The present invention relates to a method for producing a morpholino oligonucleotide and a morpholinonucleotide used as a raw material for the production method.
Background technology
[0002]
　Morphorino oligonucleotides are compounds that are attracting attention for use as antisense oligonucleotides because they have high affinity for DNA and RNA, resistance to various nucleases, stability in vivo, and low toxicity. (See Non-Patent Document 1).
[0003]
　Solid-phase synthesis methods and liquid-phase synthesis methods have been reported as methods for producing morpholino oligonucleotides (see Non-Patent Documents 2 and Patent Documents 1 to 5).
　The solid-phase synthesis method is advantageous in terms of speed because it can be automatically synthesized, but it is limited in scale-up due to equipment restrictions and has low reactivity. Therefore, it is a monomer used in a nucleotide extension reaction. It is necessary to use excessively, and it is not suitable for industrial mass synthesis. In addition, there is a drawback that it is difficult to confirm the progress of the reaction in the middle stage and analyze the structure of the intermediate.
　On the other hand, the liquid phase synthesis method requires complicated treatment such as column purification, and it is difficult to rapidly synthesize a large amount of morpholino oligonucleotide having a chain length of about 20 mer, which can be used as an antisense drug.
[0004]
　In recent years, as an attempt to eliminate the drawbacks of the liquid phase method and the solid phase method, a method for synthesizing an oligonucleotide using a hydrophobic group-bonded nucleoside, a pseudo solid phase protected nucleoside, or the like has been reported (Patent Document 6). , 7). However, neither description nor suggestion has been made regarding the synthesis of morpholino oligonucleotides, whose reaction pathways and reactions themselves are different from those of oligonucleotide synthesis.
Prior art literature
Patent documents
[0005]
Patent Document 1: International Publication No. 91/09033
Patent Document 2: International Publication No. 2008/008113
Patent Document 3: US Patent Application Publication No. 2009/0131632
Patent Document 4: International Publication No. 2009/064741
Patent Document 5: International Publication No. 2012/0473730
Patent Document 6: Japanese Patent Application Laid-Open No. 2010-275254
Patent Document 7: International Publication No. 2012/157723
Non-patent literature
[0006]
Non-Patent Document 1: Summerton, J. Mol. Etc., Antisense and Nucleic Acid Drug Development, 1997, Vol. 7, p. 187.
Non-Patent Document 2: Harakawa et al., Bioorganic & Medicinal Chemistry Letters, 2012, Vol. 22, p. 1445-1447
Outline of the invention
Problems to be solved by the invention
[0007]
　An object of the present invention is to provide a method for producing a morpholino oligonucleotide efficiently and in a high yield by a liquid phase method, and a novel morpholinonucleotide as a raw material for the method.
Means to solve problems
[0008]
　The present inventors have found that the above-mentioned problems can be solved by protecting the 5'-hydroxyl side with a specific protecting group in the liquid phase synthesis of morpholino oligonucleotides.
　That is, by using a morpholinonucleotide whose 5'-hydroxyl side is protected by the protecting group as a raw material for morpholino oligonucleotide liquid phase synthesis, the condensation reaction itself can be carried out in the liquid phase, so that the reactivity is solid. Compared to the phase method, it is significantly improved, the amount of monomer equivalent used can be significantly reduced, and after the reaction, morpholino oligonucleotides can be easily isolated and purified by crystallization or extraction operation, so they can be used in pharmaceuticals. A morpholino oligonucleotide having a chain length of about 20 mer can be synthesized efficiently and in high yield by the liquid phase method.
[0009]
　On the other hand, in the process of investigating the liquid phase synthesis of morpholino oligonucleotides by the present inventors, double addition occurs when a trace amount of the activated morpholinonucleoside monomer used in the condensation reaction remains during the condensation reaction in the next cycle. , The problem that the quality of the obtained morpholino oligonucleotide is deteriorated has been found. It has been found that the problem can be solved by treating the activated morpholinonucleoside monomer remaining after the condensation reaction with a quenching agent.
　That is, the present invention includes the following.
[1] General formula (I):
[0010]
[Chemical 1]

[0011]
[In the formula,
m represents an arbitrary integer greater than or equal to 0,
m + 1 Base represents a nucleic acid base that may be independently protected, and
P 1 is a hydrogen atom or can be removed under acidic conditions. The
m X each has a C 1-6 alkoxy group, a di C 1-6 alkylamino group, or a 4-position nitrogen atom protected by a protective group and further substituted. A good piperadino group is indicated,
m Ws independently indicate an oxygen atom or a sulfur atom, respectively,
S 1 is a single bond, or * OS 2 ** (in the formula, * is L). The bond position is indicated, ** indicates the bond position with the 5'-position hydroxyl group, S 2 indicates the group whose main chain is represented by a spacer having 1 to 20 atoms.), And
L is a single bond. , Or formula (a1):
[0012]
[Chemical 2]

[0013]
[In the formula, * indicates the bond position with Y;
** indicates the bond position with S 1 ;
L 1 indicates a divalent C 1-22 hydrocarbon group which may be substituted. ; And
L 2 indicates C (= O), or *** N (R 3 ) -R 1- N (R 2 ) C (= O) ** (In the formula, ** is L 1 Indicates the bonding position with, where *** indicates the bonding position with Y, R 1 indicates a C 1-22 alkylene group which may be substituted , and R 2 and R 3 are independent of each other. , Hydrogen atom or optionally substituted C It may show a 1-22 alkyl group, or R 2 and R 3 may be combined to form a optionally substituted C 1-22 alkylene bond. ) Indicates a group. ] Indicates a group,
Y indicates a single bond, an oxygen atom, or NR (R indicates a hydrogen atom, an alkyl group or an aralkyl group), and
Z indicates a formula (a2) :.
[0014]
[Chemical 3]

[0015]
[In the formula, * indicates the bond position with Y;
R 4 indicates a hydrogen atom, or when R b is a group represented by the following formula (a 3), together with R 6 May form a fluorenyl group or a xanthenyl group with ring B, indicating a single bond or -O-;
k Qs independently exhibit a single bond or -O-, respectively. -S -, - OC (= O ) -, - NHC (= O) - or -NH- are shown;
k-number of R 5 is independently having 10 to 300 carbon atoms each an alkyl group and / or carbon not less than 10 300 represents an organic group having an alkenyl group;
k represents an integer of 1-4;
ring a, k-number of QR 5 in addition to, substituted further halogen atom, a halogen atom also a C 1-6 alkyl group, and a C be substituted with a halogen atom 1-6 may have a substituent group selected from the group consisting of an alkoxy group;
R a represents a hydrogen atom ;
R BIs a hydrogen atom, or formula (a3):
[0016]
[Chemical 4]

[0017]
(In the formula, * indicates the bond position;
j indicates an integer from 0 to 4;
j Q indicates the same meaning as described above;
j R 7 independently have 10 carbon atoms. Indicates an organic group having an alkyl group of not more than 300 and / or an alkoxy group having 10 or more carbon atoms and not more than 300;
R 6 indicates a hydrogen atom or forms a single bond or —O— together with R 4. As shown, a fluorenyl group or a xanthenyl group may be formed together with the ring A; and the
ring B may be further substituted with a halogen atom or a halogen atom in addition to j QR 7 C 1-6. alkyl group, and a halogen atom in the optionally substituted C 1-6 shows a group represented by which may have a substituent selected from the group consisting of an alkoxy group.), or
R a and R b together form an oxygen atom. ] Indicates a group represented by. ] The
morpholinonucleotide indicated by.
[0018]
[2] The morpholinonucleotide according to [1], wherein m is 0.
[3] L in the general formula (I) is a succinyl group, and
R 5 and / or R 7 is an alkyl group having a carbon number of 10 to 40, according to [1] or [2] Morphorinonucleotides.
[4] L in the general formula (I) is a succinyl group, and
R a and R b are both hydrogen atom, and R 5 is an alkyl group having a carbon number of 10 to 40 [ 1] or [2]. The morpholinonucleotide.
[5] The method according to [1] or [2], wherein L in the general formula (I) is a succinyl group, and
R 5 and / or R 7 is an alkyl group having 12 to 30 carbon atoms. Morphorinonucleotides.
[0019]
[6] L in the general formula (I) is a succinyl group, and
ZZ is a 3,4,5-tri (octadecyloxy) benzyloxy group,
3,5-di (docosyloxy) benzyloxy. Group,
3,5-bis [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzyloxy group,
3,4,5-tris [3', 4', 5'-tri (octadecyloxy) ) Benzyloxy] benzyloxy group,
3,4,5-tri (octadecyloxy) benzylamino group,
2,4-di (docosyloxy) benzylamino group,
3,5-di (docosyloxy) benzylamino group,
di (4) -Docosyloxyphenyl) methylamino group,
4-methoxy-2- [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino group,
4-methoxy-2- [3', 4' , 5'-tri (octadecyloxy) cyclohexylmethyloxy] benzylamino group,
2,4-di (dodecyloxy) benzylamino group,
phenyl (2,3,4-tri (octadecyloxy) phenyl) methylamino group,
di [4- (12-docosyloxide decyloxy) phenyl] methylamino group,
3,5-bis [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino group, and

The morpho according to [1] or [2], which is a group selected from the group consisting of 3,4,5-tris [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino groups. Renonucleotide.
[0020]
[7] ZZ is a
2- {2,4-di (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
3,5-di (2', 3'). -Dihydrophytyloxy) benzyl succinyl group;
4- (2', 3'-dihydrophytyloxy) benzyl succinyl group;
2- {1-[(2-chloro-5- (2', 3', 3'-dihydrofi) Tyruoxy) phenyl)] benzylaminocarbonyl} ethylcarbonyl group;
3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl succinyl group;
2- {3,4,5-tri (2') , 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {4- (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {2- [3' , 4', 5'-tri (2'', 3''-dihydrophytyloxy) benzyloxy] -4-methoxybenzylaminocarbonyl} ethylcarbonyl group;
2- {4- (2', 3'-dihydro) Phythyloxy) -2-methoxybenzylaminocarbonyl} ethylcarbonyl group;
4- (2', 3'-dihydrophytyloxy) -2-methylbenzyl succinyl group;
2- {4- (2', 3'- Dihydrophytyloxy) -2-methylbenzylaminocarbonyl} ethylcarbonyl group;
4- [2,2,4,8,10,10-hexamethyl-5-dodecanoylamino] benzyl succinyl group;
2- {4- [2,2,4,8,10,10-hexamethyl-5-dodeca Noylamino] benzylaminocarbonyl} ethylcarbonyl group;
4- (3,7,11-trimethyldodecyloxy) benzylsuccinyl group;
2- {4- (3,7,11-trimethyldodecyloxy) benzylaminocarbonyl} ethylcarbonyl Group;
2- {3,5-di (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {1- [2,3,4-tri (2', 3'-) Dihydrophytyloxy) phenyl] benzylaminocarbonyl} ethylcarbonyl group;
2- {1- [4- (2', 3'-dihydrophytyloxy) phenyl] -4'-(2', 3'-dihydrofi) Thiruoxy) benzylaminocarbonyl} ethylcarbonyl group;
3,4,5-tris [3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl] benzyl succinyl group; and
2- {3, 4,5-Tris [3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl] benzylaminocarbonyl} Selected from the group consisting of ethylcarbonyl groups, in
[1] or [2] The morpholinonucleotide of the description.
[0021]
[8] The morpholinonucleotide according to any one of [1] to [7], wherein P 1 is a trityl group, a monomethoxytrityl group, or a dimethoxytrityl group.
[0022]
[9] (2) The 5'-hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidartized, and the morpholine ring nitrogen atom is protected by a temporary protecting group that can be removed under acidic conditions. The p-polymerized morpholino oligonucleotide (p represents any integer of 1 or more) is present on the substituent when the 5'-hydroxyl group or the 5'-hydroxyl group has a hydroxyl group. N-polymerized morpholino oligonucleotides whose hydroxyl groups are protected by an alkyl group having 10 or more and 300 or less carbon atoms and / or a protecting group having an alkenyl group having 10 or more and 300 carbon atoms or less and in which the morphophosphorus ring nitrogen atom is not protected. (N represents any integer greater than or equal to 1) and n + p, comprising the step of condensing with a (thio) phosphoramidate bond or a (thio) phosphoramidate bond via its morpholine ring nitrogen atom. A method for producing an individually polymerized morpholino oligonucleotide.
[0023]
[10] The production method according to [9], wherein p is 1.
[11] The production method according to [9] or [10], wherein the reaction mixture is treated with a quenching agent after the reaction is completed.
[0024]
[12] The production method according to any one of [9] to [11], further comprising the following step (1).
(1) Before the condensation step (2), when the 5'-position hydroxyl group or the 5'-position hydroxyl group has a substituent in a non-polar solvent, the hydroxyl group existing on the substituent has 10 or more and 300 or less carbon atoms. N polymerized morpholino oligonucleotides protected by an alkyl group and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms and a temporary protecting group in which the morpholine ring nitrogen atom can be removed under acidic conditions. Is reacted with an acid to remove the temporary protecting group of the morpholine ring nitrogen atom.
[0025]
[13] The production method according to [12], wherein the temporary protecting group is removed in the presence of a cation scavenger.
[14] The production method according to [12] or [13], which further comprises a step of removing the temporary protecting group of the morphophosphorus ring nitrogen atom and then neutralizing it with an organic base in the step (1).
[0026]
[15] A protecting group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms has the following formula (II):
[0027]
[Chemical 5]

[0028]
[L is a single bond, or formula (a1):
[0029]
[Chemical 6]

[0030]
[In the formula, * indicates the bond position with Y;
** indicates the bond position with S 1 ;
L 1 indicates a divalent C 1-22 hydrocarbon group which may be substituted. ; And
L 2 indicates C (= O), or *** N (R 3 ) -R 1- N (R 2 ) C (= O) ** (In the formula, ** is L 1 Indicates the bonding position with, where *** indicates the bonding position with Y, R 1 indicates a C 1-22 alkylene group which may be substituted , and R 2 and R 3 are independent of each other. , Hydrogen atom or optionally substituted C It may show a 1-22 alkyl group, or R 2 and R 3 may be combined to form a optionally substituted C 1-22 alkylene bond. ) Indicates a group. ] Indicates a group,
Y indicates a single bond, an oxygen atom, or NR (R indicates a hydrogen atom, an alkyl group or an aralkyl group), and
Z indicates a formula (a2) :.
[0031]
[Chemical 7]

[0032]
[In the formula, * indicates the bond position with Y;
R 4 indicates a hydrogen atom, or when R b is a group represented by the following formula (a 3), together with R 6 May form a fluorenyl group or a xanthenyl group with ring B, indicating a single bond or -O-;
k Qs independently exhibit a single bond or -O-, respectively. -S -, - OC (= O ) -, - NHC (= O) - or -NH- are shown;
k-number of R 5 is independently having 10 to 300 carbon atoms each an alkyl group and / or carbon not less than 10 300 represents an organic group having an alkenyl group;
k represents an integer of 1-4;
ring a, k-number of QR 5 in addition to, substituted further halogen atom, a halogen atom also a C 1-6 alkyl group, and a C be substituted with a halogen atom 1-6 may have a substituent group selected from the group consisting of an alkoxy group;
R a represents a hydrogen atom ;
R BIs a hydrogen atom, or formula (a3):
[0033]
[Chemical 8]

[0034]
(In the formula, * indicates the bond position;
j indicates an integer from 0 to 4;
j Q indicates the same meaning as described above;
j R 7 independently have 10 carbon atoms. Indicates an organic group having an alkyl group of not more than 300 and / or an alkoxy group having 10 or more carbon atoms and not more than 300;
R 6 indicates a hydrogen atom or forms a single bond or —O— together with R 4. As shown, a fluorenyl group or a xanthenyl group may be formed together with the ring A; and the
ring B may be further substituted with a halogen atom or a halogen atom in addition to j QR 7 C 1-6. alkyl group, and a halogen atom in the optionally substituted C 1-6 shows a group represented by which may have a substituent selected from the group consisting of an alkoxy group.), or
R a and R b together form an oxygen atom. ], The production method according to any one of [9] to [14].
[0035]
[16] The production method according to [15], further comprising the following step (3).
　(3) A step of adding a polar solvent to the reaction solution obtained in the steps (1) and / or (2) to precipitate a morpholino oligonucleotide, and obtaining the reaction solution by solid-liquid separation.
[0036]
[17] The non-polar solvent is a solvent selected from the group consisting of halogen-based solvents, aromatic solvents, ester-based solvents, aliphatic solvents, non-polar ether-based solvents, and combinations thereof. [12] The manufacturing method according to any one of [16].
[18] The production method according to [16] or [17], wherein the polar solvent is an alcohol solvent or a nitrile solvent.
[0037]
[19] The production method according to any one of [9] to [18], further comprising the following step (4).
(4) A step of removing all protecting groups of the obtained n + p polymerized morpholino oligonucleotides.
[20] The production method according to any one of [9] to [19], wherein the temporary protecting group that can be removed under acidic conditions is a trityl group, a dimethoxytrityl group, or a monomethoxytrityl group.
The invention's effect
[0038]
　According to the present invention, by protecting the 5'position hydroxyl group side of the morpholinonucleotide with a specific protecting group, it is possible to reduce the raw material monomer equivalent in the condensation reaction by improving the reactivity, which is an advantage of the liquid phase method. Since it can have the advantage of the solid phase method that morpholino oligonucleotides can be easily isolated and purified by crystallization / washing or extraction at each stage of the extension reaction, it has a chain length of about 20 mer, which is useful as a pharmaceutical. It has become possible to carry out industrial mass production of morpholino oligonucleotides efficiently and in high yield.
　In addition, it was also found that the quality of the target morpholino oligonucleotide can be prevented from deteriorating by treating the activated morpholinonucleoside monomer remaining after the condensation reaction with a quenching agent. It has been possible to provide a method for producing high quality morpholino oligonucleotides in large quantities and efficiently.
Mode for carrying out the invention
[0039]
　The present invention relates to a novel morpholinonucleotide in which the 5'-hydroxyl side is protected by a specific protecting group and the morpholine ring nitrogen atom may be protected by a temporary protecting group that can be removed under acidic conditions.
　In addition, another aspect of the present invention is that the 5'-hydroxyl group is activated (thio) phosphated or activated (thio) phosphoramidated, and the morphophosphorus ring nitrogen atom can be removed under acidic conditions. A p-polymerized morpholino oligonucleotide protected by a protecting group (p represents an arbitrary integer of 1 or more) has a hydroxyl group having 10 carbon atoms present on the substituent of the 5'-hydroxyl group or the 5'-hydroxyl group. N polymerized morpholino oligonucleotides protected by a protecting group having an alkyl group of 300 or more and / or an alkenyl group having 10 or more and 300 or less carbon atoms and not protected by a morpholine ring nitrogen atom (n is 1 or more). (Indicates any integer of) and n + p polymerized morpholino oligonucleotides comprising the step of condensing with a (thio) phosphoramidate bond or a (thio) phosphoriamidate bond via its morpholine ring nitrogen atom. It is a manufacturing method of.
　This will be described below.
[0040]
[Explanation of Terms]
　Unless otherwise specified in the text, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. Any method and material similar to or equivalent to that described herein can be used in the practice or testing of the present invention, but preferred methods and materials are described below. All publications and patents referred to herein are hereby referred to, for the purpose of describing and disclosing, for example, the constructs and methodologies described in publications that may be used in connection with the invention described. Incorporated into the book.
[0041]
　In the present specification, the "morpholinonucleoside" which is a constituent unit of the morpholino oligonucleotide is a compound represented by the following formula (1).
[0042]
[Chemical 9]

[0043]
(In the formula, Base indicates a nucleobase that may be protected) The
　morpholinonucleoside (1) is prepared according to a method known per se (eg, the method described in WO91 / 09033A1) or a method similar thereto. be able to. Specifically, as shown in the following scheme, the corresponding ribonucleoside (2) is oxidatively opened with sodium periodate or the like to obtain the corresponding 2', 3'-dialdehyde (3), and the dialdehyde (3). ) Is closed with ammonia to obtain 2', 3'-dihydroxymorpholinonucleoside (4), and dihydroxymorpholinonucleoside (4) is treated with a reducing agent (eg, sodium borohydride, sodium triacetoxyborohydride, etc.). By reduction, morpholinon nucleoside (1) can be obtained.
[0044]
[Chemical 10]

[0045]
　In addition, in this specification, the position number (1', 2', etc.) of morpholinonucleoside shall correspond to the position number of the carbon atom of ribose of ribonucleoside (2) which is a raw material.
[0046]
　In the present specification, a morpholino oligonucleotide means that two or more morpholinonucleosides have a (thio) phosphoramidate bond or a (thio) phosphoriamidate bond via a 5'-position hydroxyl group and a nitrogen atom of a morpholine ring. For example, the morpholino oligonucleotide obtained by polymerizing m'+ 1 is a compound represented by the following formula (5).
[0047]
[Chemical 11]

[0048]
(In the formula,
m'indicates any integer greater than or equal to 1,
m'+1 Base indicates a nucleobase that may be independently protected, and
m'in X independently. The C 1-6 alkoxy group, the di C 1-6 alkylamino group, the 4-position nitrogen atom are protected by a protecting group, and the piperadino group which may be further substituted is shown, respectively, and m'Ws are
independent. Indicates an oxygen atom or a sulfur atom, respectively.)
[0049]
　In the present specification, "a piperadino group in which the 4-position nitrogen atom is protected by a protecting group and may be further substituted" means that the 4-position nitrogen atom of the piperadino group is protected by a protecting group. A piperazino group protected by a protecting group capable of withstanding the deprotection conditions of the morpholin ring nitrogen atom of the morpholinonucleotide is preferred. As such a "protecting group for the nitrogen atom at the 4-position of the piperazino group", an acyl group is preferable, and for example, a monofluoroacetyl group, a difluoroacetyl group, a trifluoroacetyl group, a 2-fluoropropionyl group, a 2,2-difluoropropionyl group, 3 , 3,3-Trifluoropropionyl group, 2,3,3,3-tetrafluoropropionyl group, pentafluoropropionyl group and other acyl groups having a fluoro group in the carbon chain are more preferable (International Publication No. 2008/008113 pamphlet). reference). The piperadino group may be substituted with a hydrogen atom bonded to a carbon atom of the piperadino group, and examples of the substituent include an alkyl group such as a methyl group (preferably having 1 to 3 carbon atoms) and the like.
[0050]
　In the present specification, following the convention of nucleic acid chemistry, the morpholinonucleoside at the end of the morpholino oligonucleotide having the free hydroxyl group at the 5'position (upper left side of the above formula (5)) is referred to as "5'-terminal". The morpholinonucleoside at the opposite end (lower right side of the above formula (5)) shall be referred to as the "3'-end".
[0051]
　In the present specification, the "nucleobase" is not particularly limited as long as it is used for the synthesis of nucleic acid, and for example, a pyrimidine base such as a cytosyl group, a uracil group, a timyl group, an adenyl group, a guanyl group and the like. Purine bases can be mentioned. Further, the "protecting nucleic acid base" means that the amino group may be protected in, for example, an adenyl group, a guanyl group, or a cytosyl group which is a nucleic acid base having an amino group. A nucleic acid base in which the amino group of the nucleic acid base is protected by a protecting group capable of withstanding the deprotection conditions of the morpholin ring nitrogen atom of the morpholinonucleotide is preferable. Such "protecting group of amino group" is not particularly limited, and for example, Greens Protective Groups in Organic Synthesis (Greene's PROTECIVE GROUPS in ORGANIC SYNTHESIS), 4th edition, Willy Interscience ( Protecting groups described in Wiley-Interscience Publishing (2006) and the like can be mentioned. Specific examples of such "protective group of amino group" include, for example, pivaloyl group, pivaloyloxymethyl group, trifluoroacetyl group, phenoxyacetyl group, 4-isopropylphenoxyacetyl group, 4-tert-butylphenoxyacetyl group, and the like. Examples thereof include an acetyl group, a benzoyl group, an isobutyryl group, a dimethylformamidinyl group, a 9-fluorenylmethyloxycarbonyl group and the like. Among these, a phenoxyacetyl group, a 4-isopropylphenoxyacetyl group, an acetyl group, a benzoyl group, an isobutyryl group and a dimethylformamidinyl group are preferable. Further, the carbonyl group of the nucleic acid base may be protected, for example, phenol, 2,5-dichlorophenol, 3-chlorophenol, 3,5-dichlorophenol, 2-formylphenol, 2-naphthol, 4-methoxy. Phenol, 4-chlorophenol, 2-nitrophenol, 4-nitrophenol, 4-acetylaminophenol, pentafluo Lophenol, 4-pivalyloxybenzyl alcohol, 4-nitrophenethyl alcohol, 2- (methylsulfonyl) ethanol, 2- (phenylsulfonyl) ethanol, 2-cyanoethanol, 2- (trimethylsilyl) ethanol, dimethylcarbamic acid chloride, The carbonyl group can be protected by reacting diethylcarbamic acid chloride, ethylphenylcarbamic acid chloride, 1-pyrrolidincarboxylic acid chloride, 4-morpholinecarboxylic acid chloride, diphenylcarbamic acid chloride and the like. Here, it may not be necessary to introduce a carbonyl group protecting group. In addition to the above-mentioned groups, the "nucleic acid base" includes any substituent (for example, halogen atom, alkyl group, aralkyl group, alkoxy group, acyl group, alkoxyalkyl group, hydroxy group, amino). Modified nucleic acid bases (eg, 8-bromoadenyl group, 8-bromoguanyl group, 5-bromocytosyl) substituted with 1 to 3 at arbitrary positions with groups, monoalkylamino, dialkylamino, carboxy, cyano, nitro, etc. Groups, 5-iodositosyl groups, 5-bromourasyl groups, 5-iodourasyl groups, 5-fluorouracil groups, 5-methylcitosyl groups, 8-oxoguanyl groups, hypoxanthinyl groups, etc.) are also included.
[0052]
　In the present specification, the "halogen atom" is a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.
[0053]
　In the present specification, examples of the "alkyl (group)" include linear or branched alkyl groups having 1 or more carbon atoms, and C 1- is preferable when the carbon number range is not particularly limited. It is a 10 alkyl group, more preferably a C 1-6 alkyl group. Preferable specific examples when the carbon number range is not limited include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl and the like, and methyl and ethyl are particularly preferable. ..
[0054]
　In the present specification, the "aralkyl (group)" includes a C 7-20 aralkyl group, preferably a C 7-16 aralkyl group (C 6-10 aryl-C 1-6 alkyl group). Suitable specific examples include benzyl, 1-phenylethyl, 2-phenylethyl, 1-phenylpropyl, naphthylmethyl, 1-naphthylethyl, 1-naphthylpropyl and the like, and benzyl is particularly preferable.
[0055]
　In the present specification, the "alkoxy (group)" includes an alkoxy group having 1 or more carbon atoms, and when there is no particular limitation on the carbon number range, it is preferably a C 1-10 alkoxy group, more preferably. Is a C 1-6 alkoxy group. Preferable specific examples when the carbon number range is not limited include methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy, hexyloxy and the like, and particularly methoxy, Ethoxy is preferred.
[0056]
　In the present specification, examples of the "acyl (group)" include linear or branched C 1-6 alkanoyl groups and C 7-13 aloyl groups. Specific examples thereof include formyl, acetyl, n-propionyl, isopropionyl, n-butyryl, isobutyryl, pivaloyl, valeryl, hexanoyl, benzoyl, naphthoyl, levulinyl and the like, and these may be substituted respectively.
[0057]
　In the present specification, as the "alkenyl (group)", a linear or branched C 2-6 alkenyl group or the like is preferable, and for example, vinyl, 1-propenyl, allyl, isopropenyl, butenyl, isobutenyl and the like are preferable. Can be mentioned. Of these, the C 2-4 alkenyl group is preferable.
[0058]
　In the present specification, as the "alkynyl (group)", a C 2-6 alkynyl group or the like is preferable, and for example, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-. Examples thereof include pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl and 5-hexynyl. Of these, the C 2-4 alkynyl group is preferable.
[0059]
　In the present specification, "cycloalkyl (group)" means a cyclic alkyl group, and examples thereof include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Among them, C 3-6 cycloalkyl groups such as cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl are preferable, and cyclohexyl is particularly preferable.
[0060]
　In the present specification, "aryl (group)" means a monocyclic or polycyclic (condensed) hydrocarbon group exhibiting aromaticity, and specifically, for example, phenyl, 1-naphthyl, 2 -C6-14 aryl groups such as naphthyl, biphenylyl, 2-anthryl and the like can be mentioned. Of these, the C 6-10 aryl group is more preferable, and phenyl is particularly preferable.
[0061]
　In the present specification, examples of the "hydrocarbon group" include an aliphatic hydrocarbon group, an aromatic aliphatic hydrocarbon group, a monocyclic saturated hydrocarbon group, an aromatic hydrocarbon group and the like, and specific examples thereof. For example, a monovalent group such as an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, an aryl group, an aralkyl group, and a divalent group derived from them.
[0062]
　In the present specification, the "organic group having a hydrocarbon group" means the group having the "hydrocarbon group", and the portion other than the "hydrocarbon group" in the "organic group having a hydrocarbon group" is used. It can be set arbitrarily. For example, the linker may have sites such as -O-, -S-, -COO-, -OCONH-, and -CONH-.
[0063]
　In the present specification, the "substituent" in "may be substituted" includes the above-mentioned halogen atom, alkyl group, aralkyl group, alkoxy group, acyl group, alkenyl group, alkynyl group, cycloalkyl group and aryl group. In addition, hydroxy group, nitro group, cyano group, guanidyl group, carboxy group, alkoxycarbonyl group (alkoxy part is the same as the alkoxy group), sulfo group, phospho group, alkylthio group (alkyl part is the same as the alkyl group). , Alkyl sulfinyl group (alkyl part is the same as the alkyl group), alkyl sulfonyl group (alkyl part is the same as the alkyl group), amino group, monoalkylamino group (alkyl part is the same as the alkyl group), dialkylamino group (The alkyl portion is the same as the alkyl group), an oxo group and the like are included.
[0064]
[Even if the hydroxyl group present on the 5'-hydroxyl group or the substituent of the 5'-hydroxyl group is protected by a specific protecting group and the morpholine ring nitrogen atom is protected by a temporary protecting group that can be removed under acidic conditions. Good morpholinonucleotides] For
　liquid phase synthesis by using morpholinonucleotides in which the hydroxyl groups present on the 5'-hydroxyl or 5'-hydroxyl substituents are protected with the specific protecting groups used in the present invention. A suitable method for producing a morpholino oligonucleotide can be provided.
　Above all, from the viewpoint that high efficiency and high yield can be achieved in the target method for producing a morpholino oligonucleotide, the hydroxyl group existing on the substituent of the 5'-hydroxyl group or the 5'-hydroxyl group has 10 or more and 300 or less carbon atoms. A morpholinonucleotide protected by an alkyl group and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms is preferable.
[0065]
　The case where the 5'-hydroxyl group has a substituent means that the hydrogen atom of the 5'-hydroxyl group is substituted with the substituent having a hydroxyl group. The "substituent" of the "substituent having a hydroxyl group" is not particularly limited as long as the main chain is composed of 1 to 20 atoms. Here, the "main chain" means the shortest atomic chain connecting the oxygen atom of the 5'-hydroxyl group and the oxygen atom of the hydroxyl group existing on the substituent, and the atomic chain may be further substituted. The atom constituting the main chain is selected from a carbon atom, an oxygen atom, a nitrogen atom, a sulfur atom, a phosphorus atom and the like. Specific examples of the "substituted group having a hydroxyl group" include organic groups having a hydrocarbon group such as an alkyl group, an aralkyl group, an acyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, an aryl group and an alkoxycarbonyl group. , The hydrogen atom on the hydrocarbon group is replaced with a hydroxyl group, and the like. Further, for example, the following substituent of the 5'-hydroxyl group disclosed in Pamphlet No. 2008/008113 can be mentioned.
[0066]
[Chemical 12]

[0067]
　Examples of the "alkyl group having 10 or more and 300 or less carbon atoms and / or the alkenyl group having 10 or more and 300 or less carbon atoms" include a monovalent group and a divalent group derived from the monovalent group, and among them, an alkyl group having 10 to 40 carbon atoms. Is preferable, and an alkyl group having 10 to 30 carbon atoms is particularly preferable. The alkyl group and alkenyl group of "alkyl group having 10 or more and 300 or less carbon atoms and / or alkenyl group having 10 or more and 300 or less carbon atoms" include a linear or branched alkyl group and a linear or branched alkenyl group. In the production method of the present invention, a linear alkyl group and a linear alkenyl group are preferable, and a linear alkyl group is particularly preferable. Preferred specific examples of the "alkyl group having 10 or more and 300 or less carbon atoms and / or the alkenyl group having 10 or more and 300 or less carbon atoms" include, for example, a decyl group, a dodecyl group, a tridecyl group, a myristyl group, a cetyl group and a stearyl group. Examples thereof include monovalent aliphatic hydrocarbon groups such as an oleyl group, a linoleyl group, an araquil group, a behenyl group and an isostearyl group, and a divalent group derived from them.
[0068]
　The hydroxyl group existing on the 5'-position hydroxyl group or the 5'-position hydroxyl group substituent is protected by an alkyl group having 10 or more and 300 or less carbon atoms and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms, and is morpholin. As a morpholinonucleotide in which the ring nitrogen atom may be protected by a temporary protecting group that can be removed under acidic conditions, the hydroxyl group existing on the substituent of the 5'-position hydroxyl group or the 5'-position hydroxyl group is the formula (II) :. A morpholinonucleotide protected by a protecting group represented by ZZ is preferable, and specifically, a novel compound represented by the following general formula (I) (hereinafter, may be referred to as a compound of the present invention). .) Can be mentioned.
　General formula (I):
[0069]
[Chemical 13]

[0070]
[In the formula,
m represents an arbitrary integer greater than or equal to 0,
m + 1 Base represents a nucleic acid base that may be independently protected, and
P 1 is a hydrogen atom or can be removed under acidic conditions. The
m X each has a C 1-6 alkoxy group, a di C 1-6 alkylamino group, or a 4-position nitrogen atom protected by a protective group and further substituted. A good piperadino group is indicated,
m Ws independently indicate an oxygen atom or a sulfur atom, respectively,
S 1 is a single bond, or * OS 2 ** (in the formula, * is L). The bond position is indicated, ** indicates the bond position with the 5'-position hydroxyl group, S 2 indicates the group whose main chain is represented by a spacer having 1 to 20 atoms.), And
L is a single bond. , Or formula (a1):
[0071]
[Chemical 14]

[0072]
[In the formula, * indicates the bond position with Y;
** indicates the bond position with S 1 ;
L 1 indicates a divalent C 1-22 hydrocarbon group which may be substituted. ; And
L 2 indicates C (= O), or *** N (R 3 ) -R 1- N (R 2 ) C (= O) ** (In the formula, ** is L 1 Indicates the bonding position with, where *** indicates the bonding position with Y, R 1 indicates a C 1-22 alkylene group which may be substituted , and R 2 and R 3 are independent of each other. , Hydrogen atom or optionally substituted C It may show a 1-22 alkyl group, or R 2 and R 3 may be combined to form a optionally substituted C 1-22 alkylene bond. ) Indicates a group. ] Indicates a group,
Y indicates a single bond, an oxygen atom, or NR (R indicates a hydrogen atom, an alkyl group or an aralkyl group), and
Z indicates a formula (a2) :.
[0073]
[Chemical 15]

[0074]
[In the formula, * indicates the bond position with Y;
R 4 indicates a hydrogen atom, or when R b is a group represented by the following formula (a 3), together with R 6 May form a fluorenyl group or a xanthenyl group with ring B, indicating a single bond or -O-;
k Qs independently exhibit a single bond or -O-, respectively. -S -, - OC (= O ) -, - NHC (= O) - or -NH- are shown;
k-number of R 5 is independently having 10 to 300 carbon atoms each an alkyl group and / or carbon not less than 10 300 represents an organic group having an alkenyl group;
k represents an integer of 1-4;
ring a, k-number of QR 5 in addition to, substituted further halogen atom, a halogen atom also a C 1-6 alkyl group, and a C be substituted with a halogen atom 1-6 may have a substituent group selected from the group consisting of an alkoxy group;
R a represents a hydrogen atom ;
R BIs a hydrogen atom, or formula (a3):
[0075]
[Chemical 16]

[0076]
(In the formula, * indicates the bond position;
j indicates an integer from 0 to 4;
j Q indicates the same meaning as described above;
j R 7 independently have 10 carbon atoms. Indicates an organic group having an alkyl group of not more than 300 and / or an alkoxy group having 10 or more carbon atoms and not more than 300;
R 6 indicates a hydrogen atom or forms a single bond or —O— together with R 4. As shown, a fluorenyl group or a xanthenyl group may be formed together with the ring A; and the
ring B may be further substituted with a halogen atom or a halogen atom in addition to j QR 7 C 1-6. alkyl group, and a halogen atom in the optionally substituted C 1-6 shows a group represented by which may have a substituent selected from the group consisting of an alkoxy group.), or
R a and R b together form an oxygen atom. ] Indicates a group represented by. ]
[0077]
　In the compound of the present invention, in the method for producing a morpholino oligonucleotide of the present invention described later, the 5'position hydroxyl group is activated (thio) phosphated or activated (thio) phosphoramidated, and the morpholin ring nitrogen atom is formed. Binds to p-polymerized morpholino oligonucleotides protected by a temporary protecting group that can be removed under acidic conditions (p represents any integer greater than or equal to 1) and m + 1 + p polymerized morpholino oligonucleotides (p). p represents any integer greater than or equal to 1).
　When m is 0, the compound of the present invention is interpreted as "morpholinonucleoside" and is the starting compound at the 5'position end in the morpholino oligonucleotide synthesis of the present invention. In a broad sense, the compound of the present invention also includes a compound in which the morphophosphorus ring nitrogen atom on the 3'-terminal side is unprotected (P 1 is a hydrogen atom).
[0078]
　M in the above formula (I) represents an arbitrary integer of 0 or more, and is preferably 0. The upper limit of m is not particularly limited, but is preferably 49 or less, more preferably 29 or less, and even more preferably 19 or less.
[0079]
　The m + 1 Bases in the above formula (I) represent nucleobases that may be independently protected. The "protecting nucleic acid base" means, for example, that the amino group may be protected in an adenyl group, a guanyl group, or a cytosyl group which is a nucleic acid base having an amino group, or a cyclic imide group. It means that the imide group may be protected in the timil group and the uracil group having the above, and the amino group of the nucleic acid base is protected by a protecting group capable of withstanding the deprotection condition of the morpholin ring nitrogen atom of the morpholinonucleotide. Nucleic acid bases are preferred. The "protecting group for amino group" and "protecting group for imide group" are not particularly limited, and for example, Greens Protective Groups in Organic Synthesis (Greene's PROTECIVE GROUPS in ORGANIC SYNTHESIS), No. Protecting groups described in the 4th edition, Willy-Interscience Publishing (2006), etc. can be mentioned. Specific examples of such "amino group protecting group" and "imide group protecting group" include, for example, pivaloyl group, pivalolioxymethyl group, trifluoroacetyl group, phenoxyacetyl group, 4-isopropylphenoxyacetyl group, 4 -Tert-Butylphenoxyacetyl group, acetyl group, benzoyl group, isobutyryl group, dimethylformamidinyl group, 9-fluorenylmethyloxycarbonyl group and the like can be mentioned. Among these, a phenoxyacetyl group, a 4-isopropylphenoxyacetyl group, an acetyl group, a benzoyl group, an isobutyryl group, and a dimethylformamidinyl group are preferable. Further, the carbonyl group of the nucleic acid base may be protected, for example, phenol, 2,5-dichlorophenol, 3-chlorophenol, 3,5-dichlorophenol, 2-formylphenol, 2-naphthol, 4-methoxy. Phenol, 4-chlorophenol, 2-nitrophenol, 4-nitrophenol, 4-acetylami Nophenol, pentafluorophenol, 4-pivalyloxybenzyl alcohol, 4-nitrophenethyl alcohol, 2- (methylsulfonyl) ethanol, 2- (phenylsulfonyl) ethanol, 2-cyanoethanol, 2- (trimethylsilyl) ethanol, di The carbonyl group can be protected by reacting methylcarbamic acid chloride, diethylcarbamic acid chloride, ethylphenylcarbamic acid chloride, 1-pyrrolidincarboxylic acid chloride, 4-morpholinecarboxylic acid chloride, diphenylcarbamic acid chloride and the like. Here, it may not be necessary to introduce a carbonyl group protecting group.
[0080]
　Temporary custody group P can be used as the 3 'end of the protecting groups morpholine ring nitrogen atoms of the present compounds 1 as is possible deprotected under acidic conditions, as long as it is used as a protecting group for a hydroxyl group Although not particularly limited, a trityl group, a 9- (9-phenyl) xanthenyl group, a 9-phenylthioxanthenyl group, a 1,1-bis (4-methoxyphenyl) -1-phenylmethyl group, a dimethoxytrityl group, etc. Di (C 1-6 alkoxy) trityl group, 1- (4-methoxyphenyl) -1,1-diphenylmethyl group, monomethoxytrityl group and other mono (C 1-18 alkoxy) trityl groups and the like can be mentioned. can. Among these, from the viewpoint of easy deprotection and easy availability, a trityl group, a monomethoxytrityl group, and a dimethoxytrityl group are preferable, and a trityl group and a dimethoxytrityl group are more preferable.
[0081]
　The m Xs in the above formula (I) are independently protected with a protecting group C 1-6 alkoxy group, di C 1-6 alkylamino group, or 4-position nitrogen atom, respectively, even if they are further substituted. It exhibits a good piperazino group, preferably a diC 1-6 alkylamino group.
　As the C 1-6 alkoxy group, a methoxy group and an ethoxy group are preferable, and a methoxy group is more preferable.
　As the di-C 1-6 alkylamino group, a dimethylamino group, a diethylamino group, an N-ethyl-N-methylamino group and the like are preferable, and a dimethylamino group is preferable.
[0082]
　As the protective group for the 4-position nitrogen atom of the piperazino group, an acyl group is preferable, and for example, a monofluoroacetyl group, a difluoroacetyl group, a trifluoroacetyl group, a 2-fluoropropionyl group, a 2,2-difluoropropionyl group, 3, More preferably, an acyl group having a fluoro group in the carbon chain, such as a 3,3-trifluoropropionyl group, a 2,3,3,3-tetrafluoropropionyl group, or a pentafluoropropionyl group, is preferable. The protecting group is usually deprotected after the extension reaction is completed, but the amino group of the biperadino group may be further modified with a modifying group after the deprotection according to the method described in WO2008 / 008113. .. The modifying group includes halogen atom, alkyl group, aralkyl group, alkoxy group, acyl group, alkenyl group, alkynyl group, cycloalkyl group, aryl group, hydroxy group, nitro group, cyano group, guanidyl group, carboxy group and alkoxycarbonyl. Examples thereof include a group, a sulfo group, a phospho group, an alkylthio group, an alkylsulfinyl group, an alkylsulfonyl group and the like. As the modifying group in the piperazino group, an acyl group which may be substituted is preferable, and an acyl group which may be substituted with a guanidyl group (eg, 6-guanidinohexanoyl group) is more preferable. The piperadino group may be substituted with a hydrogen atom bonded to a carbon atom of the piperazino group, and examples of the substituent include an alkyl group such as a methyl group (preferably having 1 to 3 carbon atoms) and the like.
[0083]
　The m Ws independently represent an oxygen atom or a sulfur atom, respectively, and are preferably oxygen atoms.
[0084]
　In the above formula (I), S 1 indicates a single bond or * OS 2 ** (in the formula, * indicates a bond position with L, and ** indicates a bond position with a 5'-position hydroxyl group. S 2 is a group whose main chain represents a spacer having 1 to 20 atoms.), And is preferably a single bond.
　The "spacer having a main chain having 1 to 20 atoms" represented by S 2 is formed by removing a hydroxyl group from the "substituted group having a hydroxyl group" when the 5'-hydroxyl group has a substituent. The basis of the value is mentioned.
[0085]
　Preferred embodiments of the linker L of formula (a1), wherein (a1), L 1 is an ethylene group or CH, 2 -O-1,4-phenylene-CH -O 2 shows a; and
L 2 is, C (= O) or show, or *** N (R 3 ) -R 1 -N (R 2 ) C (= O) ** (where ** is, L 1 and The bond position is indicated, *** indicates the bond position with Y, R 1 indicates a C 1-6 alkylene group, and R 2 and R 3 are independently hydrogen atoms or substituted, respectively. May show a C 1-6 alkyl group or R 2 and R 3 may be combined to form a optionally substituted C 1-6 alkylene bond. ) Is a group, which is a group.
[0086]
　Another preferred embodiment of the linker L of formula (a1), wherein (a1), L 1 is, represents an ethylene group; and
L 2 indicates a C (= O), is a group ..
[0087]
　As another preferred embodiment of the linker L represented by the above formula (a1), in the formula (a1), L 1 represents an ethylene group; and N (R 3 ) -R 1- N (in
L 2 ). R 2 ) moiety, shows a piperazinylene group, a group.
[0088]
　As yet another preferred embodiment of the linker L represented by the above formula (a1), in the formula (a1), L 1 represents an ethylene group; and
L 2 is *** N (R 3 ) -R. 1- N (R 2 ) C (= O) ** (In the formula, ** indicates the bonding position with L 1 , *** indicates the bonding position with Y, and R 1 is a pentylene group. , Or a hexylene group, and R 2 and R 3 are groups that are independently represented by a hydrogen atom or a methyl group).
[0089]
　A particularly preferred example of the linker L is a single bond or an easily available and inexpensive succinyl group.
[0090]
　Y in the above formula (I) represents a single bond, an oxygen atom, or NR (R represents a hydrogen atom, an alkyl group, or an aralkyl group).
[0091]
　In the present specification, examples of the "alkyl group" represented by R include C 1-30 alkyl groups, preferably C 1-10 alkyl groups, and more preferably C 1-6 alkyl groups. Preferable specific examples include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl and the like, and methyl and ethyl are particularly preferable.
[0092]
　In the present specification, examples of the "aralkyl group" represented by R include a C 7-30 aralkyl group, preferably a C 7-20 aralkyl group, and more preferably a C 7-16 aralkyl group (C 6-10 aryl). -C 1-6 alkyl group). Suitable specific examples include benzyl, 1-phenylethyl, 2-phenylethyl, 1-phenylpropyl, α-naphthylmethyl, 1- (α-naphthyl) ethyl, 2- (α-naphthyl) ethyl, 1- ( Examples thereof include α-naphthyl) propyl, β-naphthylmethyl, 1- (β-naphthyl) ethyl, 2- (β-naphthyl) ethyl, 1- (β-naphthyl) propyl, and benzyl is particularly preferable.
[0093]
　As R, a hydrogen atom, a C 1-6 alkyl group or a C 7-16 aralkyl group is preferable, a hydrogen atom, methyl, ethyl or benzyl is more preferable, and a hydrogen atom is particularly preferable.
[0094]
　As Y, a single bond, an oxygen atom or NH is preferable.
[0095]
　A preferred embodiment of Z is a group represented by the formula (a2).
[0096]
　The preferred embodiment of Z in the above formula (I), that is, the group represented by the formula (a2) of Z in the above formula (I) is a specific benzyl group (in the formula (a2), both Ra and R b are both. A hydrogen atom and R 4 is a hydrogen atom); a specific benzoyl group (in formula (a2), Ra and R b together form an oxygen atom, and R 4 is a hydrogen atom. ); in particular diphenylmethyl group (formula (a2), R a is a hydrogen atom, R 4 is hydrogen atom, k is 1-3, and R b has the formula (a3) (wherein, R 6 is a hydrogen atom and j is a group represented by 0 or 1); in a specific fluorenyl group (in formula (a2), Ra is a hydrogen atom and k is 1). , R b is the group represented by the formula (a3) ​​(where j is 0 in the formula), and R 6 shows a single bond together with R 4, and the fluorene ring is formed together with the ring A. To form); a specific xanthenyl group (in formula (a2), RaThere is a hydrogen atom, k is 1, R b has the formula (a3) is a group represented by (. Wherein, j is 0), and R 6 is R 4 together with the - Shows O- and forms a xanthine ring with ring A).
[0097]
　In the k QR 5 groups in the above formula (a2) and the j QR 7 groups in the formula (a3) , Q is either a single bond or -O-, -S-, -OC ( = O)-, -NHC (= O)-or -NH-, preferably -O-. The k QR 5 units and the j QR 7 units may be the same or different, respectively.
[0098]
　In the above formula (a2), " Ra and R b together form an oxygen atom" means that Ra and R b together form a carbonyl group (C (= O)). Means to do.
[0099]
　The "organic group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms" represented as R 5 or R 7 has 10 or more and 300 or less carbon atoms in its molecular structure. It is a monovalent organic group having an alkyl group and / or an alkenyl group having 10 or more and 300 or less carbon atoms.
[0100]
　"Alkyl group having 10 or more and 300 or less carbon atoms and / or an organic group having an alkenyl group having 10 or more and 300 or less carbon atoms" and / or an alkenyl group having 10 or more and 300 or less carbon atoms The carbon number of "" is preferably 14 to 40, and more preferably 14 to 30.
　"Alkyl group having 10 or more and 300 or less carbon atoms and / or an organic group having an alkenyl group having 10 or more and 300 or less carbon atoms" and / or an alkenyl group having 10 or more and 300 or less carbon atoms The site of "" is not particularly limited, and may be present at the terminal (monovalent group) or at other sites (for example, a divalent group).
[0101]
　Examples of the "alkyl group having 10 or more and 300 or less carbon atoms and / or the alkenyl group having 10 or more and 300 or less carbon atoms" include a monovalent group and a divalent group derived from the monovalent group, and among them, an alkyl group having 14 to 40 carbon atoms. Is preferable, and an alkyl group having 14 to 30 carbon atoms is particularly preferable. Specific examples of the "alkyl group having 10 or more and 300 or less carbon atoms and / or the alkenyl group having 10 or more and 300 or less carbon atoms" include a decyl group, a dodecyl group, a tridecyl group, a myristyl group, a cetyl group, a stearyl group and an oleyl group. Monovalent linear aliphatic hydrocarbon group such as group, linolyl group, araquil group, behenyl group, 3,7,11,15-tetramethylhexadecyl group, 3,7,11-trimethyldodecyl group, 2,2 , 4,8,10,10-Hexamethyl-5-dodecanoyl groups and other monovalent branched aliphatic hydrocarbon groups, and divalent groups derived from them can be mentioned.
[0102]
　"Alkyl group having 10 or more and 300 or less carbon atoms and / or an organic group having an alkenyl group having 10 or more and 300 or less carbon atoms" and / or alkenyl having 10 or more and 300 or less carbon atoms Parts other than the "group" can be set arbitrarily. For example, the linker may have sites such as -O-, -S-, -COO-, -OCONH-, and -CONH-, and a hydrocarbon group (monovalent group or divalent group). Examples of such "hydrocarbon groups" include aliphatic hydrocarbon groups, aromatic aliphatic hydrocarbon groups, monocyclic saturated hydrocarbon groups and aromatic hydrocarbon groups. Specific examples thereof include alkyl. A monovalent group such as a group, an alkenyl group, an alkynyl group, a cycloalkyl group, an aryl group or an aralkyl group and a divalent group derived from them are used. Examples of the "alkyl group", "alkenyl group", "alkynyl group", "cycloalkyl group", "aryl group", or "aralkyl group" at a site other than the "aliphatic hydrocarbon group" are as described above. The same can be mentioned. The "hydrocarbon group" is selected from halogen atoms (chlorine atom, bromine atom, fluorine atom, iodine atom), C 1-6 alkyl group which may be substituted with one or more halogen atoms , oxo group and the like. It may be substituted with a substituent.
[0103]
　An " alkyl group having 10 or more and 300 or less carbon atoms and / or an alkyl group having 10 or more carbon atoms and / or 300 carbon atoms" represented as "R 5 (group)" and / or "R 7 (group)" constituting Z in the general formula (I). The "organic group having the following alkenyl group" may have a plurality of "alkyl groups having 10 or more and 300 or less carbon atoms and / or alkenyl groups having 10 or more and 300 or less carbon atoms" by branching or the like. In "an alkyl group having 10 or more and 300 or less carbon atoms and / or an organic group having an alkenyl group having 10 or more and 300 or less carbon atoms", "an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl having 10 or more and 300 or less carbon atoms" When there are a plurality of "groups", each of them may be the same or different.
[0104]
　An " alkyl group having 10 or more and 300 or less carbon atoms and / or an alkyl group having 10 or more carbon atoms and / or 300 carbon atoms" represented as "R 5 (group)" and / or "R 7 (group)" constituting Z in the general formula (I). The lower limit of the total number of carbon atoms in the "organic group having the following alkenyl group" is preferably 10 or more, more preferably 12 or more, further preferably 14 or more, further preferably 18 or more, and particularly preferably 30 or more. On the other hand, in the " alkyl group having 10 or more and 300 or less carbon atoms and / or the organic group having an alkenyl group having 10 or more and 300 or less carbon atoms" represented as "R 5 (group)" and / or "R 7 (group)". The upper limit of the total number of carbon atoms is preferably 200 or less, more preferably 150 or less, further preferably 120 or less, further preferably 100 or less, particularly preferably 80 or less, and particularly preferably 60 or less. The larger the number of carbon atoms, the better the crystallinity or solubility of the compound of the present invention in the polar solvent even when the morpholino oligonucleotide has a long chain.
[0105]
　Preferred embodiments of Z represented by the above formula (a2), wherein
(a2), R a and R b are both a hydrogen
atom; R 4 represents a hydrogen atom,
k-number of Q is is -O-,
k-number of R 5 is independently each an organic group having an alkyl group and / or the number 10 to 300. alkenyl group having a carbon number of 10 to 300 carbon atoms (e.g., C 10-40 alkyl Group); and
k is a group indicating an integer of 1 to 3.
[0106]
　Another preferred embodiment of Z represented by the above formula (a2), wherein (a2),
k represents an integer of 1 ~
3; R a and R b are both a hydrogen
atom; R 4 It represents a hydrogen atom;
k number of Q is -O-,
k-number of R 5 is independently having 10 to 300 carbon atoms each an alkyl group and / or 300 an alkenyl having 10 or more carbon atoms Shows a benzyl group having 1 to 3 groups, or an alkyl group having 10 or more and 300 or less carbon atoms and / or a cyclohexyl group having 1 to 3 alkenyl groups having 10 or more and 300 or less carbon atoms; and
k rings A. QR of 5 in addition to further halogen atoms, optionally substituted by a halogen atom C 1-6 alkyl group, and a C be substituted with halogen atoms 1-6 is selected from the group consisting of an alkoxy group It is a group which may have a substituent.
[0107]
　Another preferred embodiment of Z represented by the above formula (a2), wherein
(a2), R a represents a hydrogen
atom; R b is, the formula (a3) (wherein, * is bonding position ; J indicates an integer from 0 to 3; j Q indicates -O-; j R 7 independently indicates C 10-40 alkyl groups, respectively ;
R 4 and R 6 Is a group, which is a group represented by ().
[0108]
　Yet another preferred embodiment of Z represented by the above formula (a2), wherein
(a2), R a represents a hydrogen
atom; R b is, the formula (a3) (wherein, * is a bond position indicates; j represents an integer of 0 ~ 3; j-number of Q is a -O-; j-number of R 7 are each independently C 10-40 represents an alkyl
group; R 6 is A group, which is a group represented by a fluorenyl group or a xanthenyl group together with R 4 of ring A to form a single bond or —O—. Is.
[0109]
　Another preferred embodiment of Z represented by the above formula (a2), wherein
(a2), R a and R b are an oxygen atom together
form; R 4 represents a hydrogen atom,
the k Q is -O-,
the k R 5 are independently each an organic group having an alkyl group and / or the number 10 to 300. alkenyl group having a carbon number of 10 to 300 carbon atoms (e.g. , C 10-40 alkyl group); and
k is a group indicating an integer of 1 to 3.
[0110]
　Another preferred embodiment of Z represented by the above formula (a2), wherein (a2),
k represents an integer of 1 ~
3; R a and R b are, form an oxygen atom together
teeth; R 4 represents a hydrogen atom;
k number of Q is -O-,
k-number of R 5 is an alkyl group independently having 10 to 300 carbon atoms and / or 10 or more carbon atoms Shows a benzyl group having 1 to 3 alkenyl groups of 300 or less, or an alkyl group having 10 or more and 300 or less carbon atoms and / or a cyclohexyl group having 1 to 3 alkenyl groups having 10 or more and 300 or less carbon atoms; and
ring A. but, k-number of QR 5 in addition to further halogen atom, a C substituted with halogen atom 1-6 alkyl group, and a C be substituted with a halogen atom 1-6 group consisting alkoxy group It is a group which may have a substituent selected from.
[0111]
　Formula (II): The Z-Y-L-protecting group represented, protecting group P morpholine ring nitrogen atom of the 3 'end 1 hardly cleaved under acidic conditions that can remove the basic conditions Groups cleaved with are preferred.
　As a typical example of such a protecting group, for example, L is a group represented by the above formula (a1) (preferably a succinyl group or the like), and
ZZ is the following group. Can be mentioned.
3,4,5-tri (octadecyloxy) benzyloxy group,
3,5-di (docosyloxy) benzyloxy group,
3,5-bis [3', 4', 5'-tri (octadecyloxy) benzyloxy] Benzyloxy group,
3,4,5-tris [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzyloxy group,
3,4,5-tri (octadecyloxy) benzylamino group,
2, 4-Di (docosyloxy) benzylamino group,
3,5-di (docosyloxy) benzylamino group,
di (4 -docosyloxyphenyl) methylamino group,
4-methoxy-2- [3', 4', 5' -Tri (octadecyloxy) benzyloxy] benzylamino group,
4-methoxy-2- [3', 4', 5'-tri (octadecyloxy) cyclohexylmethyloxy] benzylamino group,
2,4-di (dodecyloxy) ) Benzylamino group,
Phenyl (2,3,4-tri (octadecyloxy) phenyl) methylamino group,
di [4- (12-docosyloxide decyloxy) phenyl] methylamino group,
3,5-bis [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino group, or
3,4,5-tris [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino group.
[0112]
　Further, as another embodiment of the protecting group ZZ, the following benzyl succinyl group or diphenylmethyl succinyl group can be mentioned.
2- {2,4-di (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
3,5-di (2', 3'-dihydrophytyloxy) benzylsuccinyl group;
4 -(2', 3'-dihydrophytyloxy) benzyl succinyl group;
2- {1-[(2-chloro-5- (2', 3'-dihydrophytyloxy) phenyl)] benzylaminocarbonyl} ethyl Carbonyl group;
3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl succinyl group;
2- {3,4,5-tri (2', 3'-dihydrophytyloxy) benzylamino Carbonyl} ethylcarbonyl group;
2-{4- (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2-{2- [3', 4', 5'-tri (2') ', 3''-dihydrophytyloxy) benzyloxy] -4-methoxybenzylaminocarbonyl} ethylcarbonyl group;
2- {4- (2', 3'-dihydrophytyloxy) -2-methoxybenzylaminocarbonyl } Ethylcarbonyl group;
4- (2', 3'-dihydrophytyloxy) -2-methylbenzyl succinyl group;
2- {4- (2', 3'-dihydrophytyloxy) -2-methylbenzylamino Carbonyl} ethylcarbonyl group;
4- [2,2,4,8,10,10-hexamethyl-5-dodecanoylamino] benzyl succinyl group;
2- {4- [2,2,4,8,10,10-hexamethyl-5-dodeca Noylamino] benzylaminocarbonyl} ethylcarbonyl group;
4- (3,7,11-trimethyldodecyloxy) benzylsuccinyl group;
2- {4- (3,7,11-trimethyldodecyloxy) benzylaminocarbonyl} ethylcarbonyl Group;
2- {3,5-di (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {1- [2,3,4-tri (2', 3'-) Dihydrophytyloxy) phenyl] benzylaminocarbonyl} ethylcarbonyl group;
2- {1- [4- (2', 3'-dihydrophytyloxy) phenyl] -4'-(2', 3'-dihydrofi) Thiruoxy) benzylaminocarbonyl} ethylcarbonyl group;
3,4,5-tris [3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl] benzyl succinyl group; and
2- {3, 4,5-Tris [3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl] benzylaminocarbonyl} ethylcarbonyl group.
[0113]
　Formula (II): Another preferred embodiment of the Z-Y-L-protecting group represented,
L and Y is a single bond,
Z is The equation
(a2), R a and R b Together they form an oxygen atom;
R 4 represents a hydrogen atom,
k Q is -O-, and
k R 5 are independently 10 or more and 300 or less carbon atoms, respectively. An organic group having an alkyl group and / or an alkenyl group having 10 or more and 300 or less carbon atoms (for example, C 10-40 alkyl group); and
k is a group indicating an integer of 1 to 3.
[0114]
　Formula (II): Another preferred embodiment of the Z-Y-L-protecting group represented,
L is The equation
(a1), L 2 is, *** N (R 3 ) -R 1 -N (R 2 ) C (= O) ** (In the formula, ** indicates the bonding position with L 1 , *** indicates the bonding position with Y, and R 1 is substituted. May indicate a C 1-22 alkylene group, where R 2 and R 3 each independently represent a hydrogen atom or an optionally substituted C 1-22 alkyl group, or R 2 and R 3 may be Together, they may form a C 1-22 alkylene bond that may be substituted .)
Y is a single bond,
Z is The equation
(a2), R a and R b are, to form an oxygen atom
together; R 4 is a hydrogen atom,
k-number of Q is, is -O-,
k-number of R 5 is independently each an organic group having an alkyl group and / or 300 an alkenyl group having 10 or more carbon atoms having 10 to 300 carbon atoms (e.g., C 10-40 alkyl Group); and
k is a group indicating an integer of 1 to 3.
[0115]
　As a preferred embodiment of the compound of the present invention represented by the general formula (I), in the general formula (I),
m is 0, and the
base may be protected, respectively, as a cytosyl group, a uracil group, or a timinyl group. , Adenyl group, or guanyl group;
P 1 is a trityl group, di (C 1-6 alkoxy) trityl group, or mono (C 1-6 alkoxy) trityl group;
S 1 is a single bond. And
ZZ is a
compound similar to the combination of each group shown as a preferred embodiment in the general formula (I) .
[0116]
　Another preferred embodiment of the compound of the present invention represented by the general formula (I)
is
a cytosyl group and a uracil group in which m is 0 and Base may be protected, respectively , in the general formula (I). , thyminyl group, adenyl group or be a guanyl
group,; P 1 is a trityl group, a dimethoxytrityl group or be a monomethoxytrityl
group,; S 1 is a single bond; and
Z-Y-L-is, It is a
compound similar to the combination of each group shown as a preferable embodiment in the general formula (I) .
[0117]
　As yet another preferable embodiment of the compound of the present invention represented by the general formula (I), in the general formula (I),
m is 0 and the
base may be protected, respectively, of a citosyl group and a uracil. A group, a timinyl group, an adenyl group, or a guanyl group;
P 1 is a trityl group;
S 1 is a single bond; and
ZZ is a preferred embodiment in the general formula (I). It is a
compound similar to the combination of each group shown as .
[0118]
[Method for producing the compound of the present invention] As a method for producing the compound of the present invention represented by the general formula (I) (hereinafter, referred to as "general formula (Ia)") in which
　m is 0 and S 1 is a single bond. Is not particularly limited, but can be produced from the precursor of the above-mentioned protective group according to a method known per se or a method similar thereto (Richard T. Pon et al., Nucleic Acids Research 2004, 32, 623-631.). can.
　A general method for producing a compound in which L in the general formula (Ia) is a succinyl group is shown below.
[0119]
[Chemical 17]

[0120]
(Wherein each symbol is as defined above.) 3
　'end morpholine ring nitrogen atom protecting group P 1 morpholino nucleoside protected by (a), the presence of a base, reacted with succinic anhydride As a result, the compound (b) in which succinic acid is introduced into the 5'-hydroxyl group is obtained. The compound represented by the general formula (Ia) can be obtained by dehydrating and condensing the compound (b) with the precursor (ZHYH) (alcohol or amine) of the protecting group in the presence of a condensing agent.
[0121]
　It is advantageous that the conversion step of the morpholinonucleoside (a) to the compound (b) is carried out in a solvent inert to the reaction. Such a solvent is not particularly limited as long as the reaction proceeds, but is a halogenated hydrocarbon solvent such as dichloromethane, 1,2-dichloroethane, chloroform, carbon tetrachloride, and an aromatic hydrocarbon solvent such as benzene, toluene, and xylene. A solvent, an aliphatic hydrocarbon solvent such as pentane, hexane, heptane, or octane, an ether solvent such as diethyl ether, tetrahydrofuran, or cyclopentyl methyl ether, or a mixed solvent thereof is preferable. Of these, dichloromethane or chloroform is particularly preferable.
[0122]
　The base is not particularly limited, and examples thereof include organic bases as described later, preferably N, N-dimethylaminopyridine, triethylamine and the like.
[0123]
　It is advantageous that the dehydration condensation step is carried out in a solvent inert to the reaction. Such a solvent is not particularly limited as long as the reaction proceeds, but is a halogenated hydrocarbon solvent such as dichloromethane, 1,2-dichloroethane, chloroform, carbon tetrachloride, and an aromatic hydrocarbon solvent such as benzene, toluene, and xylene. A solvent, an aliphatic hydrocarbon solvent such as pentane, hexane, heptane, or octane, or a mixed solvent thereof is preferable. Of these, dichloromethane and chloroform are particularly preferable.
[0124]
　Examples of the condensing agent used in the condensation reaction between compound (b) and ZZ include dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC), N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide and The hydrochloride (EDC / HCl), hexafluorophosphate (benzotriazole-1-yloxy) tripyrrolidinophosphonium (PyBop), O- (benzotriazole-1-yl) -N, N, N', N'- Tetramethyluronium Tetrafluoroborate (TBTU), 1- [bis (dimethylamino) methylene] -5-chloro-1H-benzotriazolium-3-oxide hexafluorophosphate (HCTU), O-benzotriazole-N, Examples thereof include N, N', N'-tetramethyluronium hexafluorophosphate (HBTU) and the like. Of these, HBTU, HCTU, N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide and its hydrochloride (EDC / HCl) are preferable.
[0125]
　The amount of the condensing agent used can be 1 to 10 mol, preferably 1 to 5 mol, with respect to 1 mol of compound (b). The amount of ZZ used can be 1 to 10 mol, preferably 1 to 5 mol, per 1 mol of compound (b). The reaction temperature is not particularly limited as long as the reaction proceeds, but is preferably −10 ° C. to 50 ° C., more preferably 0 ° C. to 30 ° C. The reaction time is 30 minutes to 70 hours.
[0126]
　For compounds in which L in the general formula (Ia) is other than the succinyl group, the corresponding acid anhydride, the corresponding dicarboxylic acid halide, the corresponding active ester of the dicarboxylic acid and the like can be used instead of the succinic acid anhydride in the above production method. It can be produced by carrying out the same reaction using.
　S 1 is, * O-S 2 ** (wherein each symbol is. Which are of the same meaning) for compounds when it is a known method (for example, the method described in WO2008 / 008,113) in accordance with After introducing the "substituted group having a hydroxyl group" into the 5'-hydroxyl group of the morpholinonucleoside (a), it can be produced according to the above method.
　Further, for the compound in which Y is a single bond, an activating derivative of ZZ (halide, acid halide, activated carboxyl group, etc.) is subjected to a morpholinonucleoside (a) according to a method known per se. ), Or by reacting ZZ with morpholinonucleoside (a) in the presence of a condensing agent. The condensation reaction between ZZ and the morpholinonucleoside (a) can be carried out in the same manner as the condensation reaction between ZZ and compound (b).
　For the compound represented by the general formula (I) in which m is 1 or more, the compound represented by the general formula (Ia) is used as a starting material, and the 5'end extension process is repeated according to the following production method of the present invention. It can be manufactured by.
[0127]
　The method for producing the precursor (ZYH) (alcohol, amine or carboxylic acid) of the protecting group is not particularly limited, but is a method known per se (for example, Bull. Chem. Soc. Jpn. 2001, 74). , 733-738, Japanese Patent Application Laid-Open No. 2000-44493, International Publication No. 2006/10416 Pamphlet, International Publication No. 2007/034812 Pamphlet, International Publication No. 2007/122847 Pamphlet, International Publication No. 2010/1133939 Pamphlet, Special It can be produced from a raw material compound according to (see Kai 2010-275254, International Publication No. 2012/157723, etc.) or a method similar thereto.
　The compound used as the raw material compound, for example, the halide corresponding to R 5 and R 7 constituting Z in the general formula (I), is available as a commercially available product, or is a method known per se. Alternatively, it can be manufactured according to a method similar to these.
　Further, the precursor (ZHY) of the protecting group can be produced according to a method known per se or a method similar thereto, as described above, but a substituent (for example, a substituent) in which the raw material compound affects the reaction. , Hydroxyl group, amino group, carboxy group), it is common to carry out the reaction after protecting the raw material compound with an appropriate protecting group according to a known method in advance. After the reaction, such protecting groups can be removed according to known methods such as acid treatment, alkali treatment, and catalytic reduction.
[0128]
　3 'end morpholine ring nitrogen atom protecting group P 1 as the manufacturing method morpholino nucleoside protected by (a) is not particularly limited, a method known per se (see, for example, WO91 / 09033A1) or equivalent thereto It can be prepared from morpholinonucleoside (1) according to the method.
　For example, when P 1 is a trityl group, the compound (a) can be obtained by reacting the morpholinonucleoside (1) with trityl chloride in the presence of a base such as triethylamine.
　Further , the compound (a) in which P 1 is a hydrogen atom can be obtained by subjecting the compound (a) in which P 1 is a temporary protecting group to the deprotection step (1) described later.
[0129]
[Production Method
　of the Present Invention ] Next, a method for producing a morpholino oligonucleotide according to the present invention (hereinafter, also referred to as "the production method of the present invention") will be described. Specifically, a method for producing an appropriately protected n + p polymerized morpholino oligonucleotide from an appropriately protected n-polymerized morpholino oligonucleotide will be described. For example, in the case of n = 1, a method for producing the appropriately protected n + p polymerized morpholino oligonucleotide will be described. The n-polymerized morpholino oligonucleotide is interpreted as "morpholinonucleoside", and when p = 1, the p-polymerized morpholinonucleotide is interpreted as "morpholinonucleoside", and n + p-polymerized morpholinooligodo. Nucleotides should be understood as "morpholinodinucleotides".
　The production method of the present invention preferably contains the following step (2).
[0130]
(2) The 5'-hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidated, and the morpholine ring nitrogen atom is protected by a temporary protecting group that can be removed under acidic conditions. Individually polymerized morpholino oligonucleotide (p represents an arbitrary integer of 1 or more) (hereinafter, may be simply referred to as "activated morpholinonucleotide"), the 5'-position hydroxyl group or the 5'-position hydroxyl group is a hydroxyl group. When the substituent has a substituent, the hydroxyl group existing on the substituent is protected by an alkyl group having 10 or more and 300 or less carbon atoms and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms, and a morpholine ring. N-polymerized morpholino oligonucleotides with unprotected nitrogen atoms (n represents any integer greater than or equal to 1) and (thio) phosphoramidat bonds or (thio) phosphoramidate bonds via the morpholin ring nitrogen atom. ) A step of condensing with a phosphorodiamidate bond to obtain n + p polymerized morpholino oligonucleotides.
　The upper limit of n is not particularly limited, but is preferably 50 or less, more preferably 30 or less, and even more preferably 20 or less.
　The upper limit of p is not particularly limited, but is preferably 50 or less, more preferably 30 or less, further preferably 20 or less, further preferably 5 or less, and particularly preferably 3 or less.
[0131]
　The production method of the present invention preferably further contains the following step (1), and the hydroxyl group existing on the 5'-hydroxyl group or the 5'-hydroxyl group substituent used in the step (2) has 10 carbon atoms. N polymerized morpholino oligonucleotides are prepared, which are protected by a protecting group having an alkyl group of 300 or more and / or an alkenyl group having 10 or more carbon atoms and / or an alkenyl group having 10 or more carbon atoms and not protected by a morpholine ring nitrogen atom.
(1) Prior to the condensation step (2), the hydroxyl group existing on the 5'-position hydroxyl group or the 5'-position hydroxyl group in a non-polar solvent has an alkyl group having 10 or more and 300 or less carbon atoms and / or a carbon number of carbon atoms. N polymerized morpholino oligonucleotides protected with a protecting group having 10 or more and 300 or less alkenyl groups and protected with a temporary protecting group in which the morpholine ring nitrogen atom can be removed under acidic conditions are reacted with an acid. The step of removing the temporary protecting group of the morpholine ring nitrogen atom.
　The step (1) preferably further comprises a step of removing the temporary protecting group of the morpholine ring nitrogen atom and then neutralizing it with an organic base. As a result, steps (1) and (2) can be continuously performed in the liquid, and morpholino oligonucleotides in which morpholinonucleotides are extended can be continuously performed.
[0132]
　Protection in which the hydroxyl group existing on the 5'-position hydroxyl group or the 5'-position hydroxyl group substituent of the n-polymerized morpholino oligonucleotide has an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms. By being protected by a group, the lipophilicity of the obtained n + p polymerized morpholino oligonucleotide is improved. For example, by incorporating the following step (3), excess raw materials and by-products can be easily and effectively removed. Then, n + p polymerized morpholino oligonucleotides can be purified.
(3) A step of adding a polar solvent to the reaction solution obtained in the steps (1) and / or (2) to precipitate n + p polymerized morpholino oligonucleotides, and obtaining the reaction solution by solid-liquid separation.
　As shown in the following (A) to (C), the step (3) may be carried out with both the reaction solutions of the steps (1) and (2), or the reaction solutions of the steps (1) and (2). You may do it with only one of them.
(A) Process (1) → Process (3) → Process (2) → Process (3)
(B) Process (1) → Process (2) → Process (3)
(C) Process (1) → Process (3) ) → Process (2)
[0133]
　A protecting group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms is preferably given by the formula (II) ZYL- (in the formula, each symbol is described above. In that case, the above step (3) can be performed more efficiently.
[0134]
　If the amount of by-products generated can be controlled by controlling the equivalent of the raw materials and controlling the reaction, it is preferable to repeat the steps (1) and (2) as the basic unit and include the step (3).
　In addition, from the viewpoint that by-product development can be strictly controlled and controlled and can lead to high-purity morpholino oligonucleotides, any of the above (A) to (C) including steps (1) to (3) is basic. It is preferable to repeat as a unit.
[0135]
　The morpholino oligonucleotide can be isolated and produced by further incorporating the step (4) in the production method of the present invention.
(4) A step of removing all protecting groups of the obtained n + p polymerized morpholino oligonucleotides.
　Each step will be described in detail below.
[0136]
1. 1. Description of "n-Polymerized Morphorino oligonucleotides"
　First, the n-polymerized morpholino oligonucleotides used as raw materials in steps (1) and (2) will be described.
　In the n-polymerized morpholino oligonucleotide used in the step (1), for example, the hydroxyl group existing on the substituent of the 5'-position hydroxyl group or the 5'-position hydroxyl group as shown in the following general formula (i) is carbon. N Protected with a protecting group having an alkyl group of several tens or more and 300 or less and / or an alkenyl group having 10 or more and 300 or less carbon atoms, and a temporary protecting group in which the morpholine ring nitrogen atom can be removed under acidic conditions. The n-polymerized morpholino oligonucleotides showing the individually polymerized morpholino oligonucleotides and used in the step (2) are, for example, 5'-position hydroxyl groups or 5'-position hydroxyl groups as shown in the following general formula (ii). N hydroxyl groups existing on the substituent are protected by an alkyl group having 10 or more and 300 or less carbon atoms and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms, and the morpholine ring nitrogen atom is not protected. The polymerized morpholino oligonucleotide is shown.
[0137]
[Chemical 18]

[0138]
(Wherein,
m represents zero or any integer corresponding to
n-1, P 1 ' represents a temporary protecting group which can be removed under acidic
conditions, P 2 is 10 to 300 carbon atoms Indicates a protecting group having an alkyl group and / or an alkenyl group having 10 or more and 300 or less carbon atoms, and
other symbols are synonymous with each definition in the formula (I).
[0139]
　Each symbol in the general formulas (i) and (ii) will be described below.
　The upper limit of m is not particularly limited, but is usually 99 or less, preferably 74 or less, more preferably 49 or less, still more preferably 29 or less.
[0140]
　Formula (i) P in 1 ' as a temporary protecting group which can be removed under acidic conditions represented by a can deprotected under acidic conditions, as long as it is used as a protecting group for a hydroxyl group, particularly Di, but not limited to, trityl group, 9- (9-phenyl) xanthenyl group, 9-phenylthioxanthenyl group, 1,1-bis (4-methoxyphenyl) -1-phenylmethyl group, dimethoxytrityl group and the like. Examples thereof include a mono (C 1-18 alkoxy) trityl group such as a (C 1-6 alkoxy) trityl group, a 1- (4-methoxyphenyl) -1,1-diphenylmethyl group, and a monomethoxytrityl group . Among these, from the viewpoint of easy deprotection and easy availability, a trityl group, a monomethoxytrityl group, and a dimethoxytrityl group are preferable, and a trityl group and a dimethoxytrityl group are more preferable.
[0141]
　Formula (i) and P in (ii) 2 "Protecting group having an alkyl group and / or the number 10 to 300. alkenyl group of carbon atoms of 10 to 300 carbon atoms" represented by the 3 'end Morpho A morpholino oligonucleotide that is stable under acidic conditions and can remove the protecting group of the phosphorus ring nitrogen atom, and is polymerized in n non-polar solvents so that the reaction proceeds in steps (1) and (2). The group is not particularly limited as long as it can dissolve the group, but a group represented by the following general formula (II) is preferable.
[0142]
[Chemical 19]

[0143]
[In the formula, each symbol has the same meaning as described above. ] As
　a protecting group for the hydroxyl group existing on the 5'-position hydroxyl group or the 5'-position hydroxyl group substituent, a protecting group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms. Preferably, the group represented by the formula (II) is used to improve the lipophilicity of the n-polymerized morpholino oligonucleotide and the n + p-polymerized morpholino oligonucleotide, and the solubility in a solvent (particularly, a non-polar solvent). It is possible to smoothly carry out steps (1) and (2), and as in step (3) described later, n-polymerized morpholino oligonucleotides or n + p-polymerized morpholino oligonucleotides can be easily used. Can be isolated and purified.
　Preferred embodiments of L, Y and Z in formula (II) are similar to L, Y and Z in formula (I).
[0144]
2. Description of "p-Polymerized Morphorino oligonucleotide"
　First, the p-polymerized morpholino oligonucleotide used as a raw material in step (2) will be described.
　Temporary protection used in step (2), where the "5'-hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidated and the morpholine ring nitrogen atom can be removed under acidic conditions. The group-protected p-polymerized morpholino oligonucleotide (p represents any integer of 1 or more) ”is not particularly limited as long as the structural requirements are satisfied.
[0145]
　"The 5'-hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidated" means that the morpholino oligonucleotide 5'-hydroxyl group is, for example, the following formula (c):
[0146]
[Chemical 20]

[0147]
(In the formula,
* indicates the position to be attached to the 5'terminal hydroxyl group of the morpholino oligonucleotide,
L 1 indicates the leaving group,
X is the C 1-6 alkoxy group, and the di C 1-6 alkylamino. The group, or 4-position nitrogen atom, is protected by a protecting group and indicates a piperadino group which may be further substituted, and
W is
modified with a group represented by an oxygen atom or a sulfur atom.) means.
[0148]
　“Activated phosphate” means the case where X is a C 1-6 alkoxy group and W is an oxygen atom in the above formula .
　“Activated thiophosphated” means the case where X is a C 1-6 alkoxy group and W is a sulfur atom in the above formula .
　"Activated phosphoramidated" is a piperazino group in which X is a diC 1-6 alkylamino group or a nitrogen atom at the 4-position protected by a protecting group and may be further substituted in the above formula . And it means that W is an oxygen atom.
　"Activated thiophosphoruamidatation" is a piperazino group in which X is a diC 1-6 alkylamino group or a nitrogen atom at the 4-position is protected by a protecting group and may be further substituted in the above formula . , And W is a sulfur atom.
[0149]
Examples of the leaving group represented by 　L 1 include a halogen atom, a methanesulfonyloxy group, a p-toluenesulfonyloxy group and the like, and a chlorine atom is preferable.
　The definitions, examples, and preferred embodiments of X and W are as described in the above formula (I).
　Definitions, examples, and preferred embodiments of "temporary protecting groups that can be removed under acidic conditions" are as described in formula (I) above.
[0150]
　Preferred p-polymerized morpholino oligonucleotides used in step (2) include compounds represented by the general formula (iii).
[0151]
[Chemical 21]

[0152]
(In the formula,
q represents any integer greater than or equal to 0 corresponding to p-1,
P 1 ″ represents a temporary protecting group that can be removed under acidic conditions, and the
other symbols represent formula (I). And each definition in formula (c).)
[0153]
　As q in the general formula (iii), 0 is preferable. The upper limit of q is not particularly limited, but is usually 99 or less, preferably 74 or less, more preferably 49 or less, still more preferably 29 or less.
[0154]
　The temporary protecting group represented by P 1 ″ in the general formula (iii) can be removed under acidic conditions as long as it can be deprotected under acidic conditions and is used as a protecting group for a hydroxyl group. Although not particularly limited, a trityl group, a 9- (9-phenyl) xanthenyl group, a 9-phenylthioxanthenyl group, a 1,1-bis (4-methoxyphenyl) -1-phenylmethyl group, a dimethoxytrityl group, etc. Examples thereof include a mono (C 1-18 alkoxy) trityl group such as a di (C 1-6 alkoxy) trityl group, a 1- (4-methoxyphenyl) -1,1-diphenylmethyl group, and a monomethoxytrityl group. .. Among these, from the viewpoint of easy deprotection and easy availability, a trityl group, a monomethoxytrityl group, and a dimethoxytrityl group are preferable, and a trityl group and a dimethoxytrityl group are more preferable.
[0155]
　Preferred embodiments of the other symbols in the general formula (iii) are as described in the above formulas (I) and (c).
[0156]
　The p-polymerized morpholino oligonucleotide of the present invention can be prepared according to a method known per se (for example, the method described in WO91 / 09033A1) or a method similar thereto. For example, L 1 compound is a chlorine atom, the general formula (iii) in the 5 'position hydroxyl group is not activated the following formula (iii' compounds), for example, the general formula (d): Cl 2 P ( = W) (X) (wherein W and X are synonymous with the above), it can be produced by reacting with dichloromethane (thio) phosphate or dichloromethane (thio) phosphoramidate.
[0157]
[Chemical 22]

[0158]
　As the dichloro (thio) phosphate or dichloro (thio) phosphoramidate represented by the general formula (d), a commercially available product can be used, or a known method (for example, WO91 / 09033 or WO2008 /) can be used. It can be produced by the method described in (008113, etc.) or a method similar thereto.
　The compound of the general formula (iii') can be prepared by a known method such as, for example, International Publication No. 91/09033 pamphlet.
[0159]
3. 3. Description
　of Steps (1) to (4) Hereinafter, steps (1) to (4) will be described with reference to the formulas (i), (ii), (iii) and the like for convenience, but the present invention is limited thereto. It's not a thing.
[0160]
Step (1) (Deprotecting Step) In
　this step, before the condensation step (2), the hydroxyl group existing on the substituent of the 5'-position hydroxyl group or the 5'-position hydroxyl group has 10 or more carbon atoms in the non-polar solvent. N polymerized morpho protected by a protecting group having an alkyl group of 300 or less and / or an alkenyl group having 10 or more and 300 or less carbon atoms and a temporary protecting group in which the morpholine ring nitrogen atom can be removed under acidic conditions. The linoligonucleotide (i) is reacted with an acid to remove the temporary protecting group of the morpholine ring nitrogen atom, and the hydroxyl group existing on the substituent of the 5'-position hydroxyl group or the 5'-position hydroxyl group has 10 or more and 300 or less carbon atoms. To obtain n polymerized morpholino oligonucleotides (ii) protected by an alkyl group and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms and not protected by a morpholine ring nitrogen atom (deprotection). Process).
[0161]
[Chemical 23]

[0162]
(In the formula, each symbol has the same meaning as above.)
[0163]
　This step is carried out in a solvent that does not affect the reaction. The higher the solubility in the solvent, the better the reactivity can be expected. Therefore, it is preferable to select a non-polar solvent having a high solubility of the n-polymerized morpholino oligonucleotide (i) of the present invention. Specifically, halogen-based solvents such as chloroform, dichloromethane and 1,2-dichloroethane; aromatic solvents such as benzene, toluene, xylene and mesityrene; ester solvents such as ethyl acetate and isopropyl acetate; hexane, pentane and heptane. , Octane, nonane, cyclohexane and other aliphatic solvents; non-polar ether solvents such as diethyl ether, cyclopentyl methyl ether and tert-butyl methyl ether. Among them, dichloromethane, chloroform, 1,2-dichloroethane, benzene, toluene, xylene, mesitylene, hexane, pentane, heptane, nonane, cyclohexane, ethyl acetate, isopropyl acetate, tert-butyl methyl ether, cyclopentyl methyl ether and the like are preferable. Two or more of these solvents may be mixed and used in an appropriate ratio.
[0164]
　The concentration of the n-polymerized morpholino oligonucleotide (i) in this step in the solvent is not particularly limited as long as it is dissolved, but is preferably 1 to 30% by mass.
[0165]
　The acid used in this step is not particularly limited as long as good deprotection can be achieved, but trifluoroacetic acid, cyanopyridine trifluoroacetic acid and trifluoroethanol, triethylamine trifluoroacetic acid, cyanoacetic acid, acetic acid, It is preferable to use dichloroacetic acid, phosphoric acid, mesylic acid, tosilic acid, hydrochloric acid and the like.
　From the viewpoint of achieving a good reaction, trifluoroacetic acid, cyanopyridine trifluoroacetic acid, triethylamine trifluoroacetic acid and cyanoacetic acid are more preferable, cyanopyridine trifluoroacetic acid and triethylamine trifluoroacetic acid are further preferable, and triethylamine. Trifluoroacetic acid salts are particularly preferred. These acids may be diluted with the above non-polar solvent. Further, when the acid is used, a specific base (eg, triethylamine, etc.) may be combined and the acidity may be appropriately adjusted before use.
[0166]
　The amount of the acid used in this step can be 1 to 100 mol, preferably 1 to 40 mol, with respect to 1 mol of n polymerized morpholino oligonucleotides (i).
[0167]
　In this step, the protecting group P, such as a trityl cation caused by deprotection reaction 1 in order to prevent side reactions by cationic compound such as, may be added a cation scavenger. Preferred cation scavengers include pyrrole, indole, ethanol, 2,2,2-trifluoroethanol, methanol, anisole, p-cresol, triisopropylsilane, mercaptoethanol, thioanisole and the like. Of these, pyrrole, indole, ethanol and 2,2,2-trifluoroethanol are more preferable, and ethanol and 2,2,2-trifluoroethanol are particularly preferable.
[0168]
　The amount of the cation scavenger used is an excess amount of the p-polymerized morpholino oligonucleotide (iii) relative to the n-polymerized morpholino oligonucleotide (ii) (the number of moles of the p-polymerized morpholino oligonucleotide (iii) -n. The number of moles of the polymerized morpholino oligonucleotide (ii) can be appropriately determined, and 1 to 20 equivalents are preferable with respect to the excess amount (mol), and 1 to 10 equivalents are more preferable.
[0169]
　The reaction temperature in this step is not particularly limited as long as the reaction proceeds, but is preferably −10 ° C. to 50 ° C., more preferably 0 ° C. to 40 ° C. The reaction time varies depending on the type of n polymerized morpholino oligonucleotides used, the type of acid, the type of solvent, the reaction temperature, etc., but is 5 minutes to 5 hours.
[0170]
　When the acid used as a deprotecting agent is present during the condensation step of the next step, it induces the deprotection of the protecting group P 1 ″ of the p-polymerized morpholino oligonucleotide (iii), so that it is removed or neutralized. is necessary. In order to carry out the main deprotection step and the subsequent condensation step continuously in the liquid, it is preferable to remove the temporary protecting group of the 3'-terminal morpholine ring nitrogen atom in this step and then neutralize with an organic base. ..
　The organic base used for neutralization is not particularly limited as long as it can neutralize the above-mentioned acid and the obtained salt can function as a condensing agent, but from the viewpoint that the reaction proceeds satisfactorily. Therefore, N, N-diisopropylethylamine, pyridine, 4-cyanopyridine, and triethylamine are preferable, N, N-diisopropylethylamine and triethylamine are more preferable, and N, N-diisopropylethylamine is particularly preferable.
[0171]
　The amount of the organic base used in this step can be 1 to 10 mol, preferably 1 to 3 mol, with respect to 1 mol of the acid.
[0172]
　In this step, a particularly preferred combination of acid and organic base is cyanopyridine trifluoroacetate and N, N-diisopropylethylamine or cyanoacetic acid and N, N-diisopropylethylamine.
[0173]
Step (2) (Condensation step) In
　this step, the 5'-position hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidartized, and the morpholine ring nitrogen atom can be removed under acidic conditions. A p-polymerized morpholino oligonucleotide (iii) protected with a temporary protecting group, an alkyl group having a hydroxyl group having 10 or more and 300 or less carbon atoms existing on the substituent of the 5'-position hydroxyl group or the 5'-position hydroxyl group and / or Through n polymerized morpholino oligonucleotides (ii) protected by a protecting group having an alkenyl group having 10 or more carbon atoms and 300 or less carbon atoms and not protected by a morpholin ring nitrogen atom, and the morpholin ring nitrogen atom thereof (ii). This is a step of condensing with a thio) phosphoramidate bond or a (thio) phosphoriamidate bond to obtain an n + p polymerized morpholino oligonucleotide (iv).
[0174]
[Chemical 24]

[0175]
(In the formula, each symbol is synonymous with the above.) The
　5'position hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidartized, and the morphophosphorus ring nitrogen atom is under acidic conditions. As a p-polymerized morpholino oligonucleotide (iii) protected with a temporary protecting group that can be removed with, when p is 1 (that is, the 5'-position hydroxyl group is activated (thio) phosphated or activated (thio). ) A morpholinonucleoside that is phosphoramidated and whose morpholinic ring nitrogen atom is protected by a temporary protecting group P 1 ″ ) is preferred.
[0176]
　In this step, the n-polymerized morpholino oligonucleotide (ii) to be used is not particularly limited, but the one obtained in the step (1) can be preferably used. In that case, it can be carried out by simply adding the p-polymerized morpholino oligonucleotide (iii) directly to the reaction solution after the step (1) without isolating the n-polymerized morpholino oligonucleotide (ii). ..
　Alternatively, after the step (1), the reaction solution is subjected to the step (3) described later to once isolate the n-polymerized morpholino oligonucleotide (ii), dissolve it in a predetermined solvent, and then p-polymerize. Morphorino oligonucleotides (iii) may be added.
[0177]
　This step is carried out in a solvent that does not affect the reaction. It is preferable to select a non-polar solvent having a high solubility of the n-polymerized morpholino oligonucleotide (ii) of the present invention. Specifically, halogen-based solvents such as chloroform, dichloromethane and 1,2-dichloroethane; aromatic solvents such as benzene, toluene, xylene and mesityrene; ester solvents such as ethyl acetate and isopropyl acetate; hexane, pentane and heptane. , Octane, nonane, cyclohexane and other aliphatic solvents; non-polar ether solvents such as diethyl ether, cyclopentyl methyl ether and tert-butyl methyl ether. Among them, dichloromethane, chloroform, 1,2-dichloroethane, benzene, toluene, xylene, mesitylene, hexane, pentane, heptane, nonane, cyclohexane, ethyl acetate, isopropyl acetate, tert-butyl methyl ether, cyclopentyl methyl ether and the like are preferable. Two or more of these solvents may be mixed and used in an appropriate ratio. Further, as long as n polymerized morpholino oligonucleotides (ii) can be dissolved, polar solvents may be mixed and used in an appropriate ratio. Specifically, nitrile solvents such as acetonitrile and propionitrile; ketone solvents such as acetone and 2-butanone; polar ether solvents such as 1,4-dioxane and tetrahydrofuran, N, N-dimethylformamide, N, Examples thereof include amide-based solvents such as N-dimethylacetamide, N-methylpyrrolidone, and 1,3-dimethyl-2-imidazolinone; and polar solvents such as sulfoxide-based solvents such as dimethylsulfoxide.
[0178]
　The amount of the p-polymerized morpholino oligonucleotide (iii) used can be 1 to 10 mol, preferably 1 to 5 mol, more preferably 1 mol, with respect to 1 mol of the n-polymerized morpholino oligonucleotide (ii). 1 to 2 moles.
[0179]
　The reaction temperature is not particularly limited as long as the reaction proceeds, but is preferably 0 ° C to 100 ° C, more preferably 20 ° C to 50 ° C. The reaction time varies depending on the type of n-polymerized morpholino oligonucleotide (ii) to be condensed, p-polymerized morpholino oligonucleotide (iii), reaction temperature, etc., but is 30 minutes to 24 hours.
[0180]
　After completion of the condensation reaction, the reaction mixture is preferably treated with a quenching agent. By using a quenching agent, the p-polymerized morpholino oligonucleotides (iii) remaining during the condensation reaction can be completely quenched, and the activated morpholinonucleotides remaining during the condensation reaction in the next cycle are doubled. Since it is possible to avoid causing addition, it is possible to prevent deterioration of the quality of the target morpholino oligonucleotide.
　The double addition means that the activated morpholinonucleotide remaining used in the condensation reaction of the previous cycle reacts in the condensation reaction of the next cycle, and the same residue is double-added.
[0181]
　As the quenching agent, any nucleophilic reagent that reacts with the p-polymerized morpholino oligonucleotide (iii) can be used without limitation, and preferred examples thereof include organic amines and thiols, among which secondary amines are used. Is preferable, and morpholine is particularly preferable.
[0182]
　The amount of the quenching agent used is an excess amount of the p-polymerized morpholino oligonucleotide (iii) relative to the n-polymerized morpholino oligonucleotide (ii) (the number of moles of the p-polymerized morpholino oligonucleotide (iii) -n-polymerized. It can be appropriately determined in consideration of the number of moles of the morpholino oligonucleotide (ii)), and is preferably 0.1 to 10 equivalents, more preferably 0.3 to 3 equivalents, relative to the excess amount (moles).
[0183]
　After adding the quenching agent to the reaction mixture, the reaction is carried out at 0 ° C. to 100 ° C., preferably 20 ° C. to 50 ° C. for 30 minutes to 24 hours, preferably 30 minutes to 5 hours. The nucleotide (iii) can be completely quenched.
[0184]
Step (3) (Separation / purification step of morpholino oligonucleotide
　) n-polymerized morpholino oligonucleotide (ii) or n + p-polymerized morpholino oligonucleotide obtained in the steps (1) and / or (2 ) above (1) and / or (2 ) above. In iv), the 5'-terminal hydroxyl group is a protecting group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms, preferably the formula (II): ZYL. -Since it is protected by a protecting group represented by (in the formula, each symbol has the same meaning as described above), very high lipophilicity is imparted to the morpholino oligonucleotide, which complicates column purification and the like. Morphorino oligonucleotides can be easily isolated and purified only by crystallization and extraction operations without requiring any operation.
　Hereinafter, a method for isolating and purifying a morpholino oligonucleotide by crystallization will be described, but the present invention is not limited thereto.
[0185]
　In the step of isolating and purifying the morpholino oligonucleotide by crystallization, a polar solvent is added to the reaction solution obtained in the steps (1) and / or (2) to precipitate the morpholino oligonucleotide, and the solid solution is used. This is the process of obtaining by separation.
　The polar solvent may be added directly to the reaction solution obtained in the steps (1) and / or (2), or the reaction solution obtained in the steps (1) and / or (2) may be concentrated and then polar. A solvent may be added.
[0186]
　Examples of the polar solvent for precipitating the target morpholino oligonucleotide in this step include alcohol solvents such as methanol, ethanol and isopropanol; nitrile solvents such as acetonitrile and propionitrile; acetone, 2-butanone and the like. Ketone-based solvent; amide-based solvent such as dimethylformamide, dimethylacetonitrile, N-methylpiperidone, sulfoxide-based solvent such as dimethyl sulfoxide; water and the like, and a mixed solvent of two or more of these. As the polar solvent, a mixed solvent of an organic solvent and water can be used for the purpose of increasing the precipitation efficiency. In this case, the content of water in the polar solvent may be appropriately set to a preferable value depending on the organic solvent used, but is usually in the range of 1 to 50% (V / V), preferably 10 to 30% (V / V). Can be set with. As the polar solvent, an alcohol solvent, a nitrile solvent, or a mixed solvent of each of these solvents and water is preferable, and methanol, acetonitrile, or a mixed solvent of each of these solvents and water is more preferable, and acetonitrile or acetonitrile and water are used. The mixed solvent of is particularly preferable.
[0187]
　The method for producing a morpholino oligonucleotide of the present invention is in the order of steps (1)-(3)-(2)-(3), in the order of (1)-(3)-(2), or in step (1). )-(2)-(3) is repeated a desired number of times to obtain the desired morpholino oligonucleotide with high purity and high yield.
[0188]
Step (4) (Deprotection / Morphorino oligonucleotide Isolation Step) In the
　method for producing a morpholino oligonucleotide of the present invention, after step (3), deprotection is performed according to the type and properties of the protecting group. , Morphorino oligonucleotides can be isolated. Examples of deprotection methods include Greens Protecting Groups in Organic Synthesis (Greene's PROTECIVE GROUPS in ORGANIC SYNTHESIS), 4th Edition, Wiley-Interscience Publishing (2006). The step of removing all protecting groups of the morpholino oligonucleotide can be carried out according to the deprotection method described in the above. Specifically, the protecting group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms in the present invention, and a phenoxyacetyl group and an acetyl group which are protective groups for nucleic acid bases are used. , Ammonia water, ammonia water / ethanol solution, or a mixture of ammonia water and an aqueous solution of methyl amine can all be removed. Further, the protecting group of the morpholino oligonucleotide 3'-terminal morphophosphorus ring nitrogen atom can be removed by treating with the acid used in the step (1) or a solution obtained by appropriately diluting them.
[0189]
　To confirm the progress of the reaction in each of the above steps, the same method as that for a general liquid phase organic synthesis reaction can be applied. That is, the reaction can be traced using thin layer silica gel chromatography, high performance liquid chromatography, or the like.
[0190]
　The morpholino oligonucleotide obtained from step (3) or step (4) can be further subjected to an organic synthesis reaction to lead to a desired morpholino oligonucleotide derivative.
[0191]
　The morpholino oligonucleotides produced by the present invention are pharmaceuticals for various human bodies or animals (RNA, DNA, oligonucleic acid drugs, peptide-modified morpholino oligonucleotides, etc.), functional foods, specified health foods, foods, and chemical products. It can be used for various purposes such as commercial products, biological and industrial polymer materials.
Example
[0192]
　Hereinafter, the present invention will be described in more detail with reference to Examples, but these Examples do not limit the scope of the present invention at all. In addition, the reagents, devices, and materials used in the present invention are commercially available unless otherwise specified. In addition, in the present specification, when abbreviations are used, the respective abbreviations are based on the abbreviations by IUPAC-IUB Communication on Biochemical Nomenclature or the conventional abbreviations in the art unless otherwise specified.
[0193]
　The abbreviations used in the reference examples and examples are as follows.
mo: morpholinonucleoside
moA: morpholinoadenosine
moG: morpholinoguanosine
moC: morpholinocytidine
moT: morpholinothymidine
moU: morpholinouridine
PMO: phosphorodiamidate morpholino oligonucleotides,
　for example, PMO [A-G-C] When displayed, the left side is the 5'end, the right side is the 3'end, and the phosphorodiamidate morpholino oligonucleotide is in the order of morpholinoadenosine, morpholinoguanosine, and morpholinocytidine from the 5'end. means.
bz: Benzoyl group
pac: Phenoxyacetyl group
ce: 2-Cyanoethyl group When
　the nucleobase of morpholinonucleoside is protected, the protecting group is on the right side of the nucleobase abbreviations (A, G, C, T and U). It shall be displayed with.
　For example, C bz means that the amino group of cytosine is protected by a benzyl group, and G ce / pac means that the amino group of guanine is protected by a phenoxyacetyl group and the carbonyl group is protected by a 2-cyanoethyl group. Means.
TOB: 3,4,5-tri (octadecyloxy) benzyloxy group
suc: succinyl group
Tr, Trt: trityl group
CYTFA: cyanopyridine / trifluoroacetic acid
DIEA: N, N -diisopyrropyruethylamine
TFE: 2, 2,2-Trifluoroethanol
TFA: Trifluoroacetic acid
DMAP: 4-Dimethylaminopyridine
MeCN: Acetonitrile
HOBt: 1-Hydroxybenzotriazole
UHPLC: Ultra-high performance liquid chromatography
EDC ・ HCl: N-ethyl-N'-(3-) Dimethylaminopropyl) Carbodiimide Hydrochloride
MMTr:
Monomethoxytrityl deg: Triethylene Glycol
[0194]
[Chemical 25]

[0195]
Reference Example 1 Synthesis of TOB-suc-moC bz -Tr ( Introduction of suc-moC bz- Tr intermediate into TOB anchor )
[0196]
[Chemical 26]

[0197]
　Dissolve 3,4,5-tri (octadecyloxy) benzyl alcohol (4500 mg, 4.92 mmol) in chloroform (45 ml), suc-moC bz- Tr (3640 mg, 5.41 mmol), EDC / HCl in an ice bath. (1141 mg, 5.95 mmol) and DMAP (33 mg, 0.055 mmol) were added in 3 portions every hour. The mixture was stirred overnight at room temperature, and suc-moC bz- Tr (503 mg, 0.74 mmol) and EDC / HCl (157 mg, 0.82 mmol) were additionally added, and the completion of the reaction was confirmed by HPLC. The solvent was distilled off under reduced pressure, MeCN (10 ml) was added, and distillation under reduced pressure was performed again. MeCN (50 ml) was added to the residue, the precipitate was collected by filtration, completely dissolved in chloroform (30 ml), and then recrystallized from MeCN (90 ml). It was dried under reduced pressure to obtain TOB-suc-moC bz -Tr (7337 mg, yield 95%).
TOF-MS + (m / z) 1566.8
[0198]
Reference Example 2 TOB-suc-moC bz - Tr de-Tr reaction
[0199]
[Chemical 27]

[0200]
　TOB-suc-moC bz- Tr (500 mg, 0.32 mmol) is dissolved in chloroform (5 ml), and 16 ml of solution A * is slowly added dropwise over 30 minutes under an ice bath at room temperature for 1.5 hours. Stirred. After completion of the reaction, a diluted solution of DIEA (137 μl) / chloroform (1 ml) was slowly added under an ice bath, then MeCN (50 ml) was added, and the precipitate was filtered. The obtained crystals were washed again with MeCN (10 ml) and dried under reduced pressure to obtain TOB-suc-moC bz (395 mg, yield 94%).
* The composition of Liquid A is as follows.
EtOH / TFE / TFA / TEA / Chloroform = 250 μl / 2.5 ml / 173 μl / 161 μl / 22.25 ml
TOF-MS + (m / z) 1324.9
[0201]
　The schemes of Examples 1 and 2 are shown below.
[0202]
[Chemical 28]

[0203]
Example 1 Synthesis of Compound 2: Binding of succinyl linker to Compound 1 [mo (Tr) C bz ] 　Under an argon atmosphere, Compound 1 [mo (Tr) C bz ] (573 mg, 1.0 mmol) and N, N- Dimethylaminopyridine (183 mg, 1.5 mmol) was dissolved in dry dichloromethane (7.0 ml), succinic anhydride (150 mg, 1.5 mmol) was added, and the mixture was stirred at room temperature for 3 hours. After confirming the completion of the reaction by thin layer chromatography, methanol (1.0 ml) was added, and the reaction solution was concentrated under reduced pressure. The resulting ethyl acetate (8.0 ml) and 0.5 mol / LKH the concentrated residue 2 PO 4 was added an aqueous solution (8.0 ml) was extracted partial layer, further adding ethyl acetate (8.0 ml) to the aqueous layer Extracted. The obtained ethyl acetate layers are combined , washed with 0.5 mol / lKH 2 PO 4 aqueous solution (13.0 ml), water (13.0 ml), saturated brine (13.0 ml), dried over magnesium sulfate, and filtered. bottom. The filtrate was concentrated to dryness to give compound 2 [suc-mo (Tr) C bz ] (680 mg, quant). 1 1 H-NMR (400 MHz, CDCl 3)

): δ1.20 (1H, t, J = 10.4Hz), 1.49 (1H, t, J = 11.2Hz), 2.52-2.75 (4H, m), 3.14 (1H) , D, J = 11.5Hz), 3.80 (1H, d, J = 10.4Hz), 3.92 (1H, d, J = 11.7Hz), 4.37-4.59 (2H, m), 6.19 (1H, d, J = 7.2Hz), 7.15-7.88 (22H, m)
[0204]
Example 2 Synthesis of Compound 3: Supporting Compound 2 [suc-mo (Tr) C bz ] on TOB anchor [3,4,5-tris (octadecyloxy) benzyl alcohol] 　3,4,5 under an argon atmosphere -Tris (octadecyloxy) benzyl alcohol (133 mg, 0.15 mmol), N, N-dimethylaminopyridine (21 mg, 0.18 mmol), compound 2 [suc-mo (Tr) C bz ] (123 mg, 0.18 mmol ) Was dissolved in dry dichloromethane (2.4 ml), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (101 mg, 0.53 mmol) was added, and the mixture was stirred overnight at room temperature. After confirming the completion of the reaction by thin layer chromatography, methanol (6.0 ml) was added and the obtained mixed solution was concentrated under reduced pressure. Methanol (6.0 ml) was added to the concentrated residue, and the obtained slurry was stirred for 15 minutes and filtered. The obtained solid was dried by heating under reduced pressure to obtain Compound 3 [TOB-suc-mo (Tr) C bz ] (218 mg, 95%). 1 1 H-NMR (400 MHz, CDCl 3)

): δ0.88 (9H, t, J = 6.8Hz), 1.22-1.85 (98H, m), 2.54-2.68 (4H, m), 3.12-3.18 (1H, m), 3.58-3.65 (1H, m), 3.88-3.98 (6H, m), 4.07-4.15 (2H, m), 4.35-4 .43 (1H, m), 5.00 (2H, s), 6.25-6.29 (1H, m), 6.53 (2H, s), 7.15-7.88 (22H, m) ), 8.50-8.56 (1H, m)
m / z 1569.14 [M + H] +
[0205]
　The reaction schemes of Examples 3-12 are shown below.
[0206]
[Chemical 29]

[0207]
Example 3 Synthesis of compound 4 [TOB-suc-moC bz ] (method using CYTFA (salt of cyanopyridine and trifluoroacetic acid) as a detrizing agent) 　Compound 3 [TOB-suc-mo (Tr ) under an argon atmosphere. ) C bz ] (62.7 mg, 0.04 mmol), a dichloromethane solution (1.5 ml) containing 2% CYTFA, 1% ethanol, and 10% CF 3 CH 2 OH was added, and the mixture was stirred at room temperature for 30 minutes. .. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (2.3 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Then, methanol (1.5 ml) was added, and the solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue again, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was vacuum-heat dried to give detrized compound 4 [TOB-suc-moC bz ] (52.0 mg, 98.0%). 1 1 H-NMR (400 MHz, CDCl 3)

): δ0.88 (9H, t, J = 6.9Hz), 1.22-1.85 (96H, m), 2.45-2.53 (1H, m), 2.62-2.74 (5H, m), 2.94-3.00 (1H, m), 3.38-3.346 (1H, m), 3.89-4.00 (7H, m), 4.13 -4.24 (2H, m), 4.98-5.07 (2H, m), 5.75-5.82 (1H, m), 6.54 (2H, s), 7.45-7 .65 (4H, m), 7.83-8.00 (3H, m), 8.62 (1H, brs)
[0208]
Example 4 Synthesis of Compound 4 [TOB-suc-moC bz ] (method using cyanoacetic acid as a de-Tr agent) 　Compound 3 [TOB-suc-mo (Tr) C bz ] (62.7 mg, ) under an argon atmosphere . A dichloromethane solution (0.75 ml) containing 10% cyanoacetic acid and 20% acetonitrile was added to 0.04 mmol), and the mixture was stirred at room temperature for 30 minutes. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (4.5 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Then, methanol (1.5 ml) was added, and the solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue again, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was dried under vacuum to give detrized compound 4 [TOB-suc-moC bz ] (50.0 mg, 94.3%).
[0209]
Example 5 Synthesis of Compound 5 [TOB-suc-PMO [C bz- T] -Tr] (method using 3 equivalents of T monomer) 　Compound 4 [TOB-suc-moC bz ] (48.8 mg ) under an argon atmosphere. , 0.036 mmol) with a solution of ClPONMe 2- mo (Tr) T (61 mg, 0.11 mmol) in tetrahydrofuran (0.4 ml) and 1,3-dimethyl-2 containing 25% N, N-diisopropylethylamine. -Imidazoridinone solution (0.4 ml) was added, and the mixture was stirred at room temperature for 1.5 hours. After confirming the completion of the reaction by thin layer chromatography, methanol (1.5 ml) was added to the reaction solution, and this solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was vacuum dried to give compound 5 [TOB-suc-PMO [C bz- T] -Tr] (66.0 mg, 98.0%).
[0210]
Example 6 Synthesis of Compound 5 [TOB-suc-PMO [C bz- T] -Tr] (method in which T monomer was reduced to 1.1 equivalents) 　Compound 4 [TOB-suc-moC bz ] ( method in which T monomer was reduced to 1.1 equivalents) under an argon atmosphere . 54.2 mg, 0.04 mmol) versus 1,3-1,3- containing a solution of ClPONMe 2- mo (Tr) T (27 mg, 0.044 mmol) in tetrahydrofuran (0.4 ml) and 25% N, N-diisopropylethylamine. A solution of dimethyl-2-imidazolidinone (0.4 ml) was added, and the mixture was stirred at room temperature for 1.5 hours. After confirming the completion of the reaction by thin layer chromatography, methanol (1.5 ml) was added to the reaction solution, and this solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was vacuum dried to give compound 5 [TOB-suc-PMO [C bz- T] -Tr] (70.8 mg, 93.2%).
[0211]
Example 7 Synthesis of Compound 5 [TOB-suc-PMO [C bz- T] -Tr] (one-pot method from Compound 3) 　Compound 3 [TOB-suc-mo (Tr) C bz ] (62 ) under an argon atmosphere. A dichloromethane solution (1.8 ml) containing 2% CYTFA, 1% ethanol and 10% CF 3 CH 2 OH was added to ( 0.7 mg, 0.04 mmol), and the mixture was stirred at room temperature for 30 minutes. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (2.7 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Then, 1,3-dimethyl-2 containing ClPONMe 2- mo (Tr) T (73.1 mg, 0.12 mmol) in tetrahydrofuran (0.4 ml) and 25% N, N-diisopropylethylamine in this reaction solution. -The imidazolidinone solution (0.5 ml) was added, and the mixture was stirred at room temperature for 30 minutes and further at 38 ° C. for 1 hour. Methanol (1.5 ml) was added to the reaction solution, and this solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was vacuum dried to give compound 5 [TOB-suc-PMO [C bz- T] -Tr] (75.0 mg, 98.8%).
[0212]
Example 8 Synthesis of Compound 6 [TOB-suc-PMO [C bz- T]] (Method using CYTFA as a detrizing agent) 　Under an argon atmosphere, Compound 5 [TOB-suc-PMO [C bz- T]- A dichloromethane solution (0.75 ml) containing 2% CYTFA, 1% ethanol, and 10% CF 3 CH 2 OH was added to Tr] (37.4 mg, 0.02 mmol), and the mixture was stirred at room temperature for 30 minutes. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (1.0 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Then, methanol (1.5 ml) was added, and the solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue again, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). This solid was vacuum-heat-dried to give detrized compound 6 [TOB-suc-PMO [C bz- T]] (30.0 mg, 92.1%).
[0213]
Example 9 Synthesis of Compound 6 [TOB-suc-PMO [C bz- T]] (Method using cyanoacetic acid as a detrizing agent) 　Compound 5 [TOB-suc-PMO [C bz- T]] under an argon atmosphere . -Tr] (37.4 mg, 0.02 mmol) was added with a dichloromethane solution (0.38 ml) containing 10% cyanoacetic acid and 20% acetonitrile, and the mixture was stirred at room temperature for 30 minutes. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (2.3 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Then, methanol (1.5 ml) was added, and the solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue again, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was dried under vacuum to give detrized compound 6 [TOB-suc-PMO [C bz- T]] (31.0 mg, 95.2%).
[0214]
Example 10 Compound 7 [TOB-suc-PMO [C bz -T-C bz ] -Tr] (method using 3 equivalents of C monomer) Synthesis of 　Under an argon atmosphere, Compound 6 [TOB-suc-PMO [C bz - T]] (25.8 mg, 0.016 mmol), ClPONMe 2- mo (Tr) C bz (32.7 mg, 0.05 mmol) in tetrahydrofuran (0.2 ml) and 25% N, N-diisopropylethylamine. A solution of 1,3-dimethyl-2-imidazolidinone (0.2 ml) containing the above mixture was added, and the mixture was stirred at room temperature for 1.5 hours. After confirming the completion of the reaction by thin layer chromatography, methanol (1.5 ml) was added to the reaction solution, and this solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). The solid was vacuum dried to give compound 7 [TOB-suc-PMO [C bz -TC bz ] -Tr] (32.9 mg, 90.9%).
[0215]
Example 11 Synthesis of compound 7 [TOB-suc-PMO [C bz -TC bz ] -Tr] (method in which C monomer was reduced to 1.5 equivalents) 　Compound 6 [TOB-suc-PMO] under an argon atmosphere. [C bz- T]] (99.4 mg, 0.06 mmol) versus ClPONMe 2- mo (Tr) C bz (62.8 mg, 0.09 mmol) in tetrahydrofuran (0.6 ml) and 25% N, A 1,3-dimethyl-2-imidazolidinone solution (0.75 ml) containing N-diisopropylethylamine was added, and the mixture was stirred at room temperature for 5 hours. After confirming the completion of the reaction by thin layer chromatography, methanol (2.7 ml) was added to the reaction solution, and this solution was concentrated under reduced pressure. Methanol (2.7 ml) was added to the concentrated residue, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (2.7 ml). The solid was vacuum dried to give compound 7 [TOB-suc-PMO [C bz -TC bz ] -Tr] (131 mg, 94.4%).
[0216]
Example 12 Synthesis of Compound 7 [TOB-suc-PMO [C bz -TC bz ] -Tr] (One-pot method from Compound 5) 　Under an argon atmosphere, Compound 5 [TOB-suc-PMO [C bz- T] ] -Tr] (75.9 mg, 0.04 mmol ) was added a dichloromethane solution (1.5 ml) containing 2% CYTFA, 1% ethanol, and 10% CF 3 CH 2 OH, and the mixture was stirred at room temperature for 30 minutes. .. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (2.3 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Then, 1,3-dimethyl-containing a solution of ClPONMe 2- mo (Tr) C bz (83.8 mg, 0.12 mmol) in tetrahydrofuran (0.4 ml) and 25% N, N-diisopropylethylamine in this reaction solution. A 2-imidazolidinone solution (0.5 ml) was added, and the mixture was stirred at room temperature for 30 minutes and further at 38 ° C. for 45 minutes. Methanol (1.5 ml) was added to the reaction solution, and this solution was concentrated under reduced pressure. Methanol (1.5 ml) was added to the concentrated residue, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with methanol (1.5 ml). This solid was vacuum heated and dried to compound 7 [TOB-suc-PMO [C].
bz -TC bz ] -Tr] (90.8 mg, 97.9%) was obtained.
[0217]
　The reaction scheme of Example 13 is shown below.
[0218]
[Chemical 30]

[0219]
Example 13 Synthesis of
　Compound 8 [PMO [CTC]] 28% aqueous ammonia (3.5 ml) in Compound 7 [TOB-suc-PMO [C bz -TC bz ] -Tr] (162 mg, 0.07 mmol). A mixed solution of ethanol (14.0 ml) was added, the mixture was sealed in an autoclave, and the mixture was heated and stirred at 55 ° C. overnight. The mixture was cooled to room temperature, the completion of the reaction was confirmed by thin layer chromatography, and the contents were transferred into methanol while washing with methanol and dichloromethane. This mixed solution was concentrated under reduced pressure, methanol (14.0 ml) was added to the obtained concentrated residue, and the slurry was washed for 30 minutes. The solid was separated by filtration, the filtrate was concentrated, and the obtained solid was dissolved in a 0.2 mol / lKH 2 PO 4 aqueous solution (pH 2.0) and stirred for 15 minutes. After confirming the disappearance of the raw material by thin layer chromatography, the pH was adjusted to 13 to 14 with a 2.0 mol / l sodium hydroxide aqueous solution, filtered through a membrane filter, and the filtrate was subjected to HPLC analysis. Consistent with.
Reverse-phase HPLC analysis (Collum = InertStain C18, 5 μm, 4.6x150 mm; Solvent A = 50 mM TEAA (pH 7.0), Solvent B = CH 3 CN; Gradient = 0% to 40% B (20 min); Flow Rate = .75 ml / min; Temp = 60 ° C.): RT 11.6 min, 11.7 min, 11.8 min, 12.0 min (4 isomer mixture)
[0220]
　The reaction schemes of Examples 14-16 are shown below.
[0221]
[Chemical 31]

[0222]
Example 14 Compound 9 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G pac -G pac -T-T-C bz -T-G pac synthesis] -Tr] ( Single Isolation / 1 Cycle Method) Deprotection and deprotection of trityl groups from 　Compound 3 [TOB-suc-mo (Tr) C bz ] (78.4 mg, 0.05 mmol) according to the method described in Examples 7 and 12. Coupling of the corresponding monomers was performed sequentially in one pot. The product weight and weight yield isolated at each step are shown in the table below.
[0223]
[table 1]

[0224]
Example 15 Compound 9 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G pac -G pac -T-T-C bz -T-G pac synthesis] -Tr] ( 2 Isolation / 1 Cycle, Method Using Cyanoacetic Acid as DeTr Agent) 　Compound 3 [TOB-suc-mo (Tr) C bz ] (94.1 mg, 0.06 mmol) to Examples 4 and 9. The trityl group was deprotected according to the method described, and the corresponding monomers were sequentially coupled according to the methods described in Examples 5 and 10. The product weight and weight yield isolated at each step are shown in the table below.
[0225]
[Table 2]

[0226]
EXAMPLE 16 Compound 10 [PMO [CCTCCGGTTCTG] -Tr] Synthesis of
　Compound synthesized in Example 15 9 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G pac -G pac -T--T C bz -T-G pac ] -Tr] (6.0 mg, 1.0 [mu] mol) in 28% aqueous ammonia / ethanol = 1/3 (v / v) (0.2ml) was added, the autoclave The mixture was heated and stirred at 55 ° C. overnight. The temperature was returned to room temperature, and the solid matter was removed by filtering while washing with methanol. The filtrate was concentrated to give a crude product (3.3 mg, 80%) of compound 10 [PMO [CCTCCGGTTCTG] -Tr]. Reversed phase HPLC analysis (Column = InertStain C18, 5 μm, 4.6x150 mm; Solvent A = 50 mM TEAA (pH 7.0), Solvent B = CH 3 CN; Gradient = 10% to 70% B (20 min); Flow Rate = .75 ml / min; Temp = 60 ° C.): RT 13.1 min
[0227]
　The reaction schemes of Examples 17 and 18 are shown below.
[0228]
[Chemical 32]

[0229]
EXAMPLE 17 Compound 11 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G pac -G pac -T-T-C bz -T-G pac -A bz -A bz - G pac -G pac -T-G pac -T-T-C bz ] -Tr] synthesis of 　compound 3 [TOB-suc-mo (Tr) C bz ] (78.4 mg, 0.05 mmol) example 3 from Deprotection of the trityl group was performed according to the methods described in and 8, and the corresponding monomer couplings were sequentially performed according to the methods described in Examples 5 and 10. The product weight and weight yield isolated at each step are shown in the table below.
[0230]
[Table 3]

[0231]
EXAMPLE 18 Compound 12 [PMO [CCTCCGGTTCTGAAGGTGTTC] -Tr] Synthesis of
　Compound 11 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G pac -G pac -T-T-C bz -G -T pac -A bz -A bz -G pac -G pac -T-G pac -T-T-C bz ] -Tr] (6 mg, 0.61 mmol) of 28% aqueous ammonia / ethanol = 1 / It was dissolved in 3 (v / v) (200 μl), sealed in an autoclave, and stirred at 55 ° C. overnight. The temperature was returned to room temperature, and the solid matter was removed by filtering while washing with methanol. The filtrate was concentrated to obtain a crude product (3.1 mg, 71%) of compound 12 [PMO [CCTCCGGTTCTGAAGGTGTTC] -Tr].
Reversed phase HPLC analysis (Column = Ion Stain C18, 5 μm, 4.6x150 mm; Solvent A = 50 mM TEAA (pH 7.0), Solvent B = CH 3 CN; 0.75 ml / min; Temp = 60 ° C.): RT12.4 min
anion exchange HPLC analysis (Column = DNAPacPA-100, 4.0x250 mm; Solvent A = 10 mM NaOH aqueous solution, B = 1M NaOH aqueous solution; Gradent = 20 % To 100% B (30 min); Flow Rate = 1.0 ml / min; Temp = 35 ° C.): RT 10.8 min
m / z 7167.50 [M + H] +
[0232]
　The reaction schemes of Examples 19 and 20 are shown below.
[0233]
[Chemical 33]

[0234]
Example 19 Compound 13 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / pac -T] -Tr] Synthesis of 　Compound 3 [TOB-Suc- deprotecting the trityl group from mo (Tr) C bz ] (502 mg, 0.32 mmol) according to the method described in Examples 3 and 8 and coupling the corresponding monomer according to the method described in Examples 5 and 10. Was carried out in sequence. As the monomer corresponding to guanosine, ClPONMe 2- mo (Tr) Gce / pac having a cyanoethyl group as a protecting group at the O6 position was used. The product weight and weight yield isolated at each step are shown in the table below.
[0235]
[Table 4]

[0236]
Example 20 Compound 14 [PMO [CCTCCGGT] -Tr] Synthesis of
　Compound synthesized in Example 19 13 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / pac- T] -Tr] (19.3 mg, 4.2 μmol) was suspended in 28% aqueous ammonia / ethanol = 1/3 (v / v) (2.0 ml) and sealed in an autoclave. The mixture was heated and stirred at 55 ° C. in the evening. After cooling to room temperature, the solution was transferred to an eggplant flask using dichloromethane (1.5 ml) and methanol (1.5 ml), and concentrated under reduced pressure. Methanol (2.0 ml) was added to the concentrated residue, and the precipitated solid was filtered off with a membrane filter, and the filtrate was concentrated to dryness to quantitatively obtain compound 14 [PMO [CCTCCGGT] -Tr]. m / z 929.2 [M + 3H] 3+ , 1393.3 [M + 2H] 2+
[0237]
　The reaction schemes of Examples 21 and 22 are shown below.
[0238]
[Chemical 34]

[0239]
Example 21 Compound 15 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / pac -T-T-C bz -T-G ce / pac - a bz synthesis] -Tr] 　compound synthesized in example 19 13 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / pac -T] - Tr] (487 mg, 0.11 mmol) was used to deprotect the trityl group and couple with the corresponding monomer according to the method described in Example 12. The monomer corresponding to guanosine has ClPONMe 2- mo (Tr) G ce / pac having a cyanoethyl group as a protecting group at the O6 position.
Was used. The product weight and weight yield isolated at each step are shown in the table below.
[0240]
[Table 5]

[0241]
Example 22 Compound 16 [PMO [CCTCCGGTTCTGA] -Tr] Synthesis of
　exemplary compounds were synthesized in Example 21 15 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / pac -T-T-C bz -T-G ce / pac -A bz ] -Tr] (8.6 mg, 1.3Myumol) of 28% aqueous ammonia / ethanol = 1/3 (v / v ) ( It was suspended in 1.0 ml), sealed in an autoclave, and heated and stirred at 55 ° C. overnight. After cooling to room temperature, the solution was transferred to an eggplant flask using dichloromethane (1.0 ml) and methanol (1.0 ml), and concentrated under reduced pressure. Methanol (1.0 ml) was added to the concentrated residue, and the precipitated solid was filtered off with a membrane filter, and the filtrate was concentrated to dryness to quantitatively obtain compound 16 [PMO [CCTCCG] -Tr]. m / z 1114.8 [M + 4H] 4+ , 1486.0 [M + 3H] 3+
[0242]
　The reaction schemes of Examples 23 and 24 are shown below.
[0243]
[Chemical 35]

[0244]
Example 23 Compound 17 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / pac synthesis] -Tr] 　Under an argon atmosphere, Compound 3 [TOB- [Suc-mo (Tr) C bz ] (300 mg, 0.19 mmol ) was added with a dichloromethane solution (8.0 ml) containing 2% CYTFA, 1% ethanol, and 10% CF 3 CH 2 OH, and 90 at room temperature. Stirred for minutes. After confirming the completion of the reaction by thin layer chromatography, a dichloromethane solution (12.0 ml) containing 5% N, N-diisopropylethylamine and 25% 2-propanol was added, and the mixture was stirred at room temperature for 30 minutes. Acetonitrile (8.0 ml) was added to the concentrated residue obtained by concentrating this solution under reduced pressure, and the mixture was stirred at room temperature for 15 minutes. The resulting slurry was filtered and the solid was washed with acetonitrile (8.0 ml). The solid was dried under vacuum to give detrized compound 4 [TOB-suc-moC bz ] (254 mg, 100%). 　Compound 4 under an argon atmosphere

To [TOB-suc-moC bz ] (242 mg, 0.18 mmol), a solution of ClPONMe 2- mo (Tr) C bz (382 mg, 0.55 mmol) in tetrahydrofuran (1.8 ml) and 25% N, N- A 1,3-dimethyl-2-imidazolidinone solution (2.0 ml) containing diisopropylethylamine was added, and the mixture was stirred at room temperature for 30 minutes. After confirming the completion of the reaction by thin layer chromatography, morpholine (48 μl, 0.55 mmol) was added and the mixture was stirred for 10 minutes. Then, acetonitrile (7.3 ml) was added to this solution and concentrated under reduced pressure, and acetonitrile (7.3 ml) was added again to the obtained concentrated residue, and the obtained slurry was stirred for 15 minutes. The solid obtained by filtering this slurry was washed with acetonitrile (7.3 ml) and dried under reduced pressure to obtain TOB-suc-PMO [Cbz-Cbz] -Tr (355 mg, 98%).
　Hereinafter Similarly, sequentially performs a coupling between the detritylation and corresponding monomer, the title compound 17 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G ce / Pac] -Tr] was obtained. The product weight and weight yield isolated at each step are shown in the table below.
[0245]
[Table 6]

[0246]
Example 24 Compound 18 [PMO [CCTCCGG] -Tr] Synthesis of
　Compound synthesized in Example 23 17 [TOB-suc-PMO [C bz -C bz -T-C bz -C bz -G ce / pac -G Deprotection and excision from the carrier were carried out from ce / pac ] -Tr] (4 mg, 0.94 μmol) according to the method described in Example 22 to obtain compound 18 [PMO [CCTCCG] -Tr]. m / z 819.3 [M + 3H] 3+ , 1228.4 [M + 2H] 2+
[0247]
Example 25 [TOB-suc-PMO [C bz- C bz ]] (1 pot extension)
[0248]
[Chemical 36]

[0249]
　TOB-suc-moC bz (395 mg, 0.30 mmol) is dissolved in dichloromethane (4 ml), DIEA (1.8 eq, 0.54 mmol, 50 μl), ClPONMe 2- mo (Tr) C bz under an ice bath. (1.5 eq, 0.45 mmol, 312 mg) was added in 3 portions at 30 minute intervals, and the mixture was stirred overnight at room temperature. Then, DIEA (0.1 eq, 0.03 mmol, 5 μl) and ClPONMe 2- mo (Tr) C bz (0.1 eq, 0.03 mmol, 21 mg) were additionally added 3 times, and the mixture was further stirred overnight. After completion of the reaction, morpholine (1.28 eq, 0.37 mmol, 34 μl) was added, and the mixture was stirred for 1.5 hours. After confirming the disappearance of residual ClPONMe 2- mo (Tr) C bz , solution A of Reference Example 2 was confirmed. (16.8 ml) was slowly added dropwise over 10 minutes and stirred for 2 hours at room temperature. After the detrification reaction was completed, a diluted solution of DIEA (142 μl, 1.0 eq vs TFA) / dichloromethane (1 ml) was slowly added under an ice bath, and MeCN (50 ml) was added for precipitation. The precipitate of the suspension was filtered and the filter was washed with MeCN to give [TOB-suc-PMO [C bz- C bz ]] (wet. 526 mg).
TOF-MS + (m / z) 1743.8
[0250]
Example 26 Synthesis of [TOB-suc-PMO [C bz- C bz- T]] (condensation 3 and 1 pot extension)
[0251]
[Chemical 37]

[0252]
　[TOB-suc-PMO [C bz- C bz ]] is dissolved in wet crystals (wet. 526 mg) in dichloromethane (10 ml) and DIEA (0.54 mmol, 50 μl), ClPONMe 2- mo in an ice bath. (Tr) T (0.45 mmol, 272 mg) was added in 3 portions at 30 minute intervals. Stir overnight at room temperature. Then, DIEA (0.03 mmol, 3 μl) and ClPONMe 2- mo (Tr) T (0.03 mmol, 17 mg) were additionally added twice, and the mixture was stirred at room temperature for 4 hours. After completion of the reaction, morpholine (0.5 eq, 0.14 mmol, 21 μl) was added at room temperature, and the mixture was stirred for 3 hours. Liquid A (30 ml) of Reference Example 2 was slowly added dropwise over 15 minutes under an ice bath, and after completion of the addition, the mixture was stirred at room temperature for 4 hours. After completion of the reaction, a diluted solution of DIEA (77 μl) / dichloromethane (1 ml) was slowly added under an ice bath, and then MeCN (50 ml) was added to prepare a white slurry solution. 25 ml of this liquid was distilled off under reduced pressure, MeCN (20 ml) was added, and the slurry was stirred for 15 minutes and then filtered. The obtained crystals were washed again with MeCN (30 ml) and dried under reduced pressure to obtain [TOB-suc-PMO [C bz- C bz- T]] in a yield of 95% (vs TOB-suc-moC bz ).
TOF-MS + (m / z) 2073.4
[0253]
Comparative Example 1 Evaluation of
　Effect of Morforin on Quality of Quenching of Excess Monomer With respect to the intermediate of 2 mer to 5 mer obtained in the process of synthesis described in Example 14, deprotection and excision from the carrier were performed by the method described in Example 14. Then, impurity analysis was performed by mass spectrometry (LC-MS). Similarly, the intermediates of 2 mer to 7 mer obtained in the process of synthesis described in Example 23 were similarly deprotected and cut out from the carrier, and impurity analysis was performed by mass spectrometry (LC-MS). The results of each analysis were compared, and it was found that in the method described in Example 23 in which the excess monomer was quenched with morphophosphorus, excessively elongated impurities such as n + 1mer were not by-produced.

The scope of the claims
[Claim 1]
　General formula (I):
[Chemical

formula 1] [In the formula,
m indicates an arbitrary integer of 0 or more,
m + 1 Base indicates a nucleic acid base which may be independently protected, and
P 1 is , Hydrogen atom or temporary protective group that can be removed under acidic conditions, and
m X is independently protected by C 1-6 alkoxy group, di C 1-6 alkylamino group, or 4-position nitrogen atom, respectively. It represents a piperazino group that is protected by a group and may be further substituted,
m W represents an oxygen atom or a sulfur atom, respectively, and
S 1 is a single bond or * OS 2 **. (In the formula, * indicates the bond position with L, ** indicates the bond position with the 5'-position hydroxyl group, and S 2 indicates a spacer having a main chain having 1 to 20 atoms.) Where
L is a single bond, or formula (a1):
[Chemical formula 2]

[In the formula, * indicates the bond position with Y;
** indicates the bond position with S 1 ;
L 1 indicates a divalent C 1-22 hydrocarbon group which may be substituted. ; And
L 2 indicates C (= O), or *** N (R 3 ) -R 1- N (R 2 ) C (= O) ** (In the formula, ** is L 1 Indicates the bonding position with, where *** indicates the bonding position with Y, R 1 indicates a C 1-22 alkylene group which may be substituted , and R 2 and R 3 are independent of each other. , Hydrogen atom or optionally substituted C It may show a 1-22 alkyl group, or R 2 and R 3 may be combined to form a optionally substituted C 1-22 alkylene bond. ) Indicates a group. ] Indicates a group,
Y indicates a single bond, an oxygen atom, or NR (R indicates a hydrogen atom, an alkyl group or an aralkyl group), and
Z indicates the formula (a2):
[Chemical formula 3]. ]

[In the formula, * indicates the bond position with Y;
R 4 indicates a hydrogen atom, or when R b is a group represented by the following formula (a 3), R 6 and Together they may indicate a single bond or —O— to form a fluorenyl or xanthenyl group with ring B;
k Qs independently exhibit a single bond or —O—, respectively. , -S -, - OC (= O) -, - NHC (= O) - or -NH- are shown;
k-number of R 5 is independently having 10 to 300 carbon atoms each, alkyl groups and / or Shows an organic group having an alkenyl group having 10 or more and 300 or less carbon atoms;
k is from 1 to an integer of 4;
ring A, k-number of QR 5 in addition to further halogen atom, a C substituted with a halogen atom 1-6 substituted alkyl group, and a halogen atom even a C have 1-6 may have a substituent group selected from the group consisting of alkoxy radicals may;
R a represents a hydrogen atom;
R b is a hydrogen atom or the formula, (a3):
[ 4]

(In the equation, * indicates the bond position;
j indicates an integer from 0 to 4;
j Q indicates the same meaning as described above;
j R 7 independently indicate each. Indicates an organic group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkoxy group having 10 or more and 300 or less carbon atoms;
R 6 indicates a hydrogen atom, or is a single bond or-in combination with R 4. It may show O- and form a fluorenyl group or a xanthenyl group with ring A; and
ring B has j QRs. 7 in addition to further halogen atoms, optionally substituted by a halogen atom C 1-6 alkyl group, and a C be substituted with a halogen atom 1-6 substituents selected from the group consisting of an alkoxy group May have. ) Represents a group represented by, or
R a and R b together form an oxygen atom. ] Indicates a group represented by. ] The
morpholinonucleotide indicated by.
[Claim 2]
　The morpholinonucleotide according to claim 1, wherein m is 0.
[Claim 3]
　L in the general formula (I) is a succinyl group, and
R 5 and / or R 7 is an alkyl group having a carbon number of 10 to 40, morpholinoethyl nucleotides according to claim 1 or 2.
[Claim 4]
　L in the general formula (I) is a succinyl group, and
R a and R b are both hydrogen atom, and R 5 is an alkyl group having a carbon number of 10 to 40, claim 1 or 2. The morpholinonucleotide according to 2.
[Claim 5]
　L in the general formula (I) is a succinyl group, and
R 5 and / or R 7 is an alkyl group having 12 to 30 carbon atoms, morpholinoethyl nucleotides according to claim 1 or 2.
[Claim 6]
　L in the general formula (I) is a succinyl group, and
ZZ is a 3,4,5-tri (octadecyloxy) benzyloxy group,
3,5-di (docosyloxy) benzyloxy group,
3 , 5-bis [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzyloxy group,
3,4,5-tris [3', 4', 5'-tri (octadecyloxy) benzyloxy) ] Benzyloxy group,
3,4,5-tri (octadecyloxy) benzylamino group,
2,4-di (docosyloxy) benzylamino group,
3,5-di (docosyloxy) benzylamino group,
di (4-docosyl) Oxyphenyl) methylamino group,
4-methoxy-2- [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino group,
4-methoxy-2- [3', 4', 5' -Tri (octadecyloxy) cyclohexylmethyloxy] benzylamino group,
2,4-di (dodecyloxy) benzylamino group,
phenyl (2,3,4-tri (octadecyloxy) phenyl) methylamino group,
di [4- (12-docosyloxide decyloxy) phenyl] methylamino group,
3,5-bis [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino group, and

The morpholinonucleotide according to claim 1 or 2, which is a group selected from the group consisting of 3,4,5-tris [3', 4', 5'-tri (octadecyloxy) benzyloxy] benzylamino groups. ..
[Claim 7]
　ZZ is a
2- {2,4-di (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
3,5-di (2', 3'-dihydrophylli) Thiruoxy) benzyl succinyl group;
4- (2', 3'-dihydrophytyloxy) benzyl succinyl group;
2- {1-[(2-chloro-5- (2', 3'-dihydrophytyloxy)) Phenyl)] benzylaminocarbonyl} ethylcarbonyl group;
3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl succinyl group;
2- {3,4,5-tri (2', 3') -Dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {4- (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {2- [3', 4' , 5'-Tri (2'', 3''-dihydrophytyloxy) benzyloxy] -4-methoxybenzylaminocarbonyl} ethylcarbonyl group;
2- {4- (2', 3'-dihydrophytyloxy) ) -2-Methylbenzylaminocarbonyl} ethylcarbonyl group;
4- (2', 3'-dihydrophytyloxy) -2-methylbenzylsuccinyl group;
2- {4- (2', 3'-dihydrophytyl) Oxy) -2-methylbenzylaminocarbonyl} ethylcarbonyl group;
4- [2,2,4,8,10,10-hexamethyl-5-dodecanoylamino] benzyl succinyl group;
2- {4- [2,2,4,8,10,10-hexamethyl-5-dodeca Noylamino] benzylaminocarbonyl} ethylcarbonyl group;
4- (3,7,11-trimethyldodecyloxy) benzylsuccinyl group;
2- {4- (3,7,11-trimethyldodecyloxy) benzylaminocarbonyl} ethylcarbonyl Group;
2- {3,5-di (2', 3'-dihydrophytyloxy) benzylaminocarbonyl} ethylcarbonyl group;
2- {1- [2,3,4-tri (2', 3'-) Dihydrophytyloxy) phenyl] benzylaminocarbonyl} ethylcarbonyl group;
2- {1- [4- (2', 3'-dihydrophytyloxy) phenyl] -4'-(2', 3'-dihydrofi) Thiruoxy) benzylaminocarbonyl} ethylcarbonyl group;
3,4,5-tris [3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl] benzyl succinyl group; and
2- {3, 4.5-Tris [3,4,5-tri (2', 3'-dihydrophytyloxy) benzyl] benzylaminocarbonyl} The group according to
claim 1 or 2 , which is selected from the group consisting of an ethylcarbonyl group . Morphorinonucleotide.
[Claim 8]
The morpholinonucleotide according to any one of claims 1 to 7, wherein 　P 1 is a trityl group, a monomethoxytrityl group, or a dimethoxytrityl group.
[Claim 9]
　(2) The 5'-hydroxyl group is activated (thio) phosphate or activated (thio) phosphoramidated, and the morpholine ring nitrogen atom is protected by a temporary protecting group that can be removed under acidic conditions. Individually polymerized morpholino oligonucleotide (p represents an arbitrary integer of 1 or more), when the 5'-position hydroxyl group or the 5'-position hydroxyl group has a substituent having a hydroxyl group, the hydroxyl group existing on the substituent is N polymerized morpholino oligonucleotides protected by an alkyl group having 10 to 300 carbon atoms and / or an alkenyl group having 10 to 300 carbon atoms and not protected by a morpholine ring nitrogen atom (n is An arbitrary integer of 1 or more) and n + p polymerized morpho comprising the step of condensing with a (thio) phosphoramidate bond or a (thio) phosphoriamidate bond via the morpholine ring nitrogen atom. A method for producing a linoligonucleotide.
[Claim 10]
　The manufacturing method according to claim 9, wherein p is 1.
[Claim 11]
　The production method according to claim 9 or 10, wherein after completion of the reaction, the reaction mixture is treated with a quenching agent.
[Claim 12]
　The production method according to any one of claims 9 to 11, further comprising the following step (1).
(1) Before the condensation step (2), when the 5'-position hydroxyl group or the 5'-position hydroxyl group has a substituent in a non-polar solvent, the hydroxyl group existing on the substituent has 10 or more and 300 or less carbon atoms. N polymerized morpholino oligonucleotides protected by an alkyl group and / or a protecting group having an alkenyl group having 10 or more and 300 or less carbon atoms and a temporary protecting group in which the morpholine ring nitrogen atom can be removed under acidic conditions. Is reacted with an acid to remove the temporary protecting group of the morpholine ring nitrogen atom.
[Claim 13]
　The production method according to claim 12, wherein the temporary protecting group is removed in the presence of a cation scavenger.
[Claim 14]
　The production method according to claim 12 or 13, further comprising a step of removing the temporary protecting group of the morphophosphorus ring nitrogen atom and then neutralizing with an organic base in the step (1).
[Claim 15]
　A protective group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkenyl group having 10 or more and 300 or less carbon atoms has the following formula (II):
[Chemical formula 5]

[L is a single bond or formula (a1) :.
[Chemical

formula 6] [In the formula, * indicates the bond position with Y;
** indicates the bond position with S 1 ;
L 1 is a divalent C 1-22 hydrocarbon which may be substituted. Indicates a hydrogen group; and
L 2 indicates C (= O) or *** N (R 3 ) -R 1- N (R 2 ) C (= O) ** (in the formula, ** Indicates the connection position with L 1 , *** indicates the connection position with Y, and R 1Indicates a C 1-22 alkylene group which may be substituted , and R 2 and R 3 each independently indicate a hydrogen atom or a C 1-22 alkyl group which may be substituted , or R. 2 and R 3 may be combined to form a optionally substituted C 1-22 alkylene bond. ) Indicates a group. ] Indicates a group,
Y indicates a single bond, an oxygen atom, or NR (R indicates a hydrogen atom, an alkyl group or an aralkyl group), and
Z indicates the formula (a2):
[Chemical formula 7]. ]

[In the formula, * indicates the bond position with Y;
R 4 indicates a hydrogen atom, or when R b is a group represented by the following formula (a 3), R 6 and Together they may show a single bond or —O— to form a fluorenyl or xanthenyl group with ring B;
The k Qs either independently represent single bonds, or -O-, -S-, -OC (= O)-, -NHC (= O)-or -NH-;
k. R 5 independently represents an organic group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkoxy group having 10 or more and 300 or less carbon atoms, respectively;
k represents an integer of 1 to 4;
ring A represents an integer of 1 to 4. , k-number of QR 5 in addition to further halogen atoms, optionally substituted by a halogen atom C 1-6 alkyl group, and a C be substituted with a halogen atom 1-6 from the group consisting of an alkoxy group may have a substituent group selected;
R a represents a hydrogen atom;
R b is a hydrogen atom or formula (a3):
[formula 8]

(wherein, * represents a binding position ;
j represents an integer of 0 ~ 4;
j-number of Q represents the same meanings as defined above;
j-number of R 7Independently indicate an organic group having an alkyl group having 10 or more and 300 or less carbon atoms and / or an alkoxy group having 10 or more and 300 or less carbon atoms, respectively;
R 6 indicates a hydrogen atom or together with R 4. is to indicate a single bond or -O-, may form a fluorenyl group or a xanthenyl group together with ring a; and
ring B, j-number of QR 7 in addition to, substituted further halogen atom, a halogen atom which may be C 1-6 alkyl group, and a halogen atom a C substituted 1-6 may have a substituent group selected from the group consisting of an alkoxy group. ) Represents a group represented by, or
R a and R b together form an oxygen atom. ], The production method according to any one of claims 9 to 14.
[Claim 16]
　The production method according to claim 15, further comprising the following step (3).
　(3) A step of adding a polar solvent to the reaction solution obtained in the steps (1) and / or (2) to precipitate a morpholino oligonucleotide, and obtaining the reaction solution by solid-liquid separation.
[Claim 17]
　Claims 12 to 16, wherein the non-polar solvent is a solvent selected from the group consisting of halogen-based solvents, aromatic solvents, ester-based solvents, aliphatic solvents, non-polar ether-based solvents, and combinations thereof. The manufacturing method according to any one item.
[Claim 18]
　The production method according to claim 16 or 17, wherein the polar solvent is an alcohol solvent or a nitrile solvent.
[Claim 19]
　The production method according to any one of claims 9 to 18, further comprising the following step (4).
(4) A step of removing all protecting groups of the obtained n + p polymerized morpholino oligonucleotides.
[Claim 20]
　The production method according to any one of claims 9 to 19, wherein the temporary protecting group that can be removed under acidic conditions is a trityl group, a dimethoxytrityl group, or a monomethoxytrityl group.