Sign In to Follow Application
View All Documents & Correspondence

Ns2 Bns3 Pro Antigen For Diagnosis Of Dengue Virus Infections

Abstract: ABSTRACT: Title: NS2BNS3pro Antigen for Diagnosis of Dengue Virus Infections The present disclosure proposes a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect diagnostic test for dengue. The proposed method uses purified dengue virus NS2BNS3pro as an antigen in an indirect diagnostic test for dengue in order to trap anti-NS2BNS3pro antibodies. The proposed method is used for early detection of both primary and secondary infections with all the serotypes. An amino acid sequence of the antigen used in the proposed test is less conserved among flaviviruses.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
19 March 2021
Publication Number
38/2022
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
Parent Application

Applicants

University of Hyderabad
Gachibowli, Hyderabad-500046, Telangana, India.

Inventors

1. Dr.Musturi Venkataramana
Assistant Professor Department of Biotechnology & Bioinformatics, School of Life Sciences, University of Hyderabad, Gachibowli Hyderabad-500046, Telangana, India.
2. Ms.Chaitanya G
Department of Biotechnology & Bioinformatics, School of Life Sciences, University of Hyderabad, Gachibowli Hyderabad-500046 Telangana, India.
3. Ms.Lekha Gandhi
Department of Biotechnology & Bioinformatics, School of Life Sciences, University of Hyderabad, Gachibowli Hyderabad-500046, Telangana, India.
4. Ms.Deepti Maisnambi
Department of Biotechnology & Bioinformatics, School of Life Sciences, University of Hyderabad, Gachibowli Hyderabad-500046, Telangana, India.

Claims

1. A method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections, comprising: coating 96-well plates with 100µl of protein in carbonate buffer; incubating said coated well plates overnight at 4°C; washing said coated well plates with PBS-T for three time; blocking said washed coated well plates with 5% skimmed milk for one and half hour; incubating said washed coated well plates after adding 100ul of 1:100 diluted patient sera to said washed coated well plates, for one hour; incubating said washed coated well plates with anti-human HRP conjugate of 1:2000 for one hour after washing said washed coated well plates; incubating said washed coated well plates with 100ul of TMB substrate for 10 minutes; and terminating reaction by addition of 1N H2SO4,and recording absorbance at 450 nm.

2. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein concentration of said protein is 3µg/ml and said carbonate buffer is of pH 9.6.

3. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein said washed coated well plates are blocked with said skimmed milk at 37°C.

4. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein said washed coated well plates are incubated with said anti-human HRP conjugate at 37°C.

5. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein said washed coated well plates are incubated with said TMB substrate at 37°C.

6. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein NS2BNS3pro antigen construct is developed by extracting viral RNA from Den-1 infected serum sample. , Description:DESCRIPTION: Field of the invention: [0001] The present disclosure generally relates to the technical field of a reliable detection method of dengue virus infections, and in specific relates to a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect ELISA diagnostic test for dengue. Background of the invention: [0002] Arthropod born virus infections such as dengue and zika viruses, tops list in causing threat across the globe. Approximately 140 countries are at risk of dengue infections with 390 million infections every year. This virus circulates as four or five different serotypes with different genotypes among the serotypes. At present dengue virus infections changed from self-limiting level to a life threatening level. Attempts are being done to address the reason for the change to the severity of the disease. Many reasons have been put forward however, none could be convinced to be a sole reason for the severity. On the other hand, lack of a potential diagnostic test for all stages of the disease is mounting for the increase in severe dengue cases and also the number of deaths. [0003] Lack of proper diagnostics for early stage detection is an added reason for increasing mortality. The primary requirements for a dengue diagnostic test are sensitivity and specificity. The other requirements are ease of performing the cost. Early diagnosis of acute infection is critical for clinical management of severe disease, surveillance and outbreak investigations. The tests developed until now failed to satisfy all the factors due to the virus existence as different serotypes/genotypes with variable infection/multiplication potentialities, primary and secondary infections, stage of disease for samples collection, confused disease manifestations with other infections. A gold standard for dengue diagnosis is virus isolation, which is very expensive and needs technical expertise. Though RNA isolation and RT-PCR are sensitive but they have their limitations. [0004] At present, diagnostic tests in use for dengue detection are NS1 antigen detection and IgM/ IgG based ELISA. The disadvantage of IgG/IgM ELISA is the requirement of paired sera at acute and convalescent phases and their cross-reactivity with other flaviviruses. Although NS1 antigen detection is a reliable method for the early detection, it can be compromised in the case of secondary infections at the acute stage by pre-existing virus-IgG complexes and also it can be detected only in the first few days of illness. [0005] An attempt was done to evaluate the potentiality of NS3 as a diagnostic marker. Similarly, development of the tests for the detection of antibodies raised against the dengue virus structural and non-structural proteins was also attempted. Dengue virus antigen based serological tests are commercially available for dengue virus diagnosis but their costs are beyond the reach for the people of developing countries, where this virus is endemic. [0006] Several mechanisms have been tried to develop diagnostic tests for dengue virus infections. The main hurdles associated with this objective are, existence of the virus as different serotypes, primary and secondary infections, and cross reactivity with other flaviviruses (Zika, JEV) or non-flaviviruses like chikungunya. Among the developed tests, the NS1 antigen and the IgM/IgG based tests are being used for the dengue diagnosis at present. However, the NS1 levels for detection is available only for the first few days of infection and the IgM/IgG test requires paired samples and also less sensitive. Both tests are having problem of cross-reactivity with other viruses. [0007] Therefore, there is a need for developing a reliable diagnostic method that can be used for early detection of both primary and secondary infections with all serotypes. There is a need for a promising diagnostic agent for the dengue virus infections detection by taking into account of different stages of the infections, primary and secondary infections and different serotypes with different versions of un-translated regions. Objectives of the invention: [0008] The primary objective of the invention is to develop a diagnostic method that uses purified dengue virus NS2BNS3pro as an antigen for early detection of both primary and secondary infections with all serotypes. [0009] Another objective of the invention is to develop a dengue virus NS2BNS3pro construct. [0010] The other objective of the invention is to express and purify an NS2BNS3pro protein. [0011] Yet another objective of the invention is to screen the dengue virus infected clinical samples in order to trap the anti-NS2BNS3pro antibodies using an NS2BNS3pro protein as an antigen in an indirect ELISA. [0012] Further objective of the invention is to evaluate the NS2BNS3pro antibody based test as potential diagnostic test for dengue virus infections. Summary of the invention: [0013] The present disclosure proposes an NS2BNS3pro antigen for diagnosis of dengue virus infections. The following presents a simplified summary in order to provide a basic understanding of some aspects of the claimed subject matter. This summary is not an extensive overview. It is not intended to identify key/critical elements or to delineate the scope of the claimed subject matter. Its sole purpose is to present some concepts in a simplified form as a prelude to the more detailed description that is presented later. [0014] In order to overcome the above deficiencies of the prior art, the present disclosure is to solve the technical problem to provide a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect ELISA diagnostic test for dengue. [0015] According to an aspect, the invention provides a method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections. First, 96-well plates are coated with 100µl of protein in carbonate buffer, and then incubated overnight at 4°C. Next, the coated well plates are washed with PBS-T for three times, and then blocked with 5% skimmed milk for one and half hour at 37°C. Next, after subsequent washes with PBS-T, 100ul of 1:100 diluted patient sera is added to the coated well plates, and then incubated for an hour. Next, the coated well plates are washed, and then incubated with anti-human HRP conjugate of 1:2000 for an hour at 37°C. Next, the coated well plates are again washed, and then incubated with 100ul of TMB substrate for 10 min at 37°C. Later, reaction is terminated by addition of 1N H2SO4, and then absorbance is recorded at 450 nm. [0016] Further, NS2BNS3pro antigen construct is developed by extracting viral RNA from Den-1 infected serum sample. The concentration of the protein is 3µg/ml and the carbonate buffer is of pH 9.6. [0017] Further, objects and advantages of the present invention will be apparent from a study of the following portion of the specification, the claims, and the attached drawings. Detailed description of drawings: [0018] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate an embodiment of the invention, and, together with the description, explain the principles of the invention. [0019] FIG. 1 illustrates a method for early detection of dengue virus infections using NS2BNS3pro antigen in accordance to an exemplary embodiment of the invention. Detailed invention disclosure: [0020] Various embodiments of the present invention will be described in reference to the accompanying drawings. Wherever possible, same or similar reference numerals are used in the drawings and the description to refer to the same or like parts or steps. [0021] The present disclosure has been made with a view towards solving the problem with the prior art described above, and it is an object of the present invention to provide a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect diagnostic test for dengue. [0022] According to an exemplary embodiment of the invention, FIG. 1 refers to a method 100 for using an NS2BNS3pro antigen for diagnosis of dengue virus infections. At step 101, 96-well plates are coated with 100µl of protein in carbonate buffer. At step 102, the coated well plates are incubated overnight at 4°C. At step 103, the coated well plates are washed with PBS-T for three times. At step 104, the washed well plates are blocked with 5% skimmed milk for one and half hour at 37°C. At step 105, after subsequent washes with PBS-T, 100ul of 1:100 diluted patient sera is added to the coated well plates, and then incubated for an hour. At step 106, the coated well plates are washed, and then incubated with anti-human HRP conjugate of 1:2000 for an hour at 37°C. At step 107, the coated well plates are again washed, and then incubated with 100ul of TMB substrate for 10 minutes at 37°C. At 108, reaction is terminated by addition of 1N H2SO4, and then absorbance is recorded at 450 nm. [0023] According to another exemplary embodiment of the invention, to develop recombinant NS2BNS3pro construct, viral RNA was extracted from Den-1 infected serum sample. cDNA synthesis is performed by AMV reverse transcriptase using gene-specific reverse primers, NS2B and NS3pro. Further, amplifications are carried out by high fidelity DNA polymerase. The expression construct consists of 48 amino acids (hydrophobic region) of NS2B and 185 amino acid protease domain of NS3 are linked via a G4-S-G4 linker sequence. The NS2B is amplified by using forward primer, NS2B F-TATGGGATCCGCTGATTTATCATTGGAGAAA, and reverse primer, NS2B R-CCCGCCTCCACCACTACCTCCGCCCCCGAGCGTGTCATCTCTCTCTTCAT and NS3pro is amplified using forward primer, NS3 FGGGGGCGGAGGTAGTGGTGGAGGCGGGAGAGCAGTTCTTGATGATGGTA, and reverse primer, NS3R-ATCGAGAATTCTTACCTAAACACCTCGTCCTCAATC. The obtained gene products are used as templates with external primers for overlap extension PCR to generate NS2B-Gly-NS3pro. This amplified DNA is digested with Eco RI and Bam HI restriction enzymes and then cloned into similarly digested pRSET-A vector. [0024] According to another exemplary embodiment of the invention, the pRSET-A construct containing the NS2B-Gly-NS3pro sequence is transformed into E. coli (BL21 DE3) cells and grown in 500 ml of Luria broth medium containing 100ug/ml ampicillin at 37°C with continuous shaking until the OD600 reached 0.6. Expression is induced by 0.6 mM IPTG, and cells were further grown for 18 hrs at 18°C. The cells are pelleted and re-suspended in lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 10mM imidazole and 5% glycerol). The cells are incubated for 30 mins and lysed on ice by sonication using Ultrasonic processor. [0025] The lysate is subjected to centrifugation and supernatant was separated. His-tagged protein is purified from the supernatant by Ni-NTA affinity chromatography. The supernatant is passed through the pre-equilibrated Ni-NTA agarose resin, and the column is washed with lysis buffer containing 20-50 mM imidazole. The protein is eluted in lysis buffer containing 250mM imidazole. The protein fractions are pooled and dialyzed at 4°C using 10 kDa cut-off membrane against two batches of buffer, buffer A (50 mM Tris, pH 8.0, 150mM NaCl and 5% glycerol) and buffer B (50 mM Tris, pH 8.0, 5% glycerol and 5% ethylene glycol). Protein concentration is determined by Bradford assay using BSA as a standard, and the aliquots are stored at -800C in 35% glycerol. [0026] According to another exemplary embodiment of the invention, purified recombinant NS2BNS3pro protein is used as antigen for indirect ELISA. The NS3, which is part of the NS2BNS3pro, is reported to be one of the highly immunogenic among dengue virus coded proteins. The NS3 protein is the least conserved with reference to the other flaviviruses which minimizes the cross reactivity. The NS3 protein is nearly 65% conserved with in the different serotypes of dengue virus and facilitate for the detection of the antibodies of all serotypes of dengue virus. [0027] In addition, the NS2BNS3pro is catalytically active as, the NS2BNS3pro is being used for the drug molecules and hence indicated similarity with natural confirmation. This feature of the protein allows the protein for exhibiting all epitopes for antibodies to bind which are raised due to natural infections. [0028] According to another exemplary embodiment of the invention, to determine diagnostic potential of the recombinant NS2BNS3pro, 40 other febrile samples and 104 dengue-infected samples are screened for the presence of antibodies. A panel of samples are used for assay, which includes NS1 antigen-positive samples, IgM and IgG positive samples, RT-PCR positive samples, healthy samples and dengue-suspected samples negative for the above tests. Out of the 104 dengue-infected samples, 61 samples are tested positive for the NS2BNS3pro antibodies with absorbance ranging from 1.2 to 2.7. OD values of 23 other febrile samples ranged from 0.2 to 0.8. 17 other febrile (dengue-suspected) samples tested positive only for the NS2BNS3pro antibodies by ELISA. [0029] Numerous advantages of the present disclosure may be apparent from the discussion above. In accordance with the present disclosure, a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect diagnostic test for dengue is disclosed herein. [0030] The purified dengue virus NS2BNS3pro used as the antigen in the indirect diagnostic test, detects the dengue positive samples for which the other tests failed indicated the high sensitivity. The amino acid sequence of the antigen used in the present test is less conserved (40%) among the flaviviruses (Zika, JEV and CHIKV (non-flavi), the specificity of the test will be more compared to the existing tests. [0031] It will readily be apparent that numerous modifications and alterations can be made to the processes described in the foregoing examples without departing from the principles underlying the invention, and all such modifications and alterations are intended to be embraced by this application.

Specification

Claims:CLAIMS:
I / We Claim:
1. A method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections, comprising:
coating 96-well plates with 100µl of protein in carbonate buffer;
incubating said coated well plates overnight at 4°C;
washing said coated well plates with PBS-T for three time;
blocking said washed coated well plates with 5% skimmed milk for one and half hour;
incubating said washed coated well plates after adding 100ul of 1:100 diluted patient sera to said washed coated well plates, for one hour;
incubating said washed coated well plates with anti-human HRP conjugate of 1:2000 for one hour after washing said washed coated well plates;
incubating said washed coated well plates with 100ul of TMB substrate for 10 minutes; and
terminating reaction by addition of 1N H2SO4,and recording absorbance at 450 nm.
2. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein concentration of said protein is 3µg/ml and said carbonate buffer is of pH 9.6.
3. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein said washed coated well plates are blocked with said skimmed milk at 37°C.
4. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein said washed coated well plates are incubated with said anti-human HRP conjugate at 37°C.
5. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein said washed coated well plates are incubated with said TMB substrate at 37°C.
6. The method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections as recited in claim 1, wherein NS2BNS3pro antigen construct is developed by extracting viral RNA from Den-1 infected serum sample. , Description:DESCRIPTION:
Field of the invention:
[0001] The present disclosure generally relates to the technical field of a reliable detection method of dengue virus infections, and in specific relates to a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect ELISA diagnostic test for dengue.
Background of the invention:
[0002] Arthropod born virus infections such as dengue and zika viruses, tops list in causing threat across the globe. Approximately 140 countries are at risk of dengue infections with 390 million infections every year. This virus circulates as four or five different serotypes with different genotypes among the serotypes. At present dengue virus infections changed from self-limiting level to a life threatening level. Attempts are being done to address the reason for the change to the severity of the disease. Many reasons have been put forward however, none could be convinced to be a sole reason for the severity. On the other hand, lack of a potential diagnostic test for all stages of the disease is mounting for the increase in severe dengue cases and also the number of deaths.

[0003] Lack of proper diagnostics for early stage detection is an added reason for increasing mortality. The primary requirements for a dengue diagnostic test are sensitivity and specificity. The other requirements are ease of performing the cost. Early diagnosis of acute infection is critical for clinical management of severe disease, surveillance and outbreak investigations. The tests developed until now failed to satisfy all the factors due to the virus existence as different serotypes/genotypes with variable infection/multiplication potentialities, primary and secondary infections, stage of disease for samples collection, confused disease manifestations with other infections. A gold standard for dengue diagnosis is virus isolation, which is very expensive and needs technical expertise. Though RNA isolation and RT-PCR are sensitive but they have their limitations.

[0004] At present, diagnostic tests in use for dengue detection are NS1 antigen detection and IgM/ IgG based ELISA. The disadvantage of IgG/IgM ELISA is the requirement of paired sera at acute and convalescent phases and their cross-reactivity with other flaviviruses. Although NS1 antigen detection is a reliable method for the early detection, it can be compromised in the case of secondary infections at the acute stage by pre-existing virus-IgG complexes and also it can be detected only in the first few days of illness.

[0005] An attempt was done to evaluate the potentiality of NS3 as a diagnostic marker. Similarly, development of the tests for the detection of antibodies raised against the dengue virus structural and non-structural proteins was also attempted. Dengue virus antigen based serological tests are commercially available for dengue virus diagnosis but their costs are beyond the reach for the people of developing countries, where this virus is endemic.

[0006] Several mechanisms have been tried to develop diagnostic tests for dengue virus infections. The main hurdles associated with this objective are, existence of the virus as different serotypes, primary and secondary infections, and cross reactivity with other flaviviruses (Zika, JEV) or non-flaviviruses like chikungunya. Among the developed tests, the NS1 antigen and the IgM/IgG based tests are being used for the dengue diagnosis at present. However, the NS1 levels for detection is available only for the first few days of infection and the IgM/IgG test requires paired samples and also less sensitive. Both tests are having problem of cross-reactivity with other viruses.

[0007] Therefore, there is a need for developing a reliable diagnostic method that can be used for early detection of both primary and secondary infections with all serotypes. There is a need for a promising diagnostic agent for the dengue virus infections detection by taking into account of different stages of the infections, primary and secondary infections and different serotypes with different versions of un-translated regions.
Objectives of the invention:
[0008] The primary objective of the invention is to develop a diagnostic method that uses purified dengue virus NS2BNS3pro as an antigen for early detection of both primary and secondary infections with all serotypes.

[0009] Another objective of the invention is to develop a dengue virus NS2BNS3pro construct.

[0010] The other objective of the invention is to express and purify an NS2BNS3pro protein.

[0011] Yet another objective of the invention is to screen the dengue virus infected clinical samples in order to trap the anti-NS2BNS3pro antibodies using an NS2BNS3pro protein as an antigen in an indirect ELISA.

[0012] Further objective of the invention is to evaluate the NS2BNS3pro antibody based test as potential diagnostic test for dengue virus infections.
Summary of the invention:
[0013] The present disclosure proposes an NS2BNS3pro antigen for diagnosis of dengue virus infections. The following presents a simplified summary in order to provide a basic understanding of some aspects of the claimed subject matter. This summary is not an extensive overview. It is not intended to identify key/critical elements or to delineate the scope of the claimed subject matter. Its sole purpose is to present some concepts in a simplified form as a prelude to the more detailed description that is presented later.

[0014] In order to overcome the above deficiencies of the prior art, the present disclosure is to solve the technical problem to provide a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect ELISA diagnostic test for dengue.

[0015] According to an aspect, the invention provides a method for using an NS2BNS3pro antigen for diagnosis of dengue virus infections. First, 96-well plates are coated with 100µl of protein in carbonate buffer, and then incubated overnight at 4°C. Next, the coated well plates are washed with PBS-T for three times, and then blocked with 5% skimmed milk for one and half hour at 37°C. Next, after subsequent washes with PBS-T, 100ul of 1:100 diluted patient sera is added to the coated well plates, and then incubated for an hour. Next, the coated well plates are washed, and then incubated with anti-human HRP conjugate of 1:2000 for an hour at 37°C. Next, the coated well plates are again washed, and then incubated with 100ul of TMB substrate for 10 min at 37°C. Later, reaction is terminated by addition of 1N H2SO4, and then absorbance is recorded at 450 nm.

[0016] Further, NS2BNS3pro antigen construct is developed by extracting viral RNA from Den-1 infected serum sample. The concentration of the protein is 3µg/ml and the carbonate buffer is of pH 9.6.

[0017] Further, objects and advantages of the present invention will be apparent from a study of the following portion of the specification, the claims, and the attached drawings.
Detailed description of drawings:
[0018] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate an embodiment of the invention, and, together with the description, explain the principles of the invention.

[0019] FIG. 1 illustrates a method for early detection of dengue virus infections using NS2BNS3pro antigen in accordance to an exemplary embodiment of the invention.
Detailed invention disclosure:
[0020] Various embodiments of the present invention will be described in reference to the accompanying drawings. Wherever possible, same or similar reference numerals are used in the drawings and the description to refer to the same or like parts or steps.

[0021] The present disclosure has been made with a view towards solving the problem with the prior art described above, and it is an object of the present invention to provide a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect diagnostic test for dengue.

[0022] According to an exemplary embodiment of the invention, FIG. 1 refers to a method 100 for using an NS2BNS3pro antigen for diagnosis of dengue virus infections. At step 101, 96-well plates are coated with 100µl of protein in carbonate buffer. At step 102, the coated well plates are incubated overnight at 4°C. At step 103, the coated well plates are washed with PBS-T for three times. At step 104, the washed well plates are blocked with 5% skimmed milk for one and half hour at 37°C. At step 105, after subsequent washes with PBS-T, 100ul of 1:100 diluted patient sera is added to the coated well plates, and then incubated for an hour. At step 106, the coated well plates are washed, and then incubated with anti-human HRP conjugate of 1:2000 for an hour at 37°C. At step 107, the coated well plates are again washed, and then incubated with 100ul of TMB substrate for 10 minutes at 37°C. At 108, reaction is terminated by addition of 1N H2SO4, and then absorbance is recorded at 450 nm.

[0023] According to another exemplary embodiment of the invention, to develop recombinant NS2BNS3pro construct, viral RNA was extracted from Den-1 infected serum sample. cDNA synthesis is performed by AMV reverse transcriptase using gene-specific reverse primers, NS2B and NS3pro. Further, amplifications are carried out by high fidelity DNA polymerase. The expression construct consists of 48 amino acids (hydrophobic region) of NS2B and 185 amino acid protease domain of NS3 are linked via a G4-S-G4 linker sequence. The NS2B is amplified by using forward primer, NS2B F-TATGGGATCCGCTGATTTATCATTGGAGAAA, and reverse primer, NS2B R-CCCGCCTCCACCACTACCTCCGCCCCCGAGCGTGTCATCTCTCTCTTCAT and NS3pro is amplified using forward primer, NS3 FGGGGGCGGAGGTAGTGGTGGAGGCGGGAGAGCAGTTCTTGATGATGGTA, and reverse primer, NS3R-ATCGAGAATTCTTACCTAAACACCTCGTCCTCAATC. The obtained gene products are used as templates with external primers for overlap extension PCR to generate NS2B-Gly-NS3pro. This amplified DNA is digested with Eco RI and Bam HI restriction enzymes and then cloned into similarly digested pRSET-A vector.

[0024] According to another exemplary embodiment of the invention, the pRSET-A construct containing the NS2B-Gly-NS3pro sequence is transformed into E. coli (BL21 DE3) cells and grown in 500 ml of Luria broth medium containing 100ug/ml ampicillin at 37°C with continuous shaking until the OD600 reached 0.6. Expression is induced by 0.6 mM IPTG, and cells were further grown for 18 hrs at 18°C. The cells are pelleted and re-suspended in lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 10mM imidazole and 5% glycerol). The cells are incubated for 30 mins and lysed on ice by sonication using Ultrasonic processor.

[0025] The lysate is subjected to centrifugation and supernatant was separated. His-tagged protein is purified from the supernatant by Ni-NTA affinity chromatography. The supernatant is passed through the pre-equilibrated Ni-NTA agarose resin, and the column is washed with lysis buffer containing 20-50 mM imidazole. The protein is eluted in lysis buffer containing 250mM imidazole. The protein fractions are pooled and dialyzed at 4°C using 10 kDa cut-off membrane against two batches of buffer, buffer A (50 mM Tris, pH 8.0, 150mM NaCl and 5% glycerol) and buffer B (50 mM Tris, pH 8.0, 5% glycerol and 5% ethylene glycol). Protein concentration is determined by Bradford assay using BSA as a standard, and the aliquots are stored at -800C in 35% glycerol.

[0026] According to another exemplary embodiment of the invention, purified recombinant NS2BNS3pro protein is used as antigen for indirect ELISA. The NS3, which is part of the NS2BNS3pro, is reported to be one of the highly immunogenic among dengue virus coded proteins. The NS3 protein is the least conserved with reference to the other flaviviruses which minimizes the cross reactivity. The NS3 protein is nearly 65% conserved with in the different serotypes of dengue virus and facilitate for the detection of the antibodies of all serotypes of dengue virus.

[0027] In addition, the NS2BNS3pro is catalytically active as, the NS2BNS3pro is being used for the drug molecules and hence indicated similarity with natural confirmation. This feature of the protein allows the protein for exhibiting all epitopes for antibodies to bind which are raised due to natural infections.

[0028] According to another exemplary embodiment of the invention, to determine diagnostic potential of the recombinant NS2BNS3pro, 40 other febrile samples and 104 dengue-infected samples are screened for the presence of antibodies. A panel of samples are used for assay, which includes NS1 antigen-positive samples, IgM and IgG positive samples, RT-PCR positive samples, healthy samples and dengue-suspected samples negative for the above tests. Out of the 104 dengue-infected samples, 61 samples are tested positive for the NS2BNS3pro antibodies with absorbance ranging from 1.2 to 2.7. OD values of 23 other febrile samples ranged from 0.2 to 0.8. 17 other febrile (dengue-suspected) samples tested positive only for the NS2BNS3pro antibodies by ELISA.

[0029] Numerous advantages of the present disclosure may be apparent from the discussion above. In accordance with the present disclosure, a method that uses a purified dengue virus NS2BNS3pro as an antigen in an indirect diagnostic test for dengue is disclosed herein.

[0030] The purified dengue virus NS2BNS3pro used as the antigen in the indirect diagnostic test, detects the dengue positive samples for which the other tests failed indicated the high sensitivity. The amino acid sequence of the antigen used in the present test is less conserved (40%) among the flaviviruses (Zika, JEV and CHIKV (non-flavi), the specificity of the test will be more compared to the existing tests.

[0031] It will readily be apparent that numerous modifications and alterations can be made to the processes described in the foregoing examples without departing from the principles underlying the invention, and all such modifications and alterations are intended to be embraced by this application.

Documents

Application Documents

# Name Date
1 202141011672-STATEMENT OF UNDERTAKING (FORM 3) [19-03-2021(online)].pdf 2021-03-19
2 202141011672-POWER OF AUTHORITY [19-03-2021(online)].pdf 2021-03-19
3 202141011672-FORM 1 [19-03-2021(online)].pdf 2021-03-19
4 202141011672-DRAWINGS [19-03-2021(online)].pdf 2021-03-19
5 202141011672-DECLARATION OF INVENTORSHIP (FORM 5) [19-03-2021(online)].pdf 2021-03-19
6 202141011672-COMPLETE SPECIFICATION [19-03-2021(online)].pdf 2021-03-19
7 202141011672-Correspondence, Form-1, Form-3, Form-5 And POA_22-03-2021.pdf 2021-03-22
8 202141011672-EVIDENCE FOR REGISTRATION UNDER SSI [07-11-2023(online)].pdf 2023-11-07
9 202141011672-EDUCATIONAL INSTITUTION(S) [07-11-2023(online)].pdf 2023-11-07
10 202141011672-FORM 18 [08-11-2023(online)].pdf 2023-11-08