Abstract: The invention relates to an improved process for the production of a secondary metabolite comprising i) fermentation of a microorganism capable of producing said secondary metabolite, and ii) recovering said metabolite in substantially pure form. Said microorganism has been modified in a manner whereby the expression of one or more of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) enzyme(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence(s) in the original microorganism. Further contemplated is a process for production of said microorganism, a DNA construct, a vector or transformation vehicle, a microorganism capable of producing secondary metabolite and finally a secondary metabolite product.
The present invention relates to processes for the production of secondary metabolites in high yields by use of modified, microorganisms. The invention further relates to processes for producing the modified microorganisms, DNA constructs and vec¬tors for use in such processes and the modified microorganisms. Lastly the invention relates to secondary metabolites produced by the first mentioned methods.
BACKGROUND OF THS^^^WENT-ION
The biochemical pathways of microorganisms can be classified as being part of either primary or secondary metabolism. The pathways of primary metabolism are involved in the catabolism of molecules for energy production or in the synthesis of the building blocks of the cells. Most of these processes are common for all microorganisms. The secondary metabolism is usually anabolic and leads to compounds with no obvious function for the cell.
Among secondary metabolites /3-lactam antibiotics are a large family produced in nature by microorganisms. The most important class of β-lactam antibiotics both clinically and economically are the penicillins and the cephalosporins. Their biosynthesis occur via a complex pathway of enzymatic steps.
The unravelling of this pathway has been the subject of many studies during the last few decades. The first two steps in the biosynthetic pathways of the penicillin and the cephalosporin classes of /3-lactam antibiotics are identical. Thereafter the biosynthetic pathways to the penicillins and cephalosporins diverge.
The fl-lactam biosynthetic pathwav
The pathway to the important penicillin species penicillin V is
sketched belaw.
Arainoadipic acid + cysteine + valine -* ACV-tripeptide -*• isopenicillin N -* penicillin V
The first step is a condensation of L-a-aminoadipic acid (an intermediate in the lysine biosynthetic pathway in fungi or a degradation product of lysine in bacteria), L-cysteine and L-valine. In cephamycin-producing Actinomycetes, lysine (an amino acid belonging to the so-called aspartate family) is synthesiz¬ed by the dihydrodipicolinate pathway, which does not include a-aminoadipic acid as an intermediate. In these organisms the precursor is formed by catabolism of lysine by the action of lysine-6-aminotransferase.
In the second step, ACV is oxidatively cyclized by removal of four hydrogen atoms to form the bicyclic penam nucleus (a 6-lactam fused to a thiazolidine ring) of isopenicillin N which is present in all penicillins. From here the pathway diverges to penicillins in Penicillium chrysogenum and Aspergillus nidu-Iaj3s and to cepiralosporins and cephamycins in various molds and Actinomycetes. Cephalosporins and cephamycins (7-a-methoxy-cephalosporins) contain the cephem bicyclic ring system (a fi-lactam fused to a dihydrothiazine ring).
The enzymes catalyzing the i3-lactam pathway i Formation of the ACV-tripeptide is carried out by the enzyme S-(L-a-aminoadipyl)-L-cysteinyl-D-valine synthetase (ACVS).
The enzyme catalyzing the second step in the penicillin, cepha¬losporin and cephamycin biosynthesis is isopencillin N synthase (IPNS or cyclase). IPNS is stimulated by ferrous ions and as-corbate, and requires a reduced environment. As the ^-lactam ring is formed during cyclizatioh, isopenicillin N (IPN) is the first compound produced in the pathway with antibiotic activ¬ity.
IPNS has been purified from a wide variety of )3-lactam produc¬ing organisms including Streptomyces clavuligerus, Streptomyces
lactamdurans, Penlcillium chrysogenum and Cephalosporium acremonium.
The final step in the penicillin biosynthesis is catalyzed by acyl-CoA:6-aminopenicillanic acid transferase (AT), which has been purified from organisms as e.g. Penlcillium chrysogenum and Aspergillus nidulans.
Most of the enzymes involved in the biosynthesis of 6-lactams have been characterized. The genes coding for ACVS, IPNS (cyc¬lase) and AT have been cloned and modified in different ways to increase expression (Martin, J.F, J. Indust. Microorg., 9, p. 73-90, 1992).
I The genes encoding the penicillin biosynthesis The genes of penicillin biosynthesis in P. chrysogenum and A. nidulans are named respectively pcbAB, pcbC and penDE and are tightly clustered.
The pcbAB gene, encoding the ACV synthetase (ACVS) in P. chry¬sogenum, is an unusually large gene of about 12 kb without any introns (Smith et al., EMBO J., 9, p. 2743-2750, 1990, Diez et al., J. Biol. Chem., 265, p. 16358-16365, 1990). Transcriptio¬nal mapping showed the presence of a long transcript of about 11.5 kb that hybridized with several probes internally in the pcbAB gene. Further two small transcripts of 1.15 kb hybridized with the pcbC or the penDE gene (Martin, J. F. , J. Indu. Micr., 9, p. 73-90, 1992).
The transcriptional initiation and termination region of the pcbAB gene has been completely sequenced. The pcbAB gene is linked to the pcbC and penDE genes and is transcribed in the opposite orientation to them.
Also the pcbC gene, encoding isopenicillin N synthase or cyc¬lase of P. chrysogenum has been sequenced. The sequence does not contain any introns and the genes of P. chrysogenum (Barredo et al., Mol. Gen. Genet, 216, p. 91-98, 1989) are very
similar to those of Streptomyces griseus, N. lactaiadurans, and other Actinomycetes and filamentous fungi.
The penDE gene encodes AT which is the last step of the penicillin biosynthesis (Barredo et al.. Gene, 83, p. 291-300, 1989) . The penDE gene of A. nidulans is very similar to the penDE gene of P. chrysogenum and contains three introns in similar positions.
Transcription of the genes of the penicillin biosynthesis Several groups have reported transcription analysis of the upstream regions of the pcbC and pcbAB genes. In the fungi, the divergently transcribed genes are separated by about 1 kb . Smith et al. (Bio/Technology, 8, p. 237-240, 1990) used SI 1 mapping and primer extension to identify transcription initi¬ation sites in the 5' region of the C. acremonium pcbC gene. Major and minor pairs of mRNA start sites were found on either side of a pyrimidine-rich block in the promoter region at posi.tions -64 and -72, relative to the first base of the ATG initiation codon. A ^consensus TATA box was observed 68 bp upstream of the first major transcription start site. A similar motif was found at position -147 in the 5' region of the A. nidulans pcbC gene.
The sequence flanking the translation initiation codon matches the consensus fungal sequence. Barredo et al. (Mol. Gen. Genet., 216, p. 91-98, 1989) mapped the start site of P. chrysogenum pcbC mRNA by primer extension and showed that a single transcript was made that originated close to the I structural gene, starting at position -11.
Similar studies by Kolar et al. (J. Biotechnol., 17, p. 67-80, 1991) with a penicillin production strain of P. chrysogenum revealed two major transcription initiation sites, at -131 and -132 as well as at - 397.
Primer extension studies of the A. nidulans pcbAB gene demon¬strated a major mRNA start point at -2 3 0 bp. There was found no
recognizable core promoter sequences, a situation frequently encountered in fungal genes. As the pcbC and pcbAB genes may be regulated in a coordinate fashion, a search was made for poten¬tial regulatory elements, such as receptor sites for trans¬acting proteins, within the intergenic region separating the pcbAB and pcbC genes. A 53-bp region of dyad symmetry is loca¬ted equidistant from the two genes, but no other extensive se¬quence identities were detected (McCabe et al., J. Biol. Chera., 266, p. 12646-54, 1991).
Analysis of pcbC mRNA during a C. acremonium seven-day fermen¬tation showed a large accumulation of a 1.5-kb transcript be¬tween the second and the fourth day. This correlated with the appearance of products of the pathway after isopenicillin N (Smith et al., Bio/Technology, 8, p. 237-40, 1990). The fact that mRNA levels decreased after the fifth day when antibiotics peaked was attributed to stability of the IPNS enzyme.
Requlst-i on of the genes of the penicillin biosynthetic pathway Little is known about the molecular mechanisms that modify the expression of the genes that regulate the penicillin biosynthe¬sis, despite the fact that many studies show the biosynthetic pathway is subject to numerous metabolic controls.
Recent efforts in this direction have focused on characterizing the DNA regions controlling gene expression and analysing tran¬scription events in terms of critical cell growth parameters that affect antibiotic formation.
ACV synthesis may be the rate-limiting step in biosynthesis of penicillins and cephalosporins and is known to be regulated by glucose in Penicillium chrysogenum and Nocardia lactamdurans, by phosphate in Streptomyces clavuligerus and by ammonium in Streptomyces clavuligerus and Cephalosporiujn acremonium. It is also strongly affected by the oxygen transfer rate of the cultures.
Regulation of pcbC expression in C. acremonium occurs primarily at the transcriptional level. Similar studies of the S. clavn-ligerus pcbC gene show its expression to be under transcrip¬tional control. When cultures of S. clavuligerus were grown in rich or defined media, the amounts of pcbC mRNA correlated well with the IPNS enzyme activity and antibiotic production; in defined media, peak values of both occurred much earlier than in rich media (Y. Aharonowitz et al., Annu. Rev. Microbiol., 46, p. 461-95, 1992) .
Analysis of mRNA levels of penicillin biosynthetic genes in A. nidulans, under conditions where the penicillin synthesis was repressed, showed no transcripts, suggesting common regulation of these genes at the transcriptional level (McCabe et al., EMBO J., 9, p. 279-87, 1990).
Penalva et al. (Genetics ahd Molecular Biology of industrial Microorganisms, Washington, DC, Am. Soc. Microbiol., p. 256-61, 1989; Gene, 89, p. 109-15, 1990) showed that in A. nidulans the I pcbC gene was transcribed only after arrest of cell growth and only then penicillin was detected in the fermentation broth.
A rather different picture was found in P. chrysogenum. Levels of pcbC mRNA and IPNS stayed about the same throughout the fermentation, both in a wild-type strain and in a highly mutated overproducer strain (Kuck et al. Appl. Microbiol. Biotechnol., 31, p. 358-65, 1989). The latter exhibited 32- to 64-fold more mRNA than the wild-type strain.
Beatriz Perez-Esterban et al. (Molecular Microbiology 9:4, p. 881-895, 1993) found that the IPNS promoter of the A. nidulans IPNS gene is mostly regulated by upstream negative control ele¬ments that act upon a high basal activity. Sequential deletion analysis of three negative cis-acting elements result in a mutated promoter that is 40 times (sucrose broth) or J.2 times
—*
(lactose broth) more active than the wild type. One of these cis-acting elements is involved in sucrose repression. Strik¬ingly, it is located outside the non-transcribed 525 bp inter-
genie region and maps to the coding region of the divergently transcribed pcbAB gene. A 5'-deletion up to -56 (relative to the major transcription starting point (tsp)) showed that this region contain information to provide almost half of the maximal promoter activity and allows initiation of the tran¬scription at the correct site. By using total-protein extract from mycelia grown under penicillin producing conditions a DNA-binding activity was detected which specifically binds to a promoter fragment located between -654 and -455 (relative to IPNS tsp) . Deletions covering this region partially abolish IPNS promoter activity.
The interpretation of regulatory mechanisms in mutated, hiqh-0-lactam-producing strains is complicated by possible chromosomal aberrations in the cluster of biosynthetic genes. For example, one P. chrysogenum overproducer strain had 8-10 copies of the pcbC gene (Smith et al., Mol. Gen. Genet., 216, p. 492-97, 1989) and another contained the pcbC and penDE genes in a DNA segment of at least 35 kb amplified 14-fold (Barredo et al., Curr. Genet., 16, p. 453-59, 1989). The significance of such findings is relevant for attempts to genetically manipulate high producer strains, either through introducing additional copies of ^-lactam biosynthetic genes to overcome pathway blocks or by altering regulatory elements.
Amplification of the pcbC-penDE gene cluster of P. chrysogenum Wis 54-1255 led to as much as a 40% improvement in production yields (Veenstra et al. J. Biotechnol., 17, p. 81-90, 1991). Increased antibiotic yields were also reported in A. nidulans transformants containing multiple copies of pcbAB and pcbC genes (McCabe et al., J. Biotechnol-, 17, p. 91-97, 1991).
Attempts to increase cephalosporin C yields in C. acremonium and penicillin in P. chrysogenum by inserting multiple copies of the pcbC gene were unsuccessful (Skatrud et al. Bio/Techno¬logy, 7, p. 477-86, 1989).
A similar result was obtained in terms of penicillin production in a wild-type strain of A. nidulans (Penalva et al., Genetics and Molecular Biology of industrial Microorganisms, Washington, DC, Am. Soc. Microbiol, p. 256-61, 1989).
Relevant patent documents
US patent no, 4,885,251 (Eli Lilly) describes a DNA sequence from C. acremonium encoding isopenicillin N synthase (IPNS). The IPNS encoding gene sequence was isolated from C. acre¬monium. The intact IPNS gene (pcbC) and associated promoter has been used to construct a vector that drives the expression of IPNS in C. acremonium. Further the IPNS promoter has been fused to a hygromycin phosphotransferase-encoding DNA sequence and placed onto C. acremonium expression vector.
US patent no. 4,892,819 (Eli Lilly) describes a DNA sequence, encoding isopenicillin N synthase (IPNS), comprising the IPNS encoding gene (pcbC) and its promoter from Penicillium chryso-genum. The DNA sequence can be placed in an expression vector that function in P. chrysogenum and C. acremonium. This can be used to increase ultimate expression of a product encoded on a recombinant DNA vector.
EP 200,425 (Eli Lilly) discloses vectors encoding isopenicillin hJ synthase (IPNS) . The vectors permit high level expression of IPNS in C. acremonium and E. coli. The Cephalosporium vectors are useful for strain improvement, to increase efficiency and yield in fermentations for the production of penicillin and cephalosporin antibiotics. The vectors may also be modified to give vectors for increasing the production yields and effi¬ciency of P. chrysogenum, Streptomyces clavuligexrus etc. in fermentations.
EP 260,762 (Gist-Brocades) provides a transformation method for preparing Peniciilium transformants. The DNA is preferably integrated into a host with stable expression of the structural gene(s) which is introduced. Particularly, complementation of auxotrophy is employed for selection.
EP 354,624 (Gist Brocades) describes a subtraction isolation method for identifying genes associated with the production of secondary metabolites in microorganisms. The method is exemp¬lified with production of penicillin in P. chrysogenum.
EP 357,119 (Gist Brocades) discloses the clustered antibiotic biosynthetic genes encoding IPNS, AT and ACVS and are advan¬tageously employed for improvement of production of the anti¬biotic in microorganisms and for the isolation of other genes involved in the biosynthesis of the antibiotic. The invention is exemplified with improved production of penicillin in P. chrysogenum, with the isolation of another clustered biosyn¬thetic gene(s) and with the expression of clustered penicillin biosynthetic genes in Acremonium chrysogenum.
EP 448,180 (Gist Brocades) describes a method for modulating production of secondary metabolites which includes modulating the number and/or the size of the organelles, preferably microbodies, in host '^rganism. Thi*^ is done by altering the. ■ expression of a protein present in said organelles; and/or interfering with the cellular control mechanisms for maturation or fission of said organelles; and/or contacting the microor¬ganism with agents capable of regulating the number and/or size of organelles; or modulating the cellular localization of at least one protein, optionally derived from another microorgan¬ism, directly or indirectly involved in the production of said secondary metabolites by adding, deleting or altering one or more DNA sequences encoding one or more targeting signals in the gene(s) of one or more of said proteins.
Discussion of prior art
Prior art describes how to obtain high accumulated yields of secondary metabolites by increasing the number of copies of the structural gene(s) present in the fermentation microorganism and/or modification of these genes.
However, increasing the number of copies of structural genes present in the fermentation microorganism does not necessarily
increase the yield of the secondary metabolites. Apart from incorporation of the extrachromosomal DNA into essential parts of the chromosomal DNA of the microorganism, this can also lead to an expression in a growth phase in which not all the enzymes of the pathway are expressed or where the precursors for the pathway are unavailable. Furthermore, the lack of yield increase can be due to a complex set of interactions between the participants, in the biosynthetic pathways, e.g. precursors and intermediates. This may e.g. be the case when some of the enzymes in the pathway are inhibited by intermediates or pro¬ducts from the pathway. Other examples are accumulation of (un¬stable) intermediates when bottlenecks arise due to limited enzyme levels or inhibited activity, which in turn may influ¬ence the recovery negatively, or wnen several pathways are com¬peting for the same intermediates.
Furthermore, it is often desirable to produce fermentable products by a continuous fermentation process as the process eqxiipment is used more efficiently. However, this requires that the genes involved in the biosynthesis of the metabolite must all be expressed by growing cells.
When the secondary metabolite is produced using immobilized cells, the cells are usually not growing. It is thus necessary that the genes involved in the biosynthesis of the metabolite are expressed under no-growth conditions.
More specifically, in the fermentation of e.g. penicillin V, if the side-chain precursor is added to the fermentation continu¬ously during the production, the penicillin V slowly starts to accumulate in the broth after a lag phase. The volumetric pro¬ductivity does not reach a reasonable level until the culture is several hours old. If no side chain precursor is added to the fermentation a mixture of isopenicillin N, 6-aminopenicil-,lanic acid and various "natural" hydrophobic penicillins will accumulate. The presence of these /3-lactams represents a waste of substrate and may interfere with the following recovery of the desired penicillin.
SUMMARY OF THE INVENTION
The object of the invention is to overcome some of the above mentioned problems by providing an improved process for the production of a secondary metabolite comprising i) fermentation of a microorganism capable of producing said secondary metabolite, and ii) recovering said metabolite in substantially pure form.
Said microorganism has been modified in a manner whereby the expression of one or several of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) enzyine(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence(s) in the original microorganism.
Said expression may be initiated at either an earlier or a later fermentation stage in comparison to the original microor¬ganism.
The expression level of said peptide(s), protein(s) or enzyTOe(s) may be increased at-an earlier or later fermentation stage in comparison to fermentation of the original microorgan¬ism. The expression may be maintained throughout the fermenta¬tion.
According to a preferred embodiment the modification of the microorganism is accomplished by substitution of the promo¬ter (s) region (s) regulating the expression of said DNA sequence(s) .
Another object of the invention is to provide a DNA construct comprising a gene encoding the peptide(s), protein(s) or enzyme(s) of interest being connected in a regulatory manner to regulatory element(s)/promoters, which will lead to a regula¬tion that differs from the regulation of the original microor¬ganism.
A specific embodiment of this aspect of the invention relates to a DNA construct comprising the IPNS structural gene (pcbC) and the terminator, which is expressed under control of a penDE gene promoter (ATp).
A still further object of the invention is to provide a vector or transformation vehicle comprising such a DNA construct.
Also the invention relates to a process for the production of a microorganism capable of producing a secondary metabolite, which microorganism has been modified in a manner whereby the expression of one or several of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) enzyTne(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence(s) in the original microorganism.
In a specific embodiment the invention relates to such a microorganism capable of prc^ucing clavulanic acid, indole dihydrodiol and antibiotics, especially penicillin,.
Finally the invention relates to a secondary metabolite produced by a method according to the first aspect of the invention, especially an antibiotic, clavulanic acid or indole dihydrodiol.
Preferred antibiotics are penicillins, such as penicillin G and penicillin V.
BRIEF DESCRIPTION OF THE DRAWINd
The invention will be describesd in further details in the
following parts of the specification with reference to the
examples and figures.
Figure 1 shows the construction of the pME13 01 plasmid, wherein
(*) is the ligation site of the three fragment.
Figure 2 shows the restriction map of P. chrysogenum DNA region
comprising the pcbAB, pcbC and penDE genes.
Figure 3 shows penicillin V yield and the activity levels of two penicillin biosynthetic enzymes, cyclase and acyl-transferase, in BIO during a fermentation in shake flasks. The ictivity is relative to the maximal activity found during the fermentation.
Figure 4 shows the penicillin yields in shake flasks after 3 and 5 days of fermentation for BIO and two ATp IPNS transfor-Tiants (130 and 137) .
Figure 5 shows the relative penicillin yield for a 1 liter batch fermentation of BIO and transformants 13 0 and 137. The curve for BIO is an average of 5 fermentations while the curves for the two transformants each represents the average yields from two fermentations.
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an improved process for the production of a secondary metabolite comprising i) fermentation of a microorganism capable of producing said'secondary metabolite, and ii) ecovering said metabolite in substantially pure form.
Said microorganism has been modified in a manner whereby the expression of one or more of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) enzyme(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence(s) in the original microorganism.
In an embodiment of the process according to the invention said expression is initiated at a different fermentation stage in comparison to the original microorganism. If the expression is initiated at the same time the expression is maintained throughout the femnentation.
The fermentation stage includes, e.g., the- lag, growth and stationary phases.
DNA sequences coding for peptide(s), protein(s) or enzyme(s) interfering with the biosynthetic pathway of said secondary metabolite may e.g. be competing (a) peptide(s), protein(s) or enzyme(s) involved with competing pathways.
In another embodiment the expression level of said peptide(s), protein(s) or enzyme(s) is increased at an earlier or later fermentation stage in comparison to fermentation of the original microorganism. The expression may be maintained throughout the fermentation.
An increased expression level of the peptide(s), protein(s) or enzyme(s) in question is defined as an increased activity level.
The alteration of the regulation of the expression of the peptide(s), protein(s) or enzyme(s) may be obtained by genetic modification of one or more of the DNA sequence (s) of said original microorganisia. Suitable modifications are e.g. ■ substitution of the promoter and mutations at specific site(s) of" the DNA sequence(s) responsible for regulating the initi¬ation and expression of the gene(s). An example of a possible mutation is deletion and addition of one or more bases, using well-known procedures for site-directed or random mutagenesis, e.g. through radiation or chemical treatment.
Further contemplated according to the invention is modification by substitution of the DNA sequence(s) or at least a region in the DNA sequence(s) regulating the initiation and expression of the gene(s).
In a preferred embodiment of the invention said modification is accomplished by substitution of the promoter(s) region(s) regulating the expression of said DNA sequence(s).
The promoter may be any DNA sequence which regulates the ex¬pression of said DNA sequences differently from the promoter in the original microorganism.
The above mentioned principles of the process of the invention may be used for the production of any industrially important secondary metabolite where a coordinated expression of one or more peptides, proteins or enzymes is advantageous.
Examples of such relevant secondary metabolites include penicillins, cephalosporins, cephamycins, mono-bactams, chloramphenicol, erythromycin, streptomycin, clavulanic acid, nocardicins, and indole dihydrodiol.
For instance, a coordinated expression of several peptides, proteins or enzymes is advantageous in the production of indole dihydrodiol (for indigo-dyes). Indole dihydrodiol can be produced in E. coli after the introduction of a Pseudononas putida naphtalene dioxygenase (see Murduoch et al., (1993), Bio/Technology 11, 381).
The precursor for the dioxygenase in indogo synthesis is indole which is an intermediate in the biosynthesis of tryptophane. Indole is usually only present in the cell in low concentra¬tions, but by genetic engineering of the enzyme producing it (i.e. tryptophane synthetase) higher indole levels can be obtained.
In order to stabilize the naphtalene dioxygenase the simulta¬neous expression of a peptide, ferredoxin, is necessary. By using the same promoters for naphtalene dioxygenase and ferredoxin the stabilization can be obtained.
Further, the use of the same promoter for the modified tryptophane synthetase will lead to a simultaneous production of the substrate, indole.
By limiting the expression of the enzymes to a production phase, the metabolism of the cell will, not be loaded with the extra burden required for the production of these peptides, proteins or enzymes in e.g. the growth phase where the buildup of an active cell mass is most important. Another advantage by
Limiting the time where the genes are expressed is that the Likelyhood of genes reverting is limited.
The above points to the general applicability of the principle 3f the invention to metabolically engineered amino acid Dverproducing cells where it is important that all genes Involved in the biosynthesis are expressed coordinately.
Dther examples are the production of phenylalanine (Ikeda, M. and Katsumata, R. (1992) Appl. Envir. Microbiol. 58, 781) or amino acids of the aspartate family (Jetten, M.S.M., and Sinskey, A.J. (1995) Crit. Rev. Biotech. 15, 73).
In the following the production of the antibiotic penicillin will be used as another specific example. It is to be empha¬sized that penicillin production should only be regarded as an example for illustrating the general principle of the inven¬tion.
The penicillin to be produced may for instance be penicillin G or penicillin V.
By controlling the expression of the enzymes in the biosyn-thetic pathway an earlier onset of the penicillin production can be obtained.
The part of the DNA sequence encoding penicillin to be con¬trolled differently according to the invention may be the region coding for the isopenicillin N synthase (cyclase or IPNS) enzyme.
More specifically said DNA sequence may be modified so that the IPNS promoter is substituted by the promoter regulating the expression of the acyl-CoA:6-amino penicillanic acid transferase enzyme (AT) from P. chrysogenum.
*
AT is mainly produced early in the fermentation of penicillins while the cyclase peaks when growth decreases. Thus, the combi-
lation of the AT-promoter with the cyclase gene will give an sarlier expression of this enzyme and an earlier penicillin )roduction.
:n a specific example the original microorganism is Penicillium :hrysogenum used for producing penicillin. The AT is expressed it a high level in early stage of the fermentation. The IPNS ictivity increases after a considerable period of fermentation. :n order to reduce this lag phase and to induce the penicillin biosynthesis earlier in fermentation, the fermentation strain /as transformed with a plasmid comprising the IPNS gene with :he AT promoter (ATp IPNS gene).
The exchange of the promoter(s) can result in a coordinated expression of all biosynthetic enzymes for a given metabolite. This leads to a production without accumulation of intermedi¬ates in certain phases of the fermentation with the risk of ::oxic effects or degradation.
\ synchronization of the expression of the biosynthetic enzymes 3an lead to a faster production without or with reduced accumulation of intermediates, which can give purification problems or inhibition of the biosynthesis. It also reduces the degradation of already present /3-lactam.
It is advantageous to use the concept of this invention in con¬nection with immobilized cells. Immobilized cells are usually not growing and it is thus necessary to have expression of the biosynthetic genes under no-growth conditions. Some biosyn¬thetic enzymes are primarily produced by growing cells and it is therefore advantageous to introduce a promoter giving in¬creased levels of biosynthetic enzymes in stationary growth phase.
According to the present invention it"is possible to select a production phase which is more suitable to the needs of the production. An earlier start of the biosynthesis of the secondary metabolite during the production will lead to a
better utilization of the equipment and in some cases to a higher accumulated yield. Alternatively, a delayed production phase may be desirable in order to e.g build up a certain biomass before the cells starts the biosynthesis of the desired metabolite. This may especially be advantageous if the metabolite is unstable at the conditions used during the cell growth phase or if the metabolite itself or one of its precur¬sors is able to inhibit cell growth. A delayed production phase may then result in a more concentrated production phase, a reduced loss of a labile product, which in turn, leads to the formation of less byproducts, which can be of large signifi¬cance for the recovery of the metabolite.
Another argument for a period with a concentrated production phase is labile precursors or products. This can either be due to chemical instability or due to the utilization for other metabolic purposes.
An aiterndtive■is a constitutive production of d metabolite, i.e. production in all growth phases. In a continuous fermenta¬tion it is necessary that all the enzymes are expressed under conditions where at least some growth occur. Therefore regula¬tion factors that allow expression of all biosynthetic enzymes are usually advantageous under these Circumstances.
Alternatively a maintenance of expression during growth is
necessary in a continuous fermentation process, since it is
necessary that all the enzymes are expressed under conditions
where growth occurs. i
Whether an early or late expression of the biosynthetic enzymes is preferable is very dependent on the specific case. Factors, which may influence the choice, are toxic effects, stability of precursors, intermediates or product, mode of production (e.g. immobilized cells), ease of recovery, and economy.
Another application of the principle is for the regulation of competing metabolic pathways. In some circumstances it will be
advantageous to shut down or minimize this competition during ::he production phase of a metabolite.
This is the case if the competing pathways is draining the primary metabolites which are used for the biosynthesis of the desired product or if the product could itself be metabolized. Further if the primary pathways produce known repressors of the biosynthesis of the desired product.
Another object of the invention is to provide a process for the production of a microorganism capable of producing a secondary metabolite. An original microorganism is modified in a manner whereby the expression of one or more of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) enzyme(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence in the original microorganism.
In an embodimeat cf- the inventicp . s^id original microorganism is modified in a manner whereby said expression is initiated at a different fermentation" stage in comparison to the original microorganism. If the expression is initiated at the same time the expression is maintained throughout the fermentation.
It is also contemplated to increase the expression level of said peptide(s), protein(s) or enzyme(s) at an earlier or a later fermentation stage in comparison to fermentation of the original microorganism. The expression may be maintained throughout the fermentation.
In a preferred embodiment of the invention said original microorganism is modified by substitution of the promoter(s) region(s) regulating the expression of said DNA sequence(s).
According to the invention said DNA sequence(s), e.g'. compris¬ing the promoter(s) or structural gene(s), may be isolated by well-known methods. Thus, the DNA sequence may, for instance, be isolated by establishing a cDNA or genomic library from an
organism expected to harbour the sequence, e.g. a cell as described below, and screening for positive clones by conven¬tional procedures. Examples of such procedures are hybridiza¬tion to oligonucleotide probes in accordance with standard techniques (cf. Sambrook et al.. Molecular Cloning: A Labora¬tory Manual, 2nd. Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989).
A preferred method of isolating a DNA sequence from a cDNA or genomic library is by use of polymerase chain reaction (PCR) using degenerate oligonucleotide probes prepared on the basis of the DNA sequence in question. For instance, the PCR may be carried out using the techniques described in US Patent No, 4,683,202 or by R.K. Saiki et al., Science 239, p. 487-491, 1988.
Alternatively, the DNA sequence may be prepared synthetically by established standard methods, ;e.g. the phosphoamidite method described by.Beaucage and Caruthers, 1981, or the method de- -scribed by Matthes et al., 1984. According to the phosphoami¬dite method, oligonucleotides are synthesized, e.g. in an "auto¬matic DNA synthesizer, purified,, annealed, ligated and cloned in appropriate vectors.
> Finally, the DNA sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, ge¬nomic or cDNA origin (as appropriate), the fragments corre¬sponding to various parts of the entire DNA molecule, in accor-
) dance with standard techniques.
Preferably said original microorganism belongs to a genus from the group comprising Penicillium, Cephalosporium, Aspergillus, Nocardia, Streptomyces, Bacillus, Pseudomomas, Cercospora, -Micromonospora, other Eujbacteria, other Actinomycetes or filamentous fungi, capable of producing industrially important secondary metabolites selected from the group comprising penicillins, cephalosporins, cephamycins, mono-bactams,
chloramphenicol, erythromycin, streptomycin, clavulanic acid, nocardicins and indole dihydrodiol.
In a preferred embodiment said original microorganism belongs to a species from the group comprising Penicillium chrysogenum, Acremonium chrysogenum, Aspergillus nidulans, Nocardia lactam-durans, Streptomyces clavuligems and Pseudomonas putida.
In another preferred embodiment said original microorganism is a microorganism capable of producing penicillin, especially penicillin G or penicillin V.
In still an embodiment of the invention said DNA sequence comprises the DNA sequence coding for the isopenicillin N synthase (cyclase or IPNS) enzyme.
In a specific embodiment the IPNS promoter is substituted by the promoter (ATp) regulating the expression of the acyl-CoA:6-amino pen,icillanic acid transferase enzyme (AT).
A further object of the invention is to provide a DNA construct comprising (a) gene(s), which is(are) expressed under the con¬trol of a promoter different from the original promoter.
In the DNA construct, a DNA sequence, corresponding to the gene, should be operably connected to a suitable promoter se¬quence or other expression regulating factors. The promoter may be any DNA sequence which initiates expression of the peptide(s), protein(s) or enzyme(s) at a growth stage different from that of the original microorganism, and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
The DNA construct may also cotnprise a suitable terminator I operably connected to the DNA sequence.
In an embodiment of the invention said DNA construct comprises genes encoding enzymes involved in the secondary metabolism.
preferably some of the structural gene{s) encoding proteins for the /3-lactam antibiotic biosynthesis, such as the structural gene(s) encoding enzymes for the penicillin biosynthesis.
In a preferred embodiment said DNA construct comprises struc¬tural gene(s) encoding the isopenicillin N synthase (cyclase or IPNS) and a promoter of genes involved in /3-lactam antibiotic biosynthesis-
In still another preferred embodiment the promoter is a pro¬moter of the genes involved in penicillin biosynthesis, such as the promoter of the acyl-CoA:6-amino penicillanic acid trans¬ferase (AT) gene (penDE).
In a specific embodiment of the invention said DNA sequence comprises the IPNS structural gene (pcbC) and the terminator expressed under control of the AT gene (penDE) promoter (ATp).
Altern^itively the DNA sequence comprises a promoter of any cf-the genes e.g. in the primary metabolism.
A further object of the invention is to provide a vector or transformation vehicle comprising a DNA construct. Said DNA construct is preferably one of the above mentioned DNA con¬structs .
The DNA construct may further comprise a DNA sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmid pBR322, PUC19, pACYC177, pUBllO, pE194, pAMBl, pJC720 and pIJ702.
The DNA construct and/or vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the dal genes from B. suJbtilis or B. licheniformis, or one which confers antibiotic resistance such as pleomycin, ampicillin, kanamycin, chloramphenicol or tetra-
cyclin resistance, or positive selective markers, such as hy-gromycin B, AndS, sC, PyrG, ArgB, TrpC or NiaD.
To direct the enzyme to the desired location within the host cell or into the fermentation media, a targeting signal or a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence), respectively, may be provided in the recombinant vector. The targeting signals or secretory signal sequence are joined to the DNA sequence encoding the I enzyme in the correct reading frame. Secretory sequences are commonly positioned 5' to the DNA sequence, encoding the enzyme, whereas the targeting signal sequences are commonly positioned 3' to the DNA sequence. The targeting signal or secretory signal sequences may be that normally associated with the anzyme or may be from a gene encoding another protein having bhe desired signal sequence.
Intracellular expression is advantageous according to the present invention.
The procedures used to construct the DNA construct of the invention comprising ligating the DNA sequence(s) encoding the structural gene(s) in question, the promoter, terminator and other elements, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for in¬stance, Sambrook et al., supra, 1989)).
In an specific embodiment the vector or transformation vehicle is pUClS comprising an operably linked phleomycin resistant expression unit.
Also an object of the invention is to provide a microorganism capable of producing a secondary metabolite. The microorganism has been modified in a manner whereby the expression-of one or more of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) en2yme(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is
regulated differently from the regulation of the DNA sequence(s) in the original microorganism.
Preferably the microorganism is produced by the above mentioned process and modified by transformation of a vector or DNA construct of the previous mentioned type.
The microorganism may be transformed with the DNA construct of the invention, conveniently by integrating the DNA construct in the host chromosome, although the DNA construct may also exist as an extrachromosomal entity. However, the integration is gen¬erally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the microorganism. Inte¬gration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g. by homologous recombination. Alternatively, the microorganism may be trans¬formed with an expression vector as described below in connec¬tion with the different types of host cells.
The microorganism of the inventipn may be a cell of a higher organism such as a mammal or an insect, but is preferably a microbial cell, e.g. a bacterial or a fungal (including yeast) cell.
Preferably the microorganism belongs to a genus from the group comprising Penicillinm, Cephalosporium, Aspergillus, Nocardia, Streptomyces, Escherichia, Bacillus, Pseudomonas, Cercospora, Micromonospora, other SuJbacteria, other Actinomycetes or filamentous fungi and is further capable of producing an industrial important secondary metabolite. These are preferably from the group penicillins, cephalosporins, cephamycins, mono-bactams, chloramphenicol, erythromycin, streptomycin, clavulanic acid, nocardicins and indole dihydrodiol.
The transformation of bacteria, such as E. coli, may for instance be effected by protoplast transformation or by using competent cells in a manner known per se.
The filamentous fungus may belong to a species of Aspergillus, e.g. Aspergillus oryzae or Aspergillus niger. Fungal cells may¬be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of I the cell wall in a manner known per se.
In a preferred embodiment the microorganism belongs to a species from the group comprising Penicillium chrysogenum, Acremonium chrysogenum, Aspergillus nidulans, Nocardia lactam-) durans, Streptomyces clavuligerus, Pseudomonas putida or E. coli.
The medium used to cultivate the microorganisms may be any conventional medium suitable for growing the host cell in question. Suitable media are available from commercial supp¬liers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection).
A .fina.1 object of the invention is to provide a sscondary metabolite produced by the above mentioned method.
Preferably the secondary metabolite is an industrially import¬ant secondary metabolite selected from the groups of penicil¬lins, cephalosporins, cephamycins, mono-bactams, chloramphenicol, erythromycin, streptomycin, clavulanic acid and nocardicins, especially penicillin, such as penicillin G or penicillin V and pigments, in particular indigo-dyes.
MATERIALS AND METHODS
Strains:
BIO: P. chrysogenum strain (available from Panlabs, 11804 North
Creek Parkway South, Bothell WA 98011-8805, USA)
Strain 13 0: BIO transformed with pME13 01 comprising the ATp
IPNS gene
Strain 137: BIO transformed with pME1301 compjrising the ATp
IPNS gene
Clones:
Lambda KNK31 clone: Clone containing the penicillin gene cluster, respectively the pcbAB, pcbC and penDE genes.
Vector:
pUC19: 2.6kb Asp719-Sall fragment
pBR322: 3.9kb Nhel-Sall fragment
Transformation selective marker:
E. coli Tn5 phleomycin resistant gene expressed by Aspergillus
oryzae TPI (triose phosphate isoraerase) promoter and
Aspergillus niger AMG (Amyloglucosidase) terminator.
Plasmid:
pME1243: 2.3kb EcoRI-Sall fragment penDE promoter -
pcbC gene - pcbC terminator in pUC19. pME1205: Subclone of pcbC and penDE genes from lambda
KNK31 in pBR322. pME13 01: 7.6kb Plasmid containing penDE promoter - pcbC
qene - pcbC terminator (2.3kb) , TPI promoter (0.9kb) ,
Tn5 phleomycin resistant gene (l.lkb), AMG terminator
(O.Vkb) and pUC19 (2.6kb).
Materials:
LCS slant agar: (J. Lein, 1986, "The Panlabs penicillin strain
improvement program" in Vanek Z, Hostalek Z (eds.)
Overproduction of microbial metabolites, strain improvement and
process control strategies. Butterworth, Boston , p. 105-139).
P-1 seed medium: (J. Lein, 1986)
P-2 fermentation medium: (J. Lein, 1986, lard oil replaced by
olive oil))
Tween-80®: (Merck Art. 822187)
LCS medium: Lactose monohydrate 1.5%, corn steep liquor 0.5%
peptone 0.5%, NaCl 0.4%, MgS04.7H20 0.05%, KH2PO4 0.06%,
FeCl3.6H20 0.0005%, CuSO^. 5H2O-0 . 002% , pH 4.8
LCS agar: LCS medium, 2% agar.
Myra cloth (Calbiochem)
Solutions for protoplast formation;
BSA: Bovine serum albumin (Sigma A7638)
Solution A: 5 ml contains 1.2 M MgS04, 10 mM NaH2P04, pH 5.8, 150
mg Novozym234 (batch #1199), 100 /il chitinase (Sigma, 4U/ml) .
Solution B: 0.6 M sorbitol, 100 mM Tris-HCl, pH 7.0
Solution C: 1.2 M sorbitol, 10 mM Tris-HCl, pH 7.5, 10 mM CaCl,
Solution D: 60% PEG4000(BDH#29576), 10 mM Tris-HCl, pH 7.5, 10
mM CaCl2,
Methods:
DNA was prepared by CsCl density gradient (Maniatis et al., 1982, Molecular cloning, A laboratory manual. Cold Spring Harbor Laboratory, New York).
Cloning of the penicillin gene cluster from P. chrysogenum. Genomic DNA from P. chrysogenum was isolated according to the procedure of Schwarz-Sommer et al., EMBO J., 3, p. 1021-1028, 1984) and partially digested with Sau3A. Fragments 15-23 kb in size were isolated and ligatcd to lambda EM2L3 BamHI arms (Promega).
By screening of the genomic library lambda EMBL3 with plaque hybridization method (Maniatis et al., 1982, supra) a clone was found, which hybridised with probes specific for pcbAB, pcbc and penDE, i.e.:
(1) an approx. 400 bp Pstl/BamHI fragments containing the pcbAB terminator,
(2) an approx. 1 kb Ncol fragment containing the pcbC coding region, and
(3) approx. 400 bp Bsu36I/SalI fragment containing the penDE terminator.
Lambda KNK31 DNA hybridised with all the above mentioned probes (see figure 2).
Restriction enzyme sites in lambda KNK31 DNA: " Restriction of lambda KNK31 with Sail cuts away the two lambda KNK31 arms (9 and 20 kb, respectively) from the insert, enabling a size estimation of the insert. There are no EcoRI
sites in the lambda arms, and the BaitiHI site used for cloning will statistically be maintained in 25% of the cases when ligated to Sau3A partials. The lambda KNK31 has an 18.6 kb insert and give rise to 6 Sail fragments, 4 EcoRI fragments and 3 BamHI fragments.
Transformation
Penicilllum chrysogenum production strain BIO was cultured in 2 flasks of 100 ml LCS medium for 36 hrs. at 26°C. Mycelia was collected on Myra cloth and washed thoroughly with 500 ml 0.6M MgS04, Mycelia was then transferred into a plastic flask and suspended in 5 ml Solution A and placed on ice for 5 min. 750 Ml BSA (12 mg/ml) was added to the mycelial suspension and further incubated at 3 0°C for 1 to 2 hours with gentle shaking. Protoplast formation was controlled with light microscope.
Protoplasts were collected on Myra-cloth and layered carefully over 5 ml of Solution B. After centrifugation slowly up to 2000 .rpm for 15 min., protoplasts, which localized at the interphase-between Solution B and Solution A, were taken by pipeting and dilute'd by adding 2 vol. of Solution C and again centrifuged at 2500 rpm for 5 min. Protoplast pellet was washed twice with Solution C and isolated protoplasts were diluted by adding Solution C to get 1-2 x 10^ cells/ml. 100 /il of protoplasts was used for a transformation.
10 y.q DNA prepared by CsCl density gradient was added to the protoplasts and left at room temperature for 20 min. Then 200 Ml of Solution D were added and the mixture was left at room temperature for 20 min. 3 vol. bf 1,2 M sorbitol were then added and protoplast-DNA aggregatfs was centrifuged at 2500 rpm for 10 min. The pellet was then resuspended by adding 300^1 1.2 M sorbitol and plated on 3 selective plates (100 y.1 each) containing 50 Mg/ml phleomycin ahd 1.2 M Sorbitol in the LCS agar. Plates were incubated at 26 °C until transformants appeared.
Femnentation of P. chrysogenum'.
Lyophilized spores of P. chrysogenum (Panlabs Bio strain), were inoculated on 10 ml LCS slant agar after suspension in distilled water containing 0.1% (v/v) Tween-80®. After incuba¬tion at 25°C for 10 days, the spores from the slant surface were suspended in 10 ml of 0.1% Tween-80® and 5 ml were used to inoculate 50 ml P-1 Seed Medium in 300 ml erlenmeyer flasks. The seed culture were incubated at 25°C on a rotary shaker at 290 rpm. After 48 hours, 2 ml aliquots of seed culture were used for inoculation of the P-2 fermentation medium, 35 ml in 300 ml erlenmeyer flasks. The cultures were incubated at 25°C at 290 rpm until harvested.
Determination of penicillin V in supernatant from fermentation broth.
Firstly, 1 ml of ice cold ethanol was added to 1 ml supernatant, after mixing the proteins were allowed to precipi¬tate for 5 min. on ice bath.
Secondly the samples were centrifuged for 5 min. at 3 000 rpm (1-550 g) ,-4''C. Thx2..supernatant was diluted v/ith, 50 JsH Tri£,'HCl.. pH 7.2.
When analysing BIO, samples from day 1-2 were normally diluted 200 times and samples from day 3-7 were diluted 2000 times (incl. the 1 fold dilution with ethanol)
The samples were analyzed by HPLC under the following condi¬tions: Eluent: 100 ml 25 mM Na-phosphate buffer, pH 7.0
180 ml acetonitrile ;
720 ml Milli-Q water:
mixed and degassed by He Flow: 1.5 ml/min Detection: UV 210 nm Column temp.35°C i Column: Supelcpsil LC-IB-DB (25x4.6 mm) with Supelguard
column Runtime: 12 min. Retention time (penicillin V): approx. 8.3 min.
standard: 50 /xM Penicillin V (potassium salt)
Preparation of cell extracts from P. chrysogenum by sonication Shake flasks were placed on ice bath until harvest. The cells were harvested as quickly as possible by filtration on Biichner-funnel coated with one layer Myra cloth (from Calbiochem). Then the cells were washed with at least 2 volumes ice cold 0.9% (W/V) NaCl on the funnel. 2 grams of the cells were weighed into ice cold glass centrifugation tubes, followed by addition of 4 ml 50 mM Tris/HCl, pH 7.2, 5 mM dithiothreitol, 1 mM EDTA and 0.5 mM phenylmethylsulfonyl fluoride (PMSF).
Sonication took place on ice bath for 2 min. (50% duty cycle) followed by centrifugation for 20 min. at 10,000 g. The supernatant was desalted on PDIO column (G25) equilibrated with the same buffer as used for resuspension of the cells, however the PMSF content were reduced to 50 Mg/1- For the desalting 2 ml sample was applied on the column followed by 0.5 ml buffer and eluted with another 2.5 ml buffer.-The eluate containing the extract was diluted 10 times with 50 mM Tris/HCl, pH 7.2, 5 mM dithiothreitol, 1 mM EDTA, no PMSF. Assay as -described in F-9200088 (Available on request from Novo Nordisk A/S).
EXAMPLES
Example 1
The entire penicillin biosynthetic gene cluster including the
ACV synthetase gene (pcbAB) was cloned from P. chrysogenum BIO
in lambda EMBL3. !
A phage (lambda KNK31) was found to contain the entire gene cluster.
DNA was isolated (Maniatis et al., supra, 1982) from the lambda KNK31 clone and the insert was mapped by restriction enzyme Sail, EcoRI and BamHI. The restriction enzyme map is displayed in Figure 2 and below in Table 1.
DNA construct
Clone lambda KNK31 was digested with Xbal and Bglll isolating a 1427 bp fragment comprising the pcbC gene and the penDE terminator (see Figure 2).
A 874 bp fragment comprising the penDE promoter was made by PCR (PCR Protocols: A Guide to Methods and Applications, Ed. M.A. Innis, D.H. et al. Academic Press, Inc, 1990)), using lambda KNKJl as a t.emplate, and the tollowing primers. The primer tail #1069M contains Xbal site instead of the XmnI site at the original AT promoter.
Primer #1069M: Xball 5'- CTAG TCTAGA GCGGGTCGGAAGATGGGTAAAC - 3'
Primer #1070M:
Sad 5'- TTCGGCAC GAGCTC TCCTTG - 3'
The PCR fragment was digested with Sad and Xbal restriction enzymes and the 874 bp fragment was isolated by 0.7% agarose gel electrophoresis. This was ligated to the above mentioned Xbal-Bglll fragment of 1427 bp, which contains pcbC structural gene and terminator and 2.6 kb pUC19 vector which was cut with Sad and BamHl enzymes (pME124 3) . The former fragments was isolated from pME1205 (a subclone of pcbC and penDE genes from lambda clone, KNK31). From pME1243, 2.3 kb EcoRI-Sall fragment,
(penDE promoter, pcbC structural gene and pcbC terminator) (ATp IPNS) was taken out and ligated with 2.7 kb Asp718-EcoRI fragment of E.coli Tn5 phleomycin resistant gene expression unit {Aspergillus oryzae TPI promoter and Aspergillus niger AMG terminator) and with pUC19 vector (2.6 Asp718-Sall fragment) This resulted in the pME1301 plasmid (see Figure 1).
BIO was transformed with pME1301 comprising the ATp IPNS gene. This lead to BIO transformants strain 130 and 137.
Example 3
Biosynthetic enzymes during a fermentation.
The appearance of cyclase and acyltransferase during a shake flask fermentation of Penicillium chrysogenum BIG is shown in Figure 3. The activities at 0 hours are the activities in the preculture immediately before transfer into the production medium. From the Figure 3 it is clear that acyltransferase is .prii^arily expressed early in the fermentation while cyclase activity reaches a maximum late in the fermentation. Thus the activities of the two biosynthetic enzymes are uncoordinated. It appears from the figure that the production of penicillin closely follows the curve for cyclase activity.
Example 4"
Test of ATp IPNS transformants (130 and 137)
The penicillin production and Icyclase activity in the two transformants (130 and 137) produced according to example 2 were tested in shake flasks andi compared to the host strain, BIO and the results are given in Table 2, Table 3 and Figure 4.
It appears that the penicillin production is started earlier in the two transformants compared to BIO and that the accumulated penicillin V production in five days old cultures is increased as well. This corresponds well with the increased cyclase activity both the early and late stages of the fermentation.
In Table 2 the relative cyclase activity and penicillin V yield in 5 day shake flask cultures of ATp IPNS transformants (strain 130 and 137) are displayed. Yields are relative to BIO.
By replacing the promoter for cyclase with the promoter from acyltransferase an increased activity of cyclase was obtained in the early part of the fermentation. Furthermore, the elevated level of cyclase activity were maintained throughout the fermentation as is clear' from Table 3.
In Table 3 is displayed the relative cyclase activity in 2 and 5 day old shake flask cultures of BIO and two ATp IPNS I transformants.
The two ATp IPNS transformants (13 0 and 137) were tested in 1 liter fermenters using the same medium as used in. the shake flasks, and the relative accumulated penicillin V yields are given in Figure 5. From this figure it is evident that by replacing the promoter for cyclase with the promoter for
acyltransferase, the penicillin lag phase is reduced and a higher total yield of penicillin was obtained.
It is thus clear that by increasing the expression of cyclase early in the fermentation of penicillin V and maintaining an elevated level of the activity the production of penicillin is started earlier and the accumulated yields are increased.
As will be apparent to those skilled in the art in the light of the foregoing disclosure, many alterations and modifications are possible in practice of this invention without departing from the spirit or scope thereof. Accordingly, the scope of the invention is to be construed in accordance with the substance defined by the following claims.
PATENT CLAIMS
1. A process for the production of a secondary metabolite
comprising
i) fermentation of a microorganism capable of producing said secondary metabolite, and
ii) recovering said metabolite in substantially pure form, wherein said microorganism has been modified in a manner whereby the expression of one or more of the DNA sequences coding for (a) peptide(s), (a) protein(s) or (an) enzyme(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence(s) in the original microorganism.
2. The process according to claim 1, wherein said expression is initiated at an earlier fermentation stage in comparison to the expression in the original microorganism.
3. The process according to claim 1, wherein the expression level of said peptide(s), protein(s) or enzyme(s) is increased at an earlier fermentation stage in comparison to fermentation of the original microorganism.
4. The process according to claim 1, wherein said expression is initiated at a later fermentation stage in comparison to the expression in the original microorganism-
5. The process according to claim 1, wherein the expression
I level of said peptide(s), protein{s) or en2yme(s) is increased
at a later fermentation stage in comparison to fermentation of the original microorganism.
6. The process according to any of the claims 1 to 5, wherein said expression is maintained throughout the fermentation.
7. The process according to any of the claims 1 to 6, wherein said expression is synchronized to the expression of other
genes encoding enzymes belonging to the same biosynthetic pathway.
8. The process according to any of the claims 1 to 7, wherein the microorganism used for the fermentation is immobilized.
9. The process according to any of the claims 1 to 8, wherein the fermentation is continuous.
10. The process according to any of the claims 1 to 9, wherein said modification is accomplished by substitution of the promoter region(s) regulating the expression of said DNA sequence(s).
i 11. The process according to any of the claims 1 to 10, which is a process for the production of an antibiotic, clavulanic acid or indole dihydrodiol.
12. The process according to claim 11, which is a process for the production of an antibiotic selected from the group comprising penicillins, cephalosporins, cephamycins, mono-bactams, chloramphenicol, erythromycin, streptomycin, and nocardicins.
13. The process according to claim 12, which is a process for the production of penicillin.
14. The process according to claim 13, which is a process for the production of penicillin G or penicillin V.
15. The process according to any of the claims 12 to 14, wherein said DNA sequence is the DNA sequence coding for the isopenicillin N synthase (cyclase or IPNS) enzyme.
16. The process according to- claim 15, wherein the IPNS promoter is substituted by the promoter (ATp) regulating the expression of the acyl-CoA:6-amino penicillanic acid transferase enzyme (AT).
17. A process for the production of a microorganism capable of producing a secondary metabolite, wherein an original micro¬organism is modified in a manner whereby the expression of one or more of the DNA sequences coding for (a) peptide (s) , (a) protein(s) or (an) enzyme(s), involved in or interfering with the biosynthetic pathway of said secondary metabolite, is regulated differently from the regulation of said DNA sequence(s) in the original microorganism.
I 18. The process according to claim 17, wherein said original microorganism is modified in a manner whereby said expression is initiated at an earlier fermentation stage in comparison to the expression in the original microorganism.
i 19. The process according to claim 17, wherein said original microorganism is modified in a manner whereby the expression level of said peptide(s), protein{s) or enzyme(s) is increased at an earlier fermentation stage in comparison to fermentation of the original microorganism.
20. The process according to claim 17, wherein said original microorganism is modified in a manner whereby said expression is initiated at a later fermentation stage in comparison to the expression in the original microorganism.
21. The process according to claim 17, wherein said original microorganism is modified in a manner whereby the expression level of said peptide(s), protein(s) or enzyme(s) is increased at a later fermentation stage in comparison to fermentation of the original microorganism.
22. The process according to any of the claims 17 to 21, wherein said original microorganism is modified in a manner whereby the expression is maintained throughout the fermentation.
23. The process according to any of the claims 17 to 22, wherein said original microorganism is modified in a manner
whereby the expression of the genes is synchronized to the expression of other genes belonging to the same biosynthetic pathway.
5 24. The process according to any of the claims 17 to 23 wherein the microorganism used for the fermentation is immobilized.
25. The process according to any of the claims 17 to 23, where-
10 in the fermentation is continuous.
26. The process according to any of the claims 17 to 25, where¬
in said original microorganism is modified by substitution of
the promoter(s) regulating the expression of said DNA sequen-
15 ce(s).
27. The process according to any of the claims 17 to 26, where¬
in said original microorganism belongs to a genus from the
group comprising Penicillium, Cephalosporium, Aspergillus,
20 "Nocardia, Streptomyces, Escherichia, Bacillus, Pseudomonas,
Cercospora, Micromonospora^ other Eubacteria, other
Actinomycetes or filamentous fungi.
28. The process according to any of the claims 17 to 27,
25 wherein said original microorganism is a microorganism capable
of producing an antibiotic, clavulanic acid or indole dihydrodiol.
29. The process according to claim 28, wherein said original
3 0 microorganism is a microorganism capable of producing an
antibiotic selected from the group comprising penicillins, cephalosporins, cephamycins, mono-bactams, chloramphenicol, erythromycin, streptomycin, and nocardicins.
35 30. The -process according to claim 28 or 29, wherein said original microorganism belongs to a species from the group —mprising Penicillium chrysogenum, Acremonium chrysogenum,
Aspergillus nidulans, Nocardia lactamdurans, Streptomyces clavuligerus and Pseudomonas putida.
31. The process according to claim 30, wherein said original microorganism is a microorganism capable of producing penicillin.
32. The process according to claim 31, wherein said original microorganism is a microorganism capable of producing penicillin G or penicillin V.
33. The process according to claim 32, wherein said DNA se¬quence is the DNA sequence coding for the isopenicillin N synthase (cyclase or IPNS) enzyme.
34. The process according to claim 33, wherein the IPNS promoter is substituted by the promoter regulating the expression of the acyl-coenzyme A:6-amino penicillanic acid transferase enzyme.
35. A DNA construct comprising gene(s), involved in the secondary metabolism, which is expressed under the control of a promoter different from the original promoter.
36. The DNA construct according to claim 35, wherein the promoter is a promoter of any of the genes in the secondary metabolism of a microorganism.
37. The DNA construct according to claim 35 or 36, wherein said gene(s) encode(s) peptide(s), protein(s) or enzyme(s) involved in the biosynthesis of a jS-lactam, clavulanic acid or indole dihydrodiol.
38. The DNA construct according to any of the claims 35 to 37,
I wherein the -gene(s) encoding peptide(s), protein(s) or enzyme(s) of the penicillin biosynthesis.
39. The DNA construct according to any of the claims 35 to 38, wherein the gene is the gene encoding the isopenicillin N synthase (cyclase or IPNS) .
40. The DNA construct according to claim 35 to 39, wherein the promoter is a promoter of genes encoding peptide(s), protein(s) or enzyme (s) involved in the /3-lactam biosynthesis.
41. The DNA construct according to claim 40, wherein the promoter is a promoter of said gene(s) involved in the penicillin biosynthesis.
42. The DNA construct according to claim 41, wherein the promoter is the promoter of the acyl-CoA:6-amino penicillanic acid transferase (AT).
43. The DNA construct according to claim 35 to 42 comprising the IPNS structural gene and the terminator, which is expressed under control of an AT promoter.
44. The DNA construct according to claim 35, wherein the promoter is a promoter of any of the genes involved in the primary metabolism of a microorganism.
45. The DNA construct according to claim 35, wherein the promoter comprises an operable part of the promoter DNA sequence(s) according to claim 3 6 to 44.
46. A vector or transformation vehicle comprising a DNA construct according to any of the claims 3 5 to 45.
47. A vector or transformation vehicle comprising a DNA construct according to any of the claims 35 to 45, wherein said DNA construct is operably linked to a sequence encoding a targeting signal.
48. A vector or transformation vehicle comprising a DNA con¬
struct according to any of the claims 35 to 45, wherein said
vector comprise an operably linked phleomycin resistant unit.
49. A vector or transformation vehicle comprising a DNA
construct according to any of the claims 35 to 45, wherein said
vector is pUC19.
50. A microorganism capable of producing a secondary
metabolite, which microorganism has been modified in a manner
whereby the expression of one or more of the DNA sequences
coding for (a) peptide(s), (a) protein(s) or (an) enzyTne(s),
involved in or interfering with the biosynthetic pathway of
said secondary metabolite, is regulated differently from the
i regulation of said DNA sequence(s) in the original microorganism.
51. The microorganism according to claim 50, produced by any of
the processes of any of the claims 17 to 34.
I
52. The microorganism according to claim 50 or 51, wherein a
vector or DNA construct of any of the claims 3 5 to 4 5 has been
used for said modification.
i 53. The microorganism according to any of the claims 50 to 52, wherein said microorganism belongs to a genus from the group comprising Penicillium, Cephalosporium, Aspergillus, Nocardia, Streptomyces, Escherichia, Bacillus, Pseudomonas, Cercospora, Micromonospora, other Eubacteria, other Actinomycetes or
) filamentous fungi.
54. The microorganism according to any of the claims 50 to 53,
wherein said microorganism is a microorganism capable of
producing an antibiotic, clavulanic acid or indole dihydrodiol.
55. The microorganism according to claim 54, wherein said
microorganism is a microorganism capable of producing an
antibiotic selected from the group comprising microorganisms
capable of producing penicillins, cephalosporins, cephamycins, mono-bactams, chloramphenicol, erythromycin, streptomycin, and nocardicins.
56. The microorganism according to claims 54 and 55, wherein said microorganism belongs to a species from the group comprising Penicillium chrysogenum, Acremonium chrysogenum, Aspergillus nidulans, Nocardia lactamdurans, Streptomyces clavuligerus, Pseudomonas putida and E. coli.
57. A secondary metabolite produced by a process according to any of the claims 1 to 16.
58. The secondary metabolite according to claim 57, wherein said metabolite is an antibiotic, clavulanic acid or indole dihydrodiol.
59. The secondary metabolite according to claim 57 or 58,
wherein said metabolite is an antibiotic selected from the
group comprising microorganisms capable of producing penicil¬
lins, cephalosporins, cephamycins, mono-bactams,
chloramphenicol, erythromycin, streptomycin, and nocardicins.
60. The secondary metabolite according to any of the claims 57
to 59, wherein said metabolite is penicillin.
61. The secondary metabolite according to claim 53 to 56,
wherein said metabolite is penicillin G or penicillin V.
62. A process for the production of a secondary netabolite substantially as herein described with reference to the acconpanying drawings.
83. A DMA construct substantially as hereinbefore described with reference to the aooonpanying drawings.
64. A vector or transformation vehicle substantially as
hereinbefore described with reference to the aooonpanying
drawings.
65. A nicroorganisn substantially as hereinbefore described
with reference to the accompanying drawings.