Abstract: Plasmids which comprise (1) an origin of replication; (2) an additional sequence required for plasmid replication or preferably a gene giving a selective advantage; and (3) two expression cassettes each of which are located between (1) and (2) but are separated by (1) and (2) from each other; and which are free from inverted repeat sequences (other than in (3)) are highly persistent though successive generations of microbes containing them.
1
PRODUCTION OF PROTEINS, PLASMIDS CODING THEREFOR AND
ORGANISMS CONTAINING SUCH PLASMIDS
THIS INVENTION relates to the production of
proteins, plasmids coding therefor and organisms
containing such plasmids.
It is known to modify microbes to produce desired
proteins, for example enzymes, by incorporating plasmids
coding for a desired protein into a microbe which would
not otherwise produce it or which would not produce it in
sufficient quantity. There is however a tendency for the
plasmids to be lost on prolonged cultivation of the
organism. It is believed that this is at least partly
due to the production, on each division of the microbes,
of a small number of daughter cells which contain none of
the said plasmids and which are in consequence at a
selective advantage over those which contain the desired
plasmids. In the course of time, cells which contain
none of the desired plasmids increase as a proportion of
the total cells present.
In order to overcome this effect it is known to
incorporate in the plasmid one or more genes which give a
selective advantage to the microbe, for example genes
giving resistance to an antibiotic are suitable if the
microbes are cultivated in the presence of the
antibiotic, or genes making good a deficiency in the host
organism may be incorporated.
There is also a tendency for mutated variants of the
plasmid which do not produce the desired protein to be
produced for example by a mutation leading to the
introduction of a stop codon in the gene or partial or
complete deletion of the protein coding sequence.
2
Microbes containing such mutated plasmids will tend to
have a selective advantage compared with those having the
original plasmid and the desired protein producing
capability of the microbe may be reduced or lost on
prolonged cultivation.
In DDR patent 233,851 Al there are disclosed vector
plasmids in which a sequence is present twice in opposite
senses (inverted repeat sequences) into each of which
sequences duplicate genes are cloned or recloned. This
is said to cause increased synthesis of the gene product
in the microorganism due to the gene dosage effect. The
inverted repeat sequences must each have at least one
homologous cleavage site into which the duplicate genes
may be inserted. Stable plasmids are disclosed as
producible.
Surprisingly we have now found that in certain cases
stable plasmids can be produced from vectors which do not
have inverted repeat sequences. This has important
advantages.
Firstly, it reduces or eliminates the number of
homologous cleavage sites and therefore the tendency to
cut the plasmid into ineffective fragments in the process
of cutting it to insert the desired gene. It is clear
that each inverted sequence of DDR 233851 Al must have at
least one cleavage site and that these will be
homologous. Normally the vector plasmids will be cleaved
at both such sites. This increases the difficulty of
constructing a plasmid with the desired gene correctly
inserted into both of the inverted sequences. For
example the free ends may link with a single added gene
leaving plasmids with only one such gene. In addition
3
non-functional nucleic acid fragments will be formed.
The greater the number of cleavage sites in the inverted
sequences the greater this problem becomes.
Secondly, it reduces the dangers of inter- and
intra-plasmid recombination which can lead to scission of
the plasmid. The presence of unnecessary DNA adjacent to
the desired genes increases the likelihood of
recombination leading to the loss of part or all of that
gene. In addition, recombination between the inverted
repeat sequences in different plasmid molecules (copies)
may lead to formation of unstable multimeric plasmids.
By "Expression cassette" is meant a DNA sequence
effective in production of a protein which comprises a
promoter sequence and ribosomal binding site, a gene
coding for a protein and normally a termination sequence.
The gene may code for a fusion protein and may have a
signal sequence.
Thirdly, it enables the production of smaller
plasmids. We have found that according to our invention
plasmids (excluding the desired expression cassette) of
at most lOkB, for example at most 6kB and even for
example at most 5kB may be used. Each such plasmid
places a smaller burden on the host organism than a
larger plasmid. They normally also have higher copy
numbers than larger plasmids for example 50-300 or even
more than 300 plasmids per host cell, with, in general,
an improvement in output of the desired protein.
Fourthly, the inverted repeat sequences may
themselves code for proteins thus placing an additional
burden on the host and complicating separation of the
desired product.
4
The invention comprises a continuous process for the
production of organisms containing plasmids or
polypeptides expressed by genes of such plasmids in which
a plasmid comprises an origin of replication and an
additional sequence required for plasmid replication
and/or preferably a gene giving a microbe a selective
advantage, and two expression cassettes each being in a
DNA sequence located between the originating sequence and
the gene giving the selective advantage or an additional
sequence required for plasmid replication but being
separated from one another on one side by DNA comprising
the origin of replication and on the other side by DNA
comprising the gene giving the selective advantage or the
sequence required for plasmid replication, the plasmid
being substantially free from inverted repeat sequences
other than sequences represented by the expression
cassettes.
If desired, additional expression cassettes may be
included. The expression cassettes may be different but
preferably are the same.
Preferably at most one antibiotic resistance gene is
present.
Preferably the expression cassettes code for the
same protein or for proteins which are enzymes used
together for catalytic purposes whereby the organism or
material derived therefrom is useful as a catalyst or a
component of a catalyst comprising both such enzymes.
By "continuous process" is meant a process in which
fresh nutrients are added and product removed
continuously or intermittently without discontinuing the
fermentation. Before operating a continuous process it
is necessary to reach a suitable concentration of the
organisms per unit volume of culture medium. It is
normal to reach that condition by inoculation of a
fermenter with the desired organism and permitting it to
grow until the desired concentration is reached, and no
product would normally be removed until then other than
for sampling. It is preferred that at least 5,
preferably at least 10 and more preferably at least 50
generations of organisms be produced after this has been
achieved. Suitably a production of 5%, preferably 10%
and more preferably at least 15% by weight of the desired
protein is produced based on the total protein content of
the organism.
The invention also comprises a plasmid which
comprises an origin of replication and an additional
sequence required for plasmid replication and/or
preferably a gene giving a microbe a selective advantage,
and two expression cassettes which express the same
polypeptide or different polypeptides which are enzymes
used for catalytic purposes and which are preferably the
same, each being in a DMA sequence located between the
origin of replication and the gene giving the selective
advantage or the additional sequence required for plasmid
replication but being separated from one another on one
side by DNA comprising the origin of replication and on
the other side by DNA comprising the gene giving the
selective advantage or the additional sequence required
for plasmid replication, the plasmid being substantially
free from inverted repeat sequences other than sequences
represented by the expression cassettes. A second gene
giving a selective advantage may be present if desired as
also may additional expression cassette(s).
It will be apparent that if a recombination occurs
between homologous sequences of DNA from the two
expression cassettes leading to deletion of the
intervening sequence that sequence must comprise either
the origin of replication or the sequence required for
plasmid replication (in which case the plasmid will not
replicate further) or the gene giving the selective
advantage in which case the plasmid will tend to be lost
by selection. Such losses however will be less than
those occurring in plasmids with inverted repeat
sequences in addition to the genes.
Surprisingly we have found that in the case of
plasmids in which the expression cassettes are close
together, for example separated by at most 5kB and
preferably at most 2kB (as judged by the separation of
their closest points) if one of the cassettes is deleted
the resulting plasmid is at a selective disadvantage and
therefore the microbes containing plasmids with both
active cassettes continue to predominate until
simultaneous inactivation of both cassettes occurs.
In a further form of the invention the genes for
producing the desired protein are arranged to read in the
opposite sense in the plasmid, i.e. if one is regarded as
clockwise the other is anticlockwise. This makes it
difficult for homologous sequences to come into contact,
especially if the genes are close together, in a "headto-
head" or "tail-to-tail" relationship with as little
DNA between them as possible.
The invention also comprises microbes containing
plasmids according to the invention and also processes in
which a desired protein is produced by means of such
plasmids and/or microbes. The protein may be separated
therefrom for example in a purified form if desired.
The invention also comprises a process in which a
plasmid is cut at a first restriction site, a desired
expression cassette is inserted at the first restriction
site to form a modified plasmid, the modified plasmid is
cut at a second restriction site which is not homologous
with the first restriction site and a desired expression
cassette is inserted at the second restriction site, the
first and second restriction sites being separated on one
side by a sequence which comprises an origin of
replication and if they are not separated on the other
side by a sequence which includes a gene giving a
selective advantage to the host organism or a sequence
required for plasmid replication, such a gene is inserted
on that side, the plasmid being substantially free from
inverted repeat sequences other than sequences
represented by the expression cassette.
Preferably the host has a recombinational
deficiency. The deficiency may be in consequence of the
non-functionality or deletion of a recombination gene,
for example rec A or preferably rec J gene.
Increased Stability of Xylanase Expressing Plasmid In
Continuous Culture
Plasmid pSPR6 (see Figure 1), (in Escherichia coli
NM554 host NCIMB 40786 deposited with The National
Collections of Industrial and Marine Bacteria Limited, 23
St Machar Drive, Aberdeen AB2 1RY Scotland UK on 8
February 1996 under the Budapest Treaty) contains unique
NotI and Spel restriction sites which are positioned on
either side of the plasmid origin of replication and on
either side of a tetracycline resistance marker. This
plasmid allows the insertion of two independent copies of
an expression cassette to improve the genetic stability
of the plasmid during fermentations.
In this example the expression cassette was DNA
encoding the expression of a fungal xylanase comprising
of a constitutive promoter (gene A3 promoter from
bacteriophage TV), a ribosome binding site (from lac z of
E.coli), the coding sequence for the enzyme (truncated
xylanase gene from plasmid pNXlO described in
WO 93/25693) and a transcriptional terminator from
bacteriophage T4. The expression cassette was flanked by
either NotI or Spel restriction sites. The expression
cassette can be obtained by complete digestion of the
plasmid pSPRS in E. coli NM554, (NCIMB 40787 deposited
with The National Collections of Industrial and Marine
Bacteria Limited, 23 St Machar Drive, Aberdeen AB2 1RY
Scotland UK on 8 February 1996 under the Budapest Treaty)
using restriction endonucleases NotI or Spel in a high
salt restriction buffer.
Strain E.coli NM554 (pSPRS) was constructed as
follows: Plasmid DNA was prepared from E. coli strain
NM554 (pSPR6) grown overnight at 37 °C in L broth (1%
tryptone, 0.5% yeast extract, 0.5% NaCl) using "Rapid
Pure Miniprep" (RPM) (Stratech Scientific Ltd, Luton, UK)
following the manufacturers protocol. Plasmid DNA may
also be isolated using standard methods such as described
by Sainbrook et al1. 50ul of plasmid pSPR6 DNA was
digested with restriction endonuclease NotI (Boehringer
Mannheim, Lewes, UK) with the addition of 6ul of the
manufacturers H buffer (high salt restriction buffer) and
20 units of restriction enzyme. Digestion was carried out
at 37°C for 16h.
The xylanase expression cassette was digested with
NotI and ligated to plasmid pSPR6 similarly digested with
NotI, as follows. The two species of DNA were mixed and
the restriction enzyme and other contaminants were
removed using an RPM miniprep (following the
manufacturer's protocol but with the following
modifications: DNA mixture used in place of cleared
lysate and DNA eluted into 40ul). 0.5ul of lOOmM
adenosine triphosphate (ATP) was added with 4ul' of M
buffer (medium salt restriction buffer). 1 unit of T4 DNA
ligase (Boehringer Mannheim) was added and the reaction
incubated at 18°C for 16h.
5ul of the ligation reaction was mixed with lOOul of
E.coli strain JM109 (ATCC 53323) competent cell
suspension, produced by calcium chloride treatment
essentially as described by Hanahan2, and incubated on
ice for 45m. Cells were then heat shocked at 42°C for 90s
and returned to ice for 2m. 1ml of L broth was added and
cells incubated at 37°C, with shaking, for Ih before
plating out dilutions onto L agar plates (L broth + 1%
bacteriological agar) containing lOug/ml tetracycline and
1% remazol brilliant blue - xylan (RBB-Xylan, Sigma,
Poole, UK) . Plates were incubated for 24h at 37°C. One
colony which gave a zone of clearing and contained the
expected plasmid when miniprep DNA was digested with NotI
was designated JM109 (pSPR7).
Plasmid DNA from pSPR7 which is shown diagramatically
in Figure 2 was prepared as above from an
overnight culture of JM109 (pSPR7) in L broth
supplemented with lOug/ml tetracycline. 50pl of plasmid
DNA was linearised by digestion with restriction
endonuclease Spel (Boehringer Mannheim) by adding 5ul of
manufacturers H buffer and 20 units of Spel enzyme.
Reaction was incubated for 16h at 37°C.
A second xylanase expression cassette, identical to
the first except flanked by Spel restriction sites rather
than NotI, was digested with Spel as described above.
This expression cassette may be obtained by the complete
digestion of plasmid pSPRS with the restriction enzyme
Spel. This DNA was ligated to Spel digested plasmid pSPR7
exactly as described above but with selection of
transformants on L agar containing lOug/ml tetracycline.
Tetracycline resistant colonies were screened using
a rapid lysis method (Twigg and Sherrett3) to estimate
the size of the plasmid carried. 1 colony which contained
a plasmid larger than plasmid pSPRV and which subsequent
digests of isolated plasmid DNA with NotI and Spel
restriction endonucleases showed to contain 2 copies of
the xylanase expression cassette was designated JM109
(pSPRS), see Figure 3.
Plasmid DNA was prepared from JM109 (pSPRS) and
JM109 (pSPR7) and lul used to transform E.coli strain
NM554 (Stratagene, Cambridge, UK) . Preparation of DNA and
competent cells and transformation of DNA were done as
described above. Transformants were selected on L agar
containing lOug/ml tetracycline. Stocks of NM554 (pSPR7)
and NM554 (pSPRS) were stored at -70°C in L broth
containing lOug/ml tetracycline and 25% (v/v) glycerol.
To prepare a fermentation inoculum, 50ml of L broth
containing lOug/ml tetracycline was inoculated with SOOpl
from freezer stock and grown for approximately 4h at 37°C
with rapid aeration before transfer to the fermenter.
Fermentations were done using Braun ED/ER5
fermenters (B. Braun Biotech, Reading, UK). Vessels were
in situ sterilised and bottom agitated using 2x70mm
diameter Rushton impellers. The fermenter working volume
was approximately 2L. The medium used throughout the
experiments was JVl (see appendix). Temperature was
maintained at 37°C ± 0.2°C. The pH was measured using an
Ingold pH probe and maintained at 6.7 ± 0.1 by the
controlled addition of filter sterilised 10M NH,OH and 2M
H3PCV An agitation speed of 600 rpm was used with air or
35% 02 aeration to maintain a %p02 (dissolved oxygen
tension) between 20% and 80%, of saturation measured by
an Ingold oxygen probe. Foaming was controlled by the
addition of sterile Diamond Shamrock PPG Foamaster ERA
142 at a rate of O.lml/h.
50ml inoculum was transferred to the fermenter which
contained 2L of JVl medium plus 30g/l glycerol and lOppm
Fe2" (as FeS04.7H20). Cultures were allowed to grow in
batch to a point at which the C02 evolution rate was
between 10 and 40mM/l/h (typically 20mM C02/l/h) , when
the fermenter was switched to continuous operation at a
dilution rate of O.lh"1. JVl medium was fed with separate
feeds of sterile glycerol (feed rate 30g/l) and FeS04.7H20
(feed rate lOmg Fe2Vl) . 1ml samples were regularly
withdrawn and stored at -20°C in 25% glycerol for later
analysis of plasmid content. Enzyme activity and dry cell
weight was also periodically measured in 10ml samples.
Xylanase enzyme activity was determined by measuring the
12
amount of reducing sugar released from soluble oat spelt
xylan substrate (1%), essentially as described by Kellett
et al4. The production of xylanase and molecular weight
was confirmed by sodium dodecyl sulphate polyacrylamide
gel electrophoresis (SDS-PAGE) on an 8-25% gradient gel
with commasie blue protein staining using Phast
electrophoresis system (Pharmacia Biotech, St Albans,
UK). Dry cell weights were determined by pelleting the
cells in the withdrawn sample by centrifugation at 5700
rpm in a Beckman TJ-6 centrifuge for 20m and resuspending
cells in 2-3mls Tris buffer (lOOmM, pH7.2). Cells were
then re-pelleted and dried in a pre-weighed tube in an
oven at 105°C for 16h and mass of dried cells determined.
Changes to plasmid size during the fermentations
were detected by plating of stored fermentation samples
onto L agar containing lOug/ml tetracycline and 1%
RBB-Xylan. Colonies were then picked and lysed using the
procedure described by Twigg and Sherrett3. Changes in
plasmid size were seen as a shift in mobility of the
plasmid band on a 1% agarose gel compared to the control
plasmid (agarose gel electrophoresis was done as
described by Sambrook et al1) .
Fermentation results shown in Figure 4 showed that
strain NM554 (pSPR7), with a single copy of the xylanase
expression cassette, very rapidly lost enzyme activity
during continuous culture. SDS PAGE analysis of samples
confirmed that the loss of enzyme activity corresponded
to the loss of production of a heterologous protein band.
Examination of plasmids using the rapid lysis technique
showed no difference in plasmid size compared to pSPR7
control in samples taken up to 19 hrs, but showed several
differently sized plasmids at the 50 hr and 72 hr sample
points, indicating rearrangements and deletions had
occurred in this plasmid causing the loss of enzyme
activity.
Strain NM554 (pSPRS), containing 2 copies of the
xylanase expression cassette, produced a high level of
xylanase activity for 480 hrs in continuous culture. SDS
PAGE confirmed production of heterologous protein over
this time period. Analysis of plasmids from fermentation
samples showed no detectable change in plasmid size
during the course of this experiment, indicated that no
rearrangements or deletions had occurred.
It was noted that the peak xylanase activity for
NM554 (pSPRV) was higher than for NM554 (pSPRS) when the
continuous fermentation was operated at a dilution rate
of O.lh'1. In order to investigate whether the observed
increase in strain stability was due to this initial
reduction in enzyme expression strain NM554 (pSPR7) was
fermented as previously but with a dilution rate of
0.21T1. This had the effect of reducing the peak xylanase
activity to a comparable level to that seen with strain
NM554 (pSPR8) operated at a dilution rate of O.lh"1.
Results showed the same instability despite the reduced
expression level. Analysis of plasmid content showed
changes in plasmid size similar to those seen previously.
Increased Stability of Dehalogenase Expressing Plasmid in
Continuous Culture
The invention was further exemplified through
production of a second protein, a haloalkanoic acid
dehalogenase. In this example the host strain, promoter,
ribosomal binding site, structural gene and fermentation
medium were all different from those used in the xylanase
example indicating the wide applicability of the
invention.
Plasmid pSPR6 was modified to remove the unique NotI
restriction site and introduce a unique PstI restriction
site at the same position. Plasmid pSPR6 DNA was isolated
and digested with NotI restriction enzyme, as above.
Approx 2ug of a synthetic oligonucleotide with the
sequence GGCCCTGCAG was self annealed by heating to 94°C
in high salt restriction buffer and cooling slowly to
room temperature. The annealed oligonucleotide and
digested pSPR6 DNA were mixed, ATP added to final
concentration of ImM and 1 unit of T4 DNA ligase added.
Reaction was incubated at 18°C overnight. Ligation mix
was transformed into JM109 competent cells as described
above and plated onto L agar plates containing lOug/ml
tetracycline. Randomly picked colonies were screened by
isolating plasmid DNA and digesting with Not I and PstI
restriction enzymes in separate reactions. One clone
which failed to digest with NotI but digested with PstI
was isolated and designated JM109 (pSPR6pst).
Plasmid pSPRGpst DNA was isolated and digested with
PstI restriction enzyme in high salt restriction buffer.
After 3h incubation at 37°C 1 unit of calf intestinal
alkaline phosphatase (Boehringer Mannheim) was added to
prevent relegation. The reaction was incubated at 37°C
for a further 30 mins then stopped by adding EDTA to a
final concentration of 5mM and heating the reaction to
75°C for 10 mins.
The dehalogenase expression cassette, comprising the
E. coli trp promoter, a two cistron type ribosomal
binding site (Gold and Stormo5) , the hadD dehalogenase
structural gene (Earth et al6.,) and T4 phage
transcriptional terminator, may be obtained by digesting
the plasmid pSPRll.l (deposited in E.coli host strain XL1
Blue MR at NCIMB as deposit no 40859 on 12 February 1997)
with the restriction enzyme PstI as described above.
Plasmid pSPRlO, which contains a single copy of the
dehalogenase expression cassette, may then be obtained by
ligation of this DNA with the pSPRSpst DNA prepared as
above, selecting for transformants on Lagar containing
1Dug/ml of tetracycline.
Plasmid pSPRll.l (available from NCIMB in host
strain XL1 Blue MR, deposit no 40859), contains 2 copies
of the same dehalogenase expression cassette. This
plasmid was constructed by the addition of a second copy
of the expression cassette into a unique Swal restriction
site on plasmid pSPRlO. Plasmid pSPRlO DNA was isolated
as previously and digested with restriction enzyme Swal
in high salt restriction buffer before treatment with
calf intestinal alkaline phosphatase as described above.
The dehalogenase expression cassette may be obtained by
digestion of pSPRll.l with restriction enzyme PstI. To
produce blunt ended DNA compatible with the Swal digested
plasmid pSPRlO, 1 unit of T4 DNA polymerase (Boehringer
Mannheim) and a final concentration of 200uM each
deoxyadenosine 5' triphosphate, deoxy-cytidine 5'
triphosphate deoxyguanosine 5' triphosphate and thymidine
5' triphosphate (all from Boehringer Mannheim) was added
to the reaction after 3 h incubation and incubated a
further 30 mins at 12 °C. The reaction was stopped by
heating to 75°C for lOmins. The blunt ended dehalogenase
expression cassette and Swal digested pSPRlO were ligated
and transformed into XL1 Blue MR competent cells
(Stratagene) as described above and plated onto L agar
plates containing lOug/ml tetracycline. Plasmid pSPRll.1
was identified by restriction digests of isolated plasmid
DNA, as containing 2 copies of the expression cassette in
opposite orientations to one another.
Fermentation experiments were conducted in a
derivative of E.coli strain W3110 (ATCC 27325)(American
Type Culture Collection (ATCC), 12301 Parklawn Drive,
Rockville, Maryland 20852, USA) engineered to be
recombinationally deficient due to a deletion of the recJ
gene. The construction of this strain is given, but other
recombinationally deficient hosts may also be used. 2 PCR
products were produced of regions of the E.coli
chromosome flanking the recJ gene, primers used were:
TGGGATCCGCTCGGCGTTTACTTCTTCCA to give product 2. PCR
reactions were carried out using 35 cycles of
denaturation at 94°C for 1 rain; prime annealing at 60°C
per 1 min and product extension at 72°C per 1 min.
Reactions were performed in a volume of lOOul, containing
200uM of each nucleoside triphosphate. Taq DNA
polymerase buffer (Promega, Southampton;) and 5 units of
Taq DNA polymerase. E.coli W3110 cells were used as
template DNA. The 2 PCR products produced were purified
using an RPM column, as above, and cloned using the pMOS
blue T vector kit (Amersham, Amersham, UK) following the
manufacturers protocol.
Plasmid containing PCR product 1 was isolated and
digested with restriction enzyme Bglll (Boehringer
'Mannheim) in medium salt restriction buffer. A DNA
fragment encoding streptomycin and spectinomycin
resistance was produced by Bam HI restriction digestion
of plasmid pUT: :miniTn5Sm/Sp (De Lorenzo7) in medium salt
restriction buffer. This fragment was ligated to the
digested plasmid and transformed into XLl Blue MR
competent cells with selection for transformants on L
agar containing 50ug/ml ampicillin and 25pg/ml
streptomycin. The insert from this plasmid was released
by restriction digestion with the enzyme BamHI in medium
salt restriction buffer. This fragment was ligated to the
plasmid containing PCR product 2 which was digested with
the restriction enzyme Bglll. Ligation and transformation
was as above. A clone was identified by restriction
digestion of isolated plasmid DNA in which the
streptomycin/ spectinomycin resistance gene was flanked
by DNA which normally flanks the recJ gene on the E.coli
chromosome.
The deletion of the recJ gene on the E.coli
chromosome was achieved by transformation of E.coli
strain JC7623 (ATCC 47002). The above plasmid was
digested using the restriction enzyme BamHI and the DNA
concentrated by ethanol precipitation (Sambrook et al1)
to give a final concentration approx 500ng/ul. Fresh
electrocompetent JC7623 cells were produced (Sambrook et
al1) and 2ul of digested plasmid DNA was transformed by
electroporation in Gene Pulser Electroporation apparatus
(Bio-Rad, Hemel Hempstead, UK) (15KV/cm, 25uF
capacitance, 200Q parallel resistance) . After a 2hr
recovery period shaking in L broth at 37°C, transformants
were recovered on L agar containing 25ug/ml streptomycin
and 25ug/ml spectinomycin. Transformants were screened
for sensitivity to ampicillin by plating onto L agar
containing lOOug/ml ampicillin. A transformant was
identified as resistant to streptomycin and spectinomycin
but sensitive to ampicillin and with an increased
sensitivity to UV light compared to strain JC7623. This
strain was designated JC7623 ArecJ.
The ArecJ mutation was introduced to strain W3110 by
PI phage transduction. A phage lysate was raised on
JC7623 and used to infect W3110 using the method
described by Miller8. Transductants were selected on L
agar containing streptomycin and spectinomycin as above.
For fermentations the strain W3110 ArecJ was
transformed with the plasmids pSPRlO and pSPRll.l using
electroporation as described above.
Fermentation inocula and fermentations of
dehalogenase producing strains were carried out
essentially as described for xylanase production except
that no yeast autolysate was present in the medium and
glucose was used rather than glycerol.
Dehalogenase enzyme activity was measured as the
rate of dechlorination of 2-chloropropionic acid, (Fluka
Chemical, Gillingham, Dorset, UK) neutralised with NaOH.
Results of continuous fermentations of W3110 ArecJ
(pSPRlO) and W3110 ArecJ (pSPRll.l) are shown in
figure 5. It can clearly be seen that the strain with
pSPRll.l, containing 2 copies of the dehalogenase
expression cassette, has much greater stability than the
strain with plasmid pSPRlO, which has only a single copy
of the expression cassette. It is clear that although the
peak enzyme activity is reduced the overall productivity
of the fermentation is greatly enhanced.
Appendix
Fermentation Medium (JV1)
K2S04 2g/l
MgS04.7H20 1
H3P04 (85%) 0.14ml/l
CaCl2.2H20 O.llg/1
Trace Elements Solution 1ml/I
Yeast autolysate (Biospringer, Low Salt,
Grade D , ) 20g/l
Thiamine HCl (Sigma Chemicals, UK
32g/l sterile stock) 0.5ml/l
Tetracycline hydrochloride (Sigma Chemicals, UK
67mg/ml sterile stock) 0.15ml/l
Trace Element Solution contained 0.2g/l A1C13.6H20,
0.08g/l CoCl2.6H20, 0.02g/l CuCl2.2H20, O.Olg/1 H3B04,
0.2g/l KI, 0.5g/l MnS04.H20, O.Olg/1 NiS04.6H20, 0.5g/l
Na2M04.2H20, 0.5g/l ZnS04.7H40.
All chemicals were of "AR" grade and obtained from
Fisons (Loughbrough, UK) unless otherwise stated.
Sterilisation was carried out at 121°C for 30m.Thiamine,
trace elements and tetracycline solutions were filter
sterilised through a 0.2um filter and added aseptically.
95TJL04S - MS
17 February 1997
References:
1. Sambrook, J., E.F.Fritsch and T.Maniatis. 1989.
Molecular Cloning, A Laboratory Manual. Cold Spring
Harbor Laboratory Press, New York.
2. Hanahan, D. 1985. Techniques for transformation of
Escherichia coli. In: DNA Cloning vol, A Practical
Approach (Ed: D.M.G. Glover) pp!09-135. IRL Press,
Oxford.
3. Twigg, A.T. and D. Sherratt. 1980.
Trans-complementable copy number mutants of plasmid
ColEl. Nature 283 pp216-218.
4. Kellet, L.E., D.M.Poole, L.M.A.Ferreira,
A.J.Durrant, G.P.Hazelwood and H.J.Gilbert. 1990.
Xylanase B and an arabinofuranosidase from
Pseudomonas fluorescens subsp. cellulosa contain
identical cellulose-binding domains and are encoded
by adjacent genes. Biochem J 272 pp369-376.
5. Gold, L. and Stormo, G. D., 1990. High Level
Translation Initiation. Methods in Enzymology 185 p
89-103.
6. Earth, P.T., Bolton, L., and Thomson J.C., 1992.
Cloning and Partial Sequencing of an Operon Encoding
Two Pseudomonas putida Haloalkanoate Dehalogenases
of Opposite Stereospecificity. Journal of
Bacteriology 174, p 2612-2619.
7. De Lorenzo, V., Herrero, M., Jakubzik, U. and
Timmis, K.N. 1990. Mini-T-5 Transposon Derivatives
for Insertion Mutagensis, Promoter Probing and
Chromosomal Insertion of Cloned DNA in Gram Negative
Eubacteria. Journal of Bacteriology. 172 p 6568-
6571.
8- Miller, J. H. 1972. In: Experiments in Molecular
Genetics, pp 201-205. Cold Spring Harbor
Laboratory, New York.
CLAIMS
1 A continuous process for the production of organisms
containing plasmids or polypeptides expressed by
genes of such plasmids in which a plasmid comprises
(1) an origin of replication; and
(2) an additional sequence required for plasmid
replication and/or preferably a gene giving a
microbe a selective advantage; and
(3) two expression cassettes each being in a DNA
sequence located between the originating
sequence and the gene giving the selective
advantage or the additional sequence required
for plasmid replication; but being separated
from one another on one side by DNA comprising
the origin of replication and on the other
side by DNA comprising the gene giving the
selective advantage or the sequence required
for plasmid replication;
the plasmid being substantially free from inverted
repeat sequences other than sequences represented by
the expression cassettes.
2 A process as claimed in Claim 1 in which the
expression cassettes code for the same polypeptide
and are preferably the same.
3 A process as claimed in Claim 2 in which the genes
for producing the desired protein are arranged in
the opposite sense in the plasmid.
4 A process as claimed in any preceding claim in which
the host has a recombinational deficiency.
5 A process according to any preceding claim in which
the plasmid is of at most lOkB {kilobase pairs) .
A process according to any preceding claim in which
the cassettes are separated by at most 5kB and
preferably by at most 2kB as judged by the
separation of their closest ends.
A process according to any preceding claim in which
the polypeptide is a xylanase or dehalogenase.
A plasmid which comprises
(1) an origin of replication; and
(2) an additional sequence required for plasmid
replication and/or preferably a gene giving a
microbe a selective advantage; and
(3) two expression cassettes expressing the same
polypeptide or different polypeptides which
are enzymes used together for catalytic
purposes which are preferably the same each
being in a DNA sequence located between the
originating sequence and the gene giving the
selective advantage or an additional sequence
required for plasmid replication but being
separated from one another on one side by DNA
comprising the origin of replication and on
the other side by DNA comprising the gene
giving the selective advantage or the sequence
required for plasmid replication;
the plasmid being substantially free from inverted
repeat sequences other than sequences represented by
the expression cassettes.
A plasmid as claimed in Claim 8 in which the genes
for producing the desired protein read in the
opposite sense and have little DNA between their
closest ends.
10 Plasmids adapted for use according to any of Claims
1 to 7.
11 Plasmids pSPR6 and pSPRS as deposited in E.coli
under numbers NCIMB 40786 and NCIMB 40787 and
plasmid pSPRll.l as deposited in E.coli under number
NCIMB 40859 with The National Collections of
Industrial and Marine Bacteria Limited on 8 February
1996 for NCIMB 40876 and NCIMB 40878 and on 12
February 1997 for NCIMB 40859 under the Budapest
Treaty.
12 A process in which a plasmid is cut at a first
restriction site, a desired expression cassette is
inserted at the first restriction site to form a
modified plasmid, the modified plasmid is cut at a
second restriction site which is not homologous with
the first restriction site and a desired expression
cassette is inserted at the second restriction site,
the first and second restriction sites being
separated on one side by a sequence which comprises
an origin of replication and if they are not
separated on the other side by a sequence which
includes a gene giving a selective advantage to the
host organism or a sequence required for plasmid
replication, such a gene is inserted on that side,
the plasmid being substantially free from inverted
repeat sequences other than sequences represented by
the expression cassettes.
13 An organism which comprises a plasmid as claimed in
any of Claims 8 to 11.
14 A plasmid as claimed in any of Claims 8 to 11 or
made by a process as claimed in Claim 12 which has
at most one antibiotic resistance gene.
15 A process as claimed in any of Claims 1 to 7 in
which the plasmid has at most one antibiotic
resistance gene.
16. A continuous process for the production of organisms containing
plasmids substantially as herein described with reference to the
accompanying drawings.
17. A plasmid substantially as herein described with reference to the
accompanying drawings.
| # | Name | Date |
|---|---|---|
| 1 | 0924-del-2000-gpa.pdf | 2011-08-21 |
| 2 | 0924-del-2000-form-6.pdf | 2011-08-21 |
| 3 | 0924-del-2000-form-5.pdf | 2011-08-21 |
| 4 | 0924-del-2000-form-3.pdf | 2011-08-21 |
| 5 | 0924-del-2000-form-2.pdf | 2011-08-21 |
| 6 | 0924-del-2000-form-18.pdf | 2011-08-21 |
| 7 | 0924-del-2000-form-13.pdf | 2011-08-21 |
| 8 | 0924-del-2000-form-1.pdf | 2011-08-21 |
| 9 | 0924-del-2000-drawings.pdf | 2011-08-21 |
| 10 | 0924-del-2000-description (complete).pdf | 2011-08-21 |
| 11 | 0924-del-2000-correspondence-others.pdf | 2011-08-21 |
| 12 | 0924-del-2000-claims.pdf | 2011-08-21 |
| 13 | 0924-del-2000-assignments.pdf | 2011-08-21 |
| 14 | 0924-del-2000-abstract.pdf | 2011-08-21 |
| 15 | 0924-DEL-2000_EXAMREPORT.pdf | 2016-06-30 |