Sign In to Follow Application
View All Documents & Correspondence

Incorporation Of Unnatural Amino Acids Into Proteins

Abstract: The invention relates to a method for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell said method comprising the steps of: i) providing a eukaryotic cell expressing an orthogonal tRNA synthetase  t RNA pair a nucleic acid sequence of interest encoding said protein of interest and a mutant eRF1 said mutant eRF1 having amino acid sequence having at least 60% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4 said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the position for incorporation of an unnatural amino acid; ii) incubating the eukaryotic cell in the presence of an unnatural amino acid to be incorporated into a protein encoded by the nucleic acid sequence of interest wherein said unnatural amino acid is a substrate for the orthogonal tRNA synthetase; and iii) incubating the eukaryotic cell to allow incorporation of said unnatural amino acid into the protein of interest via the orthogonal tRNA synthetase  t RNA pair. The invention also relates to uses host cells combinations and kits.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
18 April 2017
Publication Number
31/2017
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Parent Application
Patent Number
Legal Status
Grant Date
2021-06-25
Renewal Date

Applicants

MEDICAL RESEARCH COUNCIL
2nd Floor David Philips Building Polaris House North Star Avenue Swindon SN2 1FL

Inventors

1. CHIN Jason W.
MRC Laboratory of Molecular Biology Francis Crick Avenue Cambridge Biomedical Campus Cambridge Cambridgeshire CB2 0QH
2. SCHMIED Wolfgang H.
MRC Laboratory of Molecular Biology Francis Crick Avenue Cambridge Biomedical Campus Cambridge Cambridgeshire CB2 0QH
3. ELSASSER Simon J.
MRC Laboratory of Molecular Biology Francis Crick Avenue Cambridge Biomedical Campus Cambridge Cambridgeshire CB2 0QH
4. KYM Eugene Y.
MRC Laboratory of Molecular Biology Francis Crick Avenue Cambridge Biomedical Campus Cambridge Cambridgeshire CB2 0QH

Specification

INCORPORATION OF UNNATURAL AMINO ACIDS INTO PROTEINS
FIELD OF THE INVENTION
The present invention is in the general field of protein expression, in particular the
incorporation of an unnatural amino acid(s) into a protein of interest.
BACKGROUNDTO THE INVENTION
Genetic code expansion has allowed the site-specific incorporation of more than a
hundred unnatural amino acids into proteins. However, the utility of these approaches
may be limited by the efficiency with which unnatural amino acids are incorporated
into proteins. The efficient, co-translational, site-specific incorporation of unnatural
amino acids into proteins will enable emerging approaches for creating site-specifically
modified recombinant proteins (1, 2), as well as strategies to precisely control and
image protein function in vivo (3, 4), and many other approaches in which designer
unnatural amino acids are used to control or report on protein function.
Orthogonal tRNA synthetase/tRNA pairs direct the incorporation of unnatural amino
acids, most commonly in response to the amber stop codon (UAG). The efficiency of
unnatural amino acid incorporation is defined both by i) the intrinsic efficiency with
which the orthogonal synthetase/tRNA pair enables translational elongation in
response to a UAGcodon in the A site of the ribosome, and ii) the efficiency with which
release factors compete with the aminoacylated orthogonal tRNAcuA to terminate
protein synthesis. The pyrrolysyl-tRNA synthetase (PylRS)/tRNAcuA pair is arguably
the most useful pair to be developed for genetic code expansion because i) it is
orthogonal in a range of hosts including E. coli, yeast, mammalian cells, C. elegans and
D. melanogaster, ii) PylRS does not recognize the common 20 amino acids, iii) PylRS
does not recognize the anticodon of its cognate tRNAcuA, iv) the active site of PylRS
accommodates a range of unnatural amino acids bearing useful functional groups
without the need for directed evolution, v) the active site of PylRS can be evolved to
recognize structurally diverse unnatural amino acids bearing a range of useful
functional groups in E. coli and vi) the synthetase variants discovered in E. coli may be
used in diverse eukaryotic hosts, where directed evolution of synthetases is challenging
to implement (5).
Unnatural amino acid incorporation is currently less efficient in eukaryotic cells than in
E. coli. The efficient, site-specific introduction of unnatural amino acids into proteins
in eukaryotic cells is an outstanding challenge in realizing the potential of genetic code
expansion approaches. Addressing this challenge will allow the synthesis of modified
recombinant proteins in eukaryotic cells and augment emerging strategies that
introduce new chemical functionalities into proteins to control and image their
function with high spatial and temporal precision in eukaryotic cells.
The present invention seeks to address this need.
SUMMARYOF THE INVENTION
The present inventors have developed an expression system based on orthogonal
synthetase/tRNA pairs for efficiently incorporating one or more unnatural amino acids
into a protein of interest expressed in a eukaryotic cell - such as a mammalian cell or
an insect cell. Advantageously, the expression system described herein increases the
efficiencyof unnatural amino acid incorporation in such cells.
In addition, the present inventors have engineered eRF1 - that normally terminates
translation on all three stop codons in mammalian cells - to provide a substantial
increase in unnatural amino acid incorporation in response to the TAGcodon without
increasing read-through of other stop codons. The data presented herein provide the
first demonstration that - despite native eRF1 recognizing all three stop codons - it is
possible to engineer eRF1 to selectively enhance the efficiency of unnatural amino acid
incorporation in eukaryotic cells in response to the amber stop codon, without
increasing read through of opal or ochre stop codons.
Release factors exist in prokaryotic systems - such as E. coli expression systems.
Temperature sensitive release factors - such as tsRFi have been studied for the
transient increase of amber suppression in prokaryotic expression systems. The
interaction of bacterial RFi with rRNA has been pinpointed to the 530 loop of rRNAin
prokaryotic systems. For example, WO 2008/065398 makes mention of this
interaction at page 4, lines 31 to 35. However, there is no crossover from the E. coli
system to eukaryotic systems which are the subject of the invention. There is no direct
analogy between the prokaryotic and eukaryotic proteins apart from their names.
It is not possible to transfer mutants from the very different bacterial proteins to
eukaryotic proteins which are the subject of the present invention. In the prokaryotic
system, different RF proteins carry out different biological functions - compared to
eukaryotic systems there is a "split function" arrangement having a very different
biology. By contrast, in eukaryotic systems a single eRF1 protein provides multiple
termination functions. Therefore, the mammalian eRF1 protein can be considered to
be technically very different from the release factor proteins in prokaryotic systems.
Thus, strategies developed in E. coli to enhance unnatural amino acid incorporation in
response to the amber codon through selective disruption of RFi function (12-16)
cannot be extended to the eukaryotic system. Certain eRF1 mutants are known in the
art. These mutants have been described purely in the course attempting to study eRF1
function. The disclosures focus on academic studies of eRF1 biology. In contrast, the
present inventors teach for the first time the use of certain eRF1 mutants in
incorporation of unnatural amino acids into proteins. Indeed, there are no known
reports of engineering the eukaryotic translational machinery to enhance the efficiency
with which unnatural amino acids are site-specifically incorporated into proteins in
eukaryotic cells using orthogonal tRNA synthetase/tRNA pairs. The inventors are the
first to realise the utility of the eRF1 mutants in the context of amber codon expression
systems.
It is therefore an advantage of the present invention that the inventors teach for the
first time enhanced suppression of amber codons by use of eRF1 mutants. It is
therefore an advantage of the present invention that the inventors teach for the first
time use of eRF1 mutants in enhanced suppression of amber codons.
Advantageously, by combining the improved expression system with the engineered
eRF1, the yield of protein bearing a single unnatural amino acid is increased 17- to 20-
fold. Proteins can be produced containing unnatural amino acids with comparable
yields to proteins produced from a gene that does not contain a stop codon. Moreover
the improved system increases the yield of protein, incorporating an unnatural amino
acid at multiple sites (for example, 3 or more sites) from unmeasurably low levels up to
43% of a no amber stop control. This approach may enable the efficient production of
site-specifically modified therapeutic proteins, and the quantitative replacement of
targeted cellular proteins with versions bearing unnatural amino acids that allow
imaging or synthetic regulation of protein function.
Advantageously, the present disclosure may enable the efficient production of sitespecifically
modified therapeutic proteins in eukaryotic cells, as well as the quantitative
replacement of targeted cellular proteins with versions bearing unnatural amino acids
that allow imaging or synthetic regulation of protein function.
Thus in one aspect the invention provides a method for incorporating an unnatural
amino acid into a protein of interest in a eukaryotic cell, said method comprising the
steps of:
i) providing a eukaryotic cell expressing an orthogonal tR A synthetase - tRNA
pair, a nucleic acid sequence of interest encoding said protein of interest, and a mutant
eRF1, said mutant eRF1 having amino acid sequence having at least 67% sequence
identity to the human wild type eRF1 sequence of SEQ IDNO: 4,
said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the
position for incorporation of an unnatural amino acid;
ii) incubating the eukaryotic cell in the presence of an unnatural amino acid to be
incorporated into a protein encoded by the nucleic acid sequence of interest, wherein
said unnatural amino acid is a substrate for the orthogonal tRNA synthetase; and
iii) incubating the eukaryotic cell to allow incorporation of said unnatural amino
acid into the protein of interest via the orthogonal tRNA synthetase - tRNA pair.
In one aspect, the invention relates to use of a mutant eRF1, said mutant eRF1 having
amino acid sequence having at least 60%, more suitably 67%, sequence identity to the
human wild type eRF1 sequence of SEQ ID NO: 4, for incorporating an unnatural
amino acid into a protein of interest in a eukaryotic cell.
In one aspect, the invention relates to a mutant eRF1 polypeptide, said mutant eRF1
having amino acid sequence having at least 60%, more suitably 67%, sequence identity
to the human wild type eRF1 sequence of SEQ ID NO: 4, or a nucleic acid encoding
same, for use in aiding incorporation of an unnatural amino acid into a polypeptide of
interest by translation of nucleic acid encoding said polypeptide of interest, said nucleic
acid comprising an orthogonal codon directing incorporation of said unnatural amino
acid into said polypeptide of interest.
In one aspect, the invention relates to a eukaryotic host cell comprising the mutant
eRF1 polypeptide or nucleic acid as described above.
In one aspect, the invention relates to a eukaryotic host cell comprising
(i) an orthogonal tRNA synthetase - tRNA pair, and
(ii) a mutant eRF1, said mutant eRF1 having amino acid sequence having at least
60%, more suitably 67%, sequence identity to the human wild type eRF1 sequence of
SEQ IDNO: 4, and optionally
(iii) a nucleic acid sequence of interest encoding a protein of interest, said nucleic
acid sequence of interest comprising a codon recognised by the tRNA at a position for
incorporation of an unnatural amino acid.
In one aspect, the invention relates to a combination or kit comprising nucleic acid(s)
encoding:
(i) an orthogonal tRNA synthetase - tRNA pair, and
(ii) a mutant eRF1, said mutant eRF1 having amino acid sequence having at least
60%, more suitably 67%, sequence identity to the human wild type eRF1 sequence of
SEQ IDNO: 4, and optionally
(iii) a nucleic acid sequence of interest encoding a protein of interest, said nucleic
acid sequence of interest comprising a codon recognised by the tRNA at a position for
incorporation of an unnatural amino acid.
In one aspect, the invention relates to a eukaryotic host cell as described above or a
combination or kit as described above, further comprising an unnatural amino acid
such as BocK or CypK or BCNK; more suitably BocK or CypK.
Suitably said mutant eRF1 provides increased efficiency of unnatural amino acid
incorporation relative to a wild type eRF1 control.
Suitably said mutant eRF1 comprises a mutation or combination of mutations relative
to SEQ ID NO: 4 selected from the group consisting of
(0 E55
(ii) N129, K130
(iii) T122, S123
(iv) Y125
(v) T58, S60, S64, L125, N129
(vi) S123, L124, Y125
(vii) S123, L124, Y125
(viii) S123, L124, Y125
( ) 51, K130
(x) S123, L124, Y125
(xi) S123, L124, Y125
(xii) S123, L124, Y125
(xiii) S123, L124, Y125
Suitably said mutant eRF1 comprises a mutation or combination of mutations relative
to SEQ ID NO: 4 selected from the group consisting of
(0 E55D
(ii) N129P, K130Q
(iii) T122Q, S123F
(iv) E55A
(v) Y125F
(vi) T58K, S60T, S64D, L125F, N129S
(vii) S123A, L124I, Y125L
(viii) S123R, L124W, Y125R
(ix) S123H, L124A, Y125G
(x) 51A, K130M
(xi) S123A, L124L, Y125V
(xii) S123L, L124C, Y125S
(xiii) S123L, L124S, Y125S
(xiv) S123V, L124T, Y125P
Suitably said eukaryotic cell is a mammalian or insect cell.
Suitably said codon is a stop codon. More suitably said stop codon is UAG.
Suitably the orthogonal tRNA synthetase - tRNA pair comprises a pyrrolysyl-tRNA
synthetase (PylRS)/PylTtRNAcuA pair.
Suitably the tRNA is:
(i) a U25C variant of PylT,
(ii) an Opt variant of PylT, or
(iii) a U25C - Opt variant of PylT.
FURTHERASPECTS AND EMBODIMENTS OF THE INVENTION
In a first aspect, there is provided a nucleic acid construct for expressing a tRNA
synthetase and tRNA pair in a eukaryotic cell - such as a mammalian cell or an insect
cell comprising: (i) a nucleic acid sequence encoding the tRNA synthetase operably
linked to a first promoter capable of expressing the tRNA synthetase; and (ii) a nucleic
acid sequence encoding the tRNA operably linked to a second promoter capable of
expressing the tRNA, wherein the first and second promoters are in opposite directions
to each other, or wherein the tRNA is present in multiple copies on the nucleic acid
construct. An exemplary nucleotide sequence encoding this construct is set forth in
SEQ IDNO:i.
Suitably, the nucleic acid construct can further comprise a nucleic acid sequence
encoding a nucleic acid sequence of interest operably linked to a further promoter
capable of expressing the nucleic acid sequence of interest in a eukaryotic cell.
Suitably, the promoter that is capable of expressing the nucleic acid sequence of
interest is oriented in the same direction as the first promoter according to the first
aspect recited above.
Suitably, the promoter that is capable of expressing the nucleic acid sequence of
interest is the same as the first promoter or different to the first promoter. In one
embodiment, this promoter is or is derived from an EF-i promoter as described herein
or is or is derived from a CMVpromoter.
Suitably, the nucleic acid construct further comprises a nucleic acid sequence encoding
a mutant eRF1 as described herein. In one embodiment, the eRF1 mutant is expressed
from a CMVpromoter downstream (3') of the first Pol II open reading frame expressing
the tRNA synthetase.
Suitably, the nucleic acid sequence encoding the mutant eRF1 and the nucleic acid
sequence encoding the tRNA synthetase are linked via a self-cleaving peptide in the
same open reading frame. Suitably, the nucleic acid sequence encoding the tRNA
synthetase and the nucleic acid sequence encoding mutant eRF1 are linked via a selfcleaving
peptide in the same open reading frame. An exemplary T2A self-cleaving
peptide is described in PLoS ONE 6(4) (2011),
In a second aspect, there is provided a nucleic acid construct for expressing a tRNA and
a nucleic acid sequence of interest in a eukaryotic cell - such as a mammalian cell or an
insect cell, said nucleic acid sequence of interest comprising a codon recognised by the
tRNA at the position for incorporation of an unnatural amino acid comprising: (i) a
nucleic acid sequence comprising the nucleic acid sequence of interest operably linked
to a first promoter capable of expressing the nucleic acid sequence of interest in a
eukaryotic cell; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a
second promoter capable of expressing the tRNA, wherein the first and second
promoters are in opposite directions to each other, or wherein the tRNA is present in
multiple copies on the nucleic acid construct. An exemplary nucleotide sequence
encoding this construct is set forth in SEQ IDNO:2.
Suitably, the construct comprises a nucleic acid sequence encoding a mutant eRF1,
suitably a mutant mammalian eRF1, suitably a mutant homo sapiens eRF1, suitably,
wherein the mutant eRF1 is selected from the group consisting of E55D, E55A,
N129P/K130Q and Y125F or a combination of two or more thereof.
Suitably, the first and second promoters are in opposite directions to each other and the
tRNAis present in multiple copies on the nucleic acid construct.
Suitably, the nucleic acid construct comprises the tRNA linked directly to the promoter.
According to this embodiment, the tRNA is linked directly to the promoter without any
intermediate sequences located between the tRNA and the promoter.
Suitably, the nucleic acid construct comprises the tRNA linked directly to the promoter.
According to this embodiment, the tRNA is linked directly to the promoter with no
intermediate sequence(s) located between the tRNA and the promoter. The 3' end of
the tRNA can be linked indirectly to a terminator sequence. By way of example, a
terminator sequence (for example, TTTTT) can be connected to the tRNA via a linker,
said linker optionally comprising the sequence GACAAGTGCGG.
Suitably, each copy of the nucleic acid sequence encoding the tRNA is under the control
of a separate (its own) promoter.
Suitably, the promoter arrangement comprises an elongation factor promoter oriented
in a first direction and a Pol III promoter oriented in a second direction.
Suitably, the first promoter is or is derived from an EF-i promoter.
Suitably, the second promoter is or is derived from a U6 promoter.
Suitably, the tRNA is present in 4, 5, 6, 7 or 8 or more copies on the nucleic acid
construct(s).
Suitably, the tRNA is a wild-type or a variant tRNA, suitably a U25C variant of PylT.
Suitably, the nucleic acid sequence of interest comprises at least 1, 2, 3 or 4 or more
stop codons, suitably, at least 1, 2 or 3 codons.
Suitably, the nucleic acid sequence of interest encodes an antibody or an antibody
fragment.
Suitably, said tRNA synthetase is orthogonal to the endogenous tRNAs in the
eukaryotic cell and/or said tRNA is orthogonal to the endogenous tRNA synthetases in
the eukaryotic cell and/ or said tRNA synthetase is orthogonal to the endogenous tRNAs
in the eukaryotic cell and said tRNA is orthogonal to the endogenous tRNA synthetases.
In a further aspect, there is provided a combination of nucleic acid constructs
comprising the nucleic acid construct according to the first aspect and the nucleic acid
construct according to the second aspect.
In a further aspect, there is provided a combination of nucleic acid constructs
comprising the nucleic acid construct according to the first aspect of the invention and
the nucleic acid construct according to the second aspect of the invention.
Suitably, the nucleic acid sequence encoding the mutant eRF1 is on a further separate
construct.
In a further aspect, there is provided a vector comprising the nucleic acid construct
according to the first aspect of the present invention or the nucleic acid construct
according to the second aspect of the present invention.
In a further aspect, there is provided a combination of vectors comprising a vector
comprising the nucleic acid construct according to the first aspect of the present
invention and the nucleic acid construct according to the second aspect of the present
invention.
Suitably, the nucleic acid sequence encoding the mutant eRF1 is on a further separate
vector.
In a further aspect, there is provided a cell comprising the nucleic acid construct
according to the first aspect of the present invention or the nucleic acid construct
according to the second aspect of the present invention, the combination of nucleic acid
constructs, the vector or the combination of vectors.
Suitably, the cell further comprises a nucleic acid construct encoding a mutant eRF1,
suitably a mutant homo sapiens eRF1. Suitably, the nucleic acid sequence encoding the
mutant eRF1 is on a separate construct or vector.
Suitably, the mutant eRF1 is selected from the group consisting of E55D, E55A,
N129P/K130Q and Y125F or a combination of two or more thereof, suitably, where in
the mutations are made in the homo sapiens eRF1 gene sequence as described in
GenBank Accession Number AF095901.1. In one embodiment, the mutations are made
in a codon optimised homo sapiens eRF1 gene sequence. An example of a codon
optimised homo sapiens eRF1 gene sequence is set forth in SEQ IDNO:3
Suitably, the cell is a mammalian cell or an insect cell.
Suitably, the cell is transiently or stably transfected with the nucleic acid.
In a further aspect, there is provided a kit for incorporating an unnatural amino acid
into a protein in a eukaryotic cell - such as a mammalian cell or an insect cell
comprising: (i) the nucleic acid construct according to the first or second aspect of the
present invention; or (ii) the combination of nucleic acid constructs; or (iii) the vector;
or (iv) the combination of vectors; or (v) the eukaryotic cell; and (vi) optionally, an
unnatural amino acid.
Suitably, the kit further comprises a nucleic acid construct or a vector encoding a
mutant eRF1, or a cell comprising same.
In a further aspect, there is provided a method for incorporating an unnatural amino
acid into a protein of interest in a eukaryotic cell - such as a mammalian cell or an
insect cell comprising the steps of: i) providing the cell, wherein said cell comprises the
combination of nucleic acid constructs or the combination of vectors as described
herein; ii) incubating the cell in the presence of the unnatural amino acid to be
incorporated into a protein of interest encoded by the nucleic acid sequence of interest,
wherein said unnatural amino acid is a substrate for the tRNA synthetase; and iii)
incubating the cell to allow incorporation of said unnatural amino acid into the protein
of interest via the orthogonal tRNA-tRNAsynthetase pair.
Suitably, at least l , 2, 3, 4, or 5 unnatural amino acids are incorporated into the protein
of interest.
In a further aspect, there is provided a method of preparing an antibody-drug conjugate
comprising the steps of: i) providing a eukaryotic cell - such as a mammalian cell or an
insect cell, wherein the nucleic acid sequence of interest encodes an antibody or an
antibody fragment, and wherein said cell comprises the combination of nucleic acid
constructs or the combination of vectors described herein, and ii) incubating the cell in
the presence of the unnatural amino acid to be incorporated into the antibody or
antibody fragment, wherein said unnatural amino acid is a substrate for the tRNA
synthetase; iii) obtaining an antibody or antibody fragment in which an unnatural
amino acid has been incorporated therein; and vi) conjugating the antibody or antibody
fragment with a drug moiety via the unnatural amino acid.
In a further aspect, there is provided the use of: (i) the nucleic acid construct according
to the first or second aspects of the present invention; and/or (ii) the combination of
nucleic acid constructs; and/or (iii) the vector; and/or (iv) the combination of vectors;
and/or (v) the eukaryotic cell - such as a mammalian cell or an insect cell, for
incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell.
In a further aspect, there is provided a method for incorporating an unnatural amino
acid into a protein of interest in a eukaryotic cell - such as a mammalian cell or an
insect cell comprising the steps of: i) providing a eukaryotic cell expressing a tRNA
synthetase and tRNA pair, a nucleic acid sequence of interest and a mutant eRF1; ii)
incubating the cell in the presence of an unnatural amino acid to be incorporated into a
protein encoded by the nucleic acid sequence of interest, wherein said unnatural amino
acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow
incorporation of said unnatural amino acid into the protein of interest via the
orthogonal tRNA-tRNA synthetase pair.
In a further aspect, there is provided the use of a mutant eRF1 for incorporating an
unnatural amino acid into a protein of interest in a eukaryotic cell - such as a
mammalian cell or an insect cell.
In a further aspect, there is provided a method of identifying a mutant of eRF1 that
increases the incorporation of an unnatural amino acid in a protein of interest,
comprising the steps of: (i) providing a cell that is capable in incorporating an
unnatural amino into a protein of interest, suitably, wherein said cell comprises the
combination of nucleic acid constructs or the combination of vectors described herein;
(ii) incubating the cell in the presence of the unnatural amino acid to be incorporated
into the protein of interest and in the presence and absence of the mutant of eRF1,
wherein said unnatural amino acid is a substrate for the tRNA synthetase; and (iii)
determining the level of unnatural amino acid incorporation into the protein of interest
in the presence and absence of the mutant of eRF1, wherein an increase in the level of
unnatural amino acid incorporation into the protein of interest in the presence the
mutant of eRF1 is indicative that said mutant of eRF1 increases the incorporation of an
unnatural amino acid in the protein of interest.
In a further aspect, there is provided a construct, vector, cell, kit, method or use
substantially as described herein with reference to the accompanying description and
drawings.
DESCRIPTION OF THE DRAWINGS
Embodiments of the present invention will now be described further, with reference to
the accompanying drawings, in which:
Chart 1 shows the plasmid constructs and unnatural amino acids used, (a) Schematics
of vectors used. PylT is the gene encoding Pyl tRNAcuA and PylT* encodes the U25C
variant. U6 indicates the U6 promoter, CMV is the CMV promoter, CMV enh is the 5'
enhancer fragment of CMV promoter, EFi prom is the EF-ia promoter. Red bars
indicate location of amber stop codons. (b) Chemical structure of 1 (N e-[(tertbutoxy)
carbonyl]-l-lysine ) and 2 (N e-[((2-methylcycloprop-2-en-i
yl)methoxy)carbonyl]-l-lysine).
Figure 1 illustrates optimizing PylRS/tRNAcuA expression vectors for the
incorporation of unnatural amino acids in response to the TAG codon in mammalian
cells, (a) Quantification of incorporation of 1 (2 mM) and 2 (0.5 mM) into sfGFP
measured in a fluorescence assay. The indicated constructs were expressed transiently
in HEK293T cells and sfGFP quantified in lysates by fluorescence at 520 nm, following
excitation at 485 nm. A no amino acid control is included for each vector combination.
The data are plotted as a percentage of the fluorescence exhibited by an equivalent
sfGFP control plasmid with a leucine codon in place of a stop codon (construct a in
Chart la). Data represent the mean ± SE of triplicates), (b) sfGFP yields in lysate
visualized by western blot. Equal amounts of cell lysate from cells transfected with the
indicated vectors and grown in the presence of the indicated amino acid, or no amino
acid, were immunoblotted with a-GFP, a-actin and a-FLAG antibodies, (c) Northern
blot analysis of relative PylT/PylT* expression from constructs b+c, b+d, b+e, g+h, in
the absence of amino acid. See Supplementary Figure 1for loading control.
Figure 2 illustrates the effect of mutations in eRF1 on stop codon read-through, and
incorporation of 1 (2 mM) using the PylRS/tRNAcuA pair, (a) eRF1 positions mutated in
this study. Structure of the N-terminal domain from eRF1 (PDB ID:3EiY) 2 , the
residues mutated in this study are in red. (b) Human eRF1 variants are expressed
following transient transfection of HEK 293T cells with peRF1 (X), where X designates
the mutations introduced, and CMV-PylRS/CMV-DLR(TAG).The negative control (-)
detects endogenous eRF1, shRNA is a knockdown of endogenous eRF1. (c) Readthrough
of all three stop codons is determined by the expression of a Renilla-TAGfirefly
luciferase reporter and eRF1 variants in HEK293T cells in the absence of a
suppressor tRNA CMV-PylRS/CMV-DLR(TAG)(or the corresponding TAA, TGA or
serine codon variant) were transiently transfected into cells and expression levels
determined after 20 hours. TAG, TAA, or TGA readthrough was normalized against
data from the serine codon (TCC) containing construct. Data represents the mean ± SE
of quadruplet measurements. The negative control (-) detects endogenous eRF1,
shRNA is a knockdown of endogenous eRF1. Wt is human eRF1 recoded with D.
melanogaster codon useage. Data for the D100 mutant are off scale, the values are:
1.6% (TAA), 2% (TAG) and 15% (TGA). (d) Transient transfection of HEK 293T cells
with peRF1 (X), where X designates the mutations introduced, plasmid c expressing
PylT from a U6 promoter (Chart la) and CMV-PylRS/CMV- n -TAG-firefly, a
version of plasmid a (Chart la) in which sfGFP is replaced by ReniWa-TAG-firefly.The
negative control (-) detects endogenous eRF1, shRNA is a knockdown of endogenous
eRF1. Equal amounts of cell lysate were immunoblotted with a-eRF1 and a-actin
antibodies, (e) eRF1 (X) variants increase unnatural amino acid incorporation in
response to an amber stop codon using the Pyrolysyl tRNA/synthetase pair. HEK293T
cells were transfected as described for panel d, and grown in the presence of 1mM
amino acid 1, and measurements made after 20 h. % readthrough was measured
relative to a i? n - C-fi refly reporter bearing a serine codon in place of the amber
stop codon.
Figure 3 illustrates combining eRF1 E55D with an optimized PylRS/tRNAcuA pair
expression system enables efficient incorporation of multiple unnatural amino acids
into recombinant proteins in mammalian cells, (a) Plasmids g, h (or i, Chart la) and
eRF1 E55D were transiently transfected into HEK293T cells, and grown in the presence
or absence of 2 mM amino acid 1 for 48 hours. Full-length sfGFP was quantified in cell
lysate at 520 nm, following excitation at 485 nm. Data represents the mean ± SE of four
independent measurements, (b) Western blots from lysates. (c) As in panel a, but using
0.5 mMamino acid 2. (d) Western blots from lysates.
Figure 4 illustrates the expression, purification and characterization of recombinant
sfGFP incorporating one or three unnatural amino acids (a). Plasmids g, h (or i, Chart
la) and eRF1 E55D were transiently transfected into HEK293T cells, and grown in the
presence or absence of 2 mM amino acid 1 or 0.5 mM amino acid 2 for 48 hours. Fulllength
sfGFP was purified by Ni-NTA chromatography, (b) Electrospray ionization
mass spectrometry confirms the quantitative incorporation of unnatural amino acids 1
and 2, at one or three sites in sfGFP (see also Supplementary Figure 4).
Figure 5 illustrates stable expression of eRF1 E55D from genomic integration
enhances amber suppression in T-Rex 293 Flp-In cells. Stable eRF1 lines were created
by using the T-Rex 293 Flp-In system (Life Technologies), giving uniform expression of
the inserted transgene due to insertion at a defined target locus.
A Plasmids g and h or i, (Figure 1, A) were transiently transfected into T-Rex293 cells
containing genomic integrated eRF1 E55D with D. melanogaster codon usage. Cells
were grown in the presence or absence of 0.5 mM amino acid 2 for 48 hours.
Expression of eRF1 E55D was induced by the addition of 1 mg/ml tetracycline sixteen
hours prior to transfection. Certified tetracycline-free growth media was used
throughout all experiments. Full-length sfGFP was quantified in cell lysate at 520 nm,
following excitation at 485 nm. Data represents the mean ± SE of 4 independent
measurements.
B Western blots from lysates, as shown in panel A. Equal amounts of cell lysates were
loaded. Stable lines constitutively expressing shRNAs against endogenous eRF1 were
created by transforming T-Rex293 Flp-in lines with inserted eRF1 wt or E55D with
lentiviral shRNA(eRF1) constructs (Santa Cruz, as in Figure 3), and puromycin
selection against naive cells. eRF1 wt and E55D were refractory to shRNA(eRF1) due to
a lack of sequences complementary to the shRNA after D. melanogaster codon
optimization.
C sfGFP(TAG) was expressed following transient transfection of constructs g and h
(Figure 1) for 48 hours in the presence or absence of 2 , and with the addition of 1
ug/ml tetracycline in the growth media, to induce expression of the release factor
variant. Full-length sfGFP was quantified in cell lysate at 520 nm, following excitation
at 485 nm. Data represents the mean ± SE of four independent measurements
D. As panel C, but expressing sfGFPCTAG)3.
Figure 6 illustrates the effect of mutations in eRF1 on stop codon read-through in
Dmel cells, and incorporation of 1 (lmM) using the PylRS/tRNAcuA pair. A. Human
eRF1 variants (recoded with D. melanogaster codon usage) are expressed following
transient transfection of Dmel cells with peRF1 (X), where X designates the mutations
introduced, and UAS-PylRS/UAS-GFP-CrAG)-mCherry/(U6 -PylT)4. The no stop
control serves as a size marker for full length protein, the negative control (-)
establishes baseline suppression efficiency in the presence of endogenous eRF1 and the
negative control without 2 indicates the level of readthrough in the absence of 1. Cells
were transfected and grown for 48 hours. Readthrough is quantified from blots
immunostained against GFP under non-saturated exposure conditions, by calculating
the ratio of the intensity of the band representing full length product over truncated
product. Each bar represents the mean ± SE of three independent transfection and
quantification experiments.
B . Expression levels of proteins in lysates visualized by western blot. Equal amounts of
cell lysate from cells transfected with the indicated vectors and grown in the presence of
1mM amino acid 1, or no amino acid, were immunostained with a -GFP, a -eRF1 and a
-HA antibodies, as described for panel A. The a -GFP blot shown was exposed for thirty
seconds to show distinct bands for the full length product in print. The corresponding
exposures of the blot used for the quantification was exposed for five seconds and
displays no saturation, as well as the additional replicates.
C. Constructs used for transient transfections.
Figure 7 illustrates the incorporation of four distinct unnatural amino acids into
sfGFPCTAG) in the presence of an eRF1 E55D mutant.
Figure 8 (Supplementary Figure 1) illustrates Northern blot using a universal
PylT/PylTU25C probe. Total RNA was extracted 24 hours after transient transfection
with plasmids b+c, b+d, b+e, g+h (Chart 1) analogous to Figure ia,b.
Figure 9 (Supplementary Figure 2) illustrates human eRF1 variants expressed
following transient transfection of HEK 293T cells with peRF1(X) and CMVPylPvS/
CMV-DLR(TAG). The negative control (-) detects endogenous eRF1. The
absolute expression levels of protein produced in the dual luciferase assay are shown by
a-Renilla western blot. No tfx is untransfected cells.
Figure 10 (Supplementary Figure 3) illustrates the calibration curve for the
fluorometric quantification of sfGFP in lysis buffer. The fluorescence intensity of
purified and serially diluted sfGFP is plotted against the concentration of sfGFP in the
sample. The protein was purified after bacterial expression, quantified by absorbance
measurements at 280 nm and diluted in RIPA-buffer with added protease inhibitor.
Figure 11 (Supplementary Figure 4 ) illustrates electrospray ionization mass
spectrometry which confirms the quantitative incorporation of unnatural amino acids 1
and 2, at three sites in sfGFP. The minor component represents the spontaneous
cleavage at the carbamate groups of one 1 or 2 during detection, producing a native
lysine. The corresponding mass loss is calculated to be 100 or 110 Da, respectively. We
have previously observed that carbamate cleavage of 1 occurs in the electron spray
ionization process?.
Figure 12 Screening transgenic D. melanogaster fly lines for effects of eRF1 E55D or
D100 expression in ovaries on stop codon readthrough in a dual-luciferase reporter
assay.
Figure 13 shows FACsplots
Figure 14 shows a photograph
Figure 15 shows bar charts
Figure 16 shows PylT U25C and PylT U25C Opt variants
Figure 17 shows sequences of PylT U25C and PylT U25C Opt variants
Figure 18 shows a photograph and a bar chart
Figure 19 shows diagrams
Figure 20 shows a diagram
Figure 21 shows (A) a diagram, (B) a chemical structure and (C) two graphs.
DETAILED DESCRIPTION
Constructs and vectors
As used herein, the term "construct" or "vector" refers generally to a nucleic acid
capable of transporting a nucleic acid sequence of interest to which it has been linked.
One type of vector is a "plasmid," which refers to a circular double stranded DNAloop
into which additional DNA segments can be ligated. Another type of vector is a viral
vector, wherein additional DNA segments can be ligated into the viral genome. Certain
vectors are capable of autonomous replication in a host cell into which they are
introduced (for example, bacterial vectors having a bacterial origin of replication and
episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors)
are integrated into the genome of a host cell upon introduction into the host cell, and
thereby are replicated along with the host genome.
Nucleic acid sequences of interest can be incorporated into a construct or a vector -
such as an expression vector. The vector may be used to replicate the nucleic acid in a
compatible host cell. The vector may be recovered from the host cell.
The vector may be an expression vector that is used to express the nucleic acid
sequence of interest in a compatible host cell - such as a eukaryotic cell - such as a
mammalian cell or an insect cell. Suitably, the nucleic acid sequence of interest is
operably linked to a control sequence - such as a promoter or an enhancer - that is
capable of providing for the expression of the nucleic acid sequence of interest in the
host cell. The term "operably linked" means that the components described are in a
relationship permitting them to function in their intended manner. A regulatory
sequence "operably linked" to a nucleic acid sequence of interest is ligated in such a
way that expression of the nucleic acid sequence of interest is achieved under
conditions compatible with the control sequences.
Vectors may be transformed or transfected into a suitable host cell to provide for the
expression of a protein. This process may comprise culturing a host cell transformed
with an expression vector under conditions to provide for expression by the vector of a
nucleic acid sequence of interest encoding the protein, and optionally recovering the
expressed protein.
The vectors may be for example, plasmid or virus vectors provided with an origin of
replication, optionally a promoter for the expression of the nucleic acid sequence of
interest and optionally a regulator of the promoter. The vectors may contain one or
more selectable marker genes, for example an ampicillin resistance gene in the case of a
bacterial plasmid.
In one aspect, there is provided a nucleic acid construct for expressing a tRNA
synthetase and tRNA pair in a eukaryotic cell comprising: (i) a nucleic acid sequence
encoding the tRNA synthetase operably linked to a first promoter capable of expressing
the tRNA synthetase; and (ii) a nucleic acid sequence encoding the tRNA operably
linked to a second promoter capable of expressing the tRNA, wherein the first and
second promoters are in opposite directions to each other, or wherein the tRNA is
present in multiple copies on the nucleic acid construct.
In another aspect, there is provided a nucleic acid construct for expressing a tRNA and
a nucleic acid sequence of interest in a eukaryotic cell, said nucleic acid sequence of
interest comprising a codon recognised by the tRNA at the position for incorporation of
an unnatural amino acid comprising: (i) a nucleic acid sequence comprising the nucleic
acid sequence of interest operably linked to a first promoter capable of expressing the
nucleic acid sequence of interest in the cell; and (ii) a nucleic acid sequence encoding
the tRNA operably linked to a second promoter capable of expressing the tRNA,
wherein the first and second promoters are in opposite directions to each other, or
wherein the tRNAis present in multiple copies on the nucleic acid construct.
In another aspect, there is also provided a combination of nucleic acid constructs
comprising each of the nucleic acid constructs described above.
In another aspect, there is also provided a vector comprising or separately comprising
each the nucleic acid constructs described above.
In another aspect, there is also provided a combination of vectors comprising a vector
separately comprising each of the nucleic acid constructs described above.
In certain embodiments, the first and second promoters in the nucleic acid constructs
are separate promoters that are placed in opposite directions. According to this
embodiment, the first and second promoters can be said to be bidirectional promoters
in which each of the promoters are coded on opposite strands with their 5' ends
oriented toward one another. Each of the nucleic acids operably linked to the
promoters will have a corresponding orientation. Thus, for example, the promoter and
the tRNA sequence to be expressed can be encoded on the reverse strand. The
promoter and the tRNA synthetase gene to be expressed can be encoded on the forward
strand. By way of further example, the U6 promoter and the tRNA sequence to be
expressed can be encoded on the reverse strand. By way of further example, the EF-ia
promoter and the tRNA synthetase gene to be expressed can be encoded on the forward
strand.
In addition to the first and second promoters, one or more further promoters may also
be included, which may be the same promoter as the first and/or second promoters or
may be different to the first and/or second promoters. The further promoter(s) can be
oriented in the same direction as the first or second promoter. Suitably, the further
promoter(s) is oriented in the same direction as the first promoter.
Suitably, the construct described herein further comprise a nucleic acid sequence
encoding a mutant eRF1 as described herein. The promoter expressing the mutant
eRF1 can be oriented in the same direction as the first or second promoter. Suitably,
the promoter is oriented in the same direction as the first promoter.
Suitably, the nucleic acid sequence encoding the mutant eRF1 and the nucleic acid
sequence encoding the tRNA synthetase are linked via a self-cleaving peptide in the
same open reading frame. Suitably, the nucleic acid sequence encoding the tRNA
synthetase and the nucleic acid sequence encoding mutant eRF1 are linked via a selfcleaving
peptide in the same open reading frame. An exemplary T2A self-cleaving
peptide is described in PLoS ONE 6(4) (2011).
Suitably, the constructs provide a multi-copy tRNA arrangement. Suitably at least 2, 3,
4 5 6, 7, 8, 9, 10, 11 or 12 copies of the tRNA gene are provided in the constructs
described herein. Suitably at least 4 copies of the tRNA gene are provided in a
construct. Suitably at least 8 copies of the tRNA gene are provided in a construct. The
multiple copies of the tRNA gene may be provided on the same or a different construct.
In one embodiment, at least 4 copies of the tRNAgene are provided on a first construct
and at least 4 copies of the tRNAgene are provided on a second construct.
In one embodiment, multiple copies of the tRNA gene are under the control of a single
promoter. In another embodiment, multiple copies of the tRNA gene are under the
control of multiple different promoters. In another embodiment, each copy of the
tRNA gene is under the control of a separate promoter, which may be the same
promoter or two or more different promoters. In another embodiment, each copy of
the tRNA gene is under the control of multiple promoters, which may be the same
promoter or two or more different promoters. Suitably, each tRNA gene is under the
control of a separate promoter, which is the same promoter for each tRNA gene.
Suitably, the promoter or promoters controlling each of the tRNA gene(s) provided is
the same. In this context by "same" is meant the same in terms of its sequence rather
than implying a single promoter sequence controlling multiple tRNA sequences.
Clearly, there may be multiple copies of the same promoter as described herein.
In one embodiment, a multi-copy tRNA arrangement is provided in which at least 4
copies of the tRNAare provided, with each copy operably linked to a promoter.
In another embodiment, a multi-copy tRNAarrangement is provided in which at least 4
copies of the tRNA are provided, with each copy operably linked to a promoter, each
promoter being the same promoter - such as a RNApol III promoter, for example a U6
promoter.
In one embodiment, the 5' end of the tRNAis directly defined by the transcription start
site of the promoter that is used to express the tRNA.
It should be noted that the nucleotide constructs provided herein have broad
application and may be used in opal and/or ochre suppression as well as in amber
suppression. When applying the nucleic acid constructs of the invention to
amber/opal/ochre suppression, the skilled operator will choose the appropriate tRNAs
and/or tRNA synthetases accordingly together with the appropriate amber/opal/ochre
codon.
Combinations of constructs and vectors
Combinations of the constructs and vectors described herein are contemplated for use
in incorporating one or more unnatural amino acids into a cell.
By way of example, a combination of constructs comprising: (l) the nucleic acid
construct comprising: (i) a nucleic acid sequence encoding the tRNA synthetase
operably linked to a first promoter capable of expressing the tRNA synthetase; and (ii)
a nucleic acid sequence encoding the tRNA operably linked to a second promoter
capable of expressing the tRNA, wherein the first and second promoters are in opposite
directions to each other, or wherein the tRNA is present in multiple copies on the
nucleic acid construct; and (2) the nucleic acid construct comprising: (i) a nucleic acid
sequence comprising the nucleic acid sequence of interest operably linked to a first
promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic
cell; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a second
promoter capable of expressing the tRNA, wherein the first and second promoters are
in opposite directions to each other, or wherein the tRNAis present in multiple copies
on the nucleic acid construct.
In one embodiment, the nucleic sequence of interest from construct (1) noted above
further comprises a nucleic acid sequence encoding a nucleic acid sequence of interest
operably linked to a further promoter capable of expressing the nucleic acid sequence
of interest in a eukaryotic cell. According to this embodiment, construct (1) does not
necessarily have to be used together with construct (2) because the nucleic acid
sequence of interest and the tRNAfrom construct (2) is incorporated into construct (1).
According to this embodiment, it may be desirable to include one or more further
copies of tRNA on another vector. This other vector may exclusively comprise the
tRNA(s) under the control of one or more promoters. Optionally other elements may
be incorporated into this other vector as desired.
The combination of constructs comprising: (1) and (2) as noted above can be used
together with a further construct encoding a mutant eRF1 as described herein.
Alternatively, the nucleic acid sequence encoding the mutant eRF1 can be incorporated
into the constructs (1) and/or (2). Suitably, the nucleic acid sequence encoding the
mutant eRF1 is incorporated into construct (1). According to this embodiment, there is
disclosed a nucleic acid construct comprising: (i) a nucleic acid sequence encoding the
tRNA synthetase operably linked to a first promoter capable of expressing the tRNA
synthetase; and (ii) a nucleic acid sequence encoding the tRNA operably linked to a
second promoter capable of expressing the tRNA, wherein the first and second
promoters are in opposite directions to each other, or wherein the tRNA is present in
multiple copies on the nucleic acid construct; optionally (iii) a nucleic acid sequence
encoding a nucleic acid sequence of interest operably linked to a further promoter
capable of expressing the nucleic acid sequence of interest in a eukaryotic cell; and
optionally (iv) a nucleic acid sequence of interest encoding a mutant eRPi as described
herein
Vectors and cells comprising these various combinations of constructs is also disclosed.
tRNA Synthetase
The tRNA synthetase (suitably, aminoacyl-tRNA synthetase) used herein may be
varied. Although specific tRNA synthetase sequences may have been used in the
examples, the invention is not intended to be confined only to those examples. In
principle any tRNA synthetase which provides a tRNA charging (aminoacylation)
function can be employed. For example the tRNA synthetase may be from any suitable
species such as from archea, for example from Methanosarcina - such as
Methanosarcina barkeri MS; Methanosarcina barkeri str. Fusaro; Methanosarcina
mazei Goi; Methanosarcina acetivorans C2A; Methanosarcina therm ophila; or
Methanococcoides - such as Methanococcoid.es burtonii. Alternatively the tRNA
synthetase may be from bacteria, for example from Desulfitobacterium - such as
Desulfitobacterium hafniense DCB-2; Desulfitobacterium hafniense Y51;
Desulfitobacterium hafniense PCPl; or Desulfotomaculum acetoxidans DSM771.
In one embodiment, the tRNA synthetase is pyrrolysyl tRNA synthetase (PylRS), which
is a protein having pyrrolysl tRNA synthetase biological activity. The PylRS is capable
of acylating a tRNA with an unnatural amino acid.
The PylRS may be a wild-type or a genetically engineered PylRS. Genetically
engineered PylRS has been described, for example, by Neumann et al. (Nat Chem Biol
4:232, 2008) and by Yanagisawa et al, (Chem Biol 2008, 15:1187), and in
EP2192185A1. Suitably, a genetically engineered tRNA synthetase gene is selected that
increases the incorporation efficiency of unnatural amino acid(s).
According to one embodiment, the PylRS is from Methanosarcina barkeri (MbPylRS),
optionally comprising or consisting of the codon optimised sequence set forth below:
ATGGACTACAAGGACGACGACGACAAGGACAAGAAACCCCTGGACGTGCTGATCAGCGCCACCGGCCTGT
GGATGAGCCGGACCGGCACCCTGCACAAGATCAAGCACCACGAGGTGTCAAGAAGCAAAATCTACATCGA
GATGGCCTGCGGCGACCACCTGGTGGTGAACAACAGCAGAAGCTGCCGGACCGCCAGAGCCTTCCGGCAC
CACAAGTACAGAAAGACCTGCAAGCGGTGCCGGGTGTCCGACGAGGACATCAACAACTTTCTGACCAGAA
GCACCGAGAGCAAGAACAGCGTGAAAGTGCGGGTGGTGTCCGCCCCCAAAGTGAAGAAAGCCATGCCCAA
GAGCGTGTCCAGAGCCCCCAAGCCCCTGGAAAACAGCGTGTCCGCCAAGGCCAGCACCAACACCAGCCGC
AGCGTGCCCAGCCCCGCCAAGAGCACCCCCAACAGCTCCGTGCCCGCCTCTGCTCCTGCTCCCAGCCTGA
CACGGTCCCAGCTGGACAGAGTGGAGGCCCTGCTGTCCCCCGAGGACAAGATCAGCCTGAACATGGCCAA
GCCCTTCCGGGAGCTGGAACCCGAGCTGGTGACCCGGCGGAAGAACGACTTCCAGCGGCTGTACACCAAC
GACCGGGAGGACTACCTGGGCAAGCTGGAACGGGACATCACCAAGTTCTTCGTGGACCGGGGCTTCCTGG
AAATCAAGAGCCCCATCCTGATCCCCGCCGAGTACGTGGAGCGGATGGGCATCAACAACGACACCGAGCT
GTCCAAGCAGATTTTCCGGGTGGACAAGAACCTGTGCCTGCGGCCTATGCTGGCCCCCACCCTGTACAAC
TACCTGCGGAAACTGGACAGAATCCTGCCTGGCCCCATCAAGATTTTCGAAGTGGGACCCTGCTACCGGA
AAGAGAGCGACGGCAAAGAGCACCTGGAAGAGTTTACAATGGTGAATTTTTGCCAGATGGGCAGCGGCTG
CACCCGGGAGAACCTGGAAGCCCTGATCAAAGAGTTCCTGGATTACCTGGAAATCGACTTCGAGATCGTG
GGCGACAGCTGCATGGTGTACGGCGACACCCTGGACATCATGCACGGCGACCTGGAACTGAGCAGCGCCG
TGGTGGGACCCGTGTCCCTGGACCGGGAGTGGGGCATCGACAAGCCCTGGATCGGAGCCGGCTTCGGCCT
GGAACGGCTGCTGAAAGTGATGCACGGCTTCAAGAACATCAAGCGGGCCAGCAGAAGCGAGAGCTACTAC
AACGGCATCAGCACCAACCTGTGATGATAA
According to a particular embodiment, the PylRS is from Methanosarcina mazei
(MmPylRS), optionally comprising or consisting of the codon optimised sequence set
forth below:
ATGGACTACAAGGACGACGACGACAAGGGACAAGAAGCCCCTGAACACCCTGATCAGCGCCACAGGACTG
TGGATGTCCAGAACCGGCACCATCCACAAGATCAAGCACCACGAGGTGTCCCGGTCCAAAATCTACATCG
AGATGGCCTGCGGCGATCACCTGGTCGTCAACAACAGCAGAAGCAGCCGGACAGCCAGAGCCCTGCGGCA
CCACAAGTACAGAAAGACCTGCAAGCGGTGCAGAGTGTCCGACGAGGACCTGAACAAGTTCCTGACCAAG
GCCAACGAGGACCAGACCAGCGTGAAAGTGAAGGTGGTGTCCGCCCCCACCCGGACCAAGAAAGCCATGC
CCAAGAGCGTGGCCAGAGCCCCCAAGCCCCTGGAAAACACCGAAGCCGCTCAGGCCCAGCCCAGCGGCAG
CAAGTTCAGCCCCGCCATCCCCGTGTCTACCCAGGAAAGCGTCAGCGTCCCCGCCAGCGTGTCCACCAGC
ATCTCTAGCATCTCAACCGGCGCCACAGCTTCTGCCCTGGTCAAGGGCAACACCAACCCCATCACCAGCA
TGTCTGCCCCTGTGCAGGCCTCTGCCCCAGCCCTGACCAAGTCCCAGACCGACCGGCTGGAAGTGCTCCT
GAACCCCAAGGACGAGATCAGCCTGAACAGCGGCAAGCCCTTCCGGGAGCTGGAAAGCGAGCTGCTGAGC
CGGCGGAAGAAGGACCTCCAGCAAATCTACGCCGAGGAACGGGAGAACTACCTGGGCAAGCTGGAAAGAG
AGATCACCCGGTTCTTCGTGGACCGGGGCTTCCTGGAAATCAAGAGCCCCATCCTGATCCCCCTGGAGTA
CATCGAGCGGATGGGCATCGACAACGACACCGAGCTGAGCAAGCAGATTTTCCGGGTGGACAAGAACTTC
TGCCTGCGGCCCATGCTGGCCCCCAACCTGTACAACTACCTGCGGAAACTGGATCGCGCTCTGCCCGACC
CCATCAAGATTTTCGAGATCGGCCCCTGCTACCGGAAAGAGAGCGACGGCAAAGAGCACCTGGAAGAGTT
TACAATGCTGAACTTTTGCCAGATGGGCAGCGGCTGCACCAGAGAGAACCTGGAATCCATCATCACCGAC
TTTCTGAACCACCTGGGGATCGACTTCAAGATCGTGGGCGACAGCTGCATGGTGTACGGCGACACCCTGG
ACGTGATGCACGGCGACCTGGAACTGTCTAGCGCCGTCGTGGGACCCATCCCTCTGGACCGGGAGTGGGG
CATCGATAAGCCCTGGATCGGAGCCGGCTTCGGCCTGGAACGGCTGCTGAAAGTCAAGCACGACTTTAAG
AACATCAAGCGGGCTGCCAGAAGCGAGAGCTACTACAACGGCATCAGCACCAACCTGTGATGATAA
Suitably the nucleotide sequence encoding the tRNA synthetase is codon optimised.
tRNA
The tRNA used herein may be varied. Although specific tRNAs may have been used in
the examples, the invention is not intended to be confined only to those examples. In
principle, any tRNA can be used provided that it is compatible with the selected tRNA
synthetase.
The tRNA may be from any suitable species such as from archea, for example from
Methanosarcina - such as Methanosarcina barkeri MS; Methanosarcina barkeri str.
Fusaro; Methanosarcina mazei Goi; Methanosarcina acetivorans C2A;
Methanosarcina thermophila; or Methanococcoides - such as Methanococcoides
burtonii. Alternatively the tRNA may be from bacteria, for example from
Desulfitobacterium - such as Desulfitobacterium hafniense DCB-2; Desulfitobacterium
hafniense Y51; Desulfitobacterium hafniense PCPl; or Desulfotomaculum acetoxidans
DSM 771.
The tRNA gene can be a wild-type tRNA gene or it may be a mutated tRNA gene.
Suitably, a mutated tRNA gene is selected that increases the incorporation efficiency of
unnatural amino acid(s). In one embodiment, the mutated tRNA gene, for example,
the mutated tRNAcuA gene, is a U25C variant of PylT as described in Biochemistry
(2013) 52, 10.
In one embodiment, the mutated tRNA gene, for example, the mutated tRNAcuA gene,
is an Opt variant of PylT as described in Fan et al 2015 (Nucleic Acids Research
doi:io.i093/nar/gkv8oo).
In one embodiment, the mutated tRNA gene, for example, the mutated tRNAcuA gene,
has both the U25C and the Opt variants of PylT, i.e. in this embodiment the tRNA, such
as the PylT tRNAcuAgene, comprises both the U25C and the Opt mutations.
In one embodiment, the sequence encoding the tRNA is the pyrrolysine tRNA (PylT)
gene from Methanosarcina mazei pyrrolysine which encodes tRNA 1, more suitably
tRNAPyl
CUA. This incorporates unnatural amino acids by amber suppression i.e. by
recognition of the amber codon.
An example of a nucleic acid sequence encoding PylT from Methanosarcina mazei is:
GGAAACCTGATCATGTAGATCGAATGGACTCTAAATCCGTTCAGCCGGGTTAGATTCCCGG
In another embodiment, the PylT from Methanosarcina mazei is expressed from a U6
promoter with a linker followed by a terminator at the 3' end of the Py IT. An exemplary
sequence is (U6 promoter in lowercase and bold; PlyT underlined; linker in capitals
and bold; terminator in uppercase and underlined):
tgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagag
ataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataat
ttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaa
gtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccggaaacctgatcatgtagatc
gaatggactctaaatccgttcagccgggttagattcccggggtttccgGACAAGTGCGgTTTTT
tRNA Synthetase/tRNA pair
Suitably, the tRNA-tRNA synthetase pair is one that does not recognise any of the 20
naturally occurring amino acids.
It will be appreciated that corresponding or cognate tRNA or tRNA synthetases may be
combined from different species - such as different species of Methanococcus
bacterium. For example, it may be possible to use a pyrrolysine tRNA from
Methanosarcina mazei together with a pyrrolysyl tRNA synthetase from
Methanosarcina barkeri. The functionality of such pairings is easily tested using
methods that are known in the art, for example, by combining together the different
components in a host cell and analysing for an intact protein of interest being produced.
In one embodiment, the tRNA-tRNA synthetase pair is the pyrrolysyl-tRNA synthetase
(PylRS)/tRNAcuA pair, suitably from Methanococcus.
In one embodiment, the tRNA synthetase is or is derived from thePylRS from
Methanosarcina barkeri (MbPylRS) and the tRNA is or is derived from the pyrrolysine
A Py lT) from Methanosarcina mazei pyrrolysine.
In one embodiment, the tRNA synthetase is or is derived from thePylRS from
Methanosarcina mazei (MmPylRS) and the tRNA is or is derived from the pyrrolysine
tRNA ( from Methanosarcina mazei pyrrolysine.
Suitably, said tRNA synthetase is orthogonal to the endogenous tRNAs in the
eukaryotic cell and/or said tRNA is orthogonal to the endogenous tRNA synthetase in
the eukaryotic cell and/or said tRNA synthetase is orthogonal to the endogenous tRNAs
in the eukaryotic cell and said tRNAis orthogonal to the endogenous tRNAsynthetases.
Control sequence
Control sequences operably linked to nucleic acid sequences include promoters,
enhancers and other expression regulation signals. These control sequences may be
selected to be compatible with the host cell for which the construct or vector is designed
to be used in. The term promoter is well-known in the art and encompasses nucleic acid
regions ranging in size and complexity from minimal promoters to promoters including
upstream elements and enhancers.
Suitably, one of the promoter sequences is a RNA Pol PI promoter - such as a U6
promoter. Suitably, the RNA Pol III promoter is operably linked to a tRNA gene.
Suitably, this arrangement is repeated at least 4, 5, 6, 7 or 8 times or more in the
constructs of the present disclosure.
Suitably, one of the promoter sequences is a eukaryotic elongation factor promoter -
such as an EF-i promoter (for example, EF-ia). Suitably, this promoter is operably
linked to a tRNA synthetase gene and/or a nucleic acid sequence of interest. Suitably,
this arrangement is repeated at least once in the constructs of the present disclosure.
RNA Pol III promoter
Suitably any promoter capable of directing RNAPol III transcription in eukaryotic cells
- such as mammalian or insect cells - may be used in the construct described herein.
RNA Pol III promoters include intragenic and extragenic (internal and external)
promoters.
Suitably said promoter is, or is derived from, the eukaryotic U6 promoter, suitably, the
homo sapien U6 promoter.
An exemplary U6 promoter is described in The Journal of Biological Chemistry (1987)
262(3), 1187-1193.
An exemplary U6 promoter for use in human and/or mouse systems is described in
Journal of the American Chemical Society (2010) 132(12), 4086-4088.
Another exemplary U6 promoter comprises or consists of the sequence set forth below:
TGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAG
ATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAAT
TTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAA
GTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG
Suitably, the promoter is, or is derived from, a U6 promoter capable of directing RNA
Pol IP transcription in mammalian cells - such as mouse or human cells - operably
linked to one or more tRNAgenes, as described herein.
Elongation factor promoter
Suitably any eukaryotic elongation factor promoter capable of directing expression in
eukaryotic cells - such as mammalian or insect cells - may be used in the construct
described herein.
Suitably said promoter is, or is derived from, the eukaryotic elongation factor l (EF-i)
promoter.
Suitably said promoter is, or is derived from, the EF-ia promoter.
An exemplary EF-ia promoter is described in Anticancer Res. (2002), 22(6A), 3325-
30.
Another exemplary EF-ia promoter comprises or consists of the sequence set forth
below:
CTAGTAAGGATCTGCGATCGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGA
AGTTGGGGGGAGGGGTCGGCAATTGAACGGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGA
TGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTG
AACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTT
CACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTG
TGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCG
GCGCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCT
ACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACCGGCGCCTACTCTAG
Suitably, the promoter is, or is derived from, an EF-ia promoter capable of directing
transcription in mammalian cells - such as mouse or human cells - operably linked to
tRNA synthetase and/or a nucleic acid sequence of interest as described herein.
Host Cells
Suitable host cells may include bacterial cells (e.g., E. coli), but most suitably host cells
are eukaryotic cells, for example insect cells (e.g. Drosophila such as Drosophila
melanogaster), yeast cells, nematodes (e.g. Celegans), mice (e.g. Mus musculus), or
mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells, human
293T cells, HeLa cells, NIH 3T3 cells, and mouse erythroleukemia (MEL) cells) or
human cells or other eukaryotic cells. Other suitable host cells are known to those
skilled in the art. Suitably, the host cell is a mammalian cell - such as a human cell or
an insect cell.
Other suitable host cells which may be used generally in the embodiments of the
invention are those mentioned in the examples section.
Vector DNA can be introduced into host cells via conventional transformation or
transfection techniques. As used herein, the terms "transformation" and "transfection"
are intended to refer to a variety of well-recognized techniques for introducing a foreign
nucleic acid molecule (e.g., DNA) into a host cell, including calcium phosphate or
calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting host cells are well
known in the art.
When creating cell lines it is generally preferred that stable cell lines are prepared. For
stable transfection of mammalian cells for example, it is known that, depending upon
the expression vector and transfection technique used, only a small fraction of cells may
integrate the foreign DNA into their genome. In order to identify and select these
integrants, a gene that encodes a selectable marker (for example, for resistance to
antibiotics) is generally introduced into the host cells along with the gene of interest.
Preferred selectable markers include those that confer resistance to drugs, such as
G418, hygromycin, or methotrexate. Nucleic acid molecules encoding a selectable
marker can be introduced into a host cell on the same vector or can be introduced on a
separate vector. Cells stably transfected with the introduced nucleic acid molecule can
be identified by drug selection (for example, cells that have incorporated the selectable
marker gene will survive, while the other cells die).
In one embodiment, the constructs described herein are integrated into the genome of
the host cell. An advantage of stable integration is that the uniformity between
individual cells or clones is achieved. Another advantage is that selection of the best
producers maybe carried out. Accordingly, it is desirable to create stable cell lines.
In another embodiment, the constructs described herein are transfected into a host cell.
An advantage of transfecting the constructs into the host cell is that protein yields may
be maximised.
In one aspect, there is described a cell comprising the nucleic acid construct or the
vector described herein.
eRFi
Unless otherwise apparent from the context, references herein to 'eRF1' refer to
eukaryotic eRF1.
When used herein, especially in discussions of eRF1, 'mutant' has its natural meaning
of 'other than wild-type'. Clearly, the wild type residue may vary depending on the
particular species of eRF1 being used. References to particular residues should be
construed with reference to the H.sapiens wild type reference sequence for eRF1 of
GenBank Accession Number AF095901.1. The database release at the date of filing is
relied on. In case of any doubt, this means Genetic Sequence Data Bank NCBIGenBank
Flat File Release 209.0 dated August 15 2015.
For avoidance of doubt, wild type human eRF1 polypeptide sequence is regarded as:
In particular, amino acid addresses given in the application correspond to the
numbering of the eRF1 reference sequence above. Where truncated or extended forms
of eRF1 are used (e.g. if a 6his tag is added or where a section of the polypeptide is
deleted) then the amino acid numbering should be treated as corresponding to the
equivalent section of the full length reference sequence and not as an 'absolute' or
rigidly inflexible numeric address. By way of explanation, if the description mentions a
substitution of E55, this means amino acid 55 of the eRF1 reference sequence above. If
another species position 55 is not E in the wild type, the amino acid corresponding to
E55 of the human wild type sequence is identified for example by aligning the sequence
of the eRF1 of said other species with the reference sequence above and selecting the
corresponding amino acid as is well known in the art. Similarly, if the polypeptide used
is truncated by deletion of the first 10 amino acids, the address given will still be E55
(rather than e.g. E45) - this will be easily understood by the skilled reader to refer to
the amino acid of the corresponding context with reference to the full length eRF1
sequence above, as is conventional in the art.
The inventors teach that other truncations which remove the N-terminal domain of
eRF1 would have a similar effect. The N-terminal domain (roughly amino acid 1-130) of
eRF1 interacts with the messenger RNAand the stop codon. If the whole or part of this
domain is deleted, in use it should form inactive eRF1-eRF3 complexes (exemplified by
the delta 100 variant) and increase stop codon read-through (and toxicity). Suitably the
eRF1 used in the invention comprises amino acid sequence corresponding to at least
amino acids 131 onwards of SEQ ID NO: 4; suitably comprises amino acid sequence
corresponding to at least amino acids 101 onwards of SEQ ID NO: 4.
Suitably the eRF1 used in the invention comprises amino acid sequence corresponding
to at least amino acids 101 to the end of SEQ IDNO: 4.
Suitably the eRF1 used in the invention comprises amino acid sequence corresponding
to at least amino acids 131 to the end of SEQ IDNO: 4.
Suitably the C-terminal end of eRF1 is not truncated or is truncated only minimally
relative to SEQ ID NO: 4. Most suitably the C-terminal end of eRF1 is not truncated
relative to SEQ ID NO: 4.
Any alignment required should be carried out by eye, or using any of the widely
available sequence alignment programs known in the art, such as the GCG suite of
programs (GCG Genetics Computer Group University Research Park 575 Science Drive
Madison, WI 53711). Most suitably alignments are using ClustalW with the default
settings.
Advantageously, certain mutants of eRF1 can be employed in accordance with the
present disclosure to provide a substantial increase in unnatural amino acid
incorporation in response to one or more stop codons without substantially increasing
read-through of other stop codons. Accordingly, it can be advantageous to express the
nucleic acid constructs as described herein in a cell together with certain eRF1 mutants.
eRF1 may be expressed using various promoters - such as an EFi promoter or a CMV
promoter.
Most suitably the eRF1 mutants of the invention provide increased efficiency of
unnatural amino acid incorporation.
Suitably the eRF1 mutants of the invention increase efficiency of unnatural amino acid
incorporation relative to a natural translation control.
Suitably the eRF1 mutants of the invention provide increased efficiency of unnatural
amino acid incorporation relative to a wild type eRF1 control.
This may be easily determined as taught herein, for example by reference to the
examples section.
In certain embodiments, the mutant eRF1 is integrated into the host cell, suitably stably
integrated into the host cell.
In certain embodiments, the mutant eRF1 is expressed from one or more of the nucleic
acid constructs described herein in a host cell.
In certain embodiments, the nucleic acid sequence encoding the mutant eRF1 is on a
separate construct or a separate vector.
Eukaryotic translation termination factor l (eRF1), also known as TB3-1, is
a protein that in humans is encoded by the ETF1 gene. In eukaryotes, this is the
only release factor which recognizes all three stop codons. Termination of protein
biosynthesis and release of the nascent polypeptide chain are signaled by the presence
of an in-frame stop codon at the aminoacyi site of the ribosome. The process of
translation termination is universal and is mediated by protein release factors (RFs)
and GTP.
An exemplary eRF1 gene sequence is the wild type homo sapiens eRF1 gene sequence
as described in GenBank Accession Number AF095901.1. Suitably, the eRF1 gene can
be codon optimized, for example, for Drosophila melanogaster.
Using shRNA to knock down eRF1 expression in mammalian cells can also be
deleterious after providing a transient increase in suppression. High levels of stop
codon read through can also occur. Clearly these deleterious effects should be avoided
and shRNA should suitably not be used in the present disclosure.
eRF1 mutants useful in the invention are disclosed in the table below:
*In choosing which eRF1 mutants to employ, the skilled person will take account of the
interaction between cell viability and increased suppression. For example, the D100
eRF1 mutant can result in high levels of stop codon read through and sick cells. The
D100 eRF1 mutant is therefore suitably not used in the present disclosure.
** Not useful for UAG as an incorporation signal, but may find application for UGA.
Occasionally there is mention of unmutated site(s), such as "L124L". Clearly this is not
a mutation since the wild type 'L' is not changed. This is to be understood as showing
that L124 is NOT mutated in that particular eFRi i.e. position L124 is left as wild-type
(as L) in that particular combination of mutations/that particular exemplary eRF1.
For each mutation at a given position there is believed to be a number of closely related
amino acids that will give a similar effect. The 'exemplary mutants' are not intended to
be exhaustive. Also contemplated are mutations to 'other than wild-type' to the
residues identified in column I above. More suitably conservative substitutions maybe
made to those residues mentioned in Column II, for example according to the table
below. Amino acids in the same block in the second column and preferably in the same
line in the third column of the table below may be substituted for each other:
For example, E55 in column I maybe mutated to 'other than E More suitably E55 may
be mutated to an amino acid conservative to the specific mutations in Column II - such
as E55D or E55A or E55G or E55P. Most suitably E55 may be mutated to an amino
acid specifically mentioned in Column II such as E55A or E55D, most suitably E55D.
The same applies to the other residues listed in Column I.
All S123, L124, Y125 mutants perform well compared to E55D in DLR assays (i-2x
better than E55D), but perform less well than E55D in protein expression tests. They
remain useful in the invention but the most preferred mutant is E55D.
(sfGFP(3TAG).
Although some mutations are presented in combinations, those combinations are
especially preferred examples of the invention. Disclosed is the use of individual eRF1
mutants; suitably said mutant eRF1 comprises a mutation relative to SEQ ID NO: 4
selected from the group consisting of E55, N129, K130, T122, S123, Y125, T58, S60,
S64, L125, S123, L124, M51, and K130. Suitably said mutant eRF1 comprises a
mutation relative to SEQ ID NO: 4 selected from the group consisting of E55D, N129P,
K130Q, T122Q, S123F, E55A, Y125F, T58K, S60T, S64D, L125F, N129S, S123A, L124I,
Y125L, S123R, L124W, Y125R, S123H, L124A, Y125G, M51A, K130M, Y125V, S123L,
L124C, Y125S, S123L, L124S, Y125S, S123V,L124T, and Y125P.
eRF1 may be provided in a host cell by transient expression or by genomic integration.
For example, using the TRex Flip-In system (human HEK293-dervied) to get inducible
expression of the eRF1 mutant in a stable genetic background. In one embodiment the
relevant nucleic acids are introduced by transient transfection. In one embodiment
the relevant nucleic acids are introduced by stable cell line creation.
Various especially suitable mutants and combinations are described herein including
M51A/K130M, T122Q/S123F, S70A/G73S, E55D, E55A, N129P/K130Q and Y125F.
Suitably, the eRF1 mutant used in the present disclosure comprises a mutation at E55.
Suitably, the eRF1 mutant used in the present disclosure is selected from the group
consisting of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more
thereof. These mutations are made with respect to the wild type homo sapiens eRF1
amino acid sequence which is derived from GenBank Accession Number AF095901.1
or a codon optimised variant thereof.
The eRF1 protein shows very strong homology across most eukaryotic organisms. We
used the human eRF1 as the example to introduce our mutations, but eRF1s from other
species may also carry the same mutations (e.g. E55D in a human or insect eRF1
protein). We teach that these alternate species mutant eRF1 proteins should have
similar technical effects as shown for the exemplary eRFs herein.
We used the preferred eRF1 mutant (engineered human (H. sapiens) eRF1 variant) to
successfully enhance unnatural amino acid incorporation in diverse eukaryotic host
cells including CHO cells (C. griseus), HEKcells (H. sapiens) and Dmel cells D.
melanogaster). The eRF1 proteins in these organisms are highly conserved (table 1).
Table 1: Pair-wise similarity of eRFi in various species. The percentage given indicates
conserved amino acid identities across the protein, as determined by ClustalW alignment.
Given the level of conservation between the various unicellular (yeast) and
multicellular (mammal, insects) eukaryotic organisms it is supported that eRF1
variants from various eukaryotic species will be functional in multiple other eukaryotic
species host cells. For example, the host cell maybe human, mouse, C. elegans, donkey,
yeast or other eukaryotic host cell.
Suitably the mutant eRF1 has amino acid sequence having at least 60% sequence
identity to the human wild type eRF1 sequence of SEQ IDNO: 4; suitably the mutant
eRF1 has amino acid sequence having at least 67% sequence identity to the human wild
type eRF1 sequence of SEQ IDNO: 4; suitably the mutant eRF1 has amino acid
sequence having at least 84% sequence identity to the human wild type eRF1 sequence
of SEQ IDNO: 4; suitably the mutant eRF1 has amino acid sequence having at least
92% sequence identity to the human wild type eRF1 sequence of SEQ ID NO: 4, suitably
the mutant eRF1 has amino acid sequence having at least 95% sequence identity to the
human wild type eRF1 sequence of SEQ IDNO: 4, suitably the mutant eRF1 has amino
acid sequence having at least 98% sequence identity to the human wild type eRF1
sequence of SEQ IDNO: 4, or even more.
In one embodiment, suitably percentage identity levels are calculated before specific
mutations recited for the mutant eFRi's are introduced. Preferably the percentage
identity levels are calculated including the specific mutations recited for the mutant
eFRi's.
Suitably the host cell is in vitro. When the host cell is in an organism, suitably the host
is non-human.
We have introduced the exemplary human eRF1 into cell lines from three eukaryotic
species (human, hamster, flies), as well as eukaryotic live animals (flies).
The engineered human eRF1 enhances unnatural amino acid incorporation in species
where the native eRF1 is only 84% conserved (Dmel insect cells).
We have used constructs to replace the native yeast eRF1 with our exemplary human
eRF1 variant (Plasmids derived from Nucleic Acids Res. 2010 Sep;38(i6):5479-92).
This shows that diverse eRF1 proteins can be used with only 67% conservation
(sequence identity), and cover a large range of eukaryotic organisms.
Of course the nucleic acid sequence for eRF1 (or a variant) is not important - one
exemplary human eRF1 variant has been codon optimised to express well in insect
cells, but also works in human cell lines. Thus the codon optimisation of the nucleic
acid (if desired) is a matter for the skilled operator.
It is an advantage of the invention that amber suppression is increased. Suitably the
eRF1 mutants described herein are used in amber suppression.
In a further aspect, there is provided a method for incorporating an unnatural amino
acid into a protein of interest in a eukaryotic cell - such as a mammalian cell or an
insect cell comprising the steps of: i) providing a eukaryotic cell expressing a tRNA
synthetase and tRNA pair, a nucleic acid sequence of interest and a mutant eRF1; ii)
incubating the cell in the presence of an unnatural amino acid to be incorporated into a
protein encoded by the nucleic acid sequence of interest, wherein said unnatural amino
acid is a substrate for the tRNA synthetase; and iii) incubating the cell to allow
incorporation of said unnatural amino acid into the protein of interest via the
orthogonal tRNA-tRNA synthetase pair.
The use of a mutant eRF1 for incorporating an unnatural amino acid into a protein of
interest in a eukaryotic cell is also disclosed.
There is also disclosed a method of identifying a mutant of eRF1 that increases the
incorporation of an unnatural amino acid in a protein of interest is also provided. The
method comprises the steps of: (i) providing a cell that is capable in incorporating an
unnatural amino into a protein of interest, suitably wherein said cell is the eukaryotic
cell as described herein; (ii) incubating the cell in the presence of the unnatural amino
acid to be incorporated into the protein of interest and in the presence and absence of
the mutant of eRF1, wherein said unnatural amino acid is a substrate for the tRNA
synthetase; and (iii) determining the level of unnatural amino acid incorporation into
the protein of interest in the presence and absence of the mutant of eRF1, wherein an
increase in the level of unnatural amino acid incorporation into the protein of interest
in the presence the mutant of eRF1 is indicative that said mutant of eRF1 increases the
incorporation of an unnatural amino acid in the protein of interest.
Methods for incorporating one or more mutations into a eRF1 include site-directed
mutagenesis and the like which are well known in the art. Suitably, the mutations that
are selected may be based on mutations in amino acids in eRF1 that have an effect on
termination at amber codons, as described in references 25-30. Suitably, the mutations
that are selected may be located in the N-terminal domain of eRF1 (see Figure 2a) that
interacts with the stop codon on the mRNA within the ribosome. Desirably, the eRF1
mutants result in efficient unnatural amino acid incorporation in response to a selected
codon - such as TAG- without increasing read-through of other stop codons.
In one embodiment, release factor mutants - such as eRF1 - are not used in the
present disclosure.
In one embodiment, expression of endogenous release factor - such as eRF1 - is
decreased or deleted from the host cell. This can be achieved by, for example, a
disruption one or more of the genomic loci encoding eRF1, or through RNA-mediated
gene silencing of eRF1.
Making a Protein Comprising Unnatural Amino Acid(s)
An orthogonal or expanded genetic code can be used in the present disclosure, in which
one or more specific codons present in the nucleic acid sequence of interest are
allocated to encode the unnatural amino acid so that it can be genetically incorporated
into the protein of interest by using an orthogonal tRNA synthetase/tRNA pair. The
orthogonal tRNA synthetase/tRNA pair is capable of charging a tRNA with an
unnatural amino acid and is capable of incorporating that unnatural amino acid into
the polypeptide chain in response to the codon.
The codon may be the codon amber, ochre, opal or a quadruplet codon. The codon
simply has to correspond to the orthogonal tRNA which will be used to carry the
unnatural amino acid. Suitably, the codon is amber. Suitably, the codon is an
orthogonal codon.
Unnatural amino acid incorporation is to a large extent performed on the amber UAG
codon. Suitably the codon is UAG or UGA, most suitably UAG (amber). An exemplary
mutation that minimises activity of the release factor on the amber (UAG) stop codon
(e.g. E55D). Other mutations described may not affect recognition of the amber stop
codon, but reduce termination activity on UGA or UAA stop codons (opal/ochre). This
is exemplified by S70A, G73S. The skilled operator will select the eRF1 mutants to suit
their needs when using codons other than UAG(amber).
It should be noted that the specific examples shown herein have used the amber codon
and the corresponding tRNA/tRNA synthetase. As noted above, these may be varied.
Alternatively, in order to use other codons without going to the trouble of using or
selecting alternative t A/ tR A synthetase pairs capable of working with the
unnatural amino acid, the anticodon region of the tRNA may simply be swapped for the
desired anticodon region for the codon of choice. The anticodon region is not involved
in the charging or incorporation functions of the tRNA nor recognition by the tRNA
synthetase so such swaps are entirely within the ambit of the skilled person.
Thus, alternative orthogonal tRNA synthetase/tRNA pairs may be used if desired.
A host cell can be used to produce (for example, express) a protein that comprises one
or more unnatural amino acids.
The host cell into which the constructs or vectors disclosed herein are introduced is
cultured or maintained in a suitable medium such that the tRNA, the tRNA synthetase
and the protein of interest are produced. The medium also comprises the unnatural
amino acid(s) such that the protein of interest incorporates the unnatural amino
acid(s). Such proteins are encoded by a nucleic acid comprising one or more codons as
described herein within the coding sequence. The orthogonal tRNA synthetase/tRNA
pair charges a tRNA with an unnatural amino acid and incorporates the unnatural
amino acid into the polypeptide chain in response to the codon.
In a further aspect, there is a provided a method for incorporating an unnatural amino
acid into a protein of interest in a eukaryotic cell comprising the steps of: i) providing a
eukaryotic cell comprising the construct(s) or vector(s) described herein; ii) incubating
the cell in the presence of one or more unnatural amino acids to be incorporated into a
protein of interest encoded the nucleic acid sequence of interest, wherein said
unnatural amino acid is a substrate for the tRNA synthetase; and iii) incubating the cell
to allow incorporation of said unnatural amino acid into the protein of interest via the
orthogonal tRNA-tRNAsynthetase pair.
Proteins comprising an unnatural amino acid(s) are prepared by introducing the
nucleic acid constructs described herein comprising the tRNA and tRNA synthetase
and comprising a nucleic acid sequence of interest with one or more in-frame
orthogonal (stop) codons into a host cell. The host cell is exposed to a physiological
solution comprising the unnatural amino acid(s), and the host cells are then
maintained under conditions which permit expression of the protein of interest's
encoding sequence. The unnatural amino acid(s) is incorporated into the polypeptide
chain in response to the codon.
Advantageously, more than one unnatural amino acid is incorporated into the protein
of interest. Alternatively two or more unnatural amino acids may be incorporated into
the protein of interest at two or more sites in the protein. Suitably at least three
unnatural amino acids may be incorporated into the protein of interest at three or more
sites in the protein. Suitably at least four unnatural amino acids may be incorporated
into the protein of interest at four or more sites in the protein. Suitably at least five
unnatural amino acids may be incorporated into the protein of interest at five or more
sites in the protein. Suitably at least six unnatural amino acids may be incorporated
into the protein of interest at six or more sites in the protein. Suitably at least seven
unnatural amino acids may be incorporated into the protein of interest at seven or
more sites in the protein. Suitably at least eight unnatural amino acids may be
incorporated into the protein of interest at eight or more sites in the protein.
When multiple unnatural amino acids are to be incorporated into a protein of interest,
it will be understood that multiple codons will need to be incorporated into the
encoding nucleic acid sequence at the desired positions such that the tRNA
synthetase/tRNA pairs can direct the incorporation of the unnatural amino acids in
response to the codon(s). At least 1, 2, 3, 4, 5, 6, 7 or 8 or more codon encoding nucleic
acids maybe incorporated into the nucleic acid sequence of interest.
When it is desired to incorporate more than one type of unnatural amino acid into the
protein of interest into a single protein, a second or further orthogonal tRNA-tRNA
synthetase pair may be used to incorporate the second or further unnatural amino acid;
suitably said second or further orthogonal tRNA-tRNA synthetase pair recognises a
different codon in the nucleic acid encoding the protein of interest so that the two or
more unnatural amino acids can be specifically incorporated into different defined sites
in the protein in a single manufacturing step. In certain embodiments, two or more
orthogonal tRNA-tRNAsynthetase pairs may therefore be used.
Once the protein of interest incorporating the unnatural amino acid(s) has been
produced in the host cell it can be extracted therefrom by a variety of techniques known
in the art, including enzymatic, chemical and/or osmotic lysis and physical disruption.
The protein of interest can be purified by standard techniques known in the art such as
preparative chromatography, affinity purification or any other suitable technique.
Unnatural Amino Acids
As used herein, the term "unnatural amino acid" refers to an amino acid other than the
20 amino acids that occur naturally in protein.
Non-limiting examples of unnatural amino acids include: a p-acetyl-L-phenylalanine, a
p-iodo-L-phenylalamne, an O-methyl-L-tyrosine, a p-propargyloxyphenylalanine, a ppropargyl-
phenylalanine, an L-3-(2-naphthyl)alanine, a 3-methyl-phenylalanine, an O-
4-allyl-L-tyrosine, a 4-propyl-L-tyrosine, a tri-O-acetyl-GlcNAcp-serine, an L-Dopa, a
fluorinated phenylalanine, an isopropyl-L-phenylalanine, a p-azido-L-phenylalanine, a
p-acyl-L-phenylalanine, a p-benzoyl-L-phenylalanine, an L-phosphoserine, a
phosphonoserine, a phosphonotyrosine, a p-bromophenylalanine, a p-amino-Lphenylalanine,
an isopropyl-L-phenylalanine, an unnatural analogue of a tyrosine
amino acid; an unnatural analogue of a glutamine amino acid; an unnatural analogue
of a phenylalanine amino acid; an unnatural analogue of a serine amino acid; an
unnatural analogue of a threonine amino acid; an alkyl, aryl, acyl, azido, cyano, halo,
hydrazine, hydrazide, hydroxy!, alkenyl, alkynl, ether, thiol, sulfonyl, seleno, ester,
thioacid, borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone,
imine, aldehyde, hydroxylamine, keto, or amino substituted amino acid, or a
combination thereof; an amino acid with a photoactivatable cross-linker; a spin-labeled
amino acid; a fluorescent amino acid; a metal binding amino acid; a metal-containing
amino acid; a radioactive amino acid; a photocaged and/or photoisomerizable amino
acid; a biotin or biotin-analogue containing amino acid; a keto containing amino acid;
an amino acid comprising polyethylene glycol or polyether; a heavy atom substituted
amino acid; a chemically cleavable or photocleavable amino acid; an amino acid with
an elongated side chain; an amino acid containing a toxic group; a sugar substituted
amino acid; a carbon-linked sugar-containing amino acid; a redox-active amino acid;
an a-hydroxy containing acid; an amino thio acid; an a , a disubstituted amino acid; a
b-amino acid; a cyclic amino acid other than proline or histidine, and an aromatic
amino acid other than phenylalanine, tyrosine or tryptophan.
In order to incorporate one or more unnatural amino acid(s) of choice into a protein as
described herein, the skilled operator simply selects the correct synthetase capable of
charging the orthogonal tRNArecognising the codon.
Specific examples of incorporation of different unnatural amino acids are provided
herein.
In Example 2, the incorporation of (N e-[(tert-butoxy)carbonyl]-l-lysine ) and (N -[((2-
methylcycloprop-2-en-i-yl)methoxy)carbonyl]-l-lysine is demonstrated. The structures
of these compounds are shown in Chart lb. Both of these substrates are known
efficient substrates for the PylRS/tRNAcuA pair (Nat Biotechnol 2014, 32, 465 and J Am
Chem Soc 2009, 131, 8720).
In Example 9, the incorporation of Boc-K (N e-[(tert-butoxy)carbonyl]-L-lysine,
Norbonene-K (N e--norbomene-2-yloxycarbonyl-L-lysine), Cyclopropene-K (N e-[((2-
methylcycloprop-2-en-i-yl)methoxy)carbonyl]-L-lysine) and Bicyclonyne-K (N e-
([(iR,8S)-bicyclo[6.i.o]non-4-yn-9-ylmethoxy]carbonyl)-Lysine) is shown.
WO2010/139948 describes the incorporation of aliphatic or straight chain carbon
backbone amino acids capable of supporting alkyne-azide bonding into a protein of
interest using an orthogonal tRNA-tRNA synthetase pair.
WO2013/10844 describes the incorporation of a norbornene amino acid into a protein
of interest using an orthogonal tRNA-tRNA synthetase pair.
Antibodies
Suitably, the nucleic acid sequence of interest encodes an antibody or an antibody
fragment. One or more unnatural amino acids - suitably, 2, 3, 4, 5, 6, 7 or 8 or more
unnatural amino acids - maybe incorporated into an antibody or an antibody fragment.
As used herein, term "antibody" refers to a protein of the immunoglobulin family that is
capable of binding a corresponding antigen non-covalently, reversibly, and in a specific
manner. The term includes, but is not limited to, monoclonal antibodies, human
antibodies, humanized antibodies, camelid antibodies, chimeric antibodies, and antiidiotypic
(anti-Id) antibodies. The antibodies can be of any isotype/class and can
therefore include IgG, IgE, IgM, IgD, IgA and IgY, or subclass of antibodies - such as
IgGi, IgG2, IgG3, IgG4, IgAi and IgA2.
As used herein, the term "antibody fragment", refers to one or more portions of an
antibody that retains the ability to specifically interact with (for example, by binding,
steric hindrance, stabilizing/destabilizing, spatial distribution) an epitope of an
antigen. Examples of binding fragments include, but are not limited to, single-chain
Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F(ab') fragments, a monovalent
fragment consisting of the VL, VH, CL and CHi domains; a F(ab) fragment, a bivalent
fragment comprising two Fab fragments linked by a disulphide bridge at the hinge
region; a Fd fragment consisting of the VH and CHi domains; a Fv fragment consisting
of the VL and VH domains of a single arm of an antibody; a dAb fragment, which
consists of a VH domain; and an isolated complementarity determining region (CDR),
or other epitope-binding fragments of an antibody. Furthermore, although the two
domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be
joined, using recombinant methods, by a synthetic linker that enables them to be made
as a single protein chain in which the VL and VH regions pair to form monovalent
molecules (known as single chain Fv ("scFv"). Such single chain antibodies are
encompassed within the term "antigen binding fragment." These antigen binding
fragments are obtained using conventional techniques known to those of skill in the art,
and the fragments can be screened for activity in the same manner as intact antibodies.
The antibody may be monospecific, bi-specific, or multispecific. A multispecific
antibody may be specific for different epitopes of one target protein or may contain
antigen-binding domains specific for more than one target protein. The antibody can
be linked to or co-expressed with another functional molecule - such as another
peptide or protein. For example, an antibody or fragment thereof can be functionally
linked to one or more other molecular entities - such as another antibody or antibody
fragment to produce a bi-specific or a multi-specific antibody with a second binding
specificity. Functional linking may be achieved using chemical coupling, genetic fusion,
or non-covalent association for example.
Other exemplary bispecific formats include scFv-based or diabody bispecific formats,
IgG-scFv fusions, dual variable domain (DVD)-Ig, Quadroma, knobs-into-holes,
common light chain (e.g., common light chain with knobs-into-holes, etc.), CrossMab,
CrossFab, (SEED)body, leucine zipper, Duobody, IgGi/IgG2 and dual acting Fab
(DAF)-IgG bispecific formats (see, for example, mAbs (2012) 4:6, 1-11).
Suitably, the antibodies that are used are human antibodies. The term "human
antibody" includes antibodies having variable regions in which both the framework and
CDR regions are derived from sequences of human origin. Furthermore, if the
antibody contains a constant region, the constant region also is derived from such
human sequences, for example, human germline sequences, or mutated versions of
human germline sequences or antibody containing consensus framework sequences
derived from human framework sequences analysis. The human antibodies can include
amino acid residues not encoded by human sequences (for example, mutations
introduced by random or site-specific mutagenesis in vitro or by somatic mutation in
vivo, or a conservative substitution to promote stability or manufacturing).
Antibody drug conjugate
The antibody or antibody fragment with one or more unnatural amino acids
incorporated therein may be used to prepare an antibody drug conjugate (ADC).
ADCs comprise an antibody(s) or antibody fragment(s) conjugated to a drug moiety.
The drug moiety can be any drug moiety that has a desired impact on the cell in which
the ADC is present. By way of example, it can be an anti-cancer agent, antihematological
disorder agent, an autoimmune treatment agent, an anti-inflammatory
agent, an antifungal agent, an antibacterial agent, an anti-parasitic agent, an anti-viral
agent, or an anesthetic agent, or a radioisotope and the like.
The antibodies or antibody fragments can be conjugated to one or more identical or
different drug moieties as required. The antibodies or antibody fragments may be
conjugated to a drug moiety that modifies a given biological response. Thus, for
example, the drug moiety may be a protein, peptide, or polypeptide possessing a
desired biological activity. Such proteins may include, for example, a toxin, a cytotoxin,
a protein - such as tumor necrosis factor, a cytokine, an apoptotic agent, an antiangiogenic
agent, or, a biological response modifier - such as a lymphokine.
Various methods for conjugating a drug moiety to antibodies or antibody fragments are
well known in the art. For example, reference can be made to MAbs (2014) 6(1): 46-53
which reviews current methods for site-specific drug conjugation to antibodies.
Various techniques for chemical modification of proteins are also known in the art (see,
for example, Nat Chem Biol. (2011) 7, 876-84; Bioconjugate Techniques, Elsevier
(2008) and Chem Biol. (2010) 17, 213-27).
A drug moiety can be joined to an antibody or an antibody fragment via a linker. As
used herein, a 'linker" refers to any chemical moiety that is capable of linking an
antibody or antibody fragment to a drug moeity. Linkers can be susceptible to cleavage
(cleavable linker), such as, acid-induced cleavage, photo-induced cleavage, peptidaseinduced
cleavage, esterase-induced cleavage, and disulfide bond cleavage.
Alternatively, linkers can be substantially resistant to cleavage (for example, stable
linker or noncleavable linker).
The ADCs can be characterized and selected for their physical/chemical properties
and/or biological activities by various assays known in the art. For example, an
antibody can be tested for its antigen binding activity by known methods - such as
ELISA, FACS, Biacore or Western blot. Transgenic animals and cell lines are
particularly useful in screening ADCs that have potential as prophylactic or therapeutic
treatments. Screening for a useful ADC may involve administering a candidate ADC
over a range of doses to the transgenic animal, and assaying at various time points for
the effect(s) of the ADC on the disease or disorder being evaluated. Alternatively, or
additionally, the drug can be administered prior to or simultaneously with exposure to
an inducer of the disease, if applicable. The candidate ADC may be screened serially
and individually, or in parallel under medium or high-throughput screening format.
Thus, in a further aspect, there is provided a method of preparing an antibody-drug
conjugate comprising the steps of: i) providing the eukaryotic cell described herein,
wherein the nucleic acid sequence of interest encodes an antibody or an antibody
fragment; ii) incubating the cell in the presence of the unnatural amino acid to be
incorporated into the antibody or antibody fragment, wherein said unnatural amino
acid is a substrate for the tRNA synthetase; iii) obtaining an antibody or antibody
fragment in which an unnatural amino acid has been incorporated therein; and vi)
conjugating the antibody or antibody fragment with a drug moiety via the unnatural
amino acid. A linker between the unnatural amino acid and the drug moiety may be
used.
In one embodiment, the antibody or an antibody fragment comprising one or more (for
example, 2, 3, 4, 5, 6, 7 or 8 or more) unnatural amino acids is conjugated to a drug
moiety through a linkage between the unnatural amino acid and the drug moiety.
Traditionally, a drug moiety is conjugated non-selectively to cysteine or lysine residues
in the antibody or antibody fragment. However, this strategy often leads to
heterogeneous products, which make optimisation of the biological, physical, and
pharmacological properties of an ADC challenging. The use of unnatural amino acids
as conjugation points to synthesize homogeneous ADCs with precise control of
conjugation site and stoichiometry offers a number of advantages which can include
improved pharmacokinetics and improved potency. Site-specific conjugation methods
are therefore highly desirable.
To date, many ADCs have targeted an average of 4 drugs per antibody. This ratio has
been chosen as an optimal combination of cytotoxicity and pharmacokinetic stability
(see . Chem. Res (2008) 41(1) 98-107 and Clin. Cancer. Res (2004) 10(20):7063~
7070). Accordingly, a particular embodiment relates to an antibody or antibody
fragment comprising about 4 unnatural amino acids that can be or are conjugated to a
drug moiety through a linkage between the unnatural amino acid and the drug moiety.
In one exemplary embodiment, the antibody is an anti-HER2/neu IgGi humanized
antibody or a variant or derivative thereof - such as Trastuzumab.
Different non-naturally occurring amino acids (for example, N e-[((2-methylcycloprop-
2-en-i-yl)methoxy)carbonyl ]-L-lysine) for conjugation of one or more small molecules
will be incorporated. The molecules can be conjugated with the unnatural amino
acid(s) containing mAbs using tetrazine chemistry. The molecules can include cytotoxic
molecules or chemical moieties that induce immune responses.
Advantageously, N e-[((2-methylcycloprop-2-en-i-yl)methoxy)carbonyl]-L-lysine)
exhibits very high incorporation rates at amber codons (and subsequently higher
protein expression). Compared with many of the UAAs which are used for protein
conjugation in the public domain, cyclopropene has a longer side chain and a more
solvent-exposed conjugation handle. This long side-chain, combined with the high
rates of amber-codon incorporation, should allow for incorporation of the UAAat more
sites within the mAb scaffold. This flexibility can be important for customising
different antibody-drug conjugates.
Kits
Kits for producing a protein of interest comprising one or more unnatural amino acids
are also provided.
In one aspect, there is provided a t for incorporating an unnatural amino acid into a
protein in a eukaryotic cell comprising: (i) the nucleic acid constructs described herein;
or (ii) the combination of nucleic acid constructs described herein; or (iii) the vector
described herein; or (iv) the combination of vectors described herein; or (v) the cell
described herein; and (vi) optionally, an unnatural amino acid.
Suitably, the kit further comprises a nucleic acid construct or a vector encoding a
mutant eRF1, or a cell comprising same.
The kits may also comprise printed instructional materials describing a method for
using the reagents to produce such proteins.
General recombinant DNA techniques
The present invention employs, unless otherwise indicated, conventional techniques of
chemistry, molecular biology, microbiology and recombinant DNA technology, which
are within the capabilities of a person of ordinary skill in the art. Such techniques are
explained in the literature. See, for example, M. Green &J . Sambrook, 2012, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. This text is
herein incorporated by reference.
The invention is now described by way of numbered paragraphs:
paragraph 1. A nucleic acid construct for expressing a tRNA synthetase and tRNA pair
in a eukaryotic cell, suitably a mammalian or insect cell, comprising:
(i) a nucleic acid sequence encoding the tRNA synthetase operably linked to a first
promoter capable of expressing the tRNA synthetase; and
(ii) a nucleic acid sequence encoding the tRNA operably linked to a second
promoter capable of expressing the tRNA,
wherein the first and second promoters are in opposite directions to each other, or
wherein the tRNA is present in multiple copies on the nucleic acid construct.
paragraph 2. The nucleic acid construct according to paragraph 1, wherein the nucleic
acid construct further comprises a nucleic acid sequence encoding a nucleic acid
sequence of interest operably linked to a further promoter capable of expressing the
nucleic acid sequence of interest in a eukaryotic cell.
paragraphs. The nucleic acid construct according to paragraph 2, wherein the
promoter is oriented in the same direction as the first promoter, optionally, wherein the
promoter capable of expressing the nucleic acid sequence of interest in a eukaryotic cell
is the same as the first promoter or different to the first promoter.
paragraph 4. The nucleic acid construct according to any of paragraphs 1to 3, further
comprising a nucleic acid sequence encoding a mutant eRF1, suitably a mutant homo
sapiens eRF1, suitably, wherein the mutant eRF1 is selected from the group consisting
of E55D, E55A, N129P/K130Q and Y125F or a combination of two or more thereof.
paragraph 5. The nucleic acid construct according to paragraph 4, wherein the nucleic
acid sequence encoding the mutant eRF1 and the nucleic acid sequence encoding the
tRNA synthetase are linked via a self-cleaving peptide in the same open reading frame.
paragraph 6. A nucleic acid construct for expressing a tRNA and a nucleic acid
sequence of interest in a eukaryotic cell, said nucleic acid sequence of interest
comprising a codon recognised by the tRNA at the position for incorporation of an
unnatural amino acid comprising:
(i) a nucleic acid sequence comprising the nucleic acid sequence of interest
operably linked to a first promoter capable of expressing the nucleic acid sequence of
interest in a eukaryotic cell; and
(ii) a nucleic acid sequence encoding the tRNA operably linked to a second
promoter capable of expressing the tRNA,
wherein the first and second promoters are in opposite directions to each other, or
wherein the tRNA is present in multiple copies on the nucleic acid construct.
paragraph 7. The nucleic acid construct according to paragraph 6, further comprising
a nucleic acid sequence encoding a mutant eRFi, suitably a mutant homo sapiens eRF1,
suitably, wherein the mutant eRF1 is selected from the group consisting of E55D, E55A,
N129P/K130Q and Y125F or a combination of two or more thereof.
paragraph 8. The nucleic acid construct according to any of the preceding paragraphs,
wherein the first and second promoters are in opposite directions to each other and
wherein the tRNA is present in multiple copies on the nucleic acid construct.
paragraph 9. The nucleic acid construct according to any of the preceding paragraphs,
wherein the tRNA is linked directly to the promoter or indirectly to the promoter,
suitably wherein the nucleic acid construct comprises a terminator sequence connected
to the tRNAwith a linker.
paragraph ic The nucleic acid construct according to any of the preceding
paragraphs, wherein each copy of the nucleic acid sequence encoding the tRNAis under
the control of a separate promoter.
paragraph 11. The nucleic acid construct according to any of the preceding paragraphs,
wherein the promoter arrangement comprises an elongation factor promoter oriented
in a first direction and a Pol III promoter oriented in a second direction.
paragraph 12. The nucleic acid construct according to any of the preceding paragraphs,
wherein the first promoter is or is derived from an EF-i promoter.
paragraph 13. The nucleic acid construct according to any of the preceding paragraphs,
wherein the second promoter is or is derived from a U6 promoter.
paragraph 14. The nucleic acid construct according to any of the preceding paragraphs,
wherein the tRNA is present in 4, 5, 6, 7 or 8 or more copies on the nucleic acid
construct(s).
paragraph 15. The nucleic acid construct according to any of the preceding paragraphs,
wherein the tRNA is a wild-type or a variant tRNA, suitably a U25C variant of PylT.
paragraph 16. The nucleic acid construct according to any of the preceding
paragraphs, wherein the nucleic acid sequence of interest comprises at least 1, 2, 3 or 4
stop codons.
paragraph 17. The nucleic acid construct according to any of paragraphs 2 to 16,
wherein the nucleic acid sequence of interest encodes an antibody or an antibody
fragment.
paragraph 18. The nucleic acid construct according to any of the preceding paragraphs,
wherein said tRNA synthetase is orthogonal to the endogenous tRNAs in the eukaryotic
cell and/or said tRNA is orthogonal to the endogenous tRNA synthetases in the
eukaryotic cell and/or said tRNA synthetase is orthogonal to the endogenous tRNAs in
the eukaryotic cell and said tRNA is orthogonal to the endogenous tRNA synthetases.
paragraph 19. A combination of nucleic acid constructs comprising the nucleic acid
construct according to any of paragraphs 1 to 5 and 8 to 18 and the nucleic acid
construct according to any of paragraphs 6 to 18.
paragraph 20. The combination of nucleic acid constructs according to paragraph 19,
wherein the nucleic acid sequence encoding the mutant eRF1 is on a separate construct.
paragraph 21. A vector comprising the nucleic acid construct according to any of
paragraphs 1to 18.
paragraph 22. A combination of vectors comprising a vector comprising the nucleic
acid construct according to any of paragraphs 1to 5 and 8 to 18 and a vector comprising
the nucleic acid construct according to any of paragraphs 6 to 18.
paragraph 23. The combination of vectors according to paragraph 22, wherein the
nucleic acid sequence encoding the mutant eRF1 is on a separate vector.
paragraph 24. A cell comprising the nucleic acid construct according to any of
paragraphs 1 to 18, the combination of nucleic acid constructs according to paragraph
19 or paragraph 20, the vector according to paragraph 21 or the combination of vectors
according to paragraph 22 or paragraph 23.
paragraph 25. The cell according to paragraph 24, further comprising a nucleic acid
construct encoding a mutant eRF1, suitably a mutant homo sapiens eRFi.
paragraph 26. The cell according to paragraph 25, wherein the mutant eRF1 is selected
from the group consisting of E55D, E55A, N129P/K130Q and Y125F or a combination
of two or more thereof, suitably, where in the mutations are made in the homo sapiens
eRF1 gene sequence as described in GenBank Accession Number AF095901.1.
paragraph 27. The cell according to any of paragraphs 24-26, wherein the cell is an
insect cell or a mammalian cell.
paragraph 28. The cell according to any of paragraphs 24-27, wherein the cell is
transiently or stably transfected with the nucleic acid.
paragraph 29. A kit for incorporating an unnatural amino acid into a protein in a
eukaryotic cell, suitably a mammalian or insect cell, comprising:
(i) the nucleic acid construct according to any of paragraphs 1to 5 and 8 to 18 and
the nucleic acid construct according to any of paragraphs 6 to 18; or
(ii) the combination of nucleic acid constructs according to paragraph 19 or
paragraph 20; or
(iii) the vector according to paragraph 21; or
(iv) the combination of vectors according to paragraph 22 or paragraph 23; or
(v) the insect or mammalian cell according to paragraph 27 or paragraph 28; and
(vi) optionally, an unnatural amino acid.
paragraph 30. The kit according to paragraph 29, further comprising a nucleic acid
construct or a vector encoding a mutant eRF1, or a cell comprising same.
paragraph 31. A method for incorporating an unnatural amino acid into a protein of
interest in a eukaryotic cell, suitably a mammalian or insect cell, comprising the steps
of:
i) providing the cell according to paragraph 27 or paragraph 28, wherein said cell
comprises the combination of nucleic acid constructs according to paragraph 19 or
paragraph 20 or the combination of vectors according to paragraph 22 or paragraph
23; and
ii) incubating the cell in the presence of the unnatural amino acid to be
incorporated into a protein of interest encoded by the nucleic acid sequence of interest,
wherein said unnatural amino acid is a substrate for the tRNA synthetase; and
iii) incubating the cell to allow incorporation of said unnatural amino acid into the
protein of interest via the orthogonal tRNA-tRNAsynthetase pair.
paragraph 32. The method according to paragraph 31, wherein at least 3, 4, or 5
unnatural amino acids are incorporated into the protein of interest.
paragraph 33. A method of preparing an antibody-drug conjugate comprising the steps
of:
i) providing the cell according to paragraph 27 or paragraph 28, wherein said cell
comprises the combination of nucleic acid constructs according to paragraph 19 or
paragraph 20 or the combination of vectors according to paragraph 22 or paragraph 23,
and wherein the nucleic acid sequence of interest encodes an antibody or an antibody
fragment;
ii) incubating the cell in the presence of the unnatural amino acid to be
incorporated into the antibody or antibody fragment, wherein said unnatural amino
acid is a substrate for the tRNA synthetase;
iii) obtaining an antibody or antibody fragment in which an unnatural amino acid
has been incorporated therein; and
iv) conjugating the antibody or antibody fragment with a drug moiety via the
unnatural amino acid.
paragraph 34. Use of: (i) the nucleic acid construct according to any of paragraphs 1to
5 and 8 to 18 and the nucleic acid construct according to any of paragraphs 6 to 18; or
(ii) the combination of nucleic acid constructs according to paragraph 19 or paragraph
20; or (iii) the vector according to paragraph 21; or (iv) the combination of vectors
according to paragraph 22 or paragraph 23; or (v) the insect or mammalian cell
according to paragraph 27 or paragraph 28, for incorporating an unnatural amino acid
into a protein of interest in a eukaryotic cell, suitably a mammalian or insect cell.
paragraph 35. A method for incorporating an unnatural amino acid into a protein of
interest in a eukaryotic cell, suitably a mammalian or insect cell, comprising the steps
of:
i) providing a eukaryotic cell expressing an orthogonal tRNA synthetase and tRNA
pair, a nucleic acid sequence of interest and a mutant eRF1, said nucleic acid sequence
of interest comprising a codon recognised by the tRNA at the position for incorporation
of an unnatural amino acid;
ii) incubating the eukaryotic cell in the presence of an unnatural amino acid to be
incorporated into a protein encoded by the nucleic acid sequence of interest, wherein
said unnatural amino acid is a substrate for the orthogonal tRNA synthetase; and
iii) incubating the eukaryotic cell to allow incorporation of said unnatural amino
acid into the protein of interest via the orthogonal tRNA-tRNAsynthetase pair.
paragraph 36. Use of a mutant eRF1 for incorporating an unnatural amino acid into a
protein of interest in a eukaryotic cell, suitably a mammalian or insect cell .
paragraph 37. A method of identifying a mutant of eRF1 that increases the
incorporation of an unnatural amino acid in a protein of interest, comprising the steps
of:
(i) providing a cell that is capable in incorporating an unnatural amino into a
protein of interest, suitably, wherein said cell expresses an orthogonal tRNA synthetase
and tRNA pair, a nucleic acid sequence of interest and optionally a mutant eRF1, said
nucleic acid sequence of interest comprising a codon recognised by the tRNA at the
position for incorporation of an unnatural amino acid;
incubating the cell in the presence of the unnatural amino acid to be incorporated into
the protein of interest and in the presence and absence of the mutant of eRF1, wherein
said unnatural amino acid is a substrate for the tRNA synthetase; and
determining the level of unnatural amino acid incorporation into the protein of interest
in the presence and absence of the mutant of eRF1,
wherein an increase in the level of unnatural amino acid incorporation into the protein
of interest in the presence the mutant of eRF1 is indicative that said mutant of eRF1
increases the incorporation of an unnatural amino acid in the protein of interest.
paragraph 38. A construct, vector, cell, kit, method or use substantially as described
herein with reference to the accompanying description and drawings.
Description of the Embodiments
Although illustrative embodiments of the invention have been disclosed in detail
herein, with reference to the accompanying drawings, it is understood that the
invention is not limited to the precise embodiment and that various changes and
modifications can be effected therein by one skilled in the art without departing from
the scope of the invention as defined by the appended claims and their equivalents.
Further particular and preferred aspects are set out in the accompanying independent
and dependent claims. Features of the dependent claims may be combined with
features of the independent claims as appropriate, and in combinations other than
those explicitly set out in the claims.
Where an apparatus feature is described as being operable to provide a function, it will
be appreciated that this includes an apparatus feature which provides that function or
which is adapted or configured to provide that function.
EXAMPLES
Example 1- Materials &Methods
DNA constructs
Reporter constructs were derived from the previously described plasmid pMbPylRSmCherry-
TAG-EGFP-HAi restriction sites was replaced with sfGFP 150TAG, codonoptimized
(Supplementary Information Table Si) for expression in human cell lines
(Life Technologies), to create plasmid CMV-PylRS/CMV-sfGFP(TAG).The same region
was replaced with a Renilla-TAG-firefly luciferase cassette to create plasmid CMVPylRS/
CMV-DLR(TAG). Stop or sense codons were introduced by site-directed
mutagenesis into sfGFP 150TAG or the Renilla-TAG-firefly luciferase cassette in
pJeti.2 (Thermo scientific), using KOD Hot Start polymerase (Novagen). Subcloning
the resulting mutants into pMbPylRS-mCherry-TAG-EGFP-HA gave sfGFP isoLeu
(CMV-PylRS/CMV-sfGFP), and sfGFP 101, 133, 150TAG (CMV-PylRS/CMVsfGFP(
TAG)3) and the dual luciferase reporter plasmids containing TAA (CMVPylRS/
CMV-DLR(TAA)), TGA (CMV-PylRS/CMV-DLR(TGA)) and SER (CMVPylRS/
CMV-DLR).
For the 4xU6 PylT plasmid series, a PB220PA-1 backbone (System Biosciences) was
used. The CMV cassette was replaced with an EF-ia cassette from CD532A-2 (System
Biosciences), subcloning the Spel/Sall fragment into Spel/Sall of PB220PA-1. The
optimized U6 promoter / Methanosarcina mazei pyrrolysine tRNA insert
(Supplementary Information Table Si) was synthesized (Life technologies) with
Spel/Avrll flanking sites. A 4xU6 PylT tandem cassette was constructed by repeated
insertion of the Spel/Avrll fragment into a unique Spel site 5' of the EFi promoter.
The (U6-PylT*)4/EF-ia-PylRS, (U6-PylT*)4/EF-ia-sfGFP(TAG) and (U6-PylT*)4/EFi<
x-sfGFP(TAG)3 plasmids were constructed by subcloning of the relevant genes from
AG28, CMV-PylRS/CMV-sfGFP and CMV-PylRS/CMV-S2. The mCherry-TAG-EGFP
cassette between the Mfel and Nhel sfGFP(TAG)3.
The Homo sapiens eRFi gene (GenBank: AF095901.1) was codon optimized for
Drosophila melanogaster (Supplementary Information Table Si), and extended by an
N-terminal His6 tag, a C-terminal triple stop (UAAUGAUAG).The codon optimization
was performed using the Helixweb toolkit2. Additional mutations were introduced by
site-directed mutagenesis (Supplementary Information Table 2), and the resulting
constructs cloned into the mammalian expression vectors pcDNATMs/FRT/TO using
restriction sites Hindin/Notl to create the peRFi(X) vectors in which X represents the
mutation, and eRFi is expressed from a CMVpromoter.
Cell culture, antibodies and assays
Adherent HEK293T cells were maintained on Diilbecco's modified Eagle's medium
(DMEM)-Glutamax (Gibco), supplemented with 10% FBS in a 5% CO2 atmosphere at
37°C. Transient transfections were performed using TransIT®-293 (Minis)
transfection reagent or polyethylenimin (Max PEI, Polysciences) in a 3:1 PEIrDNA ratio
following the manufacturers protocol.
Expression of proteins and eRFi depletion was confirmed by immunoblotting with
antibodies against eRFi (ab30928, Abeam), Actin (#4967, Cell Signaling Technology),
FLAG (A8592, Sigma-Aldrich), HIS (27E8, Cell Signaling Technology), HA (C29F4,
Cell Signaling Technology) and corresponding secondary HRP-linked antibodies
(#7074, #7076, #7077, Cell Signaling Technology). Depletion of eRFi was achieved by
54
transfection of commercially available eRF1 shRNAs (sc-37871-SH, Santa Cruz
Biotechnology) in equal amounts to other transfected plasmids.
Amino acid 1 was commercially available (E1610.0025, Bachern), amino acid 2 was
synthesized as previously described. For protein expression, amino acid solutions were
prepared as neutralized stock solutions in culture media, and added to cultured cells
either with the premcubated transfection mixture (Trans IT-293, 96 well plates) or
while changing the culture media four hours post transfection (PEI, 24 well plates,
10cm culture dishes, T75 flasks).
Northern blotting
Total RNA was isolated from HEK293T cells using Qiazol lysis reagent (Qiagen) and
precipitated with isopropanol. Northern blotting was performed with the
NorthernMax-Gly kit (Ambion); the RNA was denatured in glyoxal load dye, separated
on a 2% agarose gel, transferred onto BrightStar-Plus positively charged nylon
membrane (Ambion) and cross-linked by UV via a Stratalinker 2400 UV crosslinker
(Strategene). The membrane was hybridized overnight at 37°C with a 5'-biofinylated
DNA probe (5'-GGAAACCCCGGGAATCTAACCCGGCTGAACGGATTTAGAG-3'). The
hybridized probe was detected using chemilumineseent nucleic acid detection module
(Thermo Scientific).
Dual Luciferase. Assay
HEK293T cells were transfected in a 96 well plate (Costar #3595, Corning) using twice
the suggested amount of DNA (total 0.2 mg ) and TransIT®-293 reagent (0.6 ul) per
well. Dual Luciferase assays were performed according to a simplified manufacturer's
protocol (Promega). After 16 hours of growth the culture media was removed, and cells
lysed in 20 ml of passive lysis buffer for 15 minutes at room t emperat ure 10 ul of lysate
were then added to 50 ul of Luciferase Assay Buffer II, in white 96 well plates (Nunc
236105, Thermo Scientific). Subsequently, the firefly luciferase luminescence
measurement was taken (Pherastar FS, BMG Labtech), the reaction quenched and the
Renill a luminescence measurement taken after addition of 50 ml Stop & Gio buffer.
Experiments were performed in quadruplicate, with three replicates used for dual
luciferase measurements, and the remaining replicate for immunoblotting after lysis in
50 ml of RIPA buffer (Sigma) with Complete protease inhibitor (Roche).
Transient expression of sfGFP variants
Expressions of sfGFP(TAG) and sfGFP(TAG)3 for fluorescent assays were performed in
24 well plates. Routinely, iooooo ceils were seeded per well, grown over night and
transiently transfected using 160 ng DNAper plasmid, 1.5ml of PE (1 mg/ml) and 50 ml
reduced serum media (Opti-MEM, Gibco). Four hours post transfection, the media was
exchanged and amino acid 1 or 2 added to the fresh growth media. Following 48 hours
of growth, the supernatant was carefully removed and cells lysed in 100 ml RIPA buffer
(Sigma) with added Complete protease inhibitor (Roche) while shaking. 50 of the
lysate were transferred into 96 well plates (Costar #3595, Corning) and the
fluorescence intensity determined at 485/520 nm (Pherastar FS, BMG Labtech). sfGFP
was quantified in lysates using a calibration curve (Supplementary Figure Si).
For calibration purposes, sfGFP was expressed in E. coli DHiob cells from a PI5Abased
plasmid under pBAD promoter control, and purified by Ni-affinity
chromatography as described previously 4. Protein purity was verified by coomassie
staining after SDS-PAGE.
The absolute protein concentration in the reference sample was determined by
measuring the absorbance at 280 nm (extinction coefficient 0.6845) serially diluted
(1:10 per step) in RIPA buffer (Sigma) supplemented with Complete protease Inhibitor
(Roche). The fluorescense intensity (excitation 485 nm, emission 520 nm) for a given
concentration of sfGFP was measured in a volume of 50 ml in 96-we.ll plates (Costar,
Corning) in triplicate. Measurements outside of the linear range of the microplate
reader for a given gain setting (Pherastar FS, BMG Labtech) were discarded and the
remaining data points fitted to a linear curve. Subsequent measurements of sfGFP
fluorescence in cell lysates were performed under the same conditions, and sfGFP
concentrations determined with reference to the standard curve (Prism6, Graphpad).
Protein expression for mass spectrometry was performed in 10 cm culture dishes.
HEK293T were transfected in a 10 cm tissue culture dish with 15 m DNA with PEI. Cell
culture media was exchanged 4 hours post transfection, and incubated for 72 hours
with amino acid. Cells were washed twice with PBS and lysed in 1 mL RIPA buffer.
Cleared lysate was added to 50 ml GFP-Trap® M (ChromoTek) and incubated for 4
hours at 4°C, Beads were magnetically separated and washed with 1 mL RIPA, 1 mL
PBS, 1mL PBS+500 raM NaCl, 1mL dd O and eluted in 1% Acetic Acid/ddH20.
Mass spectrometry
Electrospray mass spectrometry was carried out using an Agilent 1200 LC-MS system
equipped with a 6130 Quadrupole spectrometer. The solvent system consisted of 0.1%
formic acid in H2O as buffer A, and 0.1% formic acid in acetonitrile (MeCN) as buffer
B Protein UV absorbance was monitored at 214 and 280 nm. Protein MS acquisition
was carried out in positive ion mode and total protein masses were calculated by
deconvolution within the MS Chemstation software (Agilent Technologies) .
Example 2 - Increasing tRNA levels increases unnatural amino acid
incorporation efficiency
We optimized the expression levels of tRNAcuA to increase the efficiency of unnatural
amino acid incorporation in mammalian cells. Investigators have used different PylRS
and tRNA plasmids that vary the copy number of PylRS, tRNA CUA and the choice of
promoters 1'7 20 . However, there are no reports that quantify the yields of proteins
bearing unnatural amino acids incorporated with the PylRS/tRNAcuA pair in
mammalian cells, nor are there reports that quantify- the efficiencies of unnatural
amino acid incorporation relative to the expression of a control protein expressed from
a gene that does not contain an amber stop codon. These experiments are crucial for
understanding how well unnatural amino acid incorporation in mammalian cells
compares to natural protein synthesis.
We first tested the efficiency of unnatural amino acid incorporation using plasmids h
and c bearing a single copy of PylRS on a CMV promoter and four copies of tRNAcuA
each driven by a U6 promoter with a CMV enhancer 1 (Construct schematics are
shown in Chart la). This system directed the incorporation of 1 (N e-[(tertbutoxy)
carbonyl]-L-lysine, or 2 (N e-[((2-methylcycloprop-2-en-iyl)
methoxy)carbonyl]-L-lysine (Chart lb), both known and efficient substrates for the
PylRS/tRNAcuA pair 21-22) in response to an amber codon at position 150 in s GFP 23
(CMV-sfGFP(TAG)) with efficiencies of 5% and 7% (Figure la,b); all incorporation
efficiencies are reported as a percentage of sfGFP levels produced from an otherwise
identical control construct bearing a leucine codon in place of the amber codon at
position 150 (plasmid a , C rt 1) . Next we replaced the four copies of tRNAcuA with a
single copy of tRNAcuA on an optimized U6 promoter, leading to a small decrease in
unnatural amino acid incorporation efficiency (plasmids b and d .
Unlike the original four-copy cassette, (c), the new U6 tRNAcuA cassette, (d), does not
contain the CMV enhancer, and produces a precise 5' end for the tRNA, that does not
require nuclease processing. Northern blots (Figure lc) demonstrate that the levels of
Pyi tRNAcuA produced from d , are comparable to the levels produced from c. This
indicates that the altered tRNA expression construct provides more copies of the tRNA
per copy of the tRNA gene. Replacing tRNAcuA with a U25C variant 24 increased the
incorporation efficiency slightly from 2. %-3·5 to 4.7-5.1% (plasmids b and e, C r t
1) and had a small effect on tRNAcuA level.
Creating tandem arrays, each containing four copies of U6 Pyl tRNAcuA (bearing U25C)
and switching the promoter for the protein coding genes from CMV to EF-ia (plasmids
g and h , Chart 1) led to a substantial increase in sfGFP bearing 1 or 2 . In this system
amino acid 1 was incorporated in response to the amber codon in sfGFP with an
efficiency of 62%, while 2 was incorporated with an efficiency of approximately 129%.
Western blots demonstrate that changing the promoter of the protein coding genes to
EF-ia does not change the levels of PylRS (anti-FLAG b+e vs g+h, Figure lb) or wt
sfGFP (a vs/ Figure lb) , demonstrating that neither PylRS levels nor maximal levels
of sfGFP expression are substantially altered by changing to the EF a promoter.
However, northern blots demonstrate that tRNA levels are much higher in this system
than in all other systems tested, strongly suggesting that the large increases in
unnatural amino acid incorporation efficiency we observe are caused by an increase in
tRNA level.
Example 3 - Ectopic expression of seiected eRFl variants does ot increase
read through of stop codons.
Next, we asked if we could further enhance unnatural amino acid incorporation
efficiency, without increasing read-through of other stop codons, by engineering eRFl.
While the efficiency of unnatural amino acid incorporation was already good with the
optimized synthetase and tRNA system, we envisioned that eRFl engineering might
further improve this efficiency and allow us to efficiently incorporate unnatural amino
acids at multiple sites in a protein.
We first identified amino acid positions in eRFl that are reported to have an effect on
termination at amber codons from genetic o biochemical studies 25 30 . These mutations
are in the N-terminal domain of eRFl (Figure 2a) that interacts with the stop codon
on the mRNA within the ribosome. To assess the effect of the eRFl mutants on
translational termination in mammalian cells we quantified suppressor tRNA
independent read-through at the amber, opal and ochre stop codon in HEK 293T cells
and in HEK 293T cells bearing added, overexpressed human eRF1 and eRF1 mutants
(Figure 2b). eRF1 forms a complex with eRF3, primarily mediated through the Cterminal
domain on eRF137, that mediates translational termination. eRF3 is present
in cells at levels comparable to endogenous eRF1, and therefore eRF3 limits the
number of termination complexes that may form35. Overexpression of eRF1 -terminal
domain mutants may bias (by mass action) these complexes towards containing the
eRF1 mutants, thereby revealing the phenotype of the eRF1 mutations.
We introduced each eRF1 variant into cells (Figure 2b), and measured basal readthrough
of stop codons, using three dual luciferase reporters (Figure 2c). Each
reporter contained an N-terminal Renilla luciferase followed by a stop codon (amber,
opal or ochre) and a C-terminal firefly luciferase 31-34. The read through of the stop
codons was between 0.08 and 0.12% (TAG 0.09%, TGA 0.12%, TAA 0.08%), providing
a benchmark for further experiments. Ectopic overexpression of eRF1 led to a decrease
in read-through of all three stop codons (TAG 0.03%, TGA 0.07%, TAA 0.04%),
consistent with the increased level of eRF1 in cells35. This decrease in read-through is
small, consistent with the levels of eRF3 being comparable to the levels of endogenous
eRF1, and eRF3 levels limiting the number of functional termination complexes that
can be formed 5.
Introduction of eRF1 variants increased stop codon read-through with respect to the
introduction of wild-type eRF1. However, for all eRF1 mutants tested, except two, read
through of all three stop codons was not increased above the levels found in the
absence of ectopically expressed eRF1. We conclude that ectopic expression of most of
the eRF1 variants tested does not increase read through of stop codons above basal
eve s.
The two eRF1 mutants which increase read through of stop codons above levels
normally found in cells are eRF1 D100, a mutant that increases read-through to 1.6%
(TAA), 2% (TAG) and 15% (TGA) and the T122Q, S123F mutant 29 that selectively
increases read-through at TGA codons 2-fold. Reduction of endogenous eRF1 levels by
shRNA increased basal read-through for all three stop codons 2- to 3-fold.
The effect of the eRF1 D100 mutant on read through of all stop codons is expected, as
the N-terminal domain, from which the residues are deleted, mediates recognition of
all three stop codons in mRNA, but does not mediate interactions with eRF33 -39. The
mutant is therefore predicted to form inactive complexes with eRFs, decreasing the
number of functional eRF1/eRF3 complexes that can mediate termination Similarly,
the effects of shRNA against eRF1 on all stop codons are expected 40 since a decrease in
eRF1 should lead to a decrease in termination on all stop codons.
Example 4 - eRF1 mutants increase unnatural amino acid incorporation
fici cy.
To investigate the effects of eRF1, eRF1 mutants and shRNA on unnatural amino acid
incorporation, we transfected cells with the relevant eRF1 mutant (Figure 2d). Each
sample was also provided with the dual iuciferase reporter of amber suppression, a
single copy of the orthogonal pyrrolysyl tRNA- synthetase (PylRS)/tRNACUA pair (the
arrangement shown as b + d in C rt 1, but with a dual Iuciferase reporter replacing
sfGFP). We used this system to maximize the dynamic range with which we could
measure the enhancement provided by eRF1 variants. The amino acid 1 was added to
all cells n one case ,an shRNA construct to endogenous eRF1 0 was added allowing us
to compare the effects of ectopically expressed eRF1 mutants to knocking down
endogenous eRF1.
The dual Iuciferase assay was used to determine the effects of eRF1 on unnatural
amino acid incorporation efficiency (Figure 2e). In the absence of ectopically
expressed release factor, the efficiency of unnatural amino acid incorporation was
approximately 5.3% in this assay. The incorporation efficiency was decreased slightly
upon ectopic expression of wild-type release factor, and increased to 13% upon shRNA
knockdown of endogenous eRF1. The efficiency of incorporation for 1 increased in the
presence of all mutant release factors except the S70A, G73S mutant. This mutant was
described previously as a bipotent UAR specific eRF1.28-41
Two eRF1 mutants led to the most efficient unnatural amino acid incorporation: eRF1
(E55D), 27%; and eRF1 (D100), 36%. The incorporation efficiencies with the D100
mutant and the E55D mutant are 5- to 7-fold greater than the incorporation efficiency
in cells that do not contain ectopically expressed release factor. Interestingly, while
strongly enhancing amber readthrough in the presence and absence of the PylRS/
tRNAcuA pair, the eRF1 100 mutant significantly reduced the total amount of Iuciferase
produced in both situations, consistent with a drastic disruption of termination at all
three stop codons having global effects on translation efficiency (Supporting
Information Figure 2) In addition, the Dioo mutant leads to readthrough of all
three stop codons in the absence of suppressor tRNAs; therefore, we did not investigate
this release factor mutant further. We focused further work on eRF1 (E55D). This
release factor mutant has been identified to removes formyl-methionine from the
initiator tRNA in response to the ochre and opal codon more efficiently than in
response to the amber codon, in an in vitro assay using rabbit reticulocyte ribosomes. 25
Example 5 - An optimized system for incorporating multiple unnatural
amino acids.
Next, we combined the optimized synthetase and tRNA system and the E55D mutant of
eRF1 (Figure 3). We find that the addition of eRF1 (E55D) to cells containing the
PylRS/tRNACUA pair, grown in the presence of 1, increases the incorporation of 1 into
sfGFP(TAG)from 62% to 85% (Figure 3a). Similarly, the addition of the eRF1 (E55D)
increases the efficiency with which 1 is incorporated into sfGFP(TAG)3, that contains
amber stop codons at positions K101, D133 and V15014 of GFP, from 5% to 12%
(Figure 3a,b). The yield of sfGFP-1 from sfGFP(TAG)was 0.65 mg from 105 cells, while
the yield of sfGFP-(1)3 from sfGFP-(TAG)3 was 0.1 per 105 cells (Supporting
Information Figure 3; all yields are quoted per number of cells seeded, and were
measured 48 h after transfection).
We find that the addition of the eRF1 (E55D) to cells containing the PylRS/tRNAcuA
pair, grown in the presence of 2, increases the incorporation of 2 into sfGFP(TAG)from
129% to 157%, and that the addition of the eRF1 (E55D) quadruples the efficiency of
producing of sfGFP-(2)3 from sfGFP(TAG)3 from 11% to 43% (Figure 3c,d). The yield
of sfGFP-2 from sfGFP(TAG) was 1.76 mg per 105 cells, while the yield of sfGFP-(2)3
from sfGFP(TAG)3 was 0.49 mg per 105 cells (Supporting Information Figure 3).
Full-length sfGFP was purified from cell lysates containing the optimized system
(Figure 4a). Electrospray ionization mass spectrometry demonstrated the site-specific
incorporation of one and three molecules of 1 and 2 into sfGFP from sfGFP(TAG) and
sfGFP(TAG)3 respectively (Figure 4b, Supporting Information Figure 4). This
data, in combination with the no amino acid controls in Figures 4a demonstrate the
high fidelity incorporation of unnatural amino acids in the presence of eRF1 (E55D).
Example 6 - Genomic integration of inducible eRF1 mutants enhances
amber suppression
61
The eRFi-enhanced expression system described so far relies on the parallel
transfection of three plasmids in order to introduce all necessary components for
unnatural amino acid incorporation into cells. By genomic integration of the eRFi
E55D mutant, only two plasmids (Figure 1, construct g combined with h or i) have to
be transfected, increasing the amount of these plasmids delivered into cells.
By using the tetracycline inducible promoter for eRF1, a cell line was created that can
be switched from a standard cell culture maintenance mode into a high efficiency
amber suppression mode when required, by addition of tetracycline to the growth
media.
The eRFi variants were introduced into a Flp-In™ T-REx™ 293 cell line (Life
Technologies). The cell line contains a single, transcriptionally active genomic FRT
target site, and thereby removes variation in expression levels due to the genomic
insertion site. It is therefore an ideal tool for comparing the effect of multiple genetic
constructs in distinct stable cell lines. We created the necessary FRT donor plasmids,
based on pcDNA™5/FRT/TO (Life Technologies).
Both the D. melanogaster recoded human eRFi wt and the eRFi E55D variants were
successfully integrated into the genome. The resulting Trex 293 wt and E55D cell lines
could be maintained both under induced and uninduced conditions for several months,
suggesting negligible toxic effects.
Amber suppression efficiency was determined by transient transfection of the
constructs containing the PylRS/tRNAcuA and sfGFP reporter (constructs g + h/i,
Figure 1), in a 1:1 ratio. In the presence of 0.5 mM amino acid 2 , amber suppression
increased from 75% to 99% sfGFP(TAG), and from 8%to 20% in sfGFPCTAG)3 upon
induction of eRFi expression by addition of 1 mg /mL tetracycline (Figure 5 A)
compared to sfGFP(wt).
The observed effect is less pronounced compared to the introduction of eRFi by
transient transfection (Figure 4). Immunostaining the cell lysates for eRFi shows that
the levels of eRFi are successfully raised upon induction (Figure 5D) , but less
pronounced compared to eRFi expression following transient transfection (Figure 4,
B/D). This is consistent with the presence of a single genomic integration site,
compared to the delivery of multiple copies of the plasmid by transient transfection per
cell. In the presence of endogenous, wild type eRFi, amber suppression can only be
62
enhanced if sufficient eRF1 E55D exists to prevent the formation of wild type
eRF1/eRF3 complexes with the ability to terminate at UAGcodons.
Example 7 - Constitutive expression o f shRNA(eRFl) increases amber-read
through i n cell lines with stable integration of eRF1 E55Ϊ3
As strong expression of eRF1 variants enables enhanced amber suppression (Figure
3) , so should the reduction of endogenous eRF1 in the presence of transgenic eRF1
(Games et al. 2003; Xlegems et al. 2004) A reduction of endogenous eRF1 levels by
shRNAs is linked to an unspecific increase in basal stop codon read-through (Figure 3
B, C). In line with the concept of a stable cell line with enhanced amber suppression
potential, the eRF1 specific set of shRNAs used earlier was now introduced into the cell
lines by random lentiviral integration into the genome (Santa Cruz Biotechnology).
Cells with successful integration events were selected based on acquired resistance to
puromycin. Both cell lines containing eRF1 E55D and eRF1 wild-type were created, and
could be maintained in the presence and absence of tetracycline for several weeks.
Amber suppression efficiency was determined after transient transfection of the
PylRS/ tRNAcuA pair and the sfGFP(TAG) or sfGFP(TAG)3 reporter constructs (plasmid
g + h/I, Figure 1). Amber suppression efficiency is shown as total sfGFP fluorescence
over background, and normalization to sfGFP(wt) in the same cell line.
The integration and induction of eRF1 E55D caused an increase in amber suppression
in the presence of 0.5 mM 2 from 87% to 99% compared to the "blank" parent cell line,
TRex 293 Flp-In. In contrast, the induction of eRF1 wt reduced amber suppression on
average to 81%.
The cell lines with constitutive expression of eRF1-specific shRNAs increased relative
fluorescence to 114% in the eRF1 E55D background, but maintained suppression at 79%
in the eRF1 wt background (Figure 5C). Amber suppression efficiency with a
sfGFP(TAG)3 reporter was 7.6% in the Trex 293 Flp-In parent cell line. The stable line
expressing eRF1 E55D shows an increase in amber suppression to 19%, further
increasing to 31% in the cell line expressing both eRF1 E55D and shRNA(eRF1).
In contrast, the cell line expressing eRF1 wt shows no change in amber suppression
compared to the parent cell line at 7.6%. The derived cell line expressing both eRF1 wt
and shRNA(eRF1) displays a minor reduction in suppression efficiency to 5% (Figure
5D).
Overall, the relative amber suppression efficiency can be enhanced by stable integration
of a single copy of eRF1 E55D, and further enhancements require either a reduction in
endogenous eRF1 levels, or an increased expression of eRF1 E55D. In either case,
quantitative expression of sfGFP-2 can be achieved, and sfGFP-2 3 can be produced with
an efficiency of 30-40% of sfGFP.
Example 8 - eRF1 mutants increase unnatural amino acid incorporation
efficiency in Dmel cells
We also evaluated the effect of selected eRF1 mutants in an insect cell based expression
system. Cell lines derived from Drosophila, such as Schneider 2 cells, are routinely
used for the large scale expression of proteins. The incorporation of unnatural amino
acids in proteins in these systems has been demonstrated using the M. mazei PylRS/
tRNAcuApair and suitable expression systems (Bianco et al. 2012; Elliott et al. 2014).
Four constructs were used to drive unnatural amino acid incorporation: a
PylRS/tRNAcuA expression construct, a reporter construct containing GFP-mCherry or
GFP-TAG-mCherry a UAS driver and an expression construct for each eRF1 variant.
Overall, the transfection efficiency in Dmel cells is lower than in the mammalian
system, and the resulting cell lysate and blots represent a mixture of transfected and
untransfected cells, reducing the apparent effect (Figure 6.4). A visual indicator is the
D100 mutant, showing a weak band corresponding to ectopic, truncated eRF1 below the
endogenous eRF1 band (Figure 6B). The quantification of amber suppression shown
in Figure 6A is based on three independent transfection experiments, with the
corresponding blots being quantified individually.
The expression of wild-type release factor causes a very minor reduction in readthrough,
whereas the expression of the eRF1 D100 mutant increases read-through
levels five-fold, from 4.8% to 23%. This effect is accompanied by a strong reduction in
the total amount of truncated GFP, suggesting a significant disruption of the overall
translation process (Figure 6B).
The E55D mutant shows the second largest increase in read-through levels of the
variants tested, a four-fold increase to 15%. Similarly, the mutations E55A and
NK129PQ increase read-through roughly three-fold, to 12%. Mutant S70A G73S,
reported to enhance IJGA read-through, shows no effect on amber suppression.
Despite the differences both in the cellular context and the reporter system used, these
results closely mirror the relative effect sizes previously observed in mammalian cells.
The only exception is mutation Y125F, which appears to have a negligible effect in Dmel
cells, but improved UAGread-through in the mammalian system.
Example 9 - eRFl E55D mutant increases incorporation efficiency of a
wide range of unnatural amino acids and tRNA synthetase variants.
Incorporation of four distinct unnatural amino acids - Boc-K (N e-[(tertbutoxy)
carbonyl]-L-lysine, Norbonene-K (N e--norbornene-2-yloxycarbonyl-L-lysine),
Cyclopropene-K (N e-[((2-methylcycloprop-2-en-i-yl)methoxy)carbonyl]-L-lysine) and
Bicyclonyne-K (N e-([(iR,8S)-bicyclo[6.i.o]non-4-yn-9-ylmethoxy]carbonyl)-Lysine)
into sfGFP(TAG) was improved in the presence of eRF1 E55D mutant, as shown in
Figure 7. The T-REx 293 eRF1 E55D generated in Example 6 was used to inducibly
express eRF1E55D.
Amber suppression efficiency was determined by transient transfection of the
constructs containing the PylRS/tRNAcuA and sfGFP150TAG reporter (constructs g + h/i,
Figure 1), in a 1:1 ratio. Amber suppression efficiency was determined base on the
expression of sfGFP by western blotting. In all cases, the presence of eRF1 E55D
mutant increased expression of sfGFP.
Example 10 - Discussion
We have defined the efficiency of unnatural amino acid incorporation relative to a
natural translation control, allowing us to quantitatively benchmark improvements in
unnatural amino acid incorporation efficiency. The optimized system we have created
provides a 17- to 20- fold improvement in unnatural amino acid incorporation
efficiency with amino acids 1 and 2. For amino acid 1 the incorporation efficiency is
increased from 5% to 85%, while for amino acid 2 the incorporation efficiency is
increased from 7% to 157% of a no stop codon control. Moreover, the optimized system
increases the yield of proteins incorporating 1 and 2 at three positions from unmeasurably
low levels to 12% and 43% of a no stop control respectively.
Various factors contribute to the dramatic improvement in unnatural amino acid
incorporation, which include: the optimization of tRNACUA levels to optimize PylRS/
tRNAcuA expression; and the development and use of engineered eRF1 variants. While
65
the incorporation of unnatural amino acids is quite efficient in response to a single
amber codon using the optimized PylRS/tRNAcuA system alone, the efficiency is further
improved by the addition of eRF1 (for example E55D). The effect of the eRF1 mutant
on unnatural amino acid incorporation is more dramatic when incorporating unnatural
amino acids at multiple sites, increasing the yield of protein containing amino acid 1 at
three sites, 2- to 3-foid and the yield of protein containing 2 at three sites, 4-fold.
Example 11: Demonstration of Alternate eRF1 mutants
We initially screened the eRF1 variants by transient transfection in a HEK 293T cell
line. The table below lists the screened mutations ranked by their effect on unnatural
amino acid incorporation (BocK). The relevant protocols and supporting material are
as in the above examples.
Example 12: eRF1 mutant functionalities In diverse eukaryotlc species
The invention finds application in diverse eukaryotic species. The invention can be applied
in insect ceils such as fly cells (e.g. Drosophiia), fungal cells such as yeast ceils and other
eukaryotes.
We used transient transfection to introduce the mutant eRF1 into insect (Dmel) ceil lines.
Methods:
Transient transfection of D.mel-2 ceils (S2)
Drosophiia S2 cells (D.Mel; invitrogen) were maintained on complete Express 5 SFM
medium (Life technologies Ltd.), enriched with 2 mM L-glutamine and pen/strep (50 I.U./mL
penicillin, 50 Mg/mL streptomycin) in T75 flasks following standard cell culture practices.
Twenty-four hours prior to transfecfions, cells were detached from the surface by scraping
or shaking, and 5 ml suspended were cells diluted with 8 ml of pre-warmed medium. For
24-wei! plates 0.5 ml suspended cells were seeded per well and grown over night. Cells
were transiently transfected using Fugene HD (Promega). For each well, 1.75 m I Fugene
HD were mixed with 15 m I sterile water and incubated at room temperature for five minutes.
Similarly, 0.75 mg DNA (0.3 mg each of reporter, PylRS/PylT and eRF1 constructs, 0.15 mg
GAL4) were diluted in 15 m I sterile water and added to the diluted Fugene HD reagent,
followed by incubation at room temperature for 15 minutes. In each well containing target
cells the spent growth media was taken off and the cells were carefully washed with 5QQ m I
sterile PBS. Each well was then filled with 500 m I of Express 5 medium, Q2mM CuSo4
(Sigma), 2 mM/ml glutamine and unnatural amino acid, if required. 1 was dissolved in
sterile wafer/NaOH (20 mM 1), and added to the growth media. The pH was subsequently
adjusted to 6.5 using 4 M HCI. The final concentration of 2 in the growth media was 2 mM,
unless otherwise noted. 25 m I of the 30 m I transfection mix were added drop-wise to each
well. The plates were carefully shaken and incubated over night at 25°C. Sixteen hours
post transfection each well was washed using PBS, and cells lysed in in 100 m I RIPA buffer
(Sigma) with added Complete protease inhibitor (Roche) while shaking at room
temperature for 15 minutes.
Unnatural amino acid incorporation was determined by the expression of a
GFP-TAG-mCherry construct. The ratio of full length protein over truncated protein was
determined by quantification on blots immunostained for GFP, as described for HEK293T
cells.
Drosophiia melanogaster genetic constructs
A human eRF1 gene, optimized for D. meianogaster codon usage containing a terminal
His tag and a triple-stop termination signal, was cloned into piasmid SG105(Bianco et a ,
2012) using BamHI/Noti restriction sites (primer eRF1__SG105). SG105 is derived from
UASp, and contains a second multiple cloning site downstream of the white locus (R0rth,
1998). AB51 contains six copies of a U6-PylT cassette and UAS-PyIRS (Ambra Bianco,
unpublished data).
Determining unnatural amino acid incorporation efficiency in D meianogaster
Transgenic fly lines containing the eRF1 variants were created by P element injection using
a Drosophiia embryo injection service (Bestgene Inc.). eRF1 D 100 and E55D constructs
cloned into piasmid SG105 were successfully microinjected, and returned nine and seven
unique lines, respectively.
Fly line stocks were maintained on apple plates at 16°C. For genetic crosses and unnatural
amino incorporation experiments, flies were maintained at 25°C.Fiy lines containing the
eRF1 D 100 or E55D variants were crossed with virgin females from FT74-S2-nos fly lines.
The resulting offspring was screened for the correct combination of genetic markers
depending on each eRF1 line, maintained for further experiments.
The FT74-S2-nos line supports unnatural amino acid incorporation using the PyiRS/PylT C uA
pair and expresses a dual iuciferase reporter. The constructs integrates on the genome are
a UAS-dual-luciferase(TAG) reporter, UAS-Py!RS, four copies of a U6-PylT cassette
(Triple-Rep-L) and a nos-Gai4-VP16 cassette (B!oomington 4937) The creation of these
constructs and line is discussed in (Bianco et al, 2012).
Compound 2 was fed to flies mixed into yeast paste. 2 was dissolved in water/NaOH to a
final concentration of 10mM, and dried yeast added until a pasty consistency was reached.
1M HCI was added to neutralize the paste. In order to measure unnatural amino acid
incorporation in fly lines, 15 female flies of each line expressing the necessary components
for unnatural amino incorporation as well as an eRF1 variant were set-up in tubes with 5
males, and supplied with a small amount of 10m 2-yeast paste. The flies were transferred
into new tubes with fresh 2-yeast paste after 24 and 48 hours. On the third day, the transfer
into a fresh tube with 2-yeast paste was performed in the morning, and female flies were
dissected in the afternoon.
For dissection, flies were collected on a C0 2 pad. Female flies were transferred to
dissection glasses under a microscope, and the ovaries isolated from the thorax by careful
removal of the posterior tip. The ovaries from 10-12 flies were collected in PBS buffer, and
transferred into a 1.5 ml microcentrifuge tube. The tube was centrifuged in a table top
centrifuge at the lowest setting for 30 seconds, and the supernatant removed. After adding
0 m I 1x passive lysis buffer (Promega), the ovaries were ground up using a plastic pestle,
until the solution approached a milky appearance. Debris was removed by centrifugation at
full speed for 3 minutes. The supernatant was carefully taken off, and pelleted again at full
speed for 1 minute. 10 mI of this lysate were used per dual luciferase assay in a 96-well
format, with three replicates per sample. The assay (Promega) was performed as
described for mammalian cell lysates.
See Figure 12.
A. Illustration of the genetic background. Virgin females from fly line FT74-S2-Nos/TM6,
expressing a pyrrolysyl aaRS/tRNAcuA pair, a dual-luciferase reporter and an ovary-specific
promoter were crossed to males from balanced fly lines generated by random genomic
insertion of eRF1 E55D or D 100 after microinjection (Bestgene). B, C. Measuring stop
codon readthrough in a dual luciferase assay. Twelve female flies with the correct genetic
markers from each genetic cross were collected, and fed on 10mM CyP-yeast paste for 72
hours. The ovaries were collected by dissection, pooled and tested for UAG read-through.
Panel B lists the results for all fly lines generated from eRF1 E55D integration events; panel
C lists the results for eRF1 D 100.
Example 13: Both PyiT U25C and PyiT U25C Opt variants efficiently amber
suppression in HEK cells
HEK cells transfected with GFP150UAG and 4 PylT U25C or 4x PylT U25C Opt,
analysed for GFP fluorescence via FACS, GFP-positive population circled in pink with
percentage labelled, MFI of replicates for graph. Standard transfection and flow
cytometry protocols, expressed in 2 mMBocK. See Fig 13.
Western blot of Trastuzumab heavy chain, position A114UAG, LC and HC on separate
plasmids, each with either 4 PylT U25C or 4 PylT U25C Opt. Blot intensities of
replicates measured for graph. Standard transfection and western blot protocols,
expressed in 2 mM BocK. See Fig 14 and Fig 15.
tRNA cloverleaf diagrams for parental M. Mazei Pyl tRNA(cua anticodon) for
comparison, U25C derivative, U25C and Opt derivative. U25C mutation in green, six
nucleotide Opt mutation set in pink. See Fig 16.
Sequence alignments of DNA sequence for tRNA variants (differences in black), note
that the CCA tail is not explicitly encoded in mammalian plasmids, but is posttranscriptionally
added by the cell. See Fig 17.
M. Mazei PylT U25C Opt
(ix) Human U6 promoter : : M. Maze! PylT U25C Opt : : 3' UTR and terminator
(4x) Human U6 promoter : : M. Mazei PylT U25C Opt :: 3' UTR and terminator as
cloned
This 4 cassette may replace the 4 PylT U25C cassette in various vectors described
above, such as pKYMi with FP 150 uag), Trastuzumab LC and HC (114 uag).
Example 14: eRFl E55D increases antibody expression
All experiments were done with 2 mM bocK unless otherwise stated. Ones listed as
"CypK" were done with 0.5 mM cyclopropene. Both are pyrollysine mimetics. HC and
LC were on separate plasmids and were co-transfected at a 1:1 ratio using standard PE
protocols. For the GFP studies, only a single plasmid was transfected. Since the
unnatural machinery tRNA/synthetases are on the same plasmid as the GFP/mAb
genes, no additional plasmids were necessary for these studies.
Antibody expression was done in a LC-ires-HC format from a single vector containing
both the antibody genes as well as the Pyrollysine unnatural amino acid tRNA and
synthetase. This 4xPylT(u25c)/PylS construct is as described above.
eRFl was expressed from pcDNAs, a standard expression vector. eRFl was transfected
at 1:5 ratio to the antibody plasmid. Experiment was done in Expi293 cells, a
suspension HEK system, and transfected with PEI using standard protocols. Cultures
were 30 mL each, 60 ug of DNAwith 180 ug of PEI, expression for 7 days.
Western blot was directly from supernatant of culture, using anti-HC and anti-LC
antibodies conjugated to HRP. Trastuzumab with a UAG amber codon at position
Alaii4 of the heavy chain shows increased expression with eRFl E55D with our
expression system in HEK cells. See Fig 18.
Constructs are in Fig 19. Plasmid diagram is in Figure 20. Sequences below.
pKYMi LC-ires-HC sequence

HCA114X DNA sequence with leader peptide
HCwith A114X mutation protein sequence, * represents the UAGunnatural site
LC protein sequence
Example 15: eRF1 E55D enhances BCN incorporation in HEK cells
ABBREVIATIONS
PylRS, pyrrolysyl-tRNA synthetase; PylT, pyrrolysyl-tRNA synthetase; eRFl, eukaiyotic
release factor 1; eRF3, eukaiyotic release factor 3: sfGFP, super-folder green fluorescent
protein.
REFERENCES
(1) Lang, K.; Chin J . W. Chem Rev 2014, 114, 4764.
(2) Kim, C. H.; Axup, J . Y.; Schultz, P. G. Cu rr Opin Chem Biol 2013, 17, 412.
(3) Baker, A. S.; Deiters, A.ACS Chem Biol 2014, 9, 7
(4) Davis, L.; Chin, J .W. Nat Rev Mol Cell Biol 2012, 13, 168.
(5) Chin, J .W. Anna Rev Biochem 2014, 83: 379
(6) Bertram, G.; Innes, S.; Minella, O.; Richardson, J.; Stansiield, L Microbiology 2001,
147, 255.
(7) Jackson, R. J.; Hellen, C U.; Pestova, T. V. Adv Protein Chem Struct Biol 2012, 86,
45·
(8) Dever, T. E„; Green, R. Cold Spring Harb Perspect Biol 2012, 4, a013706.
(9) Scolnick, E.; Tompkins, R.; Caskey, T.; Nirenberg, M. Proc Natl Acad Sci U S A
1968, 61, 768.
(10) Petry, S.; Brodersen, D E.; Murphy, F.V. t ; Dunham, C. M.; Selmer, M.; Tarry, M.
J.; Kelley, A. C ; Ramakrishnan, V. Cell 2005, 123, 1255.
(11) Konecki, D. S.; Aune, K. C ; Tate, W.; Caskey, C. T. J Biol Chem 1977, 252, 4514.
(12) Wang, K ; Neumann, FL; Peak-Chew, S Y ; Chin, J . W. Nat Biotechnol 2007, 25,
770.
(13) Mukai, T.; Hayashi, A.; Iraha, F.; Sato, A.; Ohtake, K.; Yokoyama, S.; Sakamoto, K.
Nucleic Acids Res 2010, 38, 8188.
(14) Johnson, D. B.; Xu, J.; Shen, Z.; Takimoto, J . K.; Schultz, M. D ; Schmitz, R. J ;
Xiang, Z„; Ecker, J . R„; Briggs, S. P.; Wang, L Nat Chem Biol 2011, 7, 779
(15) Lajoie, M. J.; Rovner, A. J.; Goodman, D. B.; Aerni, H. R.; Haimovich, A. D.;
Kuznetsov, G.; Mercer, J . A.; Wang, H. H.; Carr, P. A.; Mosberg, J . A ; Rohland, N.;
Schultz, P. G.; Jacobson, J . M.; Rinehart, J.; Church, G. M.; Isaacs, F. J . Scien ce 2013,
342, 357·
(16) Wu, I. L.; Patterson, M. A.; Carpenter Desai, H. E.; Mehl, R. A.; Giorgi, G.;
Conticello, V. P. Chem biochem. 2013, 14, 968.
(17) Mukai, T.; Kobayashi, T.; Hino, N.; Yanagisawa, T.; Sakamoto, K ; Yokoyama, S.
Biochem ical and Biophysical Research Communications 2008, 371, 818.
(18) Chen, P. R.; Groff, D.; Guo, J.; Ou, W.; Cellitti, S.; Geierstanger, B. H.; Schultz, P.
G. Angew andte Chem ie International Edition 2009, 48, 4052
(19) Gautier, A ; Nguyen, D. P.; Lusic, FL; An, W.; Deiters, A.; Chin, J . W. J Am Chem
Soc 2010, I32, 4086
(20) Xiao, H.; Chatterjee, A.; Choi, S. H.; Bajjuri, K. M.; Sinha, S. C ; Schultz, P. G.
Angew Chem Int Ed Engl 2013, 52, 14080.
(21) Elliott, T. S.; Townsley, F. M.; Bianco, A.; Ernst, R. J.; Sachdeva, A.; Elsasser, S. J.;
Davis, L.; Lang, K.; Pisa, R.; Greiss, S.; Liliey, K. S.; Chin, J . W. Nat Biotechnol 2014,
32, 465.
(22) Nguyen, D. P.; Lusic, FL; Neumann, FL; Kapadnis, P. B.; DeiLers, A.; Chin, J .W. ./
Am Chem Soc 2009, 131, 8720.
(23) Miyake-Stoner, S J.; Refakis, C. A.; Hammiil, J . T.; Lusic, H.; Hazen, J . L.;
Deiters, A ; Mehl, R. A. Biochemistry 2010, 49, 1667.
(24) Chatterjee, A.; Sun, S. B.; Furman, J . L.; Xiao, H.; Schultz, P. G. Biochem istry
2013, 52, 10
(25) Kolosov, P.; Frolova, L.; Seit-Nebi, A.; Dubovaya, V.; Kononenko, A ; Oparina, N.;
Justesen, J.; Efimov, A.; Kisselev, L. Nucleic Acids Res 2005, 33, 6418.
(26) Bulygin, K. N.; Khairulina, Y. S.; Kolosov, P. M.; Ven'yaminova, A. G.; Graifer, D.
M.; Vorobjev, Y. N.; Frolova, L. Y.; Kisselev, L. L ; Karpova, G. G. RNA 2010, 16, 1902.
(27) Seit-Nebi, A.; Frolova, L.; Kisselev, L. EMBO Rep 2002, 3, 881.
(28) Eliseev, B.; Kryuchkova, P.; Alkalaeva, E.; Frolova, L. Nucleic Acids Res 2011, 39,
599·
(29) Lekomtsev, S.; Kolosov, P.; Bidou, L.; Frolova, L.; Rousset, J . P.; Kisselev, L. Proc
Nat l Acad Sci US A 2007, 104, 10824.
(30) Kryuchkova, P.; Grishin, A.; Eliseev, B.; Karyagina, A.; Frolova, L.; Alkalaeva, E.
Nucleic Acids Res 201 3, 41, 4573.
(31) Grentzmann, G.; Ingram, J . A.; Kelly, P. J.; Gesteland, R. F.; Atkins, J . F. RNA
1998, 4, 479.
(32) Keeling, K. M.; Lanier, J.; Du, M.; Salas-Marco, J.; Gao, L.; Kaenjak-Angeletti, A.;
Bedwell, D. M. RNA 2004, 10, 691.
(33) Salas-Marco, J.; Fan-Minogue, H.; Kallmeyer, A. K.; Klobutcher, L. A.; Farabaugh,
P. J.; Bedwell, D. M. Mol Cell Biol 2006, 26, 438.
(34) Conard, S. E.; Buckley, J.; Dang, M ; Bedwell, G. J.; Carter, R. L ; Khass, M.;
Bedwell D. M. RNA 2012, 18, 1210.
(35) Le Goff, X.; Philippe, M.; Jean-Jean, O. Mol Cell Biol 1997, 17, 3164.
(36) Merkulova, T. I.; Frolova, L. Y.; Lazar, M ; Caraonis, J.; Kisselev, L. L. FEES Lett
1999, 443, 41·
(37) Cheng, Z.; Saito, K ; Pisarev, A. V.; Wada, M.; Pisareva, V. P.; Pestova, T. V.; Gajda,
M.; Round, A ; Kong, C ; Lim, M.; Nakamura, Y.; Svergun, D. I ; Ito, K.; Song, H. Genes
Dev 2009, 23, 1106.
(38) Kononenko, A. V.; Mitkevich, V. A.; Dubovaya, V. I ; Kolosov, P. M.; Makarov, A.
A ; Kisselev, L. L. Proteins 2008, 70, 388.
(39) des Georges, A.; Hashem, Y.; Unbehaun, A.; Grassucci, R. A.; Taylor, D.; Hell en, C.
U.; Pestova, T. V.; Frank, J . Nucleic Acids Res 2014, 42, 3409.
(40) Janzen, D. M.; Geballe, A. P . Nucleic Acids Res 2004, 32, 4491.
(41) Liang, H,; Wong, J . Y.; Bao, Q.; Cavaicanti, A. R.; Landweber, L. F . ./ Mol Evol
2005, 60, 337.
SUPPLEMENTARY REFERENCES
(1) Gautier, A.; Nguyen, D. P.; Lusie, H.; An, W.; Deiters, A.; Chin, J . W. J Am Chem
Soe 2010, 132, 4086.
(2) Hoover, D. M,; Lubkowski, J . Nucleic Acids Res 2002, 30, 643. S12
(3) Elliott, T. S.; Townsley, F . M.; Bianco, A.; Ernst, R. J.; Sachdeva, A.; Eisasser, S. J.;
Davis, L.; Lang, K.; Pisa, R.; Greiss, S.; Lilley, K. S.; Chin, J , W. Nat Biotechnol 2014,
32, 465.
(4) Arbely, E.; Torres-Kolbus, J.; Deiters, A.; Chin, J . W. J Am Chem Soc 2012, 134,
11912.
(5) Wilkins, M. R„; Gasteiger, E.; Bairoch, A.; Sanchez, J . C ; Williams, K. L.; Appel, R.
D.; Hochstrasser, D. F. Methods Mol Biol 1999, 112, 531.
(6) Nguyen, D. P.; Garcia M. TVL; Kapadnis P . B.; Neumann, N.; Chin, J . W. J Am Chem
Soc 2009, 131, 40.
(7) Nguyen, D. P.; Mahesh, M.; Eisasser, S. J.; Hancock, S. TVL; Uttamapinant, C ; Chin,
J . W. J Am Chem Soc 2014, 136, 2240.
Any publication cited or described herein provides relevant information disclosed prior
to the filing date of the present application. Statements herein are not t o be construed
as an admission that the inventors are not entitled t o antedate such disclosures. All
publications mentioned in the above specification are herein incorporated by reference.
Various modifications and variations of the invention will b e apparent t o those skilled
in the art without departing from the scope and spirit of the invention. Although the
invention has been described in connection with specific preferred embodiments, it
should b e understood that the invention as claimed should not b e unduly limited t o
such specific embodiments. Indeed, various modifications of the described modes for
carrying out the invention which are obvious to those skilled in molecular biology and
chemistry or related fields are intended t o b e within the scope of the following claims.
Supplementary Table S 1
Nucleotide sequences of synthetic genes used in this study A. Sequence of the modified
U6-PylT* expression cassette. PylT is underlined, and the anticodon marked in red. B.
Sequence of sfGFP(TAG), with H. sapiens codon optimization and a C-terminal
poiyhistidine tag. The amber codon in position 150 is marked in red C shows the
human eRF1 sequence after codon optimisation for D. melanogaster, with an Nterminal
poiyhistidine tag.
Supplementary
Oligonucleotides used for site-directed mutagenesis
8,3
SEQUENCES
SEQ ID NO: 1

SEQ ID NO: 2

CLAIMS
1. Amethod for incorporating an unnatural amino acid into a protein of interest in
a eukaryotic cell, said method comprising the steps of:
i) providing a eukaryotic cell expressing an orthogonal tRNA synthetase - tRNA
pair, a nucleic acid sequence of interest encoding said protein of interest, and a mutant
eRFl, said mutant eRFl having amino acid sequence having at least 60% sequence
identity to the human wild type eRFl sequence of SEQ ID NO: 4,
said nucleic acid sequence of interest comprising a codon recognised by the tRNA at the
position for incorporation of an unnatural amino acid;
ii) incubating the eukaryotic cell in the presence of an unnatural amino acid to be
incorporated into a protein encoded by the nucleic acid sequence of interest, wherein
said unnatural amino acid is a substrate for the orthogonal tRNA synthetase; and
iii) incubating the eukaryotic cell to allow incorporation of said unnatural amino
acid into the protein of interest via the orthogonal tRNA synthetase - tRNApair.
2. Use of a mutant eRFl, said mutant eRFl having amino acid sequence having at
least 60% sequence identity to the human wild type eRFl sequence of SEQ ID NO: 4,
for incorporating an unnatural amino acid into a protein of interest in a eukaryotic cell.
3. A mutant eRFl polypeptide, said mutant eRFl having amino acid sequence
having at least 60% sequence identity to the human wild type eRFl sequence of SEQ ID
NO: 4, or a nucleic acid encoding same, for use in aiding incorporation of an unnatural
amino acid into a polypeptide of interest by translation of nucleic acid encoding said
polypeptide of interest, said nucleic acid comprising an orthogonal codon directing
incorporation of said unnatural amino acid into said polypeptide of interest.
4. A eukaryotic host cell comprising the mutant eRFl polypeptide or nucleic acid
of claim 3.
5. Aeukaryotic host cell comprising
(i) an orthogonal tRNA synthetase - tRNApair, and
(ii) a mutant eRFl, said mutant eRFl having amino acid sequence having at least
60% sequence identity to the human wild type eRFl sequence of SEQ ID NO: 4 , and
optionally
(iii) a nucleic acid sequence of interest encoding a protein of interest, said nucleic
acid sequence of interest comprising a codon recognised by the tRNA at a position for
incorporation of an unnatural amino acid.
6 . Acombination or kit comprising nucleic acid(s) encoding:
(i) an orthogonal tRNA synthetase - tRNA pair, and
(ii) a mutant eRFl, said mutant eRFl having amino acid sequence having at least
60% sequence identity to the human wild type eRFl sequence of SEQ ID NO: 4 , and
optionally
(iii) a nucleic acid sequence of interest encoding a protein of interest, said nucleic
acid sequence of interest comprising a codon recognised by the tRNA at a position for
incorporation of an unnatural amino acid.
7. A eukaryotic host cell according to claim 5 or a combination or kit according to
claim 6 , further comprising an unnatural amino acid such as BocKor CypKor BCNK.
8. A method according to claim 1, a use according to claim 2 , mutant eRFl
polypeptide according to claim 3 , a eukaryotic host cell according to any of claims 4 , 5
or 7, or a combination or kit according to claim 6 , wherein said mutant eRFl provides
increased efficiency of unnatural amino acid incorporation relative to a wild type eRFl
control.
9 . A method according to claim 1, a use according to claim 2 , a mutant eRFl
polypeptide according to claim 3 , a eukaryotic host cell according to any of claims 4 , 5
or 7, or a combination or kit according to claim 6 , wherein said mutant eRFl comprises
a mutation or combination of mutations relative to SEQ ID NO: 4 selected from the
group consisting of
(i) E55
(ii) N129, K130
(iii) T122, S123
(iv) Y125
(v) T58, S60, S64, L125, N129
(vi) S123, L124, Y125
10 . A meth od accord ing to claim 1, a use accordin g to claim 2, a mutant eRF l
polypeptide according to claim 3, a eukaryotic host ceil according to any of claim s 4, 5
or 7, or a combination or kit according to claim 6, wherein said mutant eRF l comprises
a mutation or com bination of mutation s relative to SEQ ID NO: 4 selected from the
group consisting of
11. A method according to claim 1, 8, 9 or 10 , a use according to claim 2, 8, 9 or 10 ,
mutant eRF l polypeptide accordin g to claim 3, 8, 9 or 10 , a eukaryotic host cell
according to any of claims 4, 5, 7, 8, 9 or 10 , or a combination or kit according to claim
6, 8, 9 or 10 , wh erein said eu karyotic ceil is a mamm alian or insect cell.
12. Amethod according to claim 1, 8, 9 or 10 , a use accordin g to claim 2, 8, 9 or 10 ,
mutant eRFl polypeptide according to claim 3, 8, 9 or 10 , a eukaryotic host cell
according to any of claims 4, 5, 7, 8, 9 or 10, or a combination or kit according to claim
6, 8, 9 or 10, wherein said codon is a stop codon, optionally wherein said stop codon is
UAG.
13. Amethod according to claim 1, 8, 9 or 10, a use according to claim 2, 8, 9 or 10,
mutant eRFl polypeptide according to claim 3, 8, 9 or 10, a eukaryotic host cell
according to any of claims 4, 5, 7, 8, 9 or 10, or a combination or kit according to claim
6, 8, 9 or 10, wherein the orthogonal tRNA synthetase - tRNA pair comprises a
pyrrolysyl-tRNA synthetase (PylRS)/PylT tRNAcuApair.
14. Amethod according to claim 1, 8, 9 or 10, a use according to claim 2, 8, 9 or 10,
mutant eRFl polypeptide according to claim 3, 8, 9 or 10, a eukaryotic host cell
according to any of claims 4, 5, 7, 8, 9 or 10, or a combination or kit according to claim
6, 8, 9 or 10, wherein the tRNA is:
(i) a U25C variant of PylT, or
(ii) an Opt variant of PylT, or
(iii) a U25C - Opt variant of PylT.

Documents

Application Documents

# Name Date
1 Form 5 [18-04-2017(online)].pdf 2017-04-18
2 Form 20 [18-04-2017(online)].pdf 2017-04-18
3 Drawing [18-04-2017(online)].pdf 2017-04-18
4 Description(Complete) [18-04-2017(online)].pdf_1.pdf 2017-04-18
5 Description(Complete) [18-04-2017(online)].pdf 2017-04-18
6 201717013653.pdf 2017-04-19
7 abstract.jpg 2017-06-21
8 201717013653-FORM-26 [18-07-2017(online)].pdf 2017-07-18
9 201717013653-Power of Attorney-180817.pdf 2017-08-24
10 201717013653-OTHERS-180817.pdf 2017-08-24
11 201717013653-Correspondence-180817.pdf 2017-08-24
12 201717013653-FORM 3 [12-10-2017(online)].pdf 2017-10-12
13 201717013653-FORM 18 [16-08-2018(online)].pdf 2018-08-16
14 201717013653-PA [16-07-2019(online)].pdf 2019-07-16
15 201717013653-ASSIGNMENT DOCUMENTS [16-07-2019(online)].pdf 2019-07-16
16 201717013653-8(i)-Substitution-Change Of Applicant - Form 6 [16-07-2019(online)].pdf 2019-07-16
17 201717013653-Further Evidence [29-07-2019(online)].pdf 2019-07-29
18 201717013653-RELEVANT DOCUMENTS [18-08-2020(online)].pdf 2020-08-18
19 201717013653-FORM 13 [18-08-2020(online)].pdf 2020-08-18
20 201717013653-AMENDED DOCUMENTS [18-08-2020(online)].pdf 2020-08-18
21 201717013653-FORM 3 [02-12-2020(online)].pdf 2020-12-02
22 201717013653-OTHERS [26-03-2021(online)].pdf 2021-03-26
23 201717013653-FER_SER_REPLY [26-03-2021(online)].pdf 2021-03-26
24 201717013653-CLAIMS [26-03-2021(online)].pdf 2021-03-26
25 201717013653-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [23-04-2021(online)].pdf 2021-04-23
26 201717013653-Correspondence to notify the Controller [28-05-2021(online)].pdf 2021-05-28
27 201717013653-Written submissions and relevant documents [14-06-2021(online)].pdf 2021-06-14
28 201717013653-PatentCertificate25-06-2021.pdf 2021-06-25
29 201717013653-IntimationOfGrant25-06-2021.pdf 2021-06-25
30 201717013653-US(14)-HearingNotice-(HearingDate-29-04-2021).pdf 2021-10-17
31 201717013653-US(14)-ExtendedHearingNotice-(HearingDate-31-05-2021).pdf 2021-10-17
32 201717013653-FER.pdf 2021-10-17
33 201717013653-RELEVANT DOCUMENTS [30-09-2022(online)].pdf 2022-09-30
34 201717013653-FORM 4 [26-12-2022(online)].pdf 2022-12-26
35 201717013653-RELEVANT DOCUMENTS [27-10-2023(online)].pdf 2023-10-27

Search Strategy

1 searchstrategyE_12-10-2020.pdf

ERegister / Renewals

3rd: 27 Aug 2021

From 21/10/2017 - To 21/10/2018

4th: 27 Aug 2021

From 21/10/2018 - To 21/10/2019

5th: 27 Aug 2021

From 21/10/2019 - To 21/10/2020

6th: 27 Aug 2021

From 21/10/2020 - To 21/10/2021

7th: 27 Aug 2021

From 21/10/2021 - To 21/10/2022

8th: 26 Dec 2022

From 21/10/2022 - To 21/10/2023

9th: 09 Oct 2023

From 21/10/2023 - To 21/10/2024

10th: 17 Oct 2024

From 21/10/2024 - To 21/10/2025

11th: 29 Sep 2025

From 21/10/2025 - To 21/10/2026