Sign In to Follow Application
View All Documents & Correspondence

"Polynucleotide Sequences"

Abstract: Nucleotide sequences and the expression products thereof are described for use in the production of transgenic plants. In particular polynucleotides comprising a sequence selected from those depicted in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5 are provided.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
07 February 2001
Publication Number
16/2007
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

ZENECA LIMITED
15 STANHOPE GATE, LONDON, W1Y 6LN,

Inventors

1. IAN JEFFREY EVANS
C/O JEALOTTS HILL INTERNATIONAL RESEARCH CENTRE, BRACKNELL, BERKSHIRE RG42 6ET,
2. JOHN ANTHONY RAY
C/O JEALOTTS HILL INTERNATIONAL RESEARCH CENTRE, BRACKNELL, BERKSHIRE RG42 6ET,

Specification

FORM 2
THE PATENTS ACT 1970
[39 OF 1970]
COMPLETE SPECIFICATION
[See Section 10]
"POLYNUCLEOTIDE SEQUENCES"
ZENECA LIMITED, A British company., 15 Stanhope Gate, London, WIY 6LN, England
The following specification particularly describes the nature of the invention and the manner in which it is to be performed :-


WO 00/11196 PCT/GB99/02720
- 1 -
POLYNUCLEOTIDE SEQUENCES The present invention relates to recombinant DNA technology, and in particular to nucleotide sequences (and expression products thereof) which are used in the production of transgenic plants.
5 The present invention provides, inter alia, nucleotide sequences useful in the
production of plants which show improved resistance to infection by microorganisms such as bacteria and fungi.
According to the present invention there is provided a polynucleotide comprising a sequence selected from those depicted in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ 10 ID No. 4 and SEQ ID No. 5.
Also included within the invention is the translation product of the said polynucleotide sequences depicted in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5.
The invention further provides a polynucleotide sequence comprising a sequence
15 selected from the group consisting of nucleotides 53 to 385 in SEQ ID No. 1, nucleotides 11
to 334 in SEQ ID No. 2, nucleotides 24 to 317 in SEQ IP No. 3, nucleotides 20 to 343 in
SEQ ID No. 4 or nucleotides 1 to 446 in SEQ ID No. 5. Also included within the invention
is the translation product of the region comprised by nucleotides 53 to 385 in SEQ ID No. 1,
by nucleotides 11 to 334 in SEQ ID No. 2, by,nucleotides24to317inSEQIDNo. 3 or by
20 nucleotides 20 to 343 in SEQ ID No. 4 or nucleotides 1 to 446 in SEQ ID No. 5 and protein
having an amino acid sequence which is at least 85% similar to said product. The said
translation product is a preproprotein comprising a signal sequence, protein encoding
sequence and C-terminal propeptide which is naturally processed to yield mature biologically
active protein.
25 The invention further provides a polynucleotide sequence comprising a sequence
selected from the group consisting of nucleotides 137 to 286 in SEQ ID No. 1, nucleotides 95 to 244 in SEQ ID No. 2, nucleotides 108 to 257 in SEQ ID No. 3, nucleotides 104 to 253 in SEQ ID No. 4 or nucleotides 177 to 326 in SEQ ID No. 5. These polynucleotide sequences are especially preferred. Also included within the invention and especially 30 preferred is the translation product of the region comprised by nucleotides 137 to 286 in SEQ ID No. 1, by nucleotides 95 to 244 in SEQ ID No. 2, by nucleotides 108 to 257 in SEQ ID

WO 00/11196 PCT/GB99/02720
-4-
solution containing 5 X SSC (saline sodium citrate buffer) containing 0.1% SDS and 0.25% powdered skimmed milk followed by washing at the same temperature with 0.1, 0.5 or2x SSC containing 0.1% SDS still hybridises with a sequence depicted in SEQ ID No 1, SEQ ID No 2, SEQ ID No3, SEQ ID No.4 or SEQ ID No.5 with the proviso that the sequence is
5 not that described in SEQ ID No.6 or 7.
The polynucleotide sequence provided in SEQ ID Nos 6 and 7 is the predicted DNA sequence for Dm-AMP 1 and Dm-AMP2 as described in Figure 31A of Published International Patent Application No. WO 93/05153.
The invention still further includes a polynucleotide encoding a protein having a
10 substantially similar activity to any one of the group selected from that encoded by nucleotides 53 to 385 in SEQ ID No. 1, by nucleotides 11 to 334 in SEQ ID No. 2, by nucleotides 24 to 317 in SEQ ID No. 3, by nucleotides 20 to 343 in SEQ ID No, 4 or by nucleotides 1 to 446 in SEQ ID No.5 which polynucleotide is complementary to one which when incubated at a temperature of between 55 and 65°C in a solution containing 5 X SSC
15 (saline sodium citrate buffer) containing 0.1% SDS and 0.25% powdered skimmed milk followed by washing at the same temperature with 0.1, 0.5 or2x SSC containing 0.1% SDS still hybridises with a sequence depicted by nucleotides 53to 385 in SEQ ID No. 1, by nucleotides 11 to 334 in SEQ ID No. 2, by nucleotides 24 to 317 in SEQ ID No. 3, by nucleotides 20 to 343 in SEQ ID No. 4 or by nucleotides 1 to 446 in SEQ ID No.5. with the
20 proviso that said sequence is not that described in SEQ ID No. 6 or SEQ ID No. 7.
The invention still further includes a polynucleotide encoding a protein having a substantially similar activity to any one of the group selected from that encoded by nucleotides 137 to 286 in SEQ ID No. 1, by nucleotides 95 to 244 in SEQ ID No. 2, by nucleotides 108 to 257 in SEQ ID No. 3,'by nucleotides 104 to 253 in SEQ ID No. 4 or by
25 nucleotides 177 to 326 in SEQ ID No.5 which polynucleotide is complementary to one
which when incubated at a temperature of between 55 and 65°C in a solution containing 5 X SSC (saline sodium citrate buffer) containing 0.1% SDS and 0.25% powdered skimmed milk followed by washing at the same temperature with 0.1, 0.5 or2x SSC containing 0.1% SDS still hybridises with a sequence depicted by nucleotides 137 to 286 in SEQ ID No. 1, by
30 nucleotides 95 to 244 in SEQ ID No. 2, by nucleotides 108 to 257 in SEQ ID No. 3, by

WO 00/11196 PCT/GB99/02720
-5-
nucleotides 104 to 253 in SEQ ID No. 4 or by nucleotides 177 to 326 in SEQ ID No.5. with the proviso that said sequence is not that described in SEQ ID No. 6 or SEQ ID No. 7.
The invention still further includes a polynucleotide encoding a protein having a substantially similar activity to any one of the group selected from that encoded by
5 nucleotides 287 to 385 in SEQ ID NO. 1, nucleotides 245 to 334 in SEQ ID No. 2, nucleotides 258 to 317 in SEQ ID No. 3, nucleotides 254 to 343 in SEQ ID No. 4 or nucleotides 327 to 446 in SEQ ID No.5. which polynucleotide is complementary to one which when incubated at a temperature of between 55 and 65°C in a solution containing 5 X SSC (saline sodium citrate buffer) containing 0.1% SDS and 0.25% powdered skimmed milk
10 followed by washing at the same temperature with 0.1, 0.5 or 2x SSC containing 0.1% SDS still hybridises with a sequence depicted by nucleotides 287 to 385 in SEQ ID NO. 1, nucleotides 245 to 334 in SEQ ID No. 2, nucleotides 258 to 317 in SEQ ID No. 3, nucleotides 254 to 343 in SEQ ID No. 4 or nucleotides 327 to 446 in SEQ ID No.5. with the proviso that said sequence is not that described in SEQ ID No. 6 or SEQ ID No. 7.
15 It may be desired to target the translation products of the polynucleotide to specific
sub-cellular compartments within the plant cell, in which case the polynucleotide comprises sequences encoding chloroplast transit peptides, cell wall targeting sequences etc. immediately 5' of the regions encoding the said translation products.
Translational expression of the protein encoding sequences contained within the
20 polynucleotide may be relatively enhanced by including known non translatable translational enhancing sequences 5* of the said protein encoding sequences. The skilled man is very familiar with such enhancing sequences, which include the TMV-derived sequences known as omega, and omega prime, as well as other sequences derivable, inter alia, from the regions 5' of other viral coat protein encoding sequences.
25 In a particularly preferred embodiment of the invention, the polynucleotide is
modified in that mRNA instability motifs and/or fortuitous splice regions are removed, or plant preferred codons are used so that expression of the thus modified polynucleotide in a plant yields substantially similar protein having a substantially similar activity/function to that obtained by expression of the unmodified polynucleotide in the organism in which the
30 protein encoding regions of the unmodified polynucleotide are endogenous, with the proviso that if the thus modified polynucleotide comprises plant preferred codons, the degree of

WO 00/11196

-6-

PCT/GB99/02720

identity between the modified polynucleotide and a polynucleotide endogenously contained within the said plant and encoding substantially the same protein is less than about 60%.
The invention also includes a plant transformation vector comprising a plant operable promoter, a polynucleotide sequence comprising all or part of the sequence selected from 5 those depicted in SEQ ID'No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No.5 under the transcriptional control thereof and encoding an antimicrobial protein, and a plant operable transcription terminator. The promoter may be constitutive or inducible. In particular, the promoter may be such that it induces transcription in response to application to the plant material containing it of a chemical.
10 The invention further provides a plant transformation vector comprising a
polynucleotide sequence selected from the group consisting of nucleotides 137 to 286 in SEQ ID No. 1, nucleotides 95 to 244 in SEQ ID No. 2, nucleotides 108 to 257 in SEQ ID No. 3, nucleotides 104 to 253 in SEQ ID No. 4 or nucleotides 177 to 326 in SEQ ID No.5 under the transcriptional control of a plant operable promoter, and a plant operable
15 transcriptional terminator.
The polynucleotide sequences provided in SEQ ID No 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No.5 are related sequences with the translated products thereof showing a high degree of sequence similarity and it is believed that they may belong to a multi gene family.
20 The invention still further includes plant tissue transformed with the said
polynucleotide or vector, and material derived from the said transformed plant tissue, as well as morphologically normal fertile whole plants comprising the tissue or material. Such transformed plants include but are not limited to, field crops, fruits and vegetables such as canola, sunflower, tobacco, sugar beet, cotton, maize, wheat, barley, rice, sorghum, tomato,
25 mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, cabbage, onion, etc. Particularly preferred genetically modified plants are bananas.
The invention still further includes the progeny of the plants of the preceding paragraph, which progeny comprises a polynucleotide of the invention stably incorporated into its genome and heritable in a mendelian manner and the seeds of such plants and such
30 progeny.

WO 00/11196

-7-

POYGB99/02720

The invention also provides a method of producing plants which are substantially tolerant or substantially resistant to antimicrobial infection, comprising the steps of:
(i) transforming plant material with a polynucleotide or vector of the invention;
(ii) selecting the thus transformed material; and
5 (iii) regenerating the thus selected material into morphologically normal fertile
whole plants.
Plant transformation, selection and regeneration techniques, which may require routine modification in respect of a particular plant species, are well known to the skilled man.
10 The invention also provides the use of a polynucleotide as described herein or a
vector described herein in the production of plant tissues and/or morphologically normal fertile whole plants which are substantially tolerant or substantially resistant to microbial infection.
In a further aspect the invention provides a method of selectively controlling
15 microorganisms at a locus comprising the plants, progeny and/or seeds described herein
comprising applying to the locus a microorganism controlling amount of the translation
product of the region comprised by nucleotides 137 to 286 in SEQ ID No. 1.; nucleotides 95
to 244 in SEQ ID No.2, nucleotides 108 to 257 in SEQ ID No. 3, or nucleotides 104 to 253
in SEQ ID No. 4. ,
20 In a still further aspect the invention provides the use of a polynucleotide according
to the invention described herein , or a vector as described herein in the production of an antimicrobial protein.
The invention will be further apparent from the following description taken in conjunction with the associated figures and sequence listings in which :
25 Figure 1 shows the polynucleotide and corresponding amino acid sequences for A) Dml (SEQ ID No5) and B) Dm2.18 (SEQ ID No 1),
Figure 2 shows the polynucleotide and corresponding amino acid sequences for A) Dm2.1 (SEQ ID No2) and B) Dm2.3 (SEQ ID No3),

WO 00/11196 PCT/GB99/02720
-8-
Figure 3 shows the polynucleotide and corresponding amino acid sequence for Dm2.5 (SEQ
ID No. 4),
Figure 4 shows a diagrammatic map of plasmids pMJBl, pDmAMPD and pDmAMPE;
Figure 5 shows a diagrammatic map of plasmid pFAJ3106; 5 Figure 6 shows a diagrammatic map of plasmid pFAJ3109
Figure 7 shows the nucleotide sequence between the Xhol and SacI sites of pFAJ3106;
Figure 8 shows the nucleotide sequence between the Xhol and SacI sites of pFAJ3109;
Figure 9 shows a diagrammatic map of plasmid pZPS38;
Figure 10 shows a diagrammatic map of plasmid pZPS34; 10 Figure 11 shows a diagrammatic map of plasmid pZPS35;
Figure 12 shows a diagrammatic map of plasmid pZPS37.
Figure 13 shows a plan of the construction of the Dm-AMP gene
Figure 14 shows one predicted polynucleotide sequence for DmAMPl (SEQ ID No. 6) and
Dm-AMP2 (SEQ ID No. 7). 15 Figure 15 shows a diagrammatic map of plasmid pAID-MR7
EXAMPLE 1
Dm Gene Isolation and Vector Construction 20 Dahlia cDNA library construction
Near-dry seeds were collected fromllowers of Dahlia merkii.
Total RNA was purified from the seeds using the method of Jepson et al. (Plant Molecular
Biology Reporter 9 131-138 (1991)).
Seeds were frozen in liquid nitrogen anoVground to a fine powder using a mortar and pestle. 25 PhenoVm-cresol (9:1) was added followed by RNA homogenisation buffer and the mixture
ground until a fine paste was obtained. The mixture was spun, the aqueous phase collected
and extracted twice with phenol/chloroform (1:1). Lithium chloride (12 M) was added to the
resulting aqueous layer to a final concentration of 2 M and incubated overnight at 4°C.
Precipitated RNA was collected by spinning at 13,000 rpm in an Eppendorf centrifuge and 30 the RNA pellet re-suspended in 5 mM Tris-HCl, pH 7.5. A second overnight lithium chloride

WO 00/11196 PCT/GB99/02720
-9-
precipitation was carried out and the RNA collected and re-suspended in 5 mM Tris-HCl, pH
7.5.
0.6 mg of total RNA was obtained from 2 g of D. merkii seed.
PolyATract magnetic beads (Promega) were used to isolate approximately 2 ug poIy-A*
5 RNA from 0.2 mg of total RNA.
The poly-A+ RNA was used to construct a cDNA library using a ZAP-cDNA synthesis kit (Stratagene). Following first and second strand synthesis double stranded cDNA was size fractionated on a Sephacryl S-400 column. The three largest cDNA size fractions were pooled and ligated with vector DNA. After phage assembly using Gigapack Gold
10 (Stratagene) packaging extracts, approximately 1 x 105 pfu were obtained. Probing
Dahlia genomic DNA was prepared from 100 mg of developing Dahlia seeds and flower tissue. Tissue was homogenised in a 1.5 ml Eppendorf tube with a conical plastic pestle. 400 ul of a solution containing 0.2M Tris-HCl pH 8.5, 0.25M NaCI, 0.025 M EDTA and 0.5%
15 SDS was added and the tube vortexed for 5 seconds. Cell debris was pelleted by spinning at 13,000 rpm for 1 minute in a MSE bench top micro centrifuge. 300 ul of aqueous extract was transferred to a fresh Eppendorf tube. Genomic DNA was precipitated by the addition of 300 ul isopropyl alcohol and incubation at room temperature for 2 minutes. Genomic DNA was pelleted by spinning at 13,000 rpm for 5 minutes. The ethanol/aqueous supernatant was
20 removed from the tube by pipette and the genomic DNA pellet allowed to air dry. Genomic DNA was then resuspended in 30 ul *120.
To amplify a 144 bp fragment of DNA encoding 48 amino acids of the mature Dm-AMPl a PCR was carried out with Dahlia genomic DNA and oligonucleotides AFP-5 (based on Dm-AMPl N-terminal amino acid sequence CEKASKTW) and AFP-3EX (based on Dm-AMPl
25 C-terminal amino acid sequence MCFCYFNC). Using the following conditions 94°C, 60 seconds, 48°C, 12 seconds and 72°C, 60 seconds for 35 cycles. A PCR product of approximately 150 bp was isolated from a 2% agarose gel by electroelution and ethanol precipitation. The PCR product was cloned into pBluescript by ligating blunt Bluescript vector and gel isolated PCR product together using T4DNA ligase and transforming into
30 competent E. coli MCI022 cells. Transformation mixes were plated onto L-agar plates
containing 100 ug/m! ampicillin and incubated at 37'C for 16 hours. Colonies were picked

WO 00/11196 PCT/GB99/02720
-10-
and cells shaken for 16 hours in 3 ml L-broth containing 100 ug/ml ampicillin at 37"C. Plasmid DNA was prepared from colonies using a Promega Wizard mini-prep kit. The inserts of 10 transformants were sequenced using a Sequenase kit (United States Biochemical). The cloned PCR product sequences represented 3 Dm-AMPl related genes.
5 PCR clone 4 contained the DNA sequence
AAGACGTGGTCGGGAAACTGTGGCAATACGGG
ACATTGTGACAACCAATGTAAATCATGGGAGGGTGCGGCCCATGGAGCGTGTCA TGTGCGTAATGGGAAACACATGTGTTTCTGCTACTTCAAC, encoding a portion of the observed mature Dm-AMP 1 protein sequence (KTWSGNCGNTGHCD
10 NQCKSWEGAAHGACHVRNGKHMCFCYFN).
The 144 bp PCR product mixture labelled with ct32-P d-CTP was used to probe Hybond N (Amersham) filter lifts made from plates containing a total of 6 x 104 pfu of the cDNA library. The filters were hybridised at 46°C for 18 hrs in 5 x SSC, 0.1% SDS, 0.25% skimmed milk powder. Filters were washed in 2 x SSC, 0.1% SDS at 60°C. Autoradiography
15 was carried out at -70°C with intensifying screens. Thirty potentially positive signals were observed. 22 plaques were picked and taken through two further rounds of screening. After in vivo excision 13 clones were characterised by DNA sequencing. Four classes of Dm-AMP related peptide were encoded by the 13 cDNA clones and the sequences of these peptides are provided in SEQ ID Nos 1- 4 in the accompanying figures.
20 Three versions of the Dm-AMP core region were represented in the four classes. One of the classes (Dm2.5 type) contained a core region which may correspond to Dm-AMP2. None of the cDNAs encoded a core region equivalent to the observed mature Dm-AMPl peptide sequence. Isolation of a Mature Dm-AMPl Gene -
25 Using the sequence of PCR clone 4 (above) and information from the NH2 and COOH ends of the peptides described by cDNA sequences two pairs of oligonucleotides were designed for amplification of a gene encoding the observed mature Dm-AMPl. A PCR was carried out with Dahlia genomic DNA and oligonucleotides MAT AFP -5P (based on the codons present in Dm2.1, Dm2.3, Dm2.18 and Dm2.5 encoding the N-terminal amino
30 acid sequence M(AV)(KN)(NR)SVAF) and MATAFP-5 (based on the mature Dm-AMP 1 amino acid sequence NGKHMCF) using the following conditions; 94°C, 60 seconds, 53°C,

WO 00/11196 PCT/GB99/02720
- 11 -
12 seconds and 72°C, 60 seconds for 40 cycles. A PCR product of approximately 220 bp was isolated from a 2% agarose gei by electroelution and ethanol precipitation. The PCR product was cloned into pBluescript and clones sequenced as described above. A clone containing the 5' half of a Dm-AMP 1 gene was identified. 5 A PCR was carried out with Dahlia genomic DNA and oligonucleotides MATAFP-3 (based on the mature Dm-AMPI amino acid sequence GACHVRN) and DM25MAT-3 (based on the last two amino acids and the 3' untranslated region of Dm2.5) using the following conditions; 94°C, 60 seconds, 53°C, 12 seconds and 72°C, 60 seconds for 40 cycles. A PCR product of approximately 170 bp was isolated from a 2% agarose gel by electroelution and 10 ethanol precipitation. The PCR product was cloned into pBluescript and clones were sequenced as described above. A clone containing the 3' half of a Dm-AMP I gene was identified.
The 5' and 3' sections of the mature gene were combined to assemble the sequence of the mature Dm-AMPI gene (see Figure 1 SEQ ID No.5) which is comprised of exon 1,64 bp 15 encoding part of the leader peptide, 92 bp intron and exon 2 encoding the end of the leader sequence, Dm-AMP 1 core and C-terminal extension. Vector Oligonucleotide design
Four oligonucleotides were designed based on the DNA sequence of the mature Dm-AMPI gene: 20 DMVEC-1 top strand priming at the 5* end of the mature DmAMP-1 gene incorporating a Nco I site at the translation start of DrfiAMP-1 allowing cloning into pMJBl (see Figure 4).
DMVEC-2 bottom strand priming in the 3' end of the C-terminal extension and a Sac I site
for cloning in pMJB 1.
DMVEC-3 top strand priming at the 5' end of the mature DmAMP-1 gene incorporating a 25 Nco I site at the translation start of DmAMP-1 allowing cloning into pMJBl also encoding
complete signal peptide (minus intron).
DMVEC-4 bottom strand priming in the 3^ end of the core region and a Sac I site for cloning
inpMJBl.
A PCR was carried out with Dahlia genomic DNA and oligonucleotides DMVEC-1 and 30 DMVEC-2 using the following conditions; 94°C, 60 seconds, 60°C, 12 seconds and 72°C, 60
seconds for 45 cycles. A PCR product of approximately 450 bp spanning the mature Dm-

WO00/I1196 PCT/GB99/02720
- 12-
AMP1 gene was obtained, this PCR product was isolated from an agarose gel and used as a template for PCRs described in vector construction below.
Vector Construction
5 pDmAMPD
A PCR was carried out with the DMVEC-1 and DMVEC-2 450 bp PCR product and oligonucleotides DMVEC-1 and DMVEC-4 using the following conditions, 94°C, 48 seconds, 58°C, 12 seconds and 72°C, 90 seconds for 33 cycles. The PCR product was cut with Nco I and Sac I the 60 bp Nco I/Sac I fragment was isolated and ligated with pMJB leut
10 with Nco I and Sac I. The ligation mix was used to transform competent E. coli MCI 022 cells and plasmid DNA of ampicillin resistant transformants was obtained as described above.
The identity of the fragment in one of the resulting transformants was confirmed by sequencing, the clone was termed pDmAMPA.
15 A PCR was carried out with the DMVEC-1 and DMVEC-2 450 bp PCR product and oligonucleotides DMVEC-3 and DMVEC-4 using the following conditions; 94°C, 48 seconds, 58°C, 12 seconds and 72°C, 90 seconds for 33 cycles. The PCR product was cut with Nco I, the resulting 150 bp Nco I fragment isolated and cloned into pDmAMPA cut with Nco I. DNA sequencing confirmed that one transformant termed pDmAMPD, contained
20 DNA encoding Dm-AMP leader and core region.
pDmAMPE ^
The PCR product obtained with DMVEC-1 and DMVEC-2 was cut with Nco I and Sac I the 180 bp Nco I/Sac I fragment was isolated and cloned into pMJB 1 cut with Nco I and Sac I as described above.
25 The identity of the fragment in one of the resulting transformants was confirmed by sequencing, the clone was termed pDmAMPB.
A PCR was carried out with the DMVEC-1 and DMVEC-2 450 bp PCR product and oligonucleotides DMVEC-3 and DMVEC-4 using the following conditions; 94°C, 48 seconds, 58°C, 12 seconds and 72°C, 90 seconds for 33 cycles. The PCR product was cut
30 with Nco I and the resulting 150 bp Nco I fragment isolated and cloned into pDmAMPB cut

WO 00/11196 PCT/GB99/02720
-13-
with Nco I. DNA sequencing confirmed that one transformant termed pDmAMPE, contained
DNA encoding Dm-AMP leader, core and C-terminal extension.
Both pDmAMPD and pDmAMPE vector sequences contained PCR derived base
substitutions with respect to Dm-AMP 1 gene DNA sequence however the base changes were 5 silent having no effect on the expected amino acid sequence.
AFP-5 (to CEKASKTW)
TG(T,C)GANAANGCN(A,T)(G,C)NAA(A,G)ACNTGG
AFP-3EX (to MCFCYFNC)
CA(A,G)TT(A,G)AANTANCANAAA(A,G)CACAT 10 MATAFP-5P
ATGGC(C,G)AAN(A,C)(A,G)NTC(A)G)GTTGCNTT
MATAFP-5
AAACACATGTGTTTCCCATT
MATAFP-3 15 AGCGTGTCATGTGCGTAAT
Dm25MAT-3
TAAAGAAACCGACCCTTTCACGG
DMVEC-1
ATCGTAGCCATGGTGAATCGGTCGGTTGCGTTCTCCGCG 20 DMVEC-2
AAACCGACCGAGCTCACGGATCTTCAACGTTTGGAAC
DMVEC-3
ATGCATCCATGGTGAATCGGTCGGTTGCGTTCTCCGCGTTCGTTCTGATCCTTTTC
GTGCTCGCCATCTCAGATATCGCATCCGTTAGTGGAGAACTATGCGAGAAA 25 DMVEC-4
AGCAAGCTTTTCGGGAGCTCAACAATTGAAGTAA
30 EXAMPLE 2
Constructions of plant transformation vectors

WO 00/11196

- 14-

PCT/GB99/02720

Expression cassettes containing a Dm-AMP 1 open reading frame functionally linked to an enhanced 35S promoter, a TMV omega translational enhancer and a Nos 3' region are isolated as restriction fragments. pDmAMPD and pDmAMPE are both digested with the restriction endonucleases Hindlll and EcoRl and the appropriate restriction fragment isolated 5 and purified. Each fragment is ligated into a binary vector (a pBINI9 derivative named pBinl9i) which has also been digested with Hindlll and EcoRI. The resulting constructs, named pDmAMPLC and pDmAMPLCC, incorporate the expression cassettes from pDmAMPD and pDmAMPE respectively. pDmAMPLC and pDmAMPLCC are subsequently introduced into Agrobacterium
10 tumefaciens strain LBA4404 and introduced into tobacco and oil seed rape using standard plant transformation methodology.
Plants are regenerated from callus tissue resistant to the selective agent kanamycin and expression of the Dm-AMP 1 product is monitored by standard Western blot or ELISA methods using antibody which had been raised against Dm-AMP 1 protein. A range of
15 expression levels are detected. The Dm-AMPl expressed in selected transgenic is further characterised following extraction and partial purification from leaves of such lines. The product is of the predicted mass, as indicted by mass spectrometry. It is also demonstrated to retain biological activity after extraction as demonstrated by retention of antifungal activity in in-vitro (micro-titre plate) assays.
20 EXAMPLE 3
Constructions of plant transformation vectors for polvprotein expression Schematic representations of the plant transformation vectors used in this work, pFAJ3106 and pFAJ3109, are shown in figures 5 and 6, respectively. The nucleotide sequences comprised between the Xhol and SacI sites of these ptasmids, which encompass the regions encoding
25 antimicrobial proteins, are presented in Figures 7 and 8. The regions comprised between the Xhol and SacI sites of plasmid pFAJ3106 (shown in Figure 7) was constructed following the two-step recombinant PCR protocol of Pont-Kindom G.A.D. (1994, Biotechniques 16, 1010-1011). Primers OWB175 (S'AGGAAGTTCATTTCATTTGG) and OWB279 (5'-GCCTTTGGCACAACTTCTGCCTCTTrCCGATGAGTTGTTCGGCTTTAAGTTTGTC);
30 were used in a first PCR reaction with plasmid pDMAMPE (see above) as a template. The second PCR reaction was done using as a template plasmid pFRG4 (Terras F.R.G. et al., 1995,

WO 00/11196 PCT/GB99/02720
- 15-
Plant Cell 7, 573-588) and as primers a mixture of the PCR product of the first PCR reaction,
primer OWB175 and primer OWB172 f5,TTAGAGCTCCTATTAACAAGGAAAGTAr,r.
Sad site underlined). The resulting PCR product was digested with Xhol and Sad and cloned
into the expression cassette vector pMJB 1 (see above). The expression cassette in the 5 resulting plasmid, called pFAJ3099, was digested with Hindlll (flanking the 5' end of the
CaMV35S promoter) and EcoRI (flanking the 3' end of the nopaline synthase terminator) and
cloned in the corresponding sites of the plant transformation vector pGPTVbar (Becker D. et
al., 1992, Plant Mol. Biol. 20, 1195-1197) to yield plasmid pFAJ3106.
Plasmid pFAJ3109 was constructed by cloning the Hindlll-EcoRI fragment of plasmid 10 pDMAMPD (see above) into the corresponding sites of plant transformation vector pGPTVbar
(see above).
Plant transformation
Arabidopsis thaliana ecotype Columbia-0 was transformed using recombinant Agrobacterium
tumefaciens by the inflorescence infiltration method of Bechtold N. et al. (1993, C.R. Acad. 15 Sci. 316,1194-1199). Transformants were selected on a sand/perlite mixture subirrigated with
water containing the herbicide Basta (Agrevo) at a final concentration of 5 mg/1 for the active
ingredient phosphinothricin.
Elisa assays and protein assays
Antisera were raised in rabbits injected with either RsAFP2 (purified as described in Terras 20 F.R.G. et al, 1992, J. Biol. Chem. 267, 15301-15309) or DmAMPl (purified as in Osbom
R.W. et al, 1995, FEBS Lett. 368, 257-262). ELISA assays were set up as competitive type
assays essentially as described by Penninckx I.A.M.A. et al. (1996, Plant Cell 8, 2309-2323).
Coating of the ELISA microtiter plates was done with 50 ng/ml RsAFP2 or DmAMPl in
coating buffer. Primary antisera were used as 1000- and 2000-fold diluted solutions 25 (DmAMPl and RsAFP2, respectively) in 3 % (w/v) gelatin in PBS containing 0.05 % (v/v)
Tween 20.
Total protein content was determined according to Bradford (1976, Anal. Biochem. 72, 248-
254) using bovine serum albumin as a standard. Purification and characterisation of expressed proteins 30 Arabidopsis leaves were homogenized under liquid nitrogen and extracted with a buffer consisting of 10 mM NaH2P04, 15 mM Na^HPO,, 100 mM KC1, 1.5 M NaCl. The

WO 00/11196

- 16-

PCT/GB99/O2720

homogenate was heated for 10 min at 85°C and cooled down on ice. The heat-treated extract was centrifuged for 15 min at 15 000 x g and was injected on a reserved phase high pressure liquid chromatography column (RP-HPLC) consisting of C8 silica (0,46 cm x 25 cm; Rainin) equilibrated with 0.1 % (v/v) trifluoroacetic acid (TFA). The column was eluted at 1 mi/min
5 in a linear gradient in 35 min. from 15 % to 50 % (v/v) acetonitrile in 0.1 % (v/v) TFA. The eluate was monitored for absorbance at 214 nm, collected as 1 ml fractions, evaporated and finally redissolved in water. The fractions were tested by ELISA assays. Preparation of extracellular fluid and intracellular extract Intercellular fluid was collected from Arabidopsis leaves by immersing the leaves in a beaker
10 containing extraction buffer (10 mMNaH3P04, 15mMNa2HP04, 100 mM KCl, 1.5 M NaCl). " The beaker with the leaves was placed in a vacuum chamber and subjected to six consecutive rounds of vacuum for 1 min followed by abrupt release of vacuum. The infiltrated leaves were gently placed in a centrifuge tube on a grid separated from the tube bottom. The intercellular fluid was collected from the bottom after centrifugation of the tubes for 15 min at 1800 x g.
15 The leaves were resubjected to a second round of vacuum infiltration and centrifugation and the resulting (extracellular) fluid was combined with that obtained after the first vacuum infiltration. After this step the leaves were extracted in a Phastprep (BlOlOl/Savant) reciprocal shaker and the extract clarified by centrifugation (10 min at 10,000 x g) and the resulting supernatant considered as the intracellular extract.
20 Characterization of transgenic plants and expression analysis
To explore the possibility of expressing polyprotein precursor genes in plants, three different plant transformation vectors were made with the aim to co-express two different cysteine-rich plant defensins with antifungal properties, namely RsAFP2 and DmAMPl. The polyprotein precursor regions of these constructs alKeatured a leader peptide region from the DmAMPl
25 cDNA, the mature protein domain of DmAMPl, an internal propeptide region, and the mature protein domain of RsAFP2. Construct 3106 has a propeptide consisting of a part of the DmAMPl propeptide and a putative subtilisin-like protease processing site (IGKR) at its C-terminus. The rationale behind construct 3106, is based on our observations that the C-terminal
30 propeptides of DmAMPl are cleaved off at their N-terminus when expressed as DmAMPl-preproproterns in tobacco, respectively, while this processing event does not prevent the

WO 00/11196 PCT/GB99/02720
- 17-
mature proteins from being sorted to the apoplast (De Bolle et al., 1996, Plant Mol. Biol. 31, 993-1008; R.W. Osborn and S. Attenborough, personal communication). This infers that the processing enzymes are either in the secretory pathway or in the apoplast. On the other hand, C-terminal cleavage of the internal propeptide in these constructs should be executed by a 5 subtilisin-Iike protease, a member of which in yeast (Kex2) is known to occur in the Golgi apparatus (Wilcox C.A. and Fuller R.S., 1991, J. Cell. Biol. 115,297- ), while a member in tomato occurs in the apoplast (Tornero P. et al., 1997, J. Biol. Chem. 272, 14412-14419). Proteins deposited in the apoplast, the preferred deposition site for antimicrobial proteins engineered in transgenic plants (Jongedijk E. et al, 1995, Euphytica 85, 173-180; De Bolle et 10 al, 1996, Plant Mol. Biol. 31, 993-1008) are normally synthesized via the secretory pathway, encompassing the Golgi apparatus.
Constructs were also made for expression of DmAMPl (construct 3109, figure 6). Expression levels of DmAMPl and RsAFP2 were analysed in leaves taken from a series of Tl transgenic Arabidopsis plants resulting from transformation with the constructs described 15 above. Most of the tested lines transformed with the polyprotein constructs 3106 clearly expressed both DmAMPl and RsAFP2. There was generally a good correlation between DmAMPl and RsAFP2 levels. However, the RsAFP2 levels were generally 2 to 5-fold lower than the DmAMPl levels. It is not known whether the apparent lower expression levels of RsAFP2 versus DmAMPl are real or whether they result from a bias in the extraction 20 procedure or the assays. The expression levels in the lines transformed with the polyprotein constructs 3106 were generally much higher compared to those in lines transformed with the single protein construct 3109. Hence, the use of polyprotein constructs appears to result in enhanced expression, which is an unexpected finding. Analysis of the proteins expressed for polyprotein constructs 25 A transgenic line was selected among each of the populations transformed with construct 3106 and the selected lines were further bred to obtain plants homozygous for the transgenes. In order to analyse whether DmAMPl and RsAFP2 were correctly processed in these lines, extracts from the plants were prepared as described in Materials and Methods and separated by RP-HPLC on a C8-siIica column. Fractions were collected and assessed for presence of 30 compounds cross-reacting with antibodies raised against either DmAMPl or RsAFP2 using Elisa assays.

WO 00/11196 PCT/CB99/02720
-18-
DmAMPl cross-reacting compound eiuted at a position identical or very close to that of authentic DmAMPl in the line transformed with construct 3106. Likewise, a RsAFP2 cross-reacting compound was detected in the 3106 lines at an elution position identical or very close to that of authentic RsAFP2. None of the fractions reacted with both the anti-DmAMPl and
5 anti-RsAFP2 antibodies, indicating that an uncleaved fusion protein was not present in the extracts. No cross-reacting compounds were observed in a non-transformed line. It is concluded that the primary translation products of the transcription units of construct 3106 (partial DmAMPl C-terminal propeptide with subtilisin-Iike protease site as a linker peptide) are somehow processed to yield separate DmAMPl-cross-reacting and RsAFP2-cross-reacting
10 portions that appear to be identical or very closely related to DmAMP 1 and RsAFP2, respectively, based on their chromatographic behavior. Analysis of the subcellular location of coexpressed plant defensins In order to determine whether the coexpressed plant defensins are either secreted extracellularly or deposited intracellular^, extracellular fluid and intracellular extract fractions
15 were obtained from leaves of homozygous transgenic Arabidopsis lines transformed with constructs 3106. The cytosolic enzyme glucose-6-phosphate dehydrogenase was used as a marker to detect contamination of the extracellular fluid fraction with intracellular components. As shown in Table 1, glucose-6-phosphate dehydrogenase was partitioned in a ratio of about 80/20 between intracellular extract fractions and extracellular fluid fractions. In
20 contrast, the majority of DmAMPl and RsAFP2 content in all transgenic plants tested was found in the extracellular fluid fractions. These results indicate that both plant defensins released from the polyprotein precursors are deposited primarily in the apoplast. Hence, all processing steps that result in cleavage of the polyprotein structure must occur either in the apoplast or along the secretory pathway. '
25 Table 1: Relative abundance of glucose-6-phosphate dehydrogenase activity (GPD),
DmAMPl and RsAFP2 in the extracellular fluid (EF) and intracellular extract (IE) fractions obtained from transgenic Arabidopsis plants. Construct Relative abundance1 (%) of

GPD DmAMPl RsAFP2
EF IE EF IE EF IE
pFAJ3106 17 83 94 6 60 40

WO 00/11196 PO7GB99/02720
-19-
1 Relative abundance is expressed as % of the sum of the contents in the EF and IE fractions.
EXAMPLE 4 Expression of the sweet tasting protein Brazzein in tomato
Production of transgenic tomato plants with increased accumulation of sweet tasting
5 protein Brazzein.
Constructs were prepared containing the Dahlia (Dahlia merckii) antimicrobial protein signal peptide fused with the Brazzein gene under the transcriptional control of the Arabidopsis polyubiquitin extension protein promoter (UBQ) or the Polygalacturonase promoter (PG). Constructs were also prepared which encoded Brazzein without a signal
10 peptide but with an N-termina! methionine by the insertion of ATG nucleotides upstream of the Brazzein gene under the expressional control of either the UBQ promoter or the PG promoter. These were prepared as follows:
Construction of the transformation vector for expression in tomato with Dahlia signal peptide fused to Brazzein under the expressional control of either the UBQ promoter or the
15 PG promoter:
A synthetic DNA was produced which coded for the Dahlia signal peptide fused to Brazzein. The codons were optimised for expression in tomato. Using appropriate restriction sites the coding sequence was cloned into a plasmid vector. The coding region was excised from the plasmid and cloned between the promoter in question and the terminator in the
20 correct orientation for expression.
Generation and analysis of plants transformed with the transformation vector. The vector was transferred to Agrobacterium tumefaciens LBA4404 (a microorganism widely available to planfbiotechnolo gists) and used to transform tomato plants. Transformation of tomato stem segments followed standard protocols (e.g. Bird et al
25 Plant Molecular Biology II, 651-662, 1988). Transformed plants were identified by their ability to grow on media containing the antibiotic kanamycin. Up to 30 individual plants were regenerated with each construct and grown to maturity. The presence of the construct in all of the plants was confirmed by polymerase chain reaction analysis. DNA Southern blot analysis on all plants indicated that the insert copy number was between 1 and 10. Northern
30 blot analysis on fruit from one plant indicated that the Brazzein gene was expressed.

WO 00/1.196 2Q PCT/GB99/02720
Brazzein production in the fruit of all plants was measured by ELISA (enzyme linked imunoabsorption assay) using a polyclonal and a monoclonal antibody raised against native Brazzein protein isolated from the fruit of the plant Pentadiplandra brazzeana Baillon Two fruit were collected from each transgenic plant at 7 days post breaker (the term breaker is 5 used to indicate when the tomato fruit first show signs of the orange colouration
characteristic of most mature tomato fruit). Total fmit protein was extracted from a sample of the pericarp of each of the fruit. The amount of Brazzein protein in the total protein extract was measured by ELISA and calculated as the amount of Brazzein per gram fresh weight of the fruit. For each plant the average Brazzein content of the two fruits was calculated. In
10 some plants Brazzein could not be detected in the fruit using the ELISA technique. Western blot analysis of the total protein extract from some of the fruit revealed a 6.5kD protein band. which matches the predicted size of the mature Brazzein protein. This confirmed that the fruit contained Brazzein and that the signal peptide had been cleaved as if the signal peptide had not been cleaved, one would expect the protein to be larger. The Brazzein in fruit from
15 plants which had been transformed with a construct lacking a signal peptide was not detected by Western blot This is because the Brazzein content in these fruit is below the level of detection by western blot. ELISA is a more sensitive technique than western blot and protein was detected in these fruit by this method. The results are summarised in Table 2 below.
20 TABLE 2

Construct Name Promoter Signal , Peptide No-of Plants Tested Plants
expressing
Brazzein
pZPS34 UBQ None 29 18
pZPS35 UBQ Dahlia
AMP1 25 23
pZPS37 PG None 15 7
pZPS38 PG Dahlia AMP1 13 11
SUBSTITUTE SHEET (RULE 26)

WO 00/11196 PCT/GB99/02720
Table 2 (continued)
Construct Name Max Brazzein ng/g Fresh wt Min Brazzein
ng/g Fresh wt Mean Brazzein in
those plants expressing the
gene
pZPS34 25.57 Not Detected 6.85
pZPS35 226.53 Not Detected 43.89
pZPS37 12.77 Not Detected 3.32
pZPS38 51745.77 Not Detected 12867.34
Example 5
Construction of Dm-AMP Transient Expression Vectors
To produce proteins for assessment of the relative activity of the variants of Dm-AMP, three 5 vectors were constructed for transformation of black Mexican sweet (BMS) maize cell
suspensions to give transient expression of Dm-AMPs.
The vector chosen for these experiments was pAID-MR7.
pAfl>MR7 was constructed using the commercially available cloning vector pNEB193
(New England Biochemicals) itself a modified version of pUCl9 (Yanisch-Perron C, Vieira 10 J. and Messing J. "Improved M13 phage cloning vectors and host strains: nucleotide
sequences of the M13mpl8 and pUC19 vectors." Gene; 33:103-19 (1985)). Gene
components to facilitate protein expression were inserted within the multiple cloning region
of pNEB 193, namely:
1) A plant promoter to drive transcription, a 1.9Kb Xba I fragment of the MR7 promoter
15 (MR7 prom.) from maize (as described in US Patent No. 5837848)
2) A sequence known to enhance gene transcription, the alcohol dehydrogenase intron 1 (I 1)
from maize (Dennis E.S., Gerlach W.L., Pryor A.J., Bennetzen J.L., Inglis A., Llewellyn
D„ Sachs M.M., Ferl R.J. and Peacock W.l "Molecular analysis of the alcohol
dehydrogenase (Adhl) gene of maize." Nucleic Acids Research; 12:3983-4000(1984)).
SUBSTITUTE SHEET (RULE 26)

WO 00/11196 PCT/GB99/02720
-22-
3) A multiple cloning region for insertion of open reading frames containing the site for restriction endonuclease Xba I.
4) A 3' region for mRNA transcript termination and polyadenylation from the cauliflower mosaic virus 35S RNA transcript (V) (Pietrak et al Nucleic Acid Research 14 5857-5868
5 (1986), Franck A., Guiiley H., Jonard G., Richards K. and Hirth L. "Nucleotide sequence
of cauliflower mosaic virus DNA." Cell; 21: 285-94 (1980)).
To produce proteins for assessment of the relative activity of the variants of Dm-AMP, three
vectors were constructed for use in a transient expression system.
All plasmid DNA described in the following examples was prepared using Promega Wizard 10 mini-prep or Promega Wizard midi-prep kits using the manufacturer's suggested protocols.
DNA sequencing was carried out using USB Sequenase kits and the manufacturer's
suggested protocols.
Example 5a 15 Vector DNA was prepared by digesting plasmid DNA of pAIDMR7 with Xba I and the ends filled in with Klenow DNA polymerase. The linear vector was isolated from an agarose gel by electroelution and ethanol precipitation. The DNA pellet was air dried and taken up in a small volume of water,
Plasmid DNA of a cDNA clone containing a Dm2.1 ORF was digested with Eco RI and Sea 20 I and the ends filled in with Klenow DNA polymerase. Insert DNA containing the Dm2.1 coding region was isolated from an agarose gel by electroelution and ethanol precipitation. The DNA pellet was air dried and taken up in a small volume of water. Vector and insert DNA were ligated together using T4 DNA ligase and transformed into competent E. coli MCI022 cells. Tranformation mixes were plated onto L-agar plates 25 containing 100 ^ig/ml ampicillin and incubated at 37°C for 16 hours. Colonies were picked and cells shaken for 16 hours in 3 ml L-broth containing 100 ug/ml ampicillin at 37°C. Plasmid DNA was prepared from several colonies and used in DNA sequencing reactions to identify transformants containing the Dm2.1 coding region in the appropriate orientation with respect to the MR7 promoter. 30 One such clone was identified and named pAIDMR721.

WO 00/11196 PCT/GB99/02720
-23-
Example 5 b
Vector DNA was prepared as in Example 5a.
Plasmid DNA of a cDNA clone containing a Dm2.3 ORF was digested with Eco RJ and Sea
I and the ends filled in with Klenow DNA polymerase. Insert DNA containing the Dm2.3 5 coding region was isolated from an agarose gel by electroelution and ethanoi precipitation.
The DNA pellet was air dried and taken up in a small volume of water.
Vector and insert DNA were ligated together, transformed into E. coli MCI022 and colonies
characterised by DNA sequencing as described in Example 5a. A clone was identified
containing the Dm2.3 ORF in the desired orientation and named pAIDMR723. 10
Example 5c
Vector DNA was prepared as in Example 5a.
Plasmid DNA of a cDNA clone containing a Dm2.5 ORF was digested with Eco RI and Dra
I and the ends filled in with Klenow DNA polymerase. Insert DNA containing the Dm2.5 15 coding region was isolated from an agarose gel by electroelution and ethanoi precipitation.
The DNA pellet was air dried and taken up in a small volume of water.
Vector and insert DNA were ligated together, transformed into E. coli MCI022 and colonies
characterised by DNA sequencing as described in Example 5a. A clone was identified
containing the Dm2.5 ORF in the desired orientation and named pAIDMR725. 20
Example 6
Transient Expression of Dm-AMPs
Plasmid DNA of clones pAIDMR721 pAIDMR723, pAIDMR725 and pA!DMR7 is used to
transform cultured maize BMS cells using the PEG method. 25 Protoplast preparation and transformation
Protoplasts are isolated from a maize suspension of Black Mexican Sweet Corn suspension culture (BMS) [Green, Hort. Sci., 12 (1977) 131; Smith et ah, Plant Sci. Lett., 36 (1984) 67] subcultured in BMS medium (MS medium supplemented with 2% sucrose, 2 mg/1 2,4-D, pH5.8). Cells from suspensions two days post subculture are digested in enzyme mixture 30 (2.0% cellulase RS (Yakult Honsha Co., Ltd), 0.2% pectolyase Y23 (Yakult Honsha Co., Ltd), 0.5M mannitol, 5mM CaCl22H20, 0.5% MES, pH5.6, ~660mmol/kg) using -lOml/g

WO fl PCT/GB99/02720
-24-
cells, incubating at 25°C, rotating gently for 2 hours. The digestion mixture is sieved through 250urn and 38nm sieves, and the filtrate centrifuged at 700rpm for 3.5 minutes. Protoplasts are resuspended in wash buffer (0.358M KC1, l.OmM NH,N03, 5.0mM CaCl22H20, 0.5mM KU2?04} pH4.8, -670mmol/kg) and pelleted twice prior to resuspending in wash buffer and
5 counting. Transformation is achieved using PEG (PEG 3350, Sigma Co) mediated uptake (Negrutiu et al., 1987) employing plasmid DNA prepared using Qiagen midi plasmid preparation kit (Qiagen Ltd, Crawley, UK). Protoplasts are resuspended at 2 x lOVml in MaMg medium (0.4M mannitol, 15mM MgCl2, 0.1% MES, pH5.6, ~450mmol/kg) aliquotting 0.5ml / treatment (i.e. lxlO6 protoplasts/treatment). Samples are heat shocked at
10 45°C for 5 minutes then cooled to room temperature. Each transformation is carried out with
lOug of pAlD-MR7 alone or lOug of each construct pAIDMR721, pAIDMR723 or
p AIDMR725. Each protoplast treatment is resuspended in 1.5ml culture medium (MS
medium, 2% sucrose, 2mg/l 2,4-D, 9% mannitol, pH5.6, ~700mmol/kg). Samples are
incubated in 3cm dishes at 25°C, in the dark, for 48 hours prior to harvesting.
15
After 48 hours incubation cells are separated from media by centrifugation.
Cells are osmotically lysed by the addition of water. Cell debris is pelleted by centrifugation
and the proteins remaining in solution are freeze dried. The freeze dried proteins are taken up
in a small volume of water and the concentration of protein determined using Bradford
20 reagent.
Culture media removed from cells *s"freeze dried and taken up in a small volume of water, ;
the concentration of protein is determined as above.
Protein samples isolated from all BMS transformations are assayed for spore germination 25 inhibition in a bioassay against Fusarium culmorum spores as described in Published International Patent Application No. WO 93/05153.
30

WO 00/11196

-25-

PCT/GB99/02720

CLAIMS
1. A polynucleotide comprising a sequence selected from those depicted in
SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5.
2. A polynucleotide sequence comprising a sequence selected from the group consisting of nucleotides 53 to 385 in SEQ ID No. 1, nucleotides 11 to 334 in SEQ ID No. 2, nucleotides 24 to 317 in SEQ ID No. 3, nucleotides 20 to 343 in SEQ ID No. 4 or nucleotides 1 to 446 in SEQ ID No. 5.
3. A polynucleotide sequence comprising a sequence selected from the group consisting of nucleotides 137 to 286 in SEQ ID No. 1, nucleotides 95 to 244 in SEQ ID No. 2, nucleotides 108 to 257 in SEQ ID No. 3, nucleotides 104 to 253 in SEQ ID No. 4 or nucleotides 177 to 326 in SEQ ID No. 5.

4. A polynucleotide sequence comprising a sequence selected from the group consisting of nucleotides 287 to 385 in SEQ ID NO. 1, nucleotides 245 to 334 in SEQ ID No. 2, nucleotides 258 to 317 in SEQ ID No. 3, nucleotides 254 to 343 in SEQ ID No. 4 or nucleotides 327 to 446 in SEQ ID No.5.
5. A polynucleotide encoding a protein having a substantially similar activity to that encoded by any of SEQ ID No. 1, No 2, No. 3, No,4 or No. 5 which polynucleotide is complementary to one which when incubated at a temperature of between 55 and 65°C in a solution containing 5 X'SSC (saline sodium citrate buffer) containing 0.1% SDS and 0.25% powdered skimmed milk followed by washing at the same temperature with 0.1, 0.5 or 2x SSC containing 0.1% SDS still hybridises with a sequence depicted in SEQ ID No 1, SEQ ID No 2, SEQ ID No3, SEQ ID No.4 or SEQ ID No.5 with the proviso that the sequence is not that described in SEQ ID No.6 or 7.

WO 00/11196 PCT/CB99/02720
-26-
6. A polynucleotide encoding a protein having a substantially similar activity to that encoded by nucleotides 137 to 286 in SEQ ID No. 1, nucleotides 95 to 244 in SEQ ID No. 2, nucleotides 108 to 257 in SEQ ID No. 3, nucleotides 104 to 253 in SEQ ID No. 4 or nucleotides 177 to 326 in SEQ ID No. 5., which polynucleotide is complementary to one which when incubated at a temperature of between 55 and 65°C in a solution containing 5 X SSC (saline sodium citrate buffer) containing 0.1% SDS and 0.25% powdered skimmed milk followed by washing at the same temperature with 0.1, 0.5 or 2x SSC containing 0.1% SDS still hybridises with a sequence depicted by nucleotides 137 to 286 in SEQ ID No. 1, by nucleotides 95 to 244 in SEQ ID No. 2, by nucleotides 108 to 257 in. SEQ ID No. 3, by nucleotides 104 to 253 in SEQ ID No. 4 or by nucleotides 177 to 326 in SEQ ID No.5. with the proviso that said sequence is not that described in SEQ ID No. 6 or SEQ ID No. 7.
7. A polynucleotide according to any preceding claim, further comprising a region encoding a peptide which is capable of targeting the translation products of the sequence to plastids such as chloroplasts, mitochondria, other organelles or plant cell walls.
8. A polynucleotide according to any preceding claim, wherein translational enhancing sequences are inserted 5' of the protein encoding regions comprised by the polynucleotide.
9. A polynucleotide according to any preceding claim, which is modified in that mRNA
instability motifs and/or fortuitous splice regions are removed, or plant preferred
codons are used so that expression of the thus modified polynucleotide in a plant
yields substantially similar protein having a substantially similar activity/function to
that obtained by expression of the unmodified polynucleotide in the organism in
which the protein encoding regions of the unmodified polynucleotide are
endogenous, with the proviso that if the thus modified polynucleotide comprises plant
preferred codons, the degree of identity between the modified polynucleotide and a

WO 00/11196

-27-

PCT/GB99/02720

polynucleotide endogenously contained within the said plant and encoding substantially the same protein is less than about °0/.
1 o. A plant transformation vector comprising a plant operable promoter, a polynucleotide sequence according to any of the preceding claims under the transcriptional control thereof and a plant transcription terminator.
11. Plant tissue transformed with the polynucleotide of any one of claims 1 to 9 or the vector of claim 10 and material derived from the said transformed plant tissue.
12. Morphologically normal fertile whole plants comPrismg me tissue or material of the preceding claim.

13. The progeny of the plants of the preceding claim. wnich progeny comprises the polynucleotide of any one of claims 1 to 9 stably incorporated into its genome and heritable in a mendelian manner, the seeds of suck plants and such progeny.
14. A method of producing plants which are substantially tolerant or substantially resistant to microbial infection, comprising the stePs °£
(i) transforming plant material with the polynucleotide of any one of claims 1 to
9 or the vector of claim 10
(ii) selecting the thus transformed material; dP&
(iii) regenerating the thus selected material into morphologically normal fertile
whole plants.
15. Use of the polynucleotide of any one of claims I to 9, or the vector of claim 10 in the production of plant tissues and/or morphologically normal fertile whole plants which are substantially tolerant or substantially resistant to microbial infection.
16. The translation product of the region comprised ty nucleotides 137 to 286 in SEQ ID No. 1.; nucleotides 95 to 244 in SEQ ID No.2, nUcIe°tides 108 to 257 in SEQ ID No.

WO 00/11196 PCT7GB99/02720
-28-
3, or nucleotides 104 to 253 in SEQ ID No. 4 and protein having an amino acid sequence which is at least 95% similar to said product.
17. The translation product of the region comprised by nucleotides 287 to 385 in SEQ ID
5 NO. 1, nucleotides 245 to 334 in SEQ ID No. 2, nucleotides 258 to 317 in SEQ ID
No. 3, nucleotides 254 to 343 in SEQ ID No. 4 or nucleotides 327 to 446 in SEQ ID No.5 and protein having an amino acid sequence which is at least 85% similar to said product.
10 18. A method of selectively controlling microorganisms at a locus comprising the plants, progeny and/or seeds of either of claims 12 or 13, comprising applying to the locus a microorganism controlling amount of the translation product of the region comprised by nucleotides 137 to 286 in SEQ ID No. 1.; nucleotides 95 to 244 in SEQ ID No.2, nucleotides 108 to 257 in SEQ ID No. 3, or nucleotides 104 to 253 in SEQ ID No. 4.
15
19. Use of the polynucleotide of any one of claims 1 to 9, or the vector of claim 10 in the production of an antimicrobial protein.

WO 00/11196

PCT/GB99/02720

1
SEQUENCE LISTING
<110> ZENECA Limited Evans, Ian J Ray, John A
<120> Polynucleotide sequences
<130> PPD 50355
<140>
<141>
<150> GB 9818003.7 <151> 1998-08-18
<160> 37
<170> Patentln Ver. 2.1
<210> 1 <211> 399
<212> DNA
<213> Dahlia merrckii
<220>
<221> CDS
<222> (53)..(388)
<400> 1
gtgccccggg tcacgaagtt cggcacatct tagcgttatg cataagtcaa aa atg gcc 58
Met Ala
1
aaa aat tea gtt get ttc ttt gca ttg tgc ctg ctt ctt ttc att ctt 106
Lys Asn Ser Val Ala Phe Phe Ala Leu Cys Leu Leu Leu Phe lie Leu
5 10 15

WO 00/ll_ _

PCT/GB99/02720

2
get ate tea gaa ate aga teg gtg aag ggg gaa tta tgt gag aag gca 154
Ala He Ser Glu He Arg Ser Val Lys Gly Glu Leu Cys Glu Lys Ala
20 25 30
age aag aca tgg tct gga aat tgt ggc aat aca aga cac tgt gat gac 202
Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Arg His Cys Asp Asp
35 40 45 50
cag tgc aag tct tgg gag ggt gca gee cat gga get tgt cac gtg cgc 250
Gin Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys His Val Arg
55 60 65
ggt ggg aaa cac atg tgc ttc tgc tac ttc aac tgt ccc aaa gcc cag 298
Gly Gly Lys His Met Cys Phe Cys Tyr Phe Asn Cys Pro Lys Ala Gin
70 75 80
aag ttg get gag gat aaa etc aga gca gca gag eta gca aag gag aag 346
Lys Leu Ala Glu Asp Lys Leu Arg Ala Ala Glu Leu Ala Lys Glu Lys
85 90 95
aat aat att gga get gaa aag gtg cct tea gcc aca cct tga 388
Asn Asn He Gly Ala Glu Lys Val Pro Ser Ala Thr Pro
100 105 110
gtactaacaa a 399
<210> 2
<211> 523
<212> DNA
<213> Dahlia merckii
<220>
<221> CDS
<222> (11)..(337)

PCT/GB99/02720
<400> 2
ggcacgagta atg gcc aaa aat tea gtt get ttc tta qca ttt ctt ctg 49
Met Ala Lys Asn Ser Val Ala Phe Leu Ala Phe Leu Leu
15 10
ctt ctt ttc gtt ctt get ate tea gaa ate gga teg gtg aag ggg gaa 97
Leu Leu Phe Val Leu Ala lie Ser Glu He Gly Ser Val Lys Gly Glu
15 20 25
tta tgt gag aag gca age aag aca tgg tct gga aat tgt ggc aat aca 145
Leu Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr
30 35 40 45
aga cac tgt gat gac cag tgc aag tct tgg gag ggc gca gcc cat gga 193
Arg His Cys Asp Asp Gin Cys Lys Ser Trp Glu Gly Ala Ala His Gly
50 55 60
get tgt cac gtg cgc ggt ggg aaa cac atg tgc ttt tgc tac ttc aac 241
Ala Cys His Val Arg Gly Gly Lys His Met Cys Phe Cys Tyr Phe Asn
65 70 75
tgt tec aaa gcc cag aag ctg get cag gat aaa etc aaa gcc gac aag 289
Cys Ser Lys Ala Gin Lys Leu Ala Gin Asp Lys Leu Lys Ala Asp Lys
80 85 90
etc gcc aag gag aag agt gaa gcc 'gaa aag gtg cca get aca cct tga 337
Leu Ala Lys Glu Lys Ser Glu Ala Glu Lys Val Pro Ala Thr Pro
95 100 105
gtactaacaa gtgttgtatg attatgaata aagagaaaat gctttctagt taccatattt 397
agcattctct aatgtgtaat gtttgttgct tttggaacta attgcttaac tatgattcca 457
gctaataatg ttttaagtat ataatataag ttatcttatt ttgaagcctg taaaaaaaaa 517

aaaaaa

523

WO 00/11196

PCT/GB99/02720

<210> 3
<211> 385
<212> DNA
<213> Dahlia merckii
<220>
<221> CDS
<222> (24)..(320)
<400> 3
cggcacgagg cacaatctca aaa atg gcc aaa aat teg gtt get ttc ttt gca 53
Met Ala Lys Asn Ser Val Ala Phe Phe Ala
1 5 10
ttt gtc ctg ctt ctt ttc gtt ctt get ate tea gaa att gga teg gtg 101
Phe Val Leu Leu Leu Phe Val Leu Ala lie Ser Glu lie Gly Ser Val
15 20 25
aag gga gaa tta tgt gag aag gca age aag aca tgg tct gga aat tgt 149
Lys Gly Glu Leu Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys
30 35 40
ggc ate aca tea cac tgt gac aac cag tgc egg teg tgg gag ggt gca 197
Gly He Thr Ser His Cys Asp Asn Gin Cys Arg Ser Trp Glu Gly Ala
45 50 55
ate cat gga get tgt cac gtg cgc ggt ggg aaa cac atg tgc ttc tgc 245
He His Gly Ala Cys His Val Arg Gly Gly Lys His Met Cys Phe Cys
60 65 ' 70
tac ttc aac tgt tec aaa gcc gat gag etc gcg aag gag aag att gaa 293
Tyr Phe Asn Cys Ser Lys Ala Asp Glu Leu Ala Lys Glu Lys He Glu
75 80 85 90
gcc gaa aag atg cca gcc aca cct tga gtactaacaa atgctatatg 340 Ala Glu Lys Met Pro Ala Thr Pro 95

WO 00/11196 PCT/GB99/02720
5
attataaata aagagaaaat gctttctaaa aaaaaaaaaaaaaaa 385
<210> 4
<211> 577
<212> DNA
<213> Dahlia merckii
<220>
<221> CDS
<222> (20)..(346)
<400> 4
ggcacgagcc tattaaaaa atg gtg aat cga teg gtt get ttc tec gtg ttc 52
Met Val Asn Arg Ser Val Ala Phe Ser Val Phe
15 10
gtt ctg ate ett ttc gtg etc gcc ate tea gat ate aca agt gtg aga 100
Val Leu lie Leu Phe Val Leu Ala He Ser Asp He Thr Ser Val Arg
15 20 25
gga gaa gta tgc gag aaa get age aag aca tgg tea gga aac tgt ggc 148
Gly Glu Val Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly
30 35 40
/
aac acg gga cac tgt gac aac caa tgt aaa tac tgg gag ggg gcg gcc 196
Asn Thr Gly His Cys Asp Asn Gin Cys Lys Tyr Trp Glu Gly Ala Ala
45 50 55
cat ggg gcg tgc cac gtg cgt gga ggg aaa cac atg tgt ttc tgc tac 244
His Gly Ala Cys His Val Arg GLy Gly Lys His Met Cys Phe Cys Tyr
60 65 70 75
ttc aag tgt ccc aaa gcc gaa aag ett get caa gac aaa gtt aat gcc 292
Phe Lys Cys Pro Lys Ala Glu Lys Leu Ala Gin Asp Lys Val Asn Ala
80 85 90

Dm Cene Structure Sequence ID No. 5 Fig.lA.
MVNRSVAFSAFVLILFVLAI 1 ATGGTGAATCGGTCGGTTGCGTTCTCCGCGTTCGTTCTGATCCTTTTCGTGCTCGCCATC
S 61 TCAQGTTATCAAATCTTTAGTTCATTTATTGAATATGATAGTATTTATATTCTTTTATGG
» intron
g? DIASVSGE
=j 121 TTTTATGTGTTCTGACAAGTTGCAAATATTGAGTAGATATCGCATCCGTTAGTGGAGAAC
to LVCEKASKTWSGNCGNTGHCD
jjj 10i TATGCGAGAAAGCTAGCAAGACATGGTCGGGAAACTGTGGCAATACGGGACATTGTGACA
3 Ncol
5 NQCKSWEGAAHGACHVRNGK
S 2 41 ACCAATGTAAATCATGGGAGGGTGCGGCCCATGGAGCGTGTCATGTGCGTAACGGGAAAC
HindXII HMCFCYFNCKKAEKLAQDKL 301 ACATGTGTTTCTGTTACTTCAATTGTAAAAAAGCCGAAAAGCTTGCTCAAGACAAACTTA
Hirwilll KAEQLAQDKLNAQKLDRDAK 361 AAGCCGAACAACTCGCTCAAGACAAACTTAATGCCCAAAAGCTTGACCGTGATGCCAAG A
KVVPNVEHP 421 AAGTGGTTCCAAACGTTGAACATCCG


Dm2.18 sequence ID No- 1 Fig.lB.
M A K
1 GTGCCCCGGGTCACGAAGTTCGGCACATCTTAGCGTTATGCATAAGTCAAAAATGGCCAA
NSVAFFALCLLLFII/AISEI 61 AAATTCAGTTGCTTTCTTTGCATTGTGCCTGCTTCTTTTCATTCTTGCTATCTCAGAAAT
RSV. KGELCEKASKTWSGNCG 121 CAGATCGGTGAAGGGGGAATTATGTGAGAAGGCAAGCAAGACATGGTCTGGAAATTGTGG
NTRHCDDQCKSWEGAAHGAC 181 CAATACAAGACACTGTGATGACCAGTGCAAGTCTTGGGAGGGTGCAGCCCATGGAGCTTG
HVRGGKHMCFCYFNCPKAQK 241 TCACGTGCGCGGTGGGAAACACATGTGCTTCTGCTACTTCAACTGTCCCAAAGCCCAGAA
LAEDKLRAAELAKEKNNIGA 301 GTTGGCTGAGGATAAACTCAGAGCAGCAGAGCTAGCAAAGGAGAAGAATAATATTGGAGC
EKVPSATP 361 TGAAAAGGTGCCTTCAGCCACACCTTGAGTACTAACAAA


Dm 2.1 Sequence ID No. 2 Fig.2A.
MAKNSVAFLAFLLLLFV 1 GGCACGAGTAATGGCCAAAAATTCAGTTGCTTTCTTAGCATTTCTTCTGCTTCTTTTCGT
LAISEIGSVKGELCEKASKT 61 TCTTGCTATCTCAGAAATCGGATCGGTGAAGGGGGAATTATGTGAGAAGGCAAGCAAGAC
WSGNCGNTRHCDDQCKSWEG 121 ATGGTCTGGAAATTGTGGCAATACAAGACACTGTGATGACCAGTGCAAGTCTTGGGAGGG
AAHGACHVRGGKHMCFCYFN 181 CGCAGCCCATGGAGCTTGTCACGTGCGCGGTGGGAAACACATGTGCTTTTGCTACTTC AA
CS KAQKLAQDKLKADKLAKE
241 CTGTTCCAAAGCCCAGAAGCTGGCTCAGGATAAACTCAAAGCCGACAAGCTCGCCAAGGA
KSEAEKVPATP 301 GAAGAGTGAAGCCGAAAAGGTGCCAGCTACACCTTGAGTACTAACAAGTGTTGTATGATT
361 ATGAATAAAGAGAAAATGCTTTCTAGTTACCATATTTAGCATTCTCTAATGTGTAATGTT
421 TGTTGCTTTTGGAACTAATTGCTTAACTATGATTCCAGCTAATAATGTTTTAAGTATATA
481 ATATAAGTTATCTTATTTTGAAGCCTGTAAAAAAAAAAAAAAA

.3 Sequence ID No. 3 Fig.2B.
MAKNSVAFFAFV 1 CGGCACGAGGCACAATCTCAAAAATGGCCAAAAATTCGGTTGCTTTCTTTGCATTTGTCC
LLLFVLAISEIGSVKGELCE 61 TGCTTCTTTTCGTTCTTGCTATCTCAGAAATTGGATCGGTGAAGGGAGAATTATGTGAGA
KASK>TWSGNCGITSHCDNQC 121 AGGCAAGCAAGACATGGTCTGGAAATTGTGGCATCACATCACACTGTGACAACCAGTGCC
RSWEGAIHGACHVRGGKHMC
181 GGTCGTGGGAGGGTGCAATCCATGGAGCTTGTCACGTGCGCGGTGGGAAACACATGTGCT
FCYFNCSKADELAKEKI EAE 241 TCTGCTACTTCAACTGTTCCAAAGCCGATGAGCTCGCGAAGGAGAAGATTGAAGCCGAAA
K M P A T P 301 AGATGCCAGCCACACCTTGAGTACTAACAAATGCTATATGATTATAAATAAAGAGAAAAT
361 GCTTTCTAAAAAAAAAAAAAAAAAA

Dm2.5 Sequence ID No. 4 Fig.3.
MVNRSVAFSVFVLI 1 GGCACGAGCCTATTAAAAAATGGTGAATCGATCGGTTGCTTTCTCCGTGTTCGTTCTGAT
LFVLAISDITSVRGEVCEKA 61 CCTTTTCGTGCTCGCCATCTCAGATATCACAAGTGTGAGAGGAGAAGTATGCGAGAAAGC
05 C CD W
SKTWSGNCGNTGHCDNQCKY
=J 121 T AGCAAGACATGGTCAGGAAACTGTGGCAACACGGGACACTGTGAC AACCAATGT AAAT A
M WEG^AHGACHVRGGKHMCFC
X
m 181 CTGGGAGGGGGCGGCCCATGGGGCGTGCCACGTGCGTGGAGGGAAACACATGTGTTTCTG
g YFKCPKAEKLAQDKVNAQEL
"* 241 CTACTTCAAGTGTCCCAAAGCCGAAAAGCTTGCTCAAGACAAAGTTAATGCCCAAGAGCT
DRDAKKVIPNVEHP 301 TGACCGTGATGCCAAGAAAGTGATTCCGAACGTTGAACATCCGTGAAAGGGTCGGTTTCT
361 TTAAATAGAAAGTCTTAGATTACGAATGCGAATAACTAT AGAAAATGTTTGCTAAATGTC
421 ACATTATAATTAGAACTTTATGATTGTTGTCAATAGGGCATTTTCTTGTTAGTGATATGT
4 81 GTAATAAGGTGATGCTTTTATGCTTTTCGTGCGTAAGAGTTTTCGACTATGTGTAATAAA
541 GAAAGGGTCTTTTTTTTTTAAAAAAAAAAAAAAAAAA

WO 00/11196

PCT/GB99/02720

6/19
Fig.4.

Sad (3751) nos 3' EcoR\ (3476)
P(BLA)
35S enhancer
Pstl (833) H/ndffl(841)
P(LAC)
AteoI(1) TMV ornega Xho\ (74) 35S minimai promoter 35S enhancer

EcoRI (3476)
35S enhancer
Pstl (833) H/ndin(841)
P(LAC)
P(BLA)

nos 3*
DmLC ORF Ncol (3806) Sad (3751)

AteoI(1)

TMV ornega Xho\ (74)
OR I
35S minimal promoter 35S enhancer

SUBSTITUTE SHEET (RULE 2.6)

WO 00/11196

PCT/GB99/02720

7/19
Fig.4 (Cont).

Ncol{\)
'TMV omega
35S minimal promoter 35S enhancer
35S enhancer
Pstl (833) H/ndDI(841)
P(LAC)
ORI
nos3'
EcoRl (3476)
P(BLA)
DmLCC ORF Ncol (3926), H/ndffl(3856) H/ndffl (3796) Sad (3751)

SUBSTITUTE SHEET (RULE 26)


c
CD CO
U)
X
m
31
c
s
ro

Symbols
RB: right border of T-DNA
Tnos: terminator of T-DMA nopaline synthase gene
MP RS-AFP2: mature protein domain of Rs-AFP2
LP: first 16 AAof Dm-AMP1 C-terminal propeptide and subtiiisin-like protease recognition site IGKR
MP Dm-AMP1: mature protein domain of Dm-AMP1 cDNA
SP Dm-AMP1: signal peptide domain of Dm-AMP1 cDNA
TMV: tobacco mosaic virus 5' leader sequence
Penh35S: promotor of 35S RNAof cauliflower mosaic virus with duplicated enhancer region
Pnos: promotor of T-DNA nopaline synthase gene
bar: basta resistance encoding gene
Tg7: terminator of T-DNA gene 7
LB: left border of T-DNA

*: unique restriction site

\ TMV
XSP Drn-AMP1

1000 bp



pFAJ3109

pBIN19 backbone (including oriRK2 and nptll)
Symbols
RB: right border of T-DNA
Tnos: terminator of T-DNA nopaline synthase gene
MP Dm-AMP1: mature protein domain of Dm-AMP1
SP Dm-AMP1: signal peptide domain of Dm-AMP1 cDNA
TMV: tobacco mosaic virus 5' leader sequence
Penh35S: promotor of 35S RNA of cauliflower mosaic virus with duplicated enhancer region
Pnos: promotor of T-DNA nopaline synthase gene
bar: basta resistance encoding gene
Tg7: terminator of T-DNA gene 7
LB: left border of T-DNA
*: unique restriction site

PFAJ3106
Xhol CTCGAGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACT
NCQl ATTTACAATTACACCATGGTGAATCGGTCGGTTGCGTTCTCCGCGTTCGTTCTGATCCTT
MVNRSVAFSAFVLIL
TTCGTGCTCGCCATCTCAGATATCGCATCCGTTAGTGGAGAACTATGCGAGAAAGCTAGC
FVLAISDIASVSG E L C E K A S
N
AAGACGTGGTCGGGCAACTGTGGCAACACGGGACATTGTGACAACCAATGTAAATCATGG
KTWSGNCGNTGHCDNOCKSW
r
GAGGGTGCGGCCCATGGAGCGTGTCATGTGCGTAACGGGAAACACATGTGTTTCTGTTAC EGAAHGACHVRNGKHMCFCY
TTCAATTGTAAAAAAGCCGAAAAGCTTGCTCAAGACAAACTTAAAGCCGAACAACTCATC F N C KKAEKLAQDKLKAEQLI
GGAAAGAGGCAGAAGTTGTGCCAAAGGCCAAGTGGGACATGGTCAGGAGTCTGTGGAAAC G K R QKLCQRPSGTWSGVCGN
AATAACGCATGCAAGAATCAGTGCATTAGACTTGAGAAAGCACGACATGGATCTTGCAAC NNACKNQCIRLEKARHGSCN
Sad
TATGTCTTCCCAGCTCACAAGTGTATCTGCTACTTTCCTTGTTAATAGGAGCTC YVFPAHKCICYFPC--


Fig.8.
pFAJ3109 a
Xhol CTCGAGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACT
NCQl ATTTACAATTACACCATGGTGAATCGGTCGGTTGCGTTCTCCGCGTTCGTTCTGATCCTT
^VNRSVAFSAFVLIL
TTCGTGCTCGCCATCTCAGATATCGCATCCGTTAGTGGAGAACTATGCGAGAAAGCTAGC
FVLAISDIASVSG E L C E K A S
AAGACGTGGTCGGGCAACTGTGGCAACACGGGACATTGTGACAACCAATGTAAATCATGG KTWSGNCGMTGHCDNQCKSW
GAGGGTGCGGCCCATGGAGCGTGTCATGTGCGTAATGGGAAACACATGTGTTTCTGTTAC EGAAHGACHVRNGKHMCFCY
SacI
TTCAATTGTTGAGCTC F N C -

WO 00/11196

PCT/GB99/02720

12/19

SUBSTITUTE SHEET (RULE 26)

WO 00/11196

PCT/GB99/02720

13/19

SUBSTITUTE SHEET (RULE 26)

WO 00/11196

PCT/GB99/02720

14/19

SUBSTITUTE SHEET (RULE 26)

«

WO 00/11196

PCT/GB99/02720

15/19

SUBSTITUTE SHEET (RULE 26)

WO 00/J n 96

PCT/GB99/02720


16/19
PCR Dahiia genomic DNA with DMVEC-1 and DMVEC-2, isolate 450 bp product.
PCR 450 bp DMVEC-1/DMVEC-2 PCR product with DMVEC 1 and 4.
Isolate 60 bp Ncol / Sad fragment, clone into pMJBl Ncol / Sad=pDmAMPA.
Cut 450 bp DMVEC-1/DMVEC-2 PCR product Ncol /Sad . Isolate 180 bp Ncol /
SacI fragment, clone into pMJBl Ncol / Sad =pDmAMPB

PCR 450 bp DMVEC-1/DMVEC-2 PCR product with DMVEC 3 and 4. Isolate 150 bp Ncol fragment, clone into pDmAMPA and pDmAMPB Ncol =pDmAMPD and pDmAMPE

N< ;oI Ncol
i 3ad
1 2 3 AC CORE nos

pDmAMPD
N< :oI Ncol $ SacI

1 2 3I AC CORE -Cter nos
pDmAMPE
SUBSTITUTE SHEET (RULE 26)


Fig.14(Cont).
TGC GGA AAC ACT GGA CAT TGC GAT AAC CAA TGC AAG TCT GGA AAG CAT ATG TGC TTC TGC TAC TTC AAC TGC
TGC GGA AAC ACT GGA CAT TGC

WO 00/11196

PCT/GB99/02720

19/19

SUBSTITUTE SHEET (RULE 26)

WO 00/11196 PCT/GB99/02720
6
caa gag ctt gac cgt gat gcc aag aaa gtg att ccg aac gtt gaa cat 340
Gin Glu Leu Asp Arg Asp Ala Lys Lys Val lie Pro Asn Val Glu His
95 100 105
ccg tga aagggtcggt ttctttaaat agaaagtctt agattacgaa tgcgaataac 396 Pro
tatagaaaat gtttgctaaa tgtcacatta taattagaac tttatgattg ttgtcaatag 456
ggcattttct tgttagtgat atgtgtaata aggtgatgct tttatgcttt tcgtgcgtaa 516
gagttttcga ctatgtgtaa taaagaaagg gtcttttttt tttaaaaaaa aaaaaaaaaa 576
a 577
<210> 5
<211> 446
<212> DNA
<213> Dahlia merckil
<220> <221> CDS <222> (1)..(64)
<220>
<221> CDS
<222> (157) . . (446)
<400> 5
atg gtg aat egg teg gtt gcg ttc tec gcg ttc gtt ctg ate ctt ttc 48
Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val Leu He Leu Phe
15 10 15
gtg etc gcc ate tea g gttatcaaat ctttagttca tttattgaat atgatagtat 104 Val Leu Ala He Ser
20

WO 00/11196

PCT/GB99/02720

ttatattctt ttatggtttt atgtgttctg acaagttgca aatattgagt ag at ate 161
Asp lie
gca tec gtt agt gga gaa eta tgc gag aaa get age aag aca tgg teg 209
Ala Ser Val Ser Gly Glu Leu Cys Glu Lys Ala Ser Lys Thr Trp Ser
25 30 35
gga aac tgt ggc aat acg gga cat tgt gac aac caa tgt aaa tea tgg 257
Gly Asn Cys Gly Asn Thr Gly His Cys Asp Asn Gin Cys Lys Ser Trp
40 45 50 55
gag ggt gcg gec cat gga gcg tgt cat gtg cgt aac ggg aaa cac atg 305
Glu Gly Ala Ala His Gly Ala Cys His Val Arg Asn Gly Lys His Met
60 65 70
tgt ttc tgt tac ttc aat tgt aaa aaa gee gaa aag ctt get caa gac 353
Cys Phe Cys Tyr Phe Asn Cys Lys Lys Ala Glu Lys Leu Ala Gin Asp
75 80 85
aaa ctt aaa gec gaa caa etc get caa gac aaa ctt aat gec caa aag 401
Lys Leu Lys Ala Glu Gin Leu Ala Gin Asp Lys Leu Asn Ala Gin Lys
90 95 100
ctt gac cgt gat gec aag aaa gtg gtt cca aac gtt gaa cat ccg 446
Leu Asp Arg Asp Ala Lys Lys Val Val Pro Asn Val Glu His Pro
105 110 115
<210> 6
<211> 150
<212> DNA
<213> Dahlia merckii
<400> 6
gagctttgcg agaaggcttc taagacttgg tctggaaact gcggaaacac tggacattgc 60
gataaccaat gcaagtcttg ggagggagct gctcatggag cttgccatgt tagaaacgga 120
aagcatatgt gettctgeta cttcaactgc. 150

wo

PCT/GB99/02720

8
<210> 7
<211> 60
<212> DNA
<213> Dahlia merckii
<400> 7
gaggtttgcg agaaggcttc taagacttgg tctggaaact gcgtjaaacac tggacattgc 60
<210> 8
<211> 111
<212> PRT
<213> Dahlia merckii
<400> 8
Met Ala Lys Asn Ser Val Ala Phe Phe Ala Leu Cys Leu Leu Leu Phe
15 10 15
He Leu Ala He Ser Glu He Arg Ser Val Lys Gly Glu Leu Cys Glu
20 25 30
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Arg His Cys
35 40 45
Asp Asp Gin Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys His
50 55 60
/
Val Arg Gly Gly Lys His Met Cys Phe Cys Tyr Phe Asn Cys Pro Lys
65 70 75 80
Ala Gin Lys Leu Ala Glu Asp Lys Leu' Arg Ala Ala Glu Leu Ala Lys
85 90 95
Glu Lys Asn Asn He Gly Ala Glu Lys Val Pro Ser Ala Thr Pro
100 105 110

PCT/GB99/02720
9
<210> 9
<211> 108
<212> PRT
<213> Dahlia merckii
<400> 9
Met Ala Lys Asn Ser Val Ala Phe Leu Ala Phe Lev1 Leu Leu Leu Phe
15 10 15
Val Leu Ala He Ser Glu He Gly Ser Val Lys Glj' Glu Leu CYS Glu
20 25 30
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asr1 Thr Ar9 His Cys
35 40 45
Asp Asp Gin Cys Lys Ser Trp Glu Gly Ala Ala Hi£ GlY Ala Cys His
50 55 SO
Val Arg Gly Gly Lys His Met Cys Phe Cys Tyr Ph^ Asn cys Ser Lys
65 70 75 80
Ala Gin Lys Leu Ala Gin Asp Lys Leu Lys Ala As(> LYS Leu Ala Lys
85 90 95
Glu Lys Ser Glu Ala Glu Lys Val Pro Ala Thr Pre?
100 105
<210> 10
<211> 98
<212> PRT
<213> Dahlia merckii
<400> 10
Met Ala Lys Asn Ser Val Ala Phe Phe Ala Phe Va> Leu Leu Leu Phe
15 10 15

WO 00/11196

PCT/GB99/02720

10
Val Leu Ala lie Ser Glu lie Gly Ser Val Lys Gly Glu Leu Cys Glu
20 25 30
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly lie Thr Ser His Cys
35 40 45
Asp Asn Gin Cys Arg Ser Trp Glu Gly Ala lie His Gly Ala Cys His
50 55 60
Val Arg Gly Gly Lys His Met Cys Phe Cys Tyr Phe Asn Cys Ser Lys
65 70 75 80
Ala Asp Glu Leu Ala Lys Glu Lys lie Glu Ala Glu Lys Met Pro Ala
85 90 95
Thr Pro
<210> 11
<211> 108
<212> PRT
<213> Dahlia merckii
<400> 11
Met Val Asn Arg Ser Val Ala Phe Ser Val Phe Val Leu lie Leu Phe
15 10 15
Val Leu Ala lie Ser Asp He Thr Ser Val Arg Gly Glu Val Cys Glu
20 25 30
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Gly His Cys
35 40 45
Asp Asn Gin Cys Lys Tyr Trp Glu Gly Ala Ala His Gly Ala Cys His
50 55 60
Val Arg Gly Gly Lys His Met Cys Phe Cys Tyr Phe Lys Cys Pro Lys
65 70 75 80

WO 00/11196

PCT/GB99/02720

11
Ala Glu Lys Leu Ala Gin Asp Lys Val Asn Ala Gin Glu Leu Asp Arg
85 90 95
Asp Ala Lys Lys Val He Pro Asn Val Glu His Pro
100 105
<210> 12
<211> 118
<212> PRT
<213> Dahlia merckii
<400> 12
Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val Leu He Leu Phe
15 10 15
Val Leu Ala He Ser Asp He Ala Ser Val Ser Gly Glu Leu Cys Glu
20 25 30
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Gly His Cys
35 40 45
Asp Asn Gin Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys His
50 55 60
Val Arg Asn Gly Lys His Met Cys Phe Cys Tyr Phe Asn Cys Lys Lys
65 70 ' 75 80
Ala Glu Lys Leu Ala Gin Asp Lys Leu Lys Ala Glu Gin Leu Ala Gin
85 90 95
Asp Lys Leu Asn Ala Gin Lys Leu Asp Arg Asp Ala Lys Lys Val Val
100 105 110
Pro Asn Val Glu His Pro 115

WO 00/11196 PCT/GB99/02720
12
<210> 13
<2ll> 8
<212> PRT
<213> Dahlia merckii
<400> 13
Cys Glu Lys Ala Ser Lys Thr Trp
1 5
<2l0> 14
<211> 8
<212> PRT
<2l3> Dahlia merckii
<400> 14
Met Cys Phe Cys Tyr Phe Asn Cys
1 5
<210> 15
<2ll> 126
<2l2> DNA
<2l3> Dahlia merckii
<4O0> 15
aagacgtggt cgggaaactg tggcaatacg ggacattgtg acaaccaatg taaatcatgg 60
gagggtgcgg cccatggagc gtgtcatgtg cgtaatggga aacacatgtg tttctgctac 120
ttcaac 126
<210> 16
<2ll> 42
<212> PRT
<213> Dahlia merckii

WO 00/11196 PCT/GB99/02720
13
<400> 16
Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Gly His Cys Asp Asn Gin
15 10 15
Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys His Val Arg Asn
20 25 30
Gly Lys His Met Cys Phe Cys Tyr Phe Asn
35 40
<210> 17
<211> 8
<212> PRT
<213> Dahlia merckii
<220>
<221> SITE
<222> (2)
<223> Xaa=Ala or Val
<220>
<221> SITE
<222> (3)
<223> Xaa=Lys or Asn
<220>
<221> SITE
<222> (4)
<223> Xaa=Asn or Arg
<400> 17
Met Xaa Xaa Xaa Ser Val Ala Phe
1 5

WO 00/11196

PCT/GB99/02720

14
<210> 18
<211> 7
<212> PRT
<213> Dahlia merckii
<400> 18
Asn Gly Lys His Met Cys Phe
1 5
<210> 19
<211> 7
<212> PRT
^JJL^ ,J\3.!?JJ.5 .WfiJtf.tj J
<400> 19
Gly Ala Cys His Val Arg Asn
1 5
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature <222> (6, 9, 12, 15, 21) <223> n is any residue
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 20
tgyganaang cnwsnaarac ntgg

WO 00/11196 PCT/GB99/02720
15
<210> 21
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature <222> (9, 12, 15) <223> n is any residue
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 21
carttraant ancanaaarc acat 24
<210> 22
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<221> misc_feature <222> (9, 12, 21) <223> n is any residue
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 22
atggcsaanm rntcrgttgc ntt 23

WO 00/11 lS-v
16
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 23
aaacacatgt gtttcccatt
<210> 24
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 24
agcgtgtcat gtgcgtaat
<210> 25
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 25
taaagaaacc gaccctttca egg

PCT/GB99/02720
17
WO 00/
<210> 26
<211> 39
<212> DNA
<213> Artificial Seguence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 26
atcgtagcca tggtgaatcg gtcggttgcg ttctccgcg 39
<210> 27
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 27
aaaccgaccg agctcacgga tgttcaacgt ttggaac 37
<210> 28
<211> 107
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Oligonucleotide
<400> 28
atgcatccat ggtgaatcgg tcggttgcgt tctccgcgtt cgttctgatc cttttcgtgc 60
tcgccatctc agatatcgca tccgttagtg gagaactatg cgagaaa 107

WO 00/] 1196

PCT/GB99/02720

<210> 29
<211> 34
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence Oligonucleotide

<400> 29
agcaagcttt tcgggagctc aacaattgaa gtaa

34

<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer

<400> 30
aggaagttca tttcatttgg

20

<210> 31
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer

<400> 31
gcctttggca caacttctgc ctctttccga tgagttgttc ggctttaagt ttgtc

55

WO 00/11196

PCT/GB99/02720

19
<210> 32
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 32
ttagagctcc tattaacaag gaaagtagc 29
<210> 33
<211> 4
<212> PUT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Synthetic sequence
<400> 33
lie Gly Lys Arg
1
<210> 34
<211> 534
<212> DNA
<213> Artificial Sequence
<220>
<221> CDS
<222> (76)..(525)

WO 00/11196

PCT/GB99/02720

20
<220>
<223> Description of Artificial Sequence: Synthetic sequence
<400> 34
ctcgagtatt tttacaaeaa ttaccaacaa eaaeaaacaa caaacaacat tacaattact 60
atttacaatt acacc atg gtg aat egg teg gtt gcg ttc tec gcg ttc gtt 111
Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val
15 10
ctg ate ctt ttc gtg etc gec ate tea gat ate gca tec gtt agt gga 159
Leu lie Leu Phe Val Leu Ala lie Ser Asp lie Ala Ser Val Ser Gly
15 20 25
gaa eta tgc gag aaa get age aag acg tgg teg ggc aac tgt ggc aac 207
Glu Leu Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn
30 35 40
acg gga cat tgt gac aac caa tgt aaa tea tgg gag ggt gcg gee cat 255
Thr Gly His Cys Asp Asn Gin Cys Lys Ser Trp Glu Gly Ala Ala His
45 50 55 60
gga gcg tgt cat gtg cgt aac ggg aaa cac atg tgt ttc tgt tac ttc 303
Gly Ala Cys His Val Arg Asn Gly Lys His Met Cys Phe Cys Tyr Phe
65 70 75
aat tgt aaa aaa gee gaa aag ctt get caa gac aaa ctt aaa gee gaa 351
Asn Cys Lys Lys Ala Glu Lys Leu Ala Gin Asp Lys Leu Lys Ala Glu
80 85 90
caa etc ate gga aag agg cag aag ttg tgc caa agg cca agt ggg aca 399
Gin Leu lie Gly Lys Arg Gin Lys Leu Cys Gin Arg Pro Ser Gly Thr
95 100 105
tgg tea gga gtc tgt gga aac aat aac gca tgc aag aat cag tgc att 447
Trp Ser Gly Val Cys Gly Asn Asn Asn Ala Cys Lys Asn Gin Cys lie
110 115 120

W^ ««/i. u« PCT/GB99/02720
21
aga ctt gag aaa gca cga cat gga tct tgc aac tat gtc ttc cca get 495
Arg Leu Glu Lys Ala Arg His Gly Ser Cys Asn Tyr Val Phe Pro Ala
125 130 135 140
cac aag tgt ate tgc tac ttt cct tgt taa taggagctc 534
His Lys Cys lie Cys Tyr Phe Pro Cys
145 150
<210> 35 <211> 149 <212> PRT
<213> Artificial Sequence
<22 3> Description of Artificial Sequence: Synthetic sequence
<400> 35
Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val Leu lie Leu Phe
15 10 15
Val Leu Ala lie Ser Asp lie Ala Ser Val Ser Gly Glu Leu Cys Glu
20 25 30
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Gly His Cys
35 40 45
/
Asp Asn Gin Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys His
50 55 60
Val Arg Asn Gly Lys His Met Cys Phe Cys Tyr Phe Asn Cys Lys Lys
65 70 75 80
Ala Glu Lys Leu Ala Gin Asp Lys Leu Lys Ala Glu Gin Leu lie Gly
85 90 95
Lys Arg Gin Lys Leu Cys Gin Arg Pro Ser Gly Thr Trp Ser Gly Mai
100 105 110

WO 00/111

PCT/CB99/02720

22
Cys Gly Asn Asn Asn Ala Cys Lys Asn Gin Cys lie Arg Leu Glu Lys
115 120 125
Ala Arg His Gly Ser Cys Asn Tyr Val Phe Pro Ala His Lys Cys lie
130 135 140
Cys Tyr Phe Pro Cys 145
<210> 36
<211> 316
<212> DNA
<213> Artificial Sequence
<220>
<221> CDS
<222> (76)..(312)
<220>
<223> Description of Artificial Sequence: Synthetic sequence
<400> 36
ctcgagtatt tttacaacaa ttaceaacaa caacaaacaa caaacaacat taeaattact 60
atttacaatt acacc atg gtg aat egg teg gtt gcg ttc tec gcg ttc gtt 111
Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val
1 '5 10
ctg ate ctt ttc gtg etc gec ate tea gat ate gca tec gtt agt gga 159
Leu lie Leu Phe Val Leu Ala lie Ser Asp lie Ala Ser Val Ser Gly
15 20 25
gaa eta tgc gag aaa get age aag acg tgg teg ggc aac tgt ggc aac 207 Glu Leu Cys Glu Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn
30 35 40

WO 00/11196 PCT/GB99/02720
23
acg gga cat tgt gac aac caa tgt aaa tea tgg gag ggt gcg gcc cat 255
Thr Gly His Cys Asp Asn Gin Cys Lys Ser Trp Glu Gly Ala Ala His
45 50 5S 60
gga gcg tgt cat gtg cgt aat ggg aaa cac atg tgt ttc tgt tac ttc 303
Gly Ala Cys His Val Arg Asn Gly Lys His Met Cys Phe Cys Tyr Phe
65 70 75
aat tgt tga gctc 316
Asn Cys
<210> 37 <211> 78 <212> PRT
<213> Artificial Sequence
<223> Description of Artificial Sequence: Synthetic sequence
<400> 37
Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val Leu lie Leu Phe
15 10 15
Val Leu Ala lie Ser Asp lie Ala Ser Val Ser Gly Glu Leu Cys Glu
20 25 30
/
Lys Ala Ser Lys Thr Trp Ser Gly Asn Cys Gly Asn Thr Gly His Cys
35 40 45
Asp Asn Gin Cys Lys Ser Trp Glu Gly Ala Ala His Gly Ala Cys His
50 55 60
Val Arg Asn Gly Lys His Met Cys Phe Cys Tyr Phe Asn Cys
65 70 75

Documents

Application Documents

# Name Date
1 in-pct-2001-00133-mum-form-pct-isa-210(07-02-2001).pdf 2001-02-07
2 in-pct-2001-00133-mum-form-pct-ipea-409(07-02-2001).pdf 2001-02-07
3 in-pct-2001-00133-mum-form 3(07-02-2001).pdf 2001-02-07
4 in-pct-2001-00133-mum-form 2(complete)-(07-02-2001).pdf 2001-02-07
5 in-pct-2001-00133-mum-form 1(07-02-2001).pdf 2001-02-07
6 in-pct-2001-00133-mum-claims(07-02-2001).pdf 2001-02-07
7 in-pct-2001-00133-mum-power of authority(05-09-2002).pdf 2002-09-05
8 in-pct-2001-00133-mum-form 13(27-09-2002).pdf 2002-09-27
9 in-pct-2001-00133-mum-correspondence(28-04-2004).pdf 2004-04-28
10 in-pct-2001-00133-mum-sequence listing(7-2-2001).pdf 2018-08-08
11 in-pct-2001-00133-mum-power of authority(7-2-2001).pdf 2018-08-08
12 IN-PCT-2001-00133-MUM-POWER OF AUTHORITY(27-9-2002).pdf 2018-08-08
13 in-pct-2001-00133-mum-form 19(28-4-2004).pdf 2018-08-08
14 IN-PCT-2001-00133-MUM-DRAWING(7-2-2001).pdf 2018-08-08
15 in-pct-2001-00133-mum-correspondence(ipo)-(2-4-2009).pdf 2018-08-08
16 in-pct-2001-00133-mum-correspondence(ipo)-(10-06-5004).pdf 5004-06-10