Abstract: The invention relates generally to the field of analysis for example biological analysis. More specifically the invention relates to a method for the detection of at least one microorganism in a sample placed in a closed container said method essentially comprising the following steps: a) in the container bringing into contact the sample a culture medium and a support capable of capturing the microorganism(s) to be detected; b) closing the container; c) placing the container under conditions that allow the microorganism(s) to grow; and d) using a detection means to detect the presence inside the container of the microorganism(s) attached to the capture support.
PROCESS OF DIRECTLY DETECTING AND IDENTIFYING A
MICROORGANISM IN A BIOLOGICAL SAMPLE DILUTED IN AN
ENRICHMENT BROTH
The present invention generally relates to the field of analysis for example
biological analysis. More specifically, the present invention relates to a process of
direct and real-time detection of a microorganism in a sample diluted or in suspension
in an enrichment broth, inside a closed container.
10 Microbiological analysis requires precise techniques for which the time to obtain
the result must be as short as possible.
In the medical field, it is necessary to envisage and diagnose the risk of infection:
the faster and more precise the diagnosis, the more efficient the handling of patients
and the more minimal the risk of transmission. The approach is similar for animal
15 health.
In the agri-food field, the issues are identical. However, it singles out:
the pathogenic microorganisms and their toxins whose presence is
sought in raw materials, intermediate products, and marketed finished
products,
the non-pathogenic microorganisms used as quality indicators in the
production process, from the raw materials to the finished products,
along the whole chain, and
bacteria of technological interest such as enzymes.
The rapid and precise detection of suspected contaminations allows them to be
25 monitored and thus allows corrective actions to be taken.
Technically, the microbiological analysis may implement one or more preenrichment
and/or enrichment phases, one or more detection phases, and one or more
microorganism counting phases. For particular applications such as agri-food
30 microbiological monitoring, a confirmation phase may also be required, in order to
meet the standards in force in this field.
There is currently no method for detecting a target microorganism in a large
initial sample quantity, without making use of an enrichment step.
The pre-enrichment and/or enrichment phase makes use of selective or non-
5 selective culture media which aim to promote the growth of the target microorganisms
in biological or environmental samples, whilst limiting the growth of the non-target
flora. The media are often used in sterile plastic bag-type containers, in which they are
placed in contact with food or environmental samples in order to re-suspend and reenrich
the microorganisms sought. This phase is necessary in order to meet the
10 requirement of revealing the potential initial presence of at least one target
microorganism in a very variable and possibly very large quantity of sample, e.g. 25
grams (g) to 375 g diluted in 225 to 3375 millilitres (mL) in the culture medium. At the
end of this enrichment step, an aliquot (from 5 microlitres (pl) to 5 mL) is sampled to
implement the step of detecting the target microorganisms. It is necessary to have a
15 sufficient quantity of target microorganisms in this aliquot to allow their systematic
detection.
The detection phase is historically based on culturing the microorganisms on agar
media, to demonstrate the metabolic characters of the microorganisms sought. Specific
20 enzymatic substrates are conventionally used. These enzymatic substrates are generally
composed of two parts, a first part which is specific for the enzymatic activity which is
to be revealed, also called the target part, and a second part acting as a marker, called
the marker part, generally constituted by a chromophore or a fluorophore. By choosing
these substrates depending on whether or not there is a reaction, it is possible to
25 characterise the nature of a microorganism or differentiate between different groups of
microorganisms. Thus the appearance or disappearance of a colouring or of a
fluorescence will indicate a genus or a type of microorganisms. In this regard, the use
of chromogenic media makes it possible to simultaneously detect and identify the
germs sought. It simplifies the process and substantially reduces the time to obtain the
30 result. By way of example, we would cite the applicant's ChrornID@ media. These
chromogenic media are based on the detection of specific metabolic characters of the
germs sought, such as beta-glucuronidase enzymatic activity for Escherichia coli for
example.
Imrnunoassays constitute another of the technologies used for the detection test.
They make use of the immunogenic characteristics of the microorganisms sought.
Without being exhaustive, the competitive or sandwich-type ELISA (Enzyme Linked
5 Immuno Sorbent Assay) techniques can be cited.
Finally, the molecular biology techniques based on the genornic characters of the
microorganisms sought are also employed to detect and identify the target
microorganisms. By way of example, it is possible to cite conventional amplification
techniques such as PCR (Polymerase Chain Reaction) and the NASBA (Nucleic Acid
10 Sequence Based Amplification), which can be coupled with real-time detection
techniques known to the person skilled in the art.
However, the use of all of these techniques requires the bag to be opened at the
end of the pre-enrichment/enrichrnent phase in order to recover an aliquot of the
homogenate and to carry out the detection step.
The confirmation phase, for its part, is more particularly associated with the
microbiological analysis in the agri-food field. Indeed, when the result of the methods
set out above is positive, it is necessary to confirm the presence of the pathogen sought.
This necessitates a complementary test and the use of a detection principle which is
20 different to that used during the first analysis. The techniques described supra are used
at will for the confirmation.
The complete and precise identification of a microorganism in a sample therefore
necessitates a sequence of several steps: enrichment, detection and confirmation. The
25 standardisation of the tests routinely used has permitted the automation of the detection
methods, though their implementation remains long. Indeed, a disadvantage of the state
of the art is that these steps are carried out sequentially and require a large number of
time-consuming manipulations, thus impacting on the time necessary to yield results.
Furthermore, the techniques described supra require the enrichment bags to be
opened once or more to sample the aliquots. The greater the number of negative
samples during screening (particularly in agri-food industries), the more detrimental
this is. It is therefore beneficial for the handler not to have to re-open the containers to
find out the positivitylnegativity result of the sample under consideration.
With regard to the technical problems associated with the state of the art
5 considered above, one of the essential objectives of the present invention is to provide a
simplified process for the detection, the identification and the confirmation of the
microorganisms present in samples, in particular agri-food samples.
Another objective of the present invention is to provide a process for the
detection, the identification and the confiiation of the microorganisms, which limits
10 the handling of the sample contained in the container, thereby limiting the risks of
contamination, both of the staff handling the sample and the sample itself.
Another objective of the present invention is to provide a process for the
detection and the identification of microorganisms, which reduces the time necessary
for the analysis of the sample.
15 Another objective of the present invention is to provide a process for the
detection, the identification and the confinnation of the microorganisms on the total
volume of the sample throughout the enrichment, manifestly increasing the
measurement sensitivity, and even its specificity.
Another objective of the present invention is to provide a process which makes it
20 possible to considerably increase the rate of sample analysis.
Another objective of the present invention is to provide a process which allows
multi-detection.
Another objective of the present invention is to improve the traceability of the
analysis by drastically reducing the sample handling steps.
These objectives amongst others are solved by the present invention, which
firstly relates to a process of detecting at least one microorganism present in a sample
placed in a closed container, said method comprising essentially the following steps:
a) Place said sample in contact in the container with at least one culture
medium and a support capable of capturing the microorganism(s) to be
detected,
b) Close the container,
c) Place the container under conditions capable of allowing the growth of the
microorganism(s),
d) Detect, inside said closed container, using detection means, the presence of
the microorganism(s) fixed onto the capture support.
According to a particular embodiment, a revealing system capable of allowing the
detection of the presence of the microorganism(s) is placed in contact in the container
during step a).
Revealing system is understood to be any molecule capable of coupling with the
microorganisms or the binding partners of said microorganisms which, by virtue of
10 their transduction properties (fluorescence, colouring, radioactivity in particular), make
it possible to reveal the presence of said microorganisms.
According to another particular embodiment, the process according to the
invention includes an intermediate step c') consisting in transferring all or part of the
mixture constituted by said sample, the culture medium, the support capable of
15 capturing the microorganism(s) to be detected and potentially a revealing system, fiom
the container, called in this case the main container, to at least one second container,
called the secondary container, wherein it is possible to potentially perform a secondary
enrichment by adding the nutritional elements and selective agents ad hoc into said
secondary container beforehand. Such a secondary enrichment increases the population
20 of the target microorganism(s) relative to that of the non-target microorganisms, which
improves the specificity.
Advantageously, at least one specific or non-specific binding partner of the
microorganism(s) is fixed onto the capture support. According to a preferred
25 embodiment of the invention, the specific binding partner is taken fiom the group
comprising: antibodies, Fab fragments, Fab' fiagments, recombinant or nonrecombinant
phage proteins and phages or any other ligand well known to the person
skilled in the art.
Advantageously, the detection means is taken fiom the group comprising:
electrical detection means, in particular electrochemical detection means, optical
detection means, acoustic detection means, thermal detection means, mechanical
detection means and magnetic detection means.
The capture support may be a conventional support. In particular we shall cite
particulate, potentially magnetic, supports or one-piece supports. It may simply be an
inert support, such as a plastic or fibreglass plate. Such a capture support is then
5 connected to the detection means. The capture support may be advantageously
sensitised with a binding partner, potentially specific.
Alternatively, the capture support may be integral with the detection means. This
is the case, for example, when the capture support is constituted by an electrochemical
. biosensor or an optical fibre.
10
According to a particular embodiment, it is entirely possible to envisage
combining the detection means in order both to perform detection and to carry out
confirmation simultaneously or subsequently. ~ berxa mple, it is possible to perform the
detection of the target microorganism(s) by means of an electrochemical biosensor. If
15 the target microorganisms are fixed via specific binding partners, the detection step in
that case constitutes an identification step. An optical analysis of the microorganisms
fixed specifically onto the biosensor at the analysis area by the optical detection device
allows the identification of the microorganisms to be confirmed. If the optical detection
device is a Raman spectrometer, an analysis of the Raman spectrum through
20 comparison with a database of reference spectra corresponding to the different target
microorganisms, then makes it possible to c o d m the identification of said
microorganism.
According to another particular embodiment, it is possible to perform the
detection and the confirmation with the same technology. Thus, if the detection means
25 is an optical means such as an intrinsic fluorescence measurement means, it is
particularly advantageous to perform detection of the target microorganisms via the
appearance of intrinsic fluorescence. The response is in that case yes (presence of
fluorescence) or no (absence of fluorescence). If there is fluorescence, then a spectral
analysis of the fluorescence signal compared to a database of reference spectra
30 corresponding to the different target microorganisms allows said microorganism to be
identified, and thereby allows the detection of the presence of said microorganism to be
confirmed.
Preferably, the detection of the microorganism(s) is performed in real-time.
Nevertheless, alternatively, the detection of the microorganism(s) may be
accomplished, at the end, after the growth step of said microorganism(s).
5 According to a particular embodiment of the process according to the invention,
the container is a homogenisation bag. Rigid containers such as flasks, bottles or
pillboxes could equally well be used.
According to another particular embodiment of the process according to the
10 invention, the detection means is connected to a data analysis system.
Advantageously, the connection between the detection means and the data
analysis device is a wired connection or a wireless connection.
The invention also relates to an electrochemical biosensor for the detection of at
15 least one microorganism present in a sample placed in a closed container. Said
biosensor comprises a support including:
at least one detection electrode, coated with at least one electroactive
polymer, onto one terminus of which is fixed at least one single-strand
or double-strand oligonucleotide, the second terminus of said
oligonucleotide being bound to at least one binding partner of the
microorganism(s) to be detected, specific or non-specific;
at least one counter-electrode.
Advantageously, the electroactive polymer is takenfiom the group comprising
25 polypyrrole, polyacetylene, polyazine, poly@-phenylene), poly@-phenylene vinylene),
polypyrene, polythophene, polyfuran, polyselenophene, polypyridazine, polycarbazole,
and polyahi line.
According to a particular embodiment, the electroactive polymer includes at least
30 one electrocherjaical mediator. Such an electrochemical mediator is taken fkom the
group comprising ferrocene, quinone and derivatives of these or any other mediator
well known to the person skilled in the art.
form in the culture medium. Such a mediator may be for example. the
ferricyanidelferrocyanide pair [Fe(CN)6]3-/4-, the iridium chloride pair [hC16]3-/4', or
ruthenium hexamine [Ru (NH~)+~1 2]+ ~.
5
The bond between the oligonucleotide and the binding partner of the
microorganism(s) is preferably made by means of at least one biotin-streptavidin or
biotin-avidin binding pair.
If the oligonucleotide is single-strand, a biotin is fixed onto the 3' terminus of
10 said nucleotide, the 5' terminus allowing the latter to be bound onto the electroactive
polymer, particularly by a covalent bond. By using a binding partner which is also
biotinylated, it is then easy to bind this to the 3' terminus of the oligonucleotide via a
molecule of streptavidin or avidin.
If the oligonucleotide is double-strand, the first strand is fixed, notably by a
15 covalent bond, to the electroactive polymer via its 5' terminus. The second strand for
its part is biotinylated at its 5' terminus, which allows the binding partner, also
biotinylated, to be fixed via a streptavidin or avidin molecule.
Advantageously, the binding partner is taken from the group comprising:
antibodies, Fab fragments, Fab' fragments, recombinant or non-recombinant phage
20 proteins, and phages.
The aims and advantages of the present invention will be better understood in
light of the following detailed description and the associated drawings in which:
- Figure 1 depicts a pre-enrichment and/or enrichment bag in combination with an
25 electrochemical biosensor.
- Figure 2 depicts a front view of the electrochemical biosensor.
I 1 - Figure 3A is a depiction of the surface of the electrochemical sensor without the
~ ! microorganism present.
- Figure 3B is a depiction of the surface of the electrochemical sensor with the
30 microorganism present.
- Figure 4 is a schematic depiction of a system for analysing the preenrichmentfenrichment
bag with the electrochemical biosensor.
- Figure 5 is a graph of impedance spectrometry measurements obtained during
the detection of E. coli 0 157:H7 in a food sample.
- Figure 6 is a graph of impedance spectrometry measurements obtained during
the detection of Listeria innocua in a food sample.
5 - Figure 7 is a schematic depiction of an analysis system by optical detection in a
pre-enrichment/enrichrnent bag with a sensitised capture support, according to a first
embodiment.
- Figure 8 is a schematic depiction of the analysis system as depicted in figure 7,
in a bag position which allows the sensitised capture support to be read.
10 - Figure 9 is a schematic depiction of a sensitised capture support.
- Figure 10 is a schematic depiction of the sensitised capture support, depicted in
figure 8, after analysis which gave a positive result.
- Figure 11 is a schematic depiction of a system of analysis by optical detection in
a pre-enrichment/enrichment bag with a sensitised capture support, according to a
15 second embodiment.
According to a first embodiment of the present invention, the process of
microorganism detection or identification consists in employing a sterile plastic
homogenisation bag, conventionally called a Stomacher03 bag. Such a bag is assigned
20 the reference number 10 in figure 1. This bag 10 is constituted of two roughly
rectangular plastic sheets, 12 and 14, joined to one another by 3 of their sides, so as to
define an inner space for receiving the culture medium and the sample to be analysed.
Its accessories comprise a roughly rectangular filter 16 connected to sheets 12 and 14
by one side, separating the inner space in two. The bag finally contains a biosensor 18.
25 This biosensor is an electrochemical biosensor, depicted in detail in figure 2. The
biosensor 18 is sandwiched between sheets 12 and 14, such that one part 181
corresponding to the detection area is found in the inner space of the bag 10, whereas a
part corresponding to the connection area is outside the bag, so as to allow the chip to
connect to a data analysis device. This is explained inpa.
3 0 Figure 2 depicts the electrochemical biosensor 18 in detail. As explained above,
the biosensor 18 is constituted of an analysis area 181 and a connection area 182. The
analysis area includes eight working electrodes 20, arranged around a central electrode,
called the counter-electrode, 22. Furthermore, the analysis area contains a reference
electrode 24, in the form of an open ring positioned around the counter-electrode 22.
All of these electrodes are independently linked to ten connection terminals 26, by
means of conductor tracks 28. The connection terminals are made of the same material
as the working electrodes. This material is preferably gold. Nevertheless any other
conducting material well known to the person skilled in the art may be used, such as
carbon, platinum or diamond. The material constituting the support of the electrodes is
a polymer material, such as polyimide. However it may be envisaged to use any other
material with equivalent properties well known to the person skilled in the art.
It should be noted that the configuration of electrodes presented in figure 2 is
only one configuration amongst others, and by no means limits the scope of the
protection conferred by the present patent application.
Figures 3A and 3B depict a cross-section of a working electrode at microscopic
level, in the absence or presence of microorganisms respectively.
At the working electrodes, three overlaid layers can be seen. The first of these
layers 30 is the polymer layer constituting the biosensor support. The intermediate layer
32 is the layer of conductive material, typically gold. Finally, the layer 34 is a layer of
electroactive conjugated polymer. Such a polymer is for example a polypyrrole. Such
polymers are well known for their conductive and electroactive character. It is also
known that polypyrroles maintain their conductivity and their electroactivity when
certain pyrrole cycles are substituted in position 3 or 4 with functional groups.
Polymers bearing this type of fimctional group are described in WO-A1 - 95129199,
Gamier et al. (Synthetic Metals, 100: 89-94,1999) Ho-Hoang et al. (Synthetic Metals,
62: 277-280, 1994), Ho-Hoang et al. (J. Mater. Chem., 6 (7), 1 107- 1 1 12,1996), and
Korri-Youssoufi et al. (Materials Science and Engineering, CI 5, 265-268,2001).
Different molecules can thus be grafted onto the functional groups borne by a
polypyrrole monomer. WO-A1-95129199 thus describes the synthesis of a polypyrrole
obtained by electro-oxidation at a potential greater than or equal to 0.8V/ECS. The
synthesis of polypyrrole by electrochemical oxidation leads to the formation of an
electroactive film at the surface of the electrode, more precisely on a conductive
substrate in the form of a self-supported film. This is a method of indirectly
immobilising oligonucleotides in polypyrrole. The pyrrole monomers substituted in
position 3 of the pyrrole nucleus with functional groups are diluted in a solution of nonsubstituted
monomers, which will immobilise the functional groups during their
electrocopolymerisation by inclusion in the chain of functional units. In a second step,
5 an anti-ligand such as an oligonucleotide, a polynucleotide or a peptide is chemically
coupled onto the functional groups of the precursor polymer. The polymer thus
obtained maintains its conductive and electroactive properties. These polymers can
therefore be used to detect an analyte interacting specifically with the anti-ligand
grafted onto the polymer by measuring a difference of potential or a variation in
10 current: WO-A1-00177523 also describes the chemical coupling of an anti-ligand, such
as an oligonucleotide, onto a precursor polymer bearing functional groups.
This can also be a method of directly imrnobilising oligonucleotides in
polypyrrole by electrocopolyrnerisation. The pyrrole monomers substituted in position
3 of the pyrrole nucleus with oligonucleotides are diluted in a solution of non-
15 substituted monomers, which will irnrnobilise the oligonucleotides directly during their
electrocopolymerisation by inclusion in the chain of functional units.
Onto this layer of electroactive polymer, there is grafted a double strand of
nucleic acid 36, via the 5' terminus of one of these strands, with the complementary
20 strand bearing a biotin molecule 38 at its 5' terminus, so that a bond to a specific
binding partner 40 also bound to a biotin 42 is possible via a streptavidin molecule 44.
The specific binding partner 40 depicted in figures 3A and 3B is an antibody. It can be
either one or more monoclonal or polyclonal antibodies. It may also be an antibody
fragment, such as a Fab or FabY2fr agment, as well as any antibody obtained by genetic
25 modification or recombination and specific of a particular microorganism.
Alternatively, the specific binding p a e r may be a phage or a recombinant
phage protein, which binds specifically to the target microorganisms. Such proteins and
their use for the capture of bacteria were described in patent EP-B-1 356 080 amongst
others.
3 0
It should be noted that the structure depicted in figures 3A and 3B is only one
example amongst others and is by no means to be understood as a restriction of the
invention. In fact, as a variation, it can be envisaged to fix the anti-ligand molecule
directly onto the electrode without using the double strand of nucleic acid.
In order to perform analysis, the electrochemical biosensor, joined to the
5 homogenisation bag, is placed in contact with the dispersed sample, the culture medium
and an electrochemical mediator, such as the ferricyanide - ferrocyanide pair. In the
absence of microorganisms, an electron exchange takes place between the electroactive
conjugated polymer and said redox system present in the reaction medium. This is
shown in figure 3A. The electron exchange is transformed into electric current and
10 measured by electrochemical spectroscopy, using a potentiostat, as explained inpa.
When the sample contains microorganisms 44, these are captured by the antiligand
molecules 40. The presence of microorganisms in the vicinity of the electrode
brings about a steric hindrance, which disrupts and diminishes the electron flow
between the electrode modified by the electroactive conjugated polymer and said redox
15 system present in the reaction medium. This modification is then measured by
impedance measurement and characterised by the load transfer resistance, a resistance
of which the value increases when the bacteria is captured (positive result).
The analysis results measurement system is depicted schematically in figure 4,
20 according to a first embodiment. As can be seen in this figure, the bag 10, by means of
its biosensor 18, is connected to a potentiostat 50. This connection is made via a
connector 52, which is connected to the connection area 182 of the biosensor 18. The
connector 52 is extended by a cable 54 linked to the potentiostat 50. The potentiostat is,
for its part, linked to a computer system 56 capable of recording and analysing the
25 impedance measurement data.
For the purposes of detection of the microorganisms, the homogenisation bag 10
is preferably incubated for as long as needed to allow the microorganisms to grow. This
incubation may be conventionally performed in an incubator at a temperature of
30 between 25 and 45°C. The incubation time may vary from 3 to 72 hours depending on
the initial quantity of microorganisms present in the sample and on the type of
microorganism to be detected.
According to a first embodiment, the impedance measurement may be performed
at the end. In fact, the homogenisation bag is incubated for the time deemed necessary
and sufficient for the growth of the microorganisms, then it is removed fiom the
incubator and connected to the impedance measurement system described supra. The
5 impedance measurement is then performed and the result is compared to a reference
impedance value. Such an impedance measurement is possible insofar as one or more
working electrodes 20 are coated with electroactive conjugated polymer andfor a nonspecific
anti-ligand molecule for the microorganism to be detected. The impedance
measurement at thislthese electrode(s) constitutes the reference impedance value.
10 Insofar as the difference between the impedance value on the detection electrodes
(electrodes onto which the anti-ligand molecules of the target microorganism are
directly or indirectly fixed) and the reference value is greater than a threshold value, the
detection of the microorganisms is effective.
- A second embodiment dotted, namely by spot impedance
15 measurements during the incubation. In this case, the homogenisation bag is removed
fiom the incubator and connected to the impedance measurement system, for the time
needed for measurement, and is then incubated again. The interval between two
measurements may be between 30 seconds to 2 minutes. This second embodiment has
as its main advantage over the first embodiment the ability to detect the presence of the
20 microorganisms after a shorter incubation time.
Finally in a third embodiment which is the preferred embodiment, it is envisaged
to have inside the incubator a means for connecting the biosensor to the impedance
measurement system. It may be a wired or wireless connection system. Such an
embodiment is particularly advantageous because it makes it possible to cany out a
25 measurement at regular intervals inside homogenisation bags without having to handle
the latter. Furthermore, the impedance measurement at regular intervals makes it
possible to carry out detection of microorganisms in real time. When linked to a
computer system alerting technical personnel when a detection is made, the latter are
no longer constrained by the workflow consisting of performing measurements
30 successively over time. Their intervention is only required when a microorganism is
detected in a bag.
A wired connection means is constituted by any means which makes it possible
to connect two electronic devices to each other in order to enable data transmission. In
particular, a wired connection means may be a serial connection system (RS 485, RS
232 standard), USB connection system (Universal Serial Bus), network connection
5 system (Ethernet), parallel connection system (GPIB) or any other equivalent means.
A wireless connection means is a radio wave transmitter - receiver. For example,
it may be a Wi-Fi (802.1 1b standard), Bluetooth (802.15 standard) or ZigBee (802.15.4
standard) system.
10
According to an alternative, the data acquisition means may be a RFID (Radio
Frequency Identification) reader, a Labjack card or any other means well known to the
person skilled in the art.
15 According to an alternative to the process according to the invention, this may be
implemented via an optical detection means. This detection means may be independent
of the capture support. This is the case for example with an optical sensor, such as a
camera. Alternatively, the optical detection means and the capture support may be
integral. This is the case for example with an optical fibre, the end of which acts as a
20 capture support.
Such an alternative is depicted in figure 7. A closed homogenisation bag 10, as
described previously, is incubated with a food sample 60, constituted here by a sample
of minced steak. This food sample 60 is plunged into a culture medium 62,
25 implemented with a revealing system. A sensitised capture support 64, held in place in
the bag by any appropriate means, is also placed into the homogenisation bag 10 and is
immersed in the culture medium 62. The sensitised capture support 64 is functionalised
by at least one binding partner specific to a target microorganism to be detected. The
capture support may be constituted of any support capable of fixing the specific binding
30 partners and well known to the person skilled in the art. By way of non-limiting
example, an appropriate capture support may be made of irradiated polystyrene, such as
that marketed by the company NuncIThenno Scientific (Cat. No. 472230). Such a
capture support is depicted schematically in figure 9, under the reference 64.
Advantageously and according to a preferred embodiment, the lower part may be
divided in two. The zone bearing the reference 641 may be sensitised with a solution of
binding partners (polyclonal antibodies, monoclonal antibodies, Fab' or Fab'2
5 fragments, phage proteins), whereas the upper part 642 remains free from any binding
partner and thus acts as a negative control.
The capture support is functionalised by at least one specific binding partner such
as antibodies, aptamers, phages, recombinant phage proteins, or any equivalent means
10 enabling the specific capture of the target bacteria.
These latter may be coloured simultaneously with their growth thanks to the
revealing system contained in the culture medium.
According to a particular example, the revealing system is based on TTC
reduction by the microorganisms. Simultaneously to the growth, the TTC (colourless in
15 its non-reduced form) is internalised by said microorganisms, then reduced by the latter
into triphenyl-formazan (red), thus colouring said microorganisms red and allowing
them to be revealed on the support.
The process of direct real-time detection of microorganisms in a food sample,
20 during the incubation period, is carried out automatically or non-automatically by the
optical reading of a sensitised capture support. The incubation may be performed at
temperatures between 25 and 44°C for 6 to 48 h.
In addition, once a certain quantity of coloured dyed microorganisms (in the case
25 of a positive sample) is effectively captured, a change to the optical properties of the
support takes place by the appearance of a red colouring thereon (i.e. transduction of
the biological signal). This colouring of the capture support is then detectable to the eye
or measurable via the use of a reading machine such as a camera. The capture support
is depicted schematically in figure 10 after analysis giving a positive result. As can be
30 seen, area 641 appears coloured due to the fixing of the target microorganisms on the
specific binding partners. The area 642, acting as the negative control, remains the
starting colour of the capture support.
To facilitate reading, it is preferable for the sensitised capture support to no
longer be in contact with the culture medium. To this end, it may be envisaged, for
example, to tilt the homogenisation bag 10, which is well depicted in figure 8. As
explained supra, the reading may be carried out at the end on a spot basis, or in real-
5 time.
According to another alternative of the process according to the invention, the
capture support is constituted by sensitised particles, namely bearing a specific or nonspecific
binding partner for the microorganism(s) to be detected. The detection is then
10 preferably demonstrated by the appearance of real-time agglutination of the sensitised
particles, via the target microorganisms bound to the latter, during the incubation
period. Such an embodiment is described in document WO-A-20091122069.
According to a particular embodiment, the sensitised particles may be magnetic
particles. This embodiment consists in directly detecting, via the agglutination of
15 sensitised magnetic particles, the presence of the target microorganism (i. e. E. coli
0157:H7) in a food sample during enrichment. The detection is performed during the
incubation period by immersing the sensitised magnetic particles with a specific
binding partner (i.e. anti-E. coli 0157:H7 recombinant phage protein) in the closed
container which contains the food sample, diluted in the culture medium.
20
In this alternative, it may be advantageous to use a secondary, tube-type container
inside the main container (homogenisation bag) in order to improve the demonstration
of the agglutination of sensitised particles. As can be seen from figure 11, the
homogenisation bag 10 contains in addition to the culture medium 62 and sample 60, a
25 tube 66. This tube 66 is in fluid communication with the culture medium 62 contained
in the homogenisation bag 10 via a conduit 68. A fraction of the culture medium 62
containing the food sample may then be transferred into the tube 66, in which the
detection takes place. Such a transfer may notably be achieved through temperature
changes, based on the law of perfect gases (PV=nRT). Such a process is described in
30 document WO-A-2004109240 1.
In the case of use of magnetic particles, the reading in the secondary container
containing the reaction medium at the end of the incubation period is carried out using
a magnetic reader.
The magnetic signal can be amplified by prior use of a magnetic field (via a
magnet) which concentrates the agglutination at the centre of the reading area.
5 The application of a magnetic field may also improve the detection limit when
this phenomenon triggers the formation of an agglutination, following a corning
together of the magnetic particles which have captured the microorganisms. In fact, if
the microorganism concentration is not sufficient to trigger passive agglutination, the
coming together of the magnetic particles, some of which will have previously captured
10 the microorganisms, will force an agglutination. Furthermore, the repetition of this
sequence (i.e. magnetisation and re-suspension) may also amplify the phenomenon of
capturing and agglutination formation and thus amplify the sensitivity of the analysis.
The examples set out hereafter aim to present different embodiments of the
15 process according to the invention and the results obtained. They by no means limit the
invention.
EXAMPLES
Example 1: Preparation of the analysis electrodes of the electrochemical
20 biosensor.
Reagents:
Lithium perchlorate (LiC104), sodium chloride (NaCl), sodium hydroxide
(NaOH), potassium (111) hexacyanoferrate (K3Fe (CN)6), potassium hexacyanoferrate
(11) trihydrate (&Fe(CN)6; 3H20), Tween 20, phosphate buffer (BPS), bovine serum
25 albumin (BSA), tris@ydroxymethyl)aminomethane (TRIS), maleic acid, salmon DNA
and 50X Denhardt come from Sigma-Aldrich.
The wash buffer, pH 7.2, is PBS 0.01M, NaCl0.5M and 0.05% Tween.
The hybridisation buffer is PBS 0.01M, NaCl 0.5M, 2X Denhardt and salmon
DNA at 10 pg/mL.
3 0 The grafting buffer of the binding partner is the TRIS-MALEATE BSA buffer,
pH 6.2, constituted of 24.23 g/L TRIS, 23.2 g/L maleic acid, 6 g/L sodium hydroxide
and 5 g/L BSA.
3-(2-hydroxyethy1)pyrrole or PyOH and 3-(phthalimide ethanoate)pyrrole or
PyNHP are supplied by EZUS Lyon.
Synthetic oligonucleotides containing 20 nucleotides and bearing an amino group
at the 5' terminus are fixed covalently by substitution of the NHP groups.
5 The functional monomer is as follows:
pyr-'TTTTTTTTTTGAATCCTCAGTTTTTCAACG~'.
The complementary nucleotide bears a biotin group at the 5' terminus. Its
sequence is as follows: S ' ~ ~ ~ ~ ~ A A A A A ~ ~ ~ ~ ~ ~ ~ 10 Biosensor and electrochemical detection equipment:
The electrochemical detection measurements are carried out using a computercontrolled
BioLogic potentiostat fiom Sciences Instruments.
The sensor used is derived fiom printed circuit board (PCB) technology. The gold
deposition on the electrodes is a galvanic deposition by electrolysis from a gold-based
15 bath. The electrodes are composed of an epoxy resin, copper, nickel and gold
multilayer.
Preparation of the electrodes:
To wash the electrodes, the analysis area of the sensors is soaked in a 1 : 1 distilled
20 waterlethanol solution for one minute in an ultrasound bath.
After washing, the sensors are cleaned and activated electrochemically. To do
this, one 30 pL drop of 0.2 M NaOH in distilled water is deposited on the analysis area
of the sensor, so as to wet all of the electrodes. The sensor is connected to a potentiostat
and several cycles of potential jump in oxidation and in reduction are generated by
25 chronoamperometry. The aim of this step is to generate oxygen bubbles at the interface
with the electrodes so as to eliminate any organic andlor inorganic contaminant. The
sensor is then rinsed with distilled water.
The surface of the working electrodes is modified by copolymer
electrodeposition. All of the electrodes are thus covered with a drop of
30 electropolyrnerisation solution, 100 rnM of PyOH and 25 pM of PyODN (114000
concentration ratio) and 0.5 M LiCL04. The reaction is then electroconducted by
application of a fixed potential of 0.8Vlgold pseudo reference, generated by
chronoamperometry. The polymerisation is interrupted once the imposed charge of 11
mc/cm2 is reached. The copolymer is formed simultaneously on all of the working
electrodes. The electrodes are then rinsed with distilled water.
The following step consists in hybridisation. The sensor is covered with one 30
5 pL drop of buffer solution in the presence of 100 nM of biotinylated target ODN. The
hybridisation is performed at 37 "C for 30 minutes. After a washing step with PBS
buffer, the sensor is soaked in a 100 pg11nL streptavidin solution in PBS buffer for 15
minutes with agitation. The anti-ligand molecule is then fured by placing the sensor in
contact with a solution of 1 pg/mL anti-ligand molecule in the TRIS-maleate BSA
10 buffer.
In the following examples, the anti-ligand molecule is either a recombinant phage
protein for the detection of E.coli 01 57, or a Fab' fragment for the detection of Listeria
SPP.
15 Example 2: Detection of E. coli 0157:H7 in a food sample
A biosensor functionalised with recombinant phage proteins specific to E . coli
01 57, such as described supra and joined to a homogenisation bag, is incubated with a
food sample.
20 Two bags containing the biosensors are incubated with positive enrichment
preparations. Two bags containing the biosensors are incubated with the negative
enrichment preparations, and two bags containing the biosensors are incubated with an
uncontaminated enrichment preparation in order to measure the background noise of
the food matrix.
25
!
i Positive enrichment preparation
25 g of raw meat having a minimum 5% of fatty material are placed aseptically
into the Stomachera bag with a filter and placed in contact with E.coli 0157:H7
ATCC 43888. The bag is placed for 24 hours at 24°C to stress the strain.
30 225 rnL of buffered peptone water (bioMCrieux ref. 42043) preheated for 24
hours at 41 .5"C and 5 mM of redox probe [Fe(CN)6]3-14- are then added to the sample.
The growth of the E.coli 0157:H7 bacteria in the presence of 5 mM of redox
probe [ F ~ (CN) ~ Iw' -a~s -v erified previously. It was confirmed that the presence of this
redox probe did not slow down the bacterial growth within a culture medium.
After homogenisation of the suspension, a functionalised capture support is
placed into the Stomacher0 0 bag. .
This protocol is repeated in order to test two positive suspensions by means of
two bags containing a functionalised support.
A count on a Petri dish, fiom two positive suspensions, made it possible to
evaluate, before incubation in the Stomacher0 0 bag, an average concentration of
E.coli 0157:H7 ATCC 43888 of 0.92 CFUIg of raw meat.
The preparation is then incubated at 4 1.5 OC for 3 hours.
Preparation of the negative enrichments
Negative control: fiom the same raw meat batch number, 25 g are placed
aseptically into a Stomacher@ @ bag with a filter and placed in contact with Bacillus
cereus ATCC 27522. The bag is placed for 24 hours at 2-8OC to stress the strain.
225 rnL of buffered peptone water (bioMCrieux ref. 42043) preheated for 24
hours at 41.5OC and 5 rnM of redox probe [ F ~ ( cN) ~ Ia~re' / t~he-n added to the sample.
After homogenisation of the suspension, a functionalised capture support is
placed into the bag.
This protocol is repeated in order to test two negative suspensions by means of
two bags containing a functionalised support.
In the two suspensions, the rates of contamination by Bacillus cereus ATCC
27522, before incubation in the Stomacher@ 0 bag, are evaluated at 1.32 CFUIg of raw
meat (theoretical measurement).
The preparation is then incubated at 41.5OC for 3 hours.
Measurement of the background noise generated by the matrix: the same protocol
is repeated without bacteria. The preparation is then incubated at 41.5OC for 6 hours.
The aim of this test is to verify if it is possible to detect E. coli 0157:H7 after 3
hours of incubation I enrichment.
Results obtained:
5 For each bag, the impedance measurement is performed directly, without the step
of washing the biosensor.
The Nyquist graphs (-Im(z) vs. Re(z)) obtained at 200 mV in a frequency scale of
between 1 Hz to 100 kHz are set out in figure 5.
The electrochemical impedance spectrum obtained after 6 hours of incubation of
10 the raw meat preparation in the Stomachera bag without contamination, and that
obtained after 3 hours of incubation of the raw meat preparation with negative
contamination show the same electron transfer resistance Kt (diameter of the
semicircles), the values are respectively equal to 1 16 and 1 15 kR.
The resistance to electron transfer is thus attributed to the background noise of
15 the matrix, which is identical to the resistance to electron transfer during non-target
bacteria growth.
After 3 hours of enrichment of the raw meat preparation with positive
contamination, by E. coli 0157:H7 (0.92 CFUIg of raw meat), the electron transfer
resistance value is 719 kR, i.e. around six times greater than that obtained with the
20 negative contamination and so allows clear detection of E. coli 0157:H7.
The average Kt value obtained with all of the homogenisation bags, the standard
deviation and variation coefficient values, are set out in table 1 below. The values
indicated are the gross values of charge resistance corresponding to the diameter of the
semicircle of the impedance signal.
25
Average kt (kn)
Standard deviation
Matrix background
noise (without
contamination)
109
9
Negative
contamination
B. cereus
(1.32 CFUIg)
90
8
Positive
contamination
E. coli
(0.92 CFUIg)
708
25
Table 1
Example 3: Detection of Listeria innocua in a food sample.
5
A biosensor functionalised with Fab' fragments specific to Listeria, such as
described supra and joined to a homogenisation bag is incubated with a food sample.
One bag containing the biosensors is incubated with a positive enrichment
preparation. One bag containing the biosensors is incubated with a negative enrichment
10 preparation.
Variation
coefficient (%)
Number of
measurements
Preparation of the positive enrichment
25 g of raw meat having a minimum 5% of fatty material are placed aseptically
into a Stomacher0 bag with a filter and placed in contact with Listeria innocua ATCC
15 33090. The bag is placed for 22 hours at 2-8OC to stress the bacteria.
225 rnL of Listeria Xpress broth ( b i o ~ ~ r i e urexf. 42626) preheated for 18 hours
at 30°C and 5 mM of redox probe [Fe(CN)6]3-14- are then added to the sample.
9
7
8
16
The growth of the Listeria innocua bacteria in the presence of 5 mM of redox
20 probe [Fe(CN)6]3-14- was verified previously. It was thus confirmed that the presence
of this redox probe did not inhibit bacterial growth within a culture medium.
4
16
After homogenisation of the suspension, two functionalised capture supports are
placed into the Stomacher0 bag.
25 A count on a Petri dish made it possible to evaluate the Listeria innocua ATCC
33090 concentration, before incubation in the Stomacher0 bag, at 0.48 CFUIg of raw
meat.
The preparation is then incubated at 30°C for 6 hours.
Preparation of the negative enrichment
Negative control: from the same raw meat batch number, 25 g are placed
5 aseptically into a Stomacher0 bag with a filter and placed in contact with
Staphylococcus aurezls ATCC 6538P. The bag is placed for 22 hours at 2-8OC.
225 rnL of Listeria Xpress broth (bioMCrieux ref. 42626) preheated for 18 hours
at 30°C and 5 mM of redox probe [Fe(CN)6]3'/4- are then added to the sample.
After homogenisation of the suspension, two capture supports are placed into the
10 Stomacher0 bag. The Staphylococcus aureus ATCC 6538P concentration is 4.10~
CFU/g of raw meat (theoretical measurement), before incubation in the Stomacher0
bag.
The preparation is then incubated at 30°C for 6 hours.
15
The aim of this test is to verify if it is possible to detect Listeria genus bacteria
after 6 hours of incubation / enrichment.
Results obtained:
20 For each bag, the impedance measurement is performed directly, without the step
of washing the biosensor.
The Nyquist graphs (-Im(z) vs. Re(z)) obtained at 200 mV in a frequency scale of
between 1 Hz to 100 kHz are set out in figure 6.
The electrochemical impedance spectrum obtained after 6 hours of incubation of
25 the raw meat preparation in the homogenisation bag with negative contamination
(Staphylococcus aureus at 4.10~ CFUIg) (Figure 6 broken line) shows an electron
transfer resistance value is of 13 kQ.
After 6 hours of enrichment of the raw meat preparation with positive
contamination, by Listeria innocua ATCC 33090 (0.48 CFU/g of raw meat before
30 incubation) (figure 6 unbroken line), the electron transfer resistance value is 45 kn, i.e.
i I around three times greater than that obtained with the negative contamination.
This result clearly shows that it is possible to detect the presence of Listeria
innocua bacteria present in a food sample with the specific Fab' fragments fured on an
electrochemical biosensor in contact with an enrichment medium containing said
sample without the step of washing the sensor, and without signal amplification.
The average kt value obtained with all of the homogenisation bags, the standard
5 deviation and variation coefficient values are set out in table 2 below. The values
indicated are the gross charge resistance values corresponding to the diameter of the
semicircle of the impedance signal.
10 Table 2
Example 4: Elaboration of a capture support sensitised with at least one binding
partner specific to the target microorganism for optical detection.
Positive
contamination
L. innocua
(0.48 CFUIg)
45
8
17
12
Average Kt (kn)
Standard deviation
Variation
coefficient (%)
Number of
measurements
15 A capture support, made of irradiated polystyrene, sold by the company
NuncIThermo Scientific (Cat. No. 472230) and shown in figures 9 and 10.
The sensitisation of the capture support is performed in six steps, as follows:
Negative
contamination
S. aureus
(4.1 o7 CFUIg)
15
1
5
16
1) the polystyrene support is immersed at 37OC for one night in a 5pgImL
I Biotinylated BSA (Bovine Serum Albumin) solution in carbonate buffer
20 pH 9.6;
2) the support is then rinsed with a PBS buffer for several seconds;
3) after rinsing, the support is immersed at 37OC for two hours in a
10pgImL streptavidin solution in phosphate buffer at pH 7.2;
4) the support is then rinsed with a carbonate buffer at pH 9.6 for several
seconds;
5 5) the support is then immersed for two hours at 37OC in a solution of
specific binding partners (1 pg/mL to 40 pg/mL) in carbonate buffer at
pH 9.6;
6) the support is finally passivated in a solution of BSA in carbonate buffer
at pH 9.6, for two hours at 37OC.
10
The sensitised support thus elaborated may be used for optical detection of the
microorganisms or kept at 2-S°C for later use.
Example 5: Optical detection of Escherichia coli 0157:H7 in a food sample
15 via the use of a sensitised support.
The aim of this experiment is to directly detect, via the use of a sensitised -support
such as described supra and shown in figure 8, the presence of the target bacteria E.
coli 0157:H7 in a food sample during enrichment.
20
As detailed hereafter, the detection is carried out during the incubation period by
immersing the sensitised capture support with an anti-E. coli 0157:H7 recombinant
phage protein in a homogenisation bag containing the food sample, diluted to 1110~in
the reaction medium.
25
Protocol:
Step 1 : Re-suspension of the samples in the reaction medium
Four samples are prepared as follows:
Sample A: in a homogenisation bag, 25 g of minced steak
contaminated by 5 colony-forming units (CFU) of E. coli 0157:H7 are
re-suspended in 225 rnL of BPW (bioMCrieux, Ref. 42043)
supplemented by 0.01 g/L of vancomycin (Sigma, Cat. No. 75423) and
0.3 g/L of TTC (bioMkrieux, Ref. 04568088);
Sample B: in a homogenisation bag, 25 g of minced steak not
contaminated by E. coli 01 57:H7 are re-suspended in 225 mL of BPW
supplemented by 0.01 g/L of vancomycin and 0.3 g/L of TTC;
Sample C: in a homogenisation bag, 375 g of minced steak
contaminated by 5 CFU of E. coli 0157:H7 are re-suspended in 3375
mL of BPW supplemented by 0.01 g/L of vancomycin and 0.3 g/L of
TTC;
Sample D: in a homogenisation bag, 375 g of minced steak not
contaminated by E. coli 0157:H7 are re-suspended in 3375 mL of
BPW supplemented by 0.01 g/L of vancomycin and 0.3 g/L of TTC;
15 The analysis is carried out three times for each sample.
Step 2: Immersion of the sensitised supports in the homoaenisation baas before
incubation
The sensitised capture support is placed in each stomacher bag (Samples. A, B, C
20 and D), as described hereafter. The homogenisation bags are then reclosed by means of
a closing pin and incubated in an incubator at 41.5OC for 16-24 h.
Step 3: Reading the capture supports after the incubation period
At the end of incubation (20 h at 41.5OC) and following the non-specific
25 reduction of the TTC by all of the bacteria present in the sample (i.e. belonging to the
annex flora and the target flora), the reaction medium is red in colour. Finally, in order
to be able to observe the capture support which reveals the positivity or negativity of
the analysed sample, the homogenisation bags are inclined in order to isolate said
capture support from the reaction medium.
I 3 0
I
i In accordance with the experimental plan, samples B and D are positive whereas
samples A and C are negative. The analysis of these same samples by the VIDASO
ECPT method marketed by the applicant (ref. 30122) led to similar results, thus
c o n f i i g the results obtained via optical reading of the sensitised capture support.
5 Finally, the target levels reached after 20 h of incubation are around 5.5 loglo
CFUImL for sample B and 3.5 loglo CFUImL for sample D.
Example 6: Optical detection of Listeria spp in environmental samples via
10 the use of a sensitised support.
The aim of this experiment is to directly detect, via the use of a sensitised
support, the presence of the bacterial strains belonging to the genus Listeria in
environmental samples during enrichment.
15
As detailed hereafter, the detection is carried out during the incubation period by
immersing a capture support as described in figure 10, sensitised with three anti-
Listeria spp. recombinant phage proteins in a closed container containing the sample,
diluted in the reaction medium.
Protocol:
Step 1 : re-suspension of the samples in the reaction medium
All of the environmental samples are prepared as in the example detailed
hereafter;
Sponges (8 cm x 3 cm) used for taking surface samples are divided into two
halves, treated as follows:
Sample 1: in a container (i.e. pillbox), the first 112 sponge is contaminated
artificially by 5 CFU of a strain belonging to the genus Listeria and re-suspended in 45
30 mL of LX medium (bioMCrieux, Ref. 42635) supplemented by 0.1 g/L of TTC
(bioMCrieux, Ref. 04568088);
Sample 2: in a second container (i.e. pillbox), the other half which is not
contaminated by a strain belonging to the genus Listeria is re-suspended in 45 mL of
LX medium (bioMCrieux, Ref. 42635) supplemented by 0.1 g/L of TTC (bioMCrieux,
Ref. 04568088).
The link between the samples and the strains inoculated artificially is presented in
5 table 3 below:
Table 3
Sample No.
Sample A1
Sample A2
Sample B1
Sample B2
Sample C1
Sample C2
Step 2: Immersion of the sensitised support in the container (pillbox) before
incubation
Inoculated strain
L. monocytogenes 4b ATCC 191 15
N/A
L. seeligeri NSB 22460
N/A
L. welshimeri 6a
N/ A
A sensitised support, such as described in figures 9 and 10 is placed in each
pillbox. To do this, a hole is made in the pillbox lid such that the sensitised capture
15 support 64 can be inserted forcibly until the analysis area (areas 641 and 642) is
completely immersed in the culture medium. The pill boxes are then sealed with their
stopper and incubated in an incubator at 30°C for 24-48 h.
Step 3: Reading the capture supports at the end of the incubation period
At the end of incubation (24-48 h at 30°C) and following the non-specific
reduction of the TTC by all of the bacteria present in the sample (i.e. belonging to the
annex flora and the target flora), the reaction medium is red in colour. Also in order to
be able to observe the sensitised capture support which reveals the positivity or
negativity of the analysed sample, the homogenisation bags are inclined in order to
isolate the sample from the reaction medium. Each sample is also analysed by the
VIDASB LIS (Ref. 30700) method.
The results obtained are listed in Table 4 below:
Table 4
Sample No.
Samp. A1
Samp. A2
Samp. B1
Samp. B2
Samp. C1
Samp. C2
For the sensitised capture support, a red coloration of area 641 and an absence of
coloration of area 642 of the capture support highlight the positivity of the sample (see
figure 10).
In accordance with the experimental plan, the 1 samples are positive, whereas the
15 2 samples versus negatives are negative. The analysis of these same samples by the
VIDAS LIS method led to similar results, thus confirming the results obtained via
optical reading of a sensitised capture support.
Inoculated strain
L. monocytogenes 4b ATCC
19115
N/A
L. seeligeri NSB 22460
N/A
L. welshimeri 6a
N/A
Example 7: Elaboration of the particles functionalised (conjugated) by at
20 least one binding partner specific to the target microorganism.
Optical Biosensor
Result
+
-
+
-
+
-
VIDAS LIS
Result
+
-
+
-
+
-
- For this example, two types of conjugates are elaborated fiom latex particles of
400 nm in diameter.
Preparation by adsorption of the specific binding partner (anti-E. coli
0 157:H7 recombinant phage protein) following the steps below:
1. washing the latex particles (Plain Hidye blue, Polymer lab) in VERSOL
water by centrifuging;
2. adsorption of the specific binding partners at 150 pg/mL in phosphate
buf5er pH 7 in the presence of the latex particles at a solid content of
0.5% for 3 hours at ambient temperature and with wheel agitation.
10
The adsorption yields are greater than 80%, it is therefore not necessary to wash
the latex particles after adsorption.
Preparation by coupling the specific binding partner (anti-0157
recombinant phage protein) following the steps below:
1. washing the latex particles (Carboxylic Hidye, Polymer lab) in verso1
water by centrifuging;
2. coupling to ethyl-(N',N'-dimethy1amino)prop ylcarbodiirnide
hydrochloride (EDC) of 125 pg/mL streptavidine in 20mM phosphate
buffer pH 7 in the presence of the latex particles at a solid content of
0.5% by agitation in a thermornixer at 37OC and 700 rpm for 3 hours;
3. the uncoupled streptavidin is eliminated by 20 minutes of centrihgation
at 5000 g and the remainder is taken back up in 20 rnM Tris buffer pH
7;
4. addition of the 150 pg/mL biotinylated specific binding partner (anti-E.
coli 0157:H7 biotinylated recombinant phage protein) and incubation
for 3 hours at ambient temperature with wheel agitation;
5. elimination of the excess of binding partner by centrifugation for 10
minutes at 7000 g and taken back up in 20 mM Tris buffer pH 7.
3 0
Example 8: Detection of Escherichia coli 0157:H7 in food samples via the
agglutination of sensitised latex particles in liquid media.
The aim of this experiment is to directly detect, via the agglutination of sensitised
blue latex particles such as described in the preceding example, the presence of the
target bacteria E. coli 01 57:H7 in a food sample during enrichment.
5 As detailed hereafter, the detection is carried out during the incubation period by
immersing the sensitised blue latex particles with an anti-E. coli 0157:H7 recombinant
phage protein, in the closed container which contains the food sample, diluted in the
enrichment medium.
10 Protocol:
Step 1 : re-suspension/dilution of the samples in the enrichment medium
Six samples are prepared as follows:
Sample A1 : in a homogenisation bag, 25 mL of pasteurised milk contaminated by
15 5 CFU of E. coli 01 57:H7 are diluted in 225 mL of BPW (bioMCrieux, ref. 42043);
Sample A2: in a homogenisation bag, 25 mL of pasteurised milk not
contaminated by E. coli 01 57:H7 are diluted in 225 mL of BPW;
20 Sample B1: in a homogenisation bag, 25 g of salmon contaminated by 5 CFU of
E. coli 0157:H7 are re-suspended in 225 mL of BPW;
Sample B2: in a homogenisation bag, 25 g of salmon not contaminated by E. coli
01 57:H7 are re-suspended in 225 mL of BPW;
25
Sample C1: in a homogenisation bag, 25 g of salad contaminated by 5 CFU of E.
coli 0157:H7 are re-suspended in 225 mL of BPW;
Sample C2: in a homogenisation bag, 25 g of salad not contaminated by E. coli
30 0157:H7 are re-suspended in 225 mL of BPW;
Three repetitions were carried out for each sample.
Step 2: Insertion of the tube containing the reaction medium into the
homogenisation bag prior to incubation
5 In accordance with figure 11, a tube containing the reaction medium is then
added into the homogenisation bag. The reaction medium is composed of 100 pl of
sensitised blue latex particles and 1.4 mL of BPW supplemented by 10 mgL of
vancomycin.
10 The homogenisation bags are then re-closed by means of a closing pin and placed
in a programmable incubator for a three-phase incubation. In fact, the transfer of an
aliquot of the sample (0.5 mL) from the homogenisation bag to the tube containing the
reaction media is performed in accordance with the process described in document
WO-A-20041092401, based on the law of perfect gases (pV = nRT).
15 The incubation period is divided as follows:
Phase 1 : 16 h at 41 S°C; enrichment of the 25 g sample diluted in BPW,
Phase 2: 1 h at 30°C; transfer of 0.5 mL of sample into the tube containing the
reaction medium,
Phase 3: 8 h at lS°C; enrichment of the reaction medium containing the 0.5 rnL
20 aliquot,
According to the experimental plan, the Samp. No. 1 samples were determined as
positive versus negative for the Samp. No. 2 samples. The analysis of these same
samples by the VIDAS ECPT method led to similar results, thus confirming the results
obtained via the agglutination of sensitised latex particles in liquid medium.
CLAIMS
1. A process of detecting at least one microorganism present in a sample placed in a
closed container, said method comprising essentially the following steps:
5 a) Place said sample in contact in the container with at least one culture
medium and a support capable of capturing the microorgamsm(s) to be
detected,
b) Close the container,
c) Place the container under conditions capable of allowing the growth of the
10 microorganism(s)
d) Detect, inside said closed container, using detection means, the presence
of the microorganism(s) fixed onto the capture support.
2. The process according to Claim 1, in which a revealing system capable of allowing
15 the detection is placed in contact in the container during step a).
3. The process according to one of the preceding claims, including an intermediate
step c') consisting in transferring all or part of the mixture constituted by said
sample, the culture medium, the support capable of capturing the microorgamsm(s)
20 to be detected and potentially of the revealing system, from the container, in this
case called the main container, to at least one second container called the
secondary container.
4. The process according to one of the preceding claims, including a supplementary
25 step e) consisting in confirming the detection of the microorganism(s) detected.
5. The process according to claim 4, wherein the confirming step e) is accomplished
using a detection means which is identical or different from the detection means
used for the detection step.
30
6. The detection process according to one of the precedmg claims, wherein the
detection means is taken from the group comprising: electrical detection means, in
34
m
particular electrochemical detection means, optical detection means, acoustic
detection means, thermal detection means, mechanical detection means, and
magnetic detection means.
5 7. The process according to one of the preceding claims, wherein the support for
capturing the microorganism(s) also constitutes the detection means.
8. The detection process according to the one of the preceding claims, wherein at
least one specific or non-specific binding partner of the microorganism(s) is fixed
10 onto the capture support.
9. The detection process according to the preceding claim, wherein the specific
binding partner is taken from the group comprising: antibodies. Fab fragments.
Fab' fragments, recombinant or non-recombinant phage proteins, and phages.
15
10. The process according to one of the preceding claims, wherein the detection of the
microorganism(s) is performed in real-time.
11. The detection process according to the one of the preceding claims, wherein the
20 detection of the microorganism(s) is performed after the growth step of said
microorganism(s).
12. The detection process according to the one of the preceding claims, wherein the
container is a homogenisation bag, a flask, a bottle or a pillbox.
25
13. The process according to one of the preceding claims, wherein the capture support
is a one-piece or particulate support.
14. The process according to the preceding claim, wherein the particulate support is
3 0 constituted of sensitised particles.
15. The process according to the preceding claim, wherein the sensitised particles are
• 35
magnetic.
16. The detection process according to one of the preceding claims, wherein the
detection means is connected to a data analysis system.
17. The detection process according to ' ^ claim 16, wherein the connection
between the capture support or the detection means and the data analysis device is
a wired connection or a wireless connection.
| # | Name | Date |
|---|---|---|
| 1 | 618-DELNP-2013.pdf | 2013-02-03 |
| 2 | 618-delnp-2013-GPA.pdf | 2013-08-20 |
| 3 | 618-delnp-2013-Form-5.pdf | 2013-08-20 |
| 4 | 618-delnp-2013-Form-3.pdf | 2013-08-20 |
| 5 | 618-delnp-2013-Form-2.pdf | 2013-08-20 |
| 6 | 618-delnp-2013-Form-1.pdf | 2013-08-20 |
| 7 | 618-delnp-2013-Drawings.pdf | 2013-08-20 |
| 8 | 618-delnp-2013-Description(Complete).pdf | 2013-08-20 |
| 9 | 618-delnp-2013-Correspondence-others.pdf | 2013-08-20 |
| 10 | 618-delnp-2013-Claims.pdf | 2013-08-20 |
| 11 | 618-delnp-2013-Form-3-(27-04-2015).pdf | 2015-04-27 |
| 12 | 618-delnp-2013-Correspondence Others-(27-04-2015).pdf | 2015-04-27 |
| 13 | 618-DELNP-2013-FER.pdf | 2018-02-26 |
| 14 | 618-DELNP-2013-AbandonedLetter.pdf | 2019-01-04 |
| 1 | 618_26-02-2018.pdf |