culture methods. The advantage of smear microscopy
is the relatively low cost. The main disadvantage is that smear microscopy
has low sensitivity (35 - 75 %), especially among HIV positive patients. While
the culture method increases sensitivity to over 90 %, it takes 6 - 8 weeks to
get results and the method also requires highly trained personnel and
specialized containment level 3 facilities. The culture method currently costs
about $10 per sample, excluding the exorbitant costs of establishing and
maintaining a containment level 3 laboratory. There seem to be a correlation
between the duration of test, cost of test and sensitivity. Serological tests are
rapid and relatively inexpensive but have poor sensitivity (16-75 %), NAATs
are rapid but only have a sensitivity of 60-70 %. The GeneXpert® is a fully
automated molecular test with a sensitivity of 60-80 % but is currently not a
cost effective method for poor resource settings. It currently costs about $20
USD per sample, excluding the high price of the instrument. Despite current
achievements, there is still a need for an Affordable, Sensitive, Specific, Userfriendly,
Rapid, Equipment-free and Deliverable to end user (ASSURED) TB
diagnostics.
DNA aptamers by virtue of their simplicity, specificity, sensitivity and low costs
of production can serve as ASSURED TB diagnostics, thus meeting the needs
of a diagnostic tool that is required in underdeveloped and high burden TB
countries. In a current proof-of-concept study, using the ELONA readout
platform, we showed that a single stranded DNA aptamer called CSIR 2.1 1
isolated against the CFP-10.ESAT-6 Mycobacterium tuberculosis target
protein can detect TB in well characterized clinical sputum samples of TB
patients from a high HIV prevalence country with a sensitivity of 80-100 %
and specificity of 60 % if latent TB is considered negative.
The two false negative readings are on the border line of the cut-off and the
results are thus inconclusive. They could be classed as either positive or
negative. The reason for the strikingly false positive sample (139) is hard to
find, unless the sample was cross-contaminated during the process of
acquiring sputum and/or during sample preparation and storage.
The low cost of $0.52 USD (R3.67 ZAR) per sample for the aptamer-based
ELONA for TB detection and the rest of data in general, including the 80-1 00
% sensitivity, demonstrate that the aptamers of the present invention can be
used successfully and economically in ASSURED TB diagnostics.
EXAMPLE 10
Further characterisation and optimisation of the anti-ESAT-6.CFP-10
aptamers yielded active, affordable TB detection molecules for the potential
development of a PoC TB diagnostic tool.
Rational truncation of the original sequences yielded shorter, lower cost
molecules that show comparable activity to the original parent sequences.
The truncated versions of the aptamers retained the parts of the original
(parent) aptamers predicted to play a role in target-binding as can be
predicted through secondary structures
Truncation of aptamer CSIR 2.1 1 was effected by secondary structure (2D)-
guided methods. The predicted 2D structure for the original sequence of
aptamer CSIR 2.1 1 consists of three stem-loops.Truncation, T2, (77-mer)
resulted from cutting out 12 nucleotide bases in the direction 3' to 5'. All the
stem-loops, along with their assigned minimum free energy, are all retained in
the predicted 2D structures of both truncated versions of the aptamer.
Truncation of aptamer CSIR 2.19 was effected by secondary structure (2D)-
guided methods. The predicted 2D structure for the original sequence of
aptamer CSIR 2.19 consists of two stem-loops. CSIR 2.1 9 Truncated (77-mer)
resulted from cutting out 12 nucleotide bases in the direction 3' to 5'. Both
stem-loops, along with their assigned minimum free energy values, are all
retained in the predicted 2D structures of both truncated versions of the
aptamer.
The truncated aptamers show binding to target proteins, with affinities
comparable to those of the parent sequences (Figure 12).
Binding of full length and truncated aptamers to the ESAT-6/CFP-1 0 dimer
and CFP-1 0 was assessed by ELONA.
Figure 12A shows apparent binding of CSIR 2.1 1: the truncated 77-mer bound
to the target proteins with affinity values comparable to those of the original
90-mer aptamer.
Figure 12B shows apparent binding of CSIR 2.19 aptamer: the 77-mer bound
to the target proteins with affinity values comparable to those of the original
90-mer aptamer for both ESAT-6/CFP-1 0 dimer and the CFP-1 0 monomer.
The 77-mer showed slightly higher affinity (* P-value <0.05) for the ESAT-
6/CFP-10 dimer than did the 90-mer.
The truncated aptamers can be used in an aptamer-based TB diagnostic tool.
EXAMPLE 11
The original full length aptamers can be used in pairs for further use in a
diagnostic setting. To test the aptamers in a sandwich ELONA, 96 well microtitre
plates (Corning, Adcock Ingram) were coated with the CSIR2.1 1 in a 10
mM NaHCC>3 buffer pH 8.5 (Sigma) and left overnight at 4°C. The plates were
then washed with 1 x phosphate buffered saline containing 0.005% Tween 20
(PBS-T) pH7 (Sigma) and blocked with a 5% fat free milk solution for 1 hour at
4°C. The plates were then washed 3 times with a 1 x PBS-T after which
500ng of CFP-1 0.ESAT-6 heterodimer was added and incubated for 2 hours
at room temperature. This was followed by three wash steps with 1 x PBS-T
and the addition of 150 nM biotinylated aptamer and incubated for a further
two hours at room temperature. Following this the plate was washed 3 times
with a 1 x PBS-T after which a HRP-conjugated streptavidin (diluted 1: 1 0000
in 1 x PBS-T) was added and incubated for two hours at 37°C. The plates
were then washed four more times with 1 x PBS-T, after which a final 3,3', 5,5'
- tetramethylbenzidine (TMB) detection substrate (Separations) was added. A
change in colour to blue, which could be observed with a naked eye, indicated
that the aptamers function in a sandwich format. The reaction was stopped
with a 2 M sulphuric acid solution (Merck), resulting in a colour change from
blue to yellow. The plates were read on the MultiSkan Go plate reader
(ThermoScientific, AEC-Amersham) at a wavelength of 450 nm. The pairs
were then compared to the no protein pair control using a Student t-test
statistical analysis to obtain the p value for significance.
Several potential pairs have been identified, as shown in Figure 13.
EXAMPLE 12
Evaluation of sputum samples using CSIR 2.21 as detection reagent was
conducted and compared to the results using CSIR 2.1 . A comparison of the
ability of CSIR 2.21 and CSIR 2.1 1 was performed on 28 sputum smaples to
evaluate the use of CSIR 2.21 in a clinical setting. The comparison was done
using an ELONA as in Example 9 using either CSIR 2.1 1 or CSIR 2.21 as a
detection molecule. The comparison is illustrated by Figure 14 and indicates
that both aptamers yielded similar results. As illustrated by Figure 14, the
sensitivity and specificity of CSIR 2.1 1 and a more specific aptamer, CSIR
2.21 , were compared using 28 sputum samples. Using Youden's index, the
cut-point for positive samples was set at an OD 50 of 0.1 and is indicated by
the solid line. Data are presented as means ± standard deviation of the mean.
Samples that gave a positive result when using CSIR 2.21 as a detection
molecule are denoted as CSIR 2.21 positive, while negative samples are
denoted as CSIR 2.21 negative. Samples that gave a positive result when
using CSIR 2.1 1 as a detection molecule are denoted as CSIR 2.1 1 positive,
while negative samples are denoted CSIR 2.1 1 negative.
EXAMPLE 13
The aptamers were tested for the detection of whole bacteria, which is useful
for diagnostics. To evaluate the aptamers detection of whole bacteria, an
ELONA similar to that described in Example 9 was performed, except instead
of coating with sputum samples the plate was coated with MTB culture at an
OD6oo = 1, OD6oo = 0.5 and OD60o = 0.25. The whole bacteria ELONA
experiments were conducted using the six aptamers: CSIR 2.1 1, CSIR 2.19,
CSIR 2.21 , CSIR 2.1 5, CSIR 2.2 and CSIR 2.9. All six of the aptamerswere all
able to detect whole bacteria as illustrated in Figure 15.
While the invention has been described in detail with respect to specific
embodiments thereof, it will be appreciated that those skilled in the art, upon
attaining an understanding of the foregoing may readily conceive of alterations
to, variations of and equivalents to these embodiments. Accordingly, the
scope of the present invention should be assessed as that of the appended
claims and any equivalents thereto.
CLAIMS
1. An oligonucleotide selected from the group comprising SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID NO: 5 and SEQ
ID NO: 6, a complementary oligonucleotide thereof, an oligonucleotide being
at least 80% homogolous thereto, a truncated portion of any of the
aforementioned, or a pairing of any of the aforementioned.
2. The oligonucleotide of Claim 1, which is single stranded.
3. The oligonucleotide of Claim 1, which is double stranded.
4. The oligonucleotide of any one of Claims 1 to 3 inclusive, which
is an aptamer, a truncated portion of an aptamer, or a pairing thereof, that
binds to a CFP-1 0.ESAT-6 heterodimer of a Mycobacterium strain.
5. The oligonucleotide of any one of Claims 1 to 3 inclusive, which
is an aptamer, a truncated portion of an aptamer, or a pairing thereof, that
binds to a CFP-1 0 monomer of a Mycobacterium strain.
6. The oligonucleotide of Claim 4 or Claim 5, wherein the
Mycobacterium strain is the Mycobacterium tuberculosis (M.tb) strain.
7. An oligonucleotide which is an aptamer, a truncated portion of
an aptamer, or a pairing thereof, that binds to a CFP-1 0.ESAT-6 heterodimer
or to a CFP-1 0 monomer of a Mycobacterium strain.
8. The oligonucleotide of Claim 7 which is selected from the group
comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ
ID NO: 5 and SEQ ID NO: 6, a complementary oligonucleotide thereof, an
oligonucleotide being at least 80% homogolous thereto, a truncated portion of
any of the aforementioned, or a pairing of any of the aforementioned.
9. An in vitro method of diagnosing tuberculosis (TB), said method
comprising :
(a) contacting a sample taken from an ind ividual suspected to be
infected with TB with the oligonucleotide of Claim 1 or Claim 8 in
a CFP-1 0.ESAT-6 heterodimer bind ing assay; and
(b) determ in ing whether or not the oligonucleotide has bound to a
CFP-1 0.ESAT-6 heterod imer in the sample, with binding of the
oligonucleotide to the CFP-1 0 .ESAT-6 heterodimer thus
confirming the presence of the CFP-1 0.ISAT-6 heterodimer, and
hence TB infection in the sample.
An in vitro method of diagnosing tuberculosis (TB), said method
contacting a sample taken from an ind ividual suspected to be
infected with TB with the oligonucleotide of Claim 1 or Claim 8 in
a CFP-1 0 monomer binding assay; and
determ in ing whether or not the oligonucleotide has bound to a
CFP-1 0 monomer in the sample, with binding of the
oligonucleotide to the CFP-1 0 monomer thus confirming the
presence of the CFP-1 0 monomer, and hence TB infection in the
sample.
1 . The method of Claim 9 or Claim 10, wherein the bind ing assay is
a mod ified ELISA-type assay, wherein the antibod ies against the
CFP-1 0.ESAT-6 heterod imer or the CFP-1 0 monomer are replaced by the
oligonucleotide of Claim 1 or Claim 8.
12. The method of any one of Claims 9 to 11 inclusive, wherein the
oligonucleotide is that of SEQ ID NO: 3.
13 . A diagnostic kit for diagnosing tuberculosis (TB), said kit
including :
(a) a device for taking a sample from an ind ividual suspected to be
infected with TB;
(b) apparatus for applying the method of diagnosing TB according
to Claim 9 or Claim 10; and
(c) optionally, a positive control and/or a negative control.
14. A nucleic acid comprising an oligonucleotide sequence selected
from SEQ. ID.NO: 1, SEQ ID NO: 2, SEQ ID NO: 3; SEQ ID NO: 4; SEQ ID
NO: 5 and SEQ ID NO: 6, a complementary oligonucleotide thereof, an
oligonucleotide being at least 80% homologous thereto, a truncated portion of
any of the aforementioned, or a pairing of any of the aforementioned.
| # | Name | Date |
|---|---|---|
| 1 | SPEC FOR E-FILING.pdf | 2014-04-11 |
| 2 | P53037PC00-seql.txt | 2014-04-11 |
| 3 | FORM 5.pdf | 2014-04-11 |
| 4 | FORM 3.pdf | 2014-04-11 |
| 5 | 2779-DELNP-2014.pdf | 2014-04-22 |
| 6 | 2779-delnp-2014-GPA-(22-05-2014).pdf | 2014-05-22 |
| 7 | 2779-delnp-2014-Correspondence-Others-(22-05-2014).pdf | 2014-05-22 |
| 8 | 2779-delnp-2014-Assignment-(22-05-2014).pdf | 2014-05-22 |
| 9 | 2779-delnp-2014-Form-3-(18-06-2014).pdf | 2014-06-18 |
| 10 | 2779-delnp-2014-Correspondence-Others-(18-06-2014).pdf | 2014-06-18 |
| 11 | 2779-DELNP-2014-Form 3-171114.pdf | 2014-12-03 |
| 12 | 2779-DELNP-2014-Correspondence-171114.pdf | 2014-12-03 |
| 13 | 2779-delnp-2014-Form-3-(09-06-2015).pdf | 2015-06-09 |
| 14 | 2779-delnp-2014-Correspondence Others-(09-06-2015).pdf | 2015-06-09 |
| 15 | 2779-DELNP-2014-Form-3-(28-12-2015).pdf | 2015-12-28 |
| 16 | 2779-DELNP-2014-Correspondence Others-(28-12-2015).pdf | 2015-12-28 |
| 17 | Form 3 [21-07-2016(online)].pdf | 2016-07-21 |
| 18 | Form 3 [15-02-2017(online)].pdf | 2017-02-15 |
| 19 | 2779-DELNP-2014-FER.pdf | 2019-05-30 |
| 20 | 2779-DELNP-2014-AbandonedLetter.pdf | 2019-12-18 |
| 1 | searchstrategy_29-05-2019.pdf |