Abstract: 7. Abstract: The current invention is relates to improved hydroxynitrile lyases by substituting different amino acids in the amino acid sequence of a wild-type (R)-Hydroxynitrile lyase, which can catalyze the synthesis of optically active ꞵ-nitroalcohols. The use of the mutated enzymes as catalysts in the stereoselective C-C bond formation reaction to synthesize chiral ꞵ-nitroalcohols. The variants have a broad substrate scope, accept a broad range of aromatic aldehydes with structural diversity in the promiscuous nitroaldol reaction and synthesize different chiral ꞵ-nitroalcohols. Further the present invention is to produce the (R)-Hydroxynitrile lyase variants that have higher catalytic efficiency than the wild type to catalyze the synthesis of various chiral ꞵ-nitroalcohols. Fig. 1
1. An engineered (R)-hydroxynitrile lyase of α/β hydrolase fold superfamily having the following: amino acid sequence as shown in SEQ ID NO: 1, correspond to nucleotide sequence as shown in SEQ IS NO: 2, in which the amino acid residue at position 14 or 179 or both, were mutated with any of the nineteen amino acid residues other than that present in the wild type, wherein the hydroxynitrile lyase has a 90% or more identity with either SEQ ID NO: 1.
2. The recombinant (R)-hydroxynitrile lyase of α/β hydrolase fold superfamily as claimed in claim 1 wherein the mutations were introduced by site saturation mutagenesis.
3. The recombinant (R)-hydroxynitrile lyase of α/β hydrolase fold superfamily produced by any one of the following steps: (i) transformant obtained by introducing the recombinant vector comprising of any of the HNL genes of claim 1, into a host; (ii) culture obtained by culturing the transformant of 3.i; (iii) enzyme obtained from the culture of 3.ii; Was used in the screening using a suitable carbonyl compound and nitromethane towards the enantioselective synthesis of a β-nitroalcohol.
4. The recombinant (R)-hydroxynitrile lyase of α/β hydrolase fold as claimed in claim 1 wherein any of the form of 3.i to 3.iii in the production of optically pure β-nitroalcohols.
5. A method for producing enantioenriched β-nitroalcohols by treating any of the form of 3.i to 3.iii by a carbonyl compound, and nitromethane and recovering the corresponding β- nitroalcohol from the treated culture.
6. DATE AND SIGNATURE Dated this 27th April 2023 Signature (Mr. Srinivas Maddipati) IN/PA 3124 Agent for applicant.
Description:4. DETAILED DESCRIPTION
TECHNICAL FIELD OF THE INVENTION
The invention relates to polypeptides generated by protein engineering of a hydroxynitrile lyase. More specifically, the present invention relates to polypeptides exhibiting nitroaldolase and hydroxynitrile lyase activity.
BACKGROUND OF THE INVENTION
Hydroxynitrile lyases (HNLs) catalyze the cleavage of cyanohydrins to yield hydrocyanic acid (HCN) and the respective carbonyl compound and are key enzymes in the process of cyanogenesis in plants. In organic syntheses, HNLs are used as biocatalysts for the formation of enantiopure cyanohydrins.
Protein engineering to improve promiscuous catalytic activity is important for biocatalytic application of enzymes in green synthesis. Engineering of AtHNL has improved enantioselective retro-nitroaldolase activity, a synthetically important biotransformation, for the production of enantiopure β-nitroalcohols having absolute configuration opposite to that of the stereopreference of the HNL.
Optically pure β-nitroalcohols are important chiral synthons for the synthesis of various enantiopure drugs, biologically active molecules and natural products. 1-3 Henry reaction or nitroaldol reaction is an important transformation that involves a carbon-carbon bond formation, coupling between a nucleophilic nitro alkane with an electrophilic aldehyde (or ketone) to form β-nitroalcohol. In organic chemistry, several metals and non-metal-based catalysts have been reported in the asymmetric synthesis β-nitroalcohols, however by virtue of their chemical nature they does not serve as green and ecofriendly catalysts. Due to their environment friendly nature and high selectivity, enzyme catalysts have lured pharma industries in recent years.
The existing biocatalytic routes for synthesis of enantiopure β-nitroalcohols are kinetic resolution,
retro-Henry reaction, dynamic kinetic resolution, asymmetric reduction, and asymmetric Henry
reaction. 4–19 The latter one represents the most important biocatalytic route to synthesize chiral β-nitroalcohols and uses HNLs as catalysts. In addition to their natural enantioselective hydrocyanation activity, a few HNLs catalyze promiscuous stereoselective Henry reaction. Two (S)-selective HNLs from Hevea brasiliensis (HbHNL) 19-20 , and Baliospermum montanum (BmHNL) 21 and three (R)-selective HNLs from Arabidopsis thaliana (AtHNL), Granulicella tundricola (GtHNL) and Acidobacterium capsulatum (AcHNL) 15 are reported to catalyze the stereoselective nitroaldol reaction. 22 Both (R)-selective GtHNL and AcHNL, are metal dependent cupin fold HNLs that require metal cofactor in the catalysis of enantioselective nitroaldol reaction. Further, their substrate scope is limited to only four substrates. An acyl-peptide releasing enzyme from Sulfolobus tokodaii (ST0779) is reported to catalyze the synthesis of chiral β-nitroalcohols, however, it requires long reaction time and does not show uniform enantiopreference. 23 Its enantioselectivity varies with the electronic effects of the substituents on the benzaldehyde ring.
So far, AtHNL is the only (R)-selective HNL reported to catalyse promiscuous Henry reaction without any cofactor requirement for its catalysis. However, AtHNL catalyzed nitroaldol synthesis has the limits of poor yield of 2-34%. A recent study of Horse liver alcohol dehydrogenase (HLADH)-AtHNL cascade catalysis describes the synthesis of ten different aromatic (R)-β-nitroalcohols from their corresponding primary alcohols. Despite the use of two enzymes, yield
of the products did not significantly improve. This study also reports HLADH-BmHNL cascade in the synthesis of (S)-β-nitroalcohols. Overall, HNL catalyzed synthesis of (R)-β-nitroalcohols is limited with (i) less number of HNLs availability, (ii) poor substrate selectivity and catalytic efficiency, and (iii) use of multiple enzymes which makes the process less economic.
Both enantiomers of β-nitro alcohols are versatile chiral building blocks. However, their synthesis using enzymes as catalysts has received little attention, with the exception of (S)-β-nitro alcohols produced in a reaction catalyzed by an S-selective hydroxynitrile lyase (HNL) from Hevea brasiliensis (HbHNL). An R-selective HNL containing an α/β-hydrolase fold from the noncyanogenic plant Arabidopsis thaliana (AtHNL) accepts nitromethane (MeNO₂) as a donor in a reaction with aromatic aldehydes to yield (R)-β-nitro alcohols (Henry reaction; nitro aldol reaction). This reaction proceeded in an aqueous-organic biphasic system. The organic solvent giving the highest enantioselectivity was n-butyl acetate (AcOBu) with an optimum aqueous phase content of 50% (v/v). This is discussed in “Synthesis of (R)-β-nitro alcohols catalyzed by R-selective hydroxynitrile lyase from Arabidopsis thaliana in the aqueous-organic biphasic system” by Ken-Ichi Fuhshuku and Yasuhisa Asano.
Among the different HNLs known so far only AtHNL, GtHNL, and AcHNL exhibit (R)-selectivity and have the ability to synthesize (R)-β-nitroalcohols. Wild type AtHNL, the first (R)-selective α/β hydrolase family HNL, without any cofactor requirement, was investigated in the synthesis of sixteen different (R)-β-nitroalcohols. 9 In case of decanal the enzyme did not show any conversion, while other fifteen aldehydes could be converted into their corresponding (R)-β-nitroalcohols with only trace to 34% yield. This shows the poor catalytic activity of AtHNL towards the promiscuous nitroaldol synthesis. GtHNL, and AcHNL are the two cupin fold HNLs catalyze the synthesis of β-nitroalcohols. Due to the poor enantioselectivity of both the wild type enzymes towards nitroaldol synthesis, they were engineered. Their variants have shown improved enantioselectivity towards the Henry reaction compared to the wild type.
Limitations with these two enzymes are their (i) metal dependency, and (ii) catalysis is restricted to only four substrates. 15 An acyl-peptide releasing enzyme from Sulfolobus tokodaii (ST0779) was studied in the enantioselective synthesis of β-nitroalcohols. 23 The catalyst, however, does not show uniform enantiopreference, and its enantioselectivity varies with the electronic effects of the substituents on the benzaldehyde ring. The acyl-peptide releasing enzyme catalyzed reaction conditions described that it was carried out on a 0.1 mM scale where 20 mg of the purified enzyme was used at 40 oC. This clearly shows that substrate to enzyme concentration used is very low, and the process was carried out at a very low substrate concentration.
In a recent study we synthesized (R)-β-nitroalcohols using AtHNL in a cascade reaction, along with purified HLADH. Despite the use of two enzymes, the cascade could produce a conversion of 1.4 to 41.2% of β-nitroalcohols only, when substituted benzaldehydes were used as substrates. The limitation of this approach is the poor to moderate conversion, use of two enzymes, and a cofactor regeneration system. The latter two makes the process less economical.
The current invention addresses these challenges using engineered AtHNL variants in the enantioselective synthesis of (R)-β-nitroalcohols.
OBJECTIVE OF THE INVENTION
It is an objective of the present invention to provide an improved hydroxynitrile lyases by substituting different amino acids in the amino acid sequence of a wild-type (R)-Hydroxynitrile lyase, which can catalyze the synthesis of optically active ꞵ-nitroalcohols.
It is another objective of the present invention to use the mutated enzymes as catalysts in the stereoselective C-C bond formation reaction to synthesized chiral ꞵ-nitroalcohols. The variants should also have a broad substrate scope, accept a broad range of aromatic aldehydes with structural diversity in the promiscuous nitroaldol reaction and synthesize different chiral ꞵ-nitroalcohols.
It is another objective of the present invention to produce the (R)-Hydroxynitrile lyase variants that have higher catalytic efficiency than the wild type to catalyze the synthesis of various chiral ꞵ-nitroalcohols.
SUMMARY OF THE INVENTION
The following summary is provided to facilitate a clear understanding of the new features in the disclosed embodiment and it is not intended to be a full, detailed description. A detailed description of all the aspects of the disclosed invention can be understood by reviewing the full specification, the drawing and the claims and the abstract, as a whole.
The invention relates to polypeptides generated by protein engineering of a hydroxynitrile lyase. The invention also relates to polypeptides exhibiting nitroaldolase and hydroxynitrile lyase activity. The invention also includes to the use of polypeptides in the synthesis of enantiopure ꞵ-nitroalcohols.
Further, the invention relates to the methods of production of enantiopure ꞵ-nitroalcohols or Henry products using these polypeptides. Furthermore, the invention relates to nucleic acids which code for the polypeptides of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The manner in which the present invention is formulated is given a more particular description below, briefly summarized above, may be had by reference to the components, some of which are illustrated in the appended drawing It is to be noted; however, that the appended drawing illustrates only typical embodiments of this invention and are therefore should not be considered limiting of its scope, for the system may admit to other equally effective embodiments.
Figure 1: SDS-PAGE analysis of Ni-NTA purified AtHNL double variants. Lane M: standard protein marker
Figure 2: Screening of AtHNL variants for enantioselective synthesis of (R)-NPE.
Figure 3: AtHNL variants catalysed enantioselective synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol.
Figure 4: HPLC spectrum of Y14M-F179W cell lysate (1000 U) catalyzed nitroaldol reaction showing enantioselective synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol at 2 h.
Figure 5: HPLC spectrum of Y14M-F179W cell lysate catalyzed preparative scale enantioselective synthesis of (R)-1-(4-methoxy nitro phenyl) ethanol at 2 h after column purification, >99 % ee.
Figure 6: 1H NMR spectrum of (R)-1-(4-methoxyphenyl)-2-nitroethanol
Figure 7: 13C NMR spectrum of (R)-1-(4-methoxyphenyl)-2-nitroethanol.
Figure 8: Michaelis‐Menten curves of wild type AtHNL, Y14M and F179N in NPE synthesis by nitroaldol reaction.
Figure 9: Michaelis‐Menten curves for the wild type AtHNL and Y14M-F179W the synthesis of (E)-1-nitro-4-phenylbut-3-en-2-ol by nitroaldol reaction.
Figure 10: Michaelis‐Menten curves for the wild type AtHNL and Y14F the synthesis of 4-chloro-2-nitro-1-phenyl ethanol by nitroaldol reaction
Figure 11: Michaelis‐Menten curves for the wild type AtHNL and Y14F in the synthesis of 2,4-dimethoxy-2-nitro-1-phenyl ethanol by nitroaldol reaction.
Figure 12: Michaelis‐Menten curves for the wild type AtHNL and F179N in the synthesis of 3-chloro-2-nitro-1-phenyl ethanol by nitroaldol reaction.
Figure 13: Michaelis‐Menten curves for the wild type AtHNL and F179N in the synthesis of 3-methyl-2-nitro-1-phenyl ethanol by nitroaldol reaction.
Figure 14: Michaelis‐Menten curves for the wild type AtHNL and Y14F in the synthesis of 4-methyl-2-nitro-1-phenyl ethanol by nitroaldol reaction.
Figure 15: Michaelis‐Menten curves for the wild type AtHNL and Y14F in the synthesis of 3,4,5-trimethoxy -2-nitro-1-phenyl ethanol by nitroaldol reaction.
Figure 16: Michaelis‐Menten curves for the wild type AtHNL and Y14M-F179W in the synthesis of 4-methoxy-2-nitro-1-phenyl ethanol by nitroaldol reaction
DETAILED DESCRIPTION OF THE INVENTION
The embodiments disclosed herein can be expressed in different forms and should not be considered as limited to the listed embodiments in the disclosed invention. The various embodiments outlined in the subsequent sections are constructed such that it provides a complete and a thorough understanding of the disclosed invention, by clearly describing the scope of the invention, for those skilled in the art.
Throughout this specification, various indications have been given as to preferred and alternative embodiments of the invention. It should be understood that it is the appended claims, including all equivalents, which are intended to define the spirit and scope of this invention.
Preparation of AtHNL variant libraries by site saturation mutagenesis at F179, and Y14
The details of preparation of site saturation mutagenesis libraries at F179 and Y14 positions of AtHNL are already described.
Preparation of AtHNL double variants
To prepare Y14F-F179N, and Y14F-F179W, PCR composition and conditions were maintained similar to that described earlier, 25 F179N and F179W plasmids were taken as templates and forward and reverse primers for Y14F (Table 1) were used in the PCR. To prepare Y14M-F179N and Y14M-F179W, we used Y14M plasmid as a template with F179N and F179W forward and reverse primers (Table 1) with same PCR conditions as used earlier.
Table 1: List of primers employed in the above work. Italicized nucleotides are the site of mutation.
Name Sequence
Y14F- FP GTTCATAATGCGTTTCACGGTGCGTG
Y14F - RP CACGCACCGTGAAACGCATTATGAAC
F179N-FP GTCAAGGCAGCAACTTTACCGAGGAT
F179N-RP ATCCTCGGTAAAGTTGCTGCCTTGAC
F179W - FP GTCAAGGCAGCTGGTTTACCGAGGAT
F179W - RP ATCCTCGGTAAACCAGCTGCCTTGAC
Expression and purification of enzymes
The expression and purification of AtHNL and its variants was carried using known protocols. The purified proteins were characterized by SDS-PAGE (Figure 1). All the pure proteins were analyzed by 12% SDS-PAGE using medium range pre-stained protein marker (BR-BIOCHEM) and stained by Coomassie Brilliant Blue R-250. A clear band at ~28 kDa indicated the good expression and purity of the purified AtHNL and its variants.
HNL assay
The assay was performed in a 96 well microtiter plate and was monitored using a Multiskan GO
UV–Visible spectrophotometer at 25°C. Each well contained reaction mixture of 160 μL of 50 mM citrate phosphate buffer (pH 5.5), 20 μL purified enzyme (1 mg/mL), and 20 μL substrate (racemic mandelonitrile, 67 mM) pre-dissolved in 1 mL of 5 mM citrate buffer (pH 3.15) making a total volume of 200 μL. The control experiment was carried out identically except the enzyme is replaced with 20 mM KPB, pH 7.0. The assay was done in triplicates and the absorbance of the control resulting due to the spontaneous reaction was subtracted from the enzymatic reaction. The assay measured the formation of benzaldehyde resulting from enzymatic cleavage of MN at 280 nm. The activity was calculated using the molar extinction coefficient of benzaldehyde (1376 M1 cm1).
Synthesis of racemic β-nitroalcohols
Synthesis of various racemic β-nitroalcohols was carried out to use them as analytical standards during chiral analysis of biocatalysis products. The syntheses was done by addition of aldehydes to nitromethane in 1:10 molar ratio in the presence of 5 mol% of Ba(OH)2 as a catalyst as per the procedure described earlier. 11 All the racemic β-nitroalcohols synthesized were confirmed by NMR characterization. 9,21,26-27
Chiral resolution of racemic β-nitroalcohols by HPLC
All the twelve racemic β-nitroalcohols were resolved using Chiralpak R IB chiral column using 1 mL/min flow rate at a wavelength of 210 nm (Table 2).
Table 2: HPLC conditions and retention times of aldehydes and racemic β-nitroalcohols
HPLC conditions
n-hexane:
2-propanol (v/v) Retention time
of aldehyde (min) Retention time of (R) and (S)-BNAs (min)
Ph 90:10 4.7 10.9, 12.4
trans-cinnamyl Ph 90:10 6.9 24.2, 22.8
3-chloro Ph 90:10 5.3 10.4, 11.8
4-chloro Ph 90:10 5.4 10.8, 12.5
4-fluoro Ph 90:10 5.2 9.7, 10.8
3-methyl Ph 90:10 4.9 9.1, 9.7
4-methyl Ph 90:10 4.9 9.9, 11.5
4-nitro Ph 90:10 10.4 22.1, 25.6
3-methoxy Ph
97:3 for 6 minutes
followed by 90:10 6.1 19.2, 21.7
2,4-dimethoxy Ph 90:10 8.3 12.3, 16.5
3,4,5-tri methoxy Ph 80:20 7.2 13.6, 15.7
4-benzyloxy Ph 90:10 8.1 18.2, 20.4
Screening of AtHNL and its variants for (R)-NPE synthesis
A reaction mixture of 1 mL containing 125 units of purified variant enzyme and n-butyl acetate in equal v/v ratio along with 25 µL of nitromethane and 12.5 µmol of the benzaldehyde was taken in a 2 mL glass vial. In the control, the enzyme was replaced by an equal volume of 20 mM potassium phosphate buffer (KPB). The reaction mixture was placed on a thermomixer at 1,200 rpm for 3 h at 30 °C. After every hour, 100 µL of aliquot was taken and extracted with 150 µL of diethyl ether. To this, a pinch of sodium sulfate was added and vortexed. After centrifugation at 10,000 rpm for 2 min at 4°C, the upper layer was taken and this step was repeated one more time. Finally, 20 µL of the upper organic layer was taken and analyzed in an HPLC (Agilent) using ChiralpakR IB chiral column using 1 mL/min flow rate and 90:10 of hexane: isopropanol. The % conversion represents the absolute amount of (R)-NPE, and was calculated by the equation % C= [(S-NPE + R-NPE)/(S-NPE + R-NPE + benzaldehyde*conversion factor)] and % ee = [(R-S)/(S+R)]*100.
Scheme 2: Screening of AtHNL variants towards enantioselective synthesis of (R)-NPE
Table 3: Enantioselective synthesis of (R)-2-nitrophenyl ethanol catalysed by F179 saturation library variants.
S. No Variants 1 h 2 h 3 h
% conv % ee % conv % ee % conv % ee
1 WT 17.45 97.5 23.31 96.32 24.45 96.24
2 F179A 3.09 98.77 8.97 98.10 13.01 98.11
3 F179H 6.3 98.3 11.01 97.29 12.09 95.9
4 F179S 5.5 94.32 7.94 95.1 8.19 96.39
5 F179C 2.68 96.97 3.78 97.74 3.78 97.96
6 F179P 0.15 7.04 0.25 3.33 0.60 2.86
7 F179R 0.39 1.64 0.96 6.94 1.00 3.83
8 F179N 6.26 97.34 8.47 96.87 10.13 94.39
9 F179Q 4.91 94.43 2.14 67.89 0.34 86.25
10 F179G 1.57 79.06 2.72 78.23 3.11 77.44
11 F179I 0.50 10.64 1.00 32.62 1.84 5.10
12 F179E 0.25 4.35 0.78 0.81 1.27 7.56
13 F179L 6.52 98.62 7.32 97.49 7.82 96.72
14 F179M 0.34 97.52 0.72 94.64 0.99 96.99
15 F179T 2.56 77.35 4.19 83.59 6.1 81.21
16 F179V 1.85 96.89 4.18 96.95 3.79 97.18
17 F179K 4.82 95.30 7.22 95.74 9.19 94.1
18 F179Y 0.85 83.8 1.3 84.42 2.16 91.3
19 F179W 16.58 97.1 17.37 96.20 17.9 91.11
20 F179D 0.25 5.17 0.59 1.45 1.13 3.98
Table 4: Enantioselective synthesis of (R)-2-nitrophenyl ethanol catalysed by Y14 saturation library variants
S. No Variants 1 h 2 h 3 h
% conv % ee % conv % ee % conv % ee
1 WT 17.45 97.5 23.31 96.32 24.45 96.24
2 Y14A 28.61 87.91 33.2 89.37 34.61 86.79
3 Y14C 29.84 95.32 32.53 93.96 34.05 91.95
4 Y14Q 22.01 88.35 3.33 0.13 3.05 38.35
5 Y14H 0.30 28.21 0.73 36.56 1.55 53.65
6 Y14N 0.77 4.11 0.98 9.84 1.3 2.8
7 Y14P 0.8 25 1.36 33.13 1.95 2.40
8 Y14S 0.23 11.86 0.65 28.14 1.06 37.5
9 Y14D 7.42 88.20 1.55 33.90 1.64 30.99
10 Y14F 30.65 97.00 32.89 94.68 33.95 92.60
11 Y14M 22.90 96.04 28.16 94.26 30.38 91.23
12 Y14V 11.79 77.89 18.58 76.92 24.83 70.50
13 Y14W 10.31 88.53 13.21 85.88 15.01 82.92
14 Y14L 22.81 93.54 23.01 87.43 23.47 83.84
15 Y14E 5.31 70.44 6.2 64.88 6.86 62.7
16 Y14T 14.57 87.82 15.1 88.17 15.4 86.09
17 Y14K 5.46 97.50 10.72 96.57 10.63 95.62
18 Y14G 8.52 94.16 12.94 92.18 13.02 73.73
19 Y14I 0.52 5.82 0.08 28.57 0.01 100
20 Y14R 0.19 88.41 0.13 95.74 0.01 100
AtHNL variant catalyzed preparation of various (R)-β-nitroalcohols using nitroaldol reaction
A reaction mixture consisting of 62.5-125 units of purified variant enzyme and n-butyl acetate in equal v/v ratio along with 1.75 M of nitromethane and 20 mM of aldehyde was taken in a 2 mL glass vial. After the reaction, the remaining protocols for extraction and HPLC analysis are the same as mentioned in the screening section above.
Based on the above results (Table 3 & 4; Figure 2), eleven different AtHNL variants, i.e., F179H, F179N, F179L, and F179W from the F179 saturation library and Y14A, Y14C, Y14F, Y14M, Y14G, Y14L and Y14T from the Y14 saturation library were selected for further study to explore their potential in the synthesis of diverse (R)-β-nitroalcohols.
AtHNL variant (62.5 U) catalyzed synthesis of various (R)-β-nitroalcohols using nitroaldol reaction
Twelve aromatic aldehydes (20 mM) including benzaldehyde were used as substrates along with 1.75 M of nitromethane in the enantioselective nitroaldol reaction. Twelve different enzymes, i.e., AtHNL wild type and its variants (F179H, F179N, F179L, and F179W from the F179 saturation library and Y14A, Y14C, Y14F, Y14M, Y14G, Y14L and Y14T from the Y14 saturation library), 62.5 U of each were used as a catalyst, which resulted into a total of 144 biotransformations towards the synthesis of the (R)-β-nitroalcohols (Scheme 3, Table 5). The variants Y14F, Y14M, F179W and F179N have exhibited better % conversion and % ee than the wild type (Table 5). We observed that F179N has shown better results than the wild type AtHNL, i.e., 96% ee and 76% conversion with benzaldehyde, 64% ee and 95% conversion with 3-chlorobenzaldehyde and 98% ee and 58% conversion with 3-methylbenzaldehyde in the synthesis of their corresponding (R)-β-nitroalcohols. The F179W has shown better results than the wild type AtHNL in the synthesis of (R)-β-nitroalcohol of trans cinnamaldehyde, i.e., 91% ee and 13% conversion. Y14M produced (R)-NPE in 95% ee and 75% conversion. The Y14F variant gave better results in the synthesis of (R)-β-nitroalcohols of 4-chlorobenzaldehyde with 95% ee and 33% conversion, 4-nitrobenzaldehyde with 44% ee and 26% conversion, 2,4-dimethoxybenzaldehyde with 93% ee and 12% conversion, 4-methylbenzaldehyde with 98% ee and 51% conversion, 3-methoxybenzaldehyde with 93% ee and 61% conversion, 3,4,5-trimethoxybenzaldehyde with 80% ee and 52% conversion and 4-benzyloxybenzaldehyde with 89% ee and 2% conversion (Table 5).
Scheme 3: AtHNL variants in the enantioselective synthesis of diverse (R)-β-nitroalcohols.
Table 5: AtHNL variants (62.5 U) catalysed enantioselective synthesis of (R)-β-nitroalcohols.
R WT F179H F179N F179L F179W Y14A Y14M Y14F Y14C Y14G Y14L Y14T
Ph 61
98 53
97 76
96 44
85 47
97 57
91 75
97 68
98 49
98 39
87 69
96 39
90
trans cinnamyl 7
82 5
24 8
91 8
50 13
91 ND 8
77 13
88 1
83 ND 9
88 ND
4-Fluoro Ph 4
77 ND 3
35 ND ND ND ND 0.4
86 ND ND ND ND
4-Chloro Ph 18
86 12
5 44
92 15
43 11
80 10
44 24
91 33
95 7
84 5
15 22
77 7
25
4-Nitro Ph 48
7 45
0.3 50
33 43
4 39
11 41
11 45
13 44
26 30
11 40
7 44
11 45
2
2,4-Dimethoxy Ph 12
87 1
57 5
82 3
68 10
89 ND 5
98 12
93 2
83 1
56 3
73 1
70
3-Chloro Ph
54
97 13
13 64
95 39
82 41
95 40
87 59
97 62
98 45
96 38
85 51
96 41
86
3-Methyl Ph 8
90 4
26 58
98 44
96 30
99 39
94 55
92 51
94 33
99 16
85 53
98 19
83
4-Methyl Ph 31
98 4
20 49
98 37
93 19
99 13
96 46
97 51
98 10
94 5
64 38
92 6
61
3-Methoxy Ph 55
95 7
74 58
96 39
98 40
99 28
94 55
99 61
93 41
98 11
97 39
99 11
88
3,4,5-Trimethoxy Ph 46
70 17
9 24
52 30
7 33
66 24
14 39
65 52
80 11
19 27
3 29
49 28
2
4-Benzyloxy Ph ND ND ND ND ND ND ND 2
89 ND ND ND ND
ND: not determined; % ee is highlighted in bold and % conversion is in plain.
Enantioselective synthesis of various (R)-β-nitroalcohols by nitroaldol reaction using higher amount of AtHNL variants (125 U)
We assumed that an increase in the enzyme amount would improve the conversion and enantioselectivity in the AtHNL variants catalyzed synthesis of (R)-β-nitroalcohols. Accordingly, we have carried out biocatalysis of all the twelve substrates with 125 U of AtHNL variants, Y14F, Y14M, F179W and F179N, which were performed better with most of the substrates (Table 5). The detailed improvement in terms of % conversion and % ee found are shown in Table 6.
The variants Y14F, Y14M, F179W and F179N have exhibited better % conversion and % ee than the wild type after increasing the amount of enzyme (Table 6). We observed that F179N has shown better results than the wild type AtHNL, i.e., 97% ee and 82% conversion with benzaldehyde, 98% ee and 72% conversion with 3-chlorobenzaldehyde and 98% ee and 59% conversion with 3-methylbenzaldehyde in the synthesis of corresponding (R)-β-nitroalcohols. The F179W variant did not show better results than the previous one with respect to trans cinnamaldehyde, i.e., 81% ee and 8% conversion. Y14M has shown 93% ee and 84% conversion with benzaldehyde, 91% ee and 5% conversion with 4-fluorobenzaldehyde and 95% ee and 7% conversion with 4-benzyloxybenzaldehyde. Y14F also gave better results i.e., 91% ee and 53% conversion with 4-chlorobenzaldehyde, 16% ee and 53% conversion with 4-nitrobenzaldehyde, 98% ee and 27% conversion with 2,4-dimethoxybenzaldehyde, 99% ee and 61% conversion with 4-methylbenzaldehyde, 99% ee and 65% conversion with 3-methoxybenzaldehyde, 91% ee and 67% conversion with 3,4,5-trimethoxybenzaldehyde and 95% ee and 5% conversion with 4-benzyloxybenzaldehyde (Table 6).
R WT F179N F179W Y14M Y14F
Ph - 82, 97 58, 99 84, 93 75, 99
trans cinnamyl - - 8, 81 - -
4-Fluoro Ph 4, 77 3, 35 3, 56 5, 91 0.4, 86
4-Chloro Ph - - - - 53, 91
4-Nitro Ph - - - - 53, 16
2,4-Dimethoxy Ph - - - - 27, 98
3-Chloro Ph - 72, 98 - - -
3-Methyl Ph - 59, 98 - - -
4-Methyl Ph - - - - 61, 99
3-Methoxy Ph - - - - 65, 99
3,4,5-Tri methoxy Ph - - - - 67, 91
4-Benzyloxy Ph 2, 70 3, 88 0.2, 38 7, 95 5, 95
Table 6: AtHNL variants (125 U) catalysed enantioselective synthesis of (R)-β-nitroalcohols.
ND: not determined; – mark: not done; % ee is highlighted in bold and % conversion is in plain.
AtHNL double variants catalyzed synthesis of various (R)-β-nitroalcohols using nitroaldol reaction
Two AtHNL double variants, i.e., Y14M-F179W and Y14M-F179N were evaluated in the biocatalytic synthesis of all the twelve (R)-β-nitroalcohols as studied in Table 5 and 6. Initially 62.5 U of the enzyme was used in the biocatalysis of AtHNL-Y14M-F179W and was compared with the data of corresponding wide type catalyzed reaction (Table 7). With the aim to further improve the conversion and enantioselectivity we investigated the biocatalysis of all the twelve substrates using 125 U of purified AtHNL-Y14M-F179W (Table 7). This double variant showed improved results than the wild type AtHNL, i.e., 99% ee and 76% conversion with benzaldehyde, 93% ee and 24% conversion with trans cinnamaldehyde and 82% ee and 3% conversion with 4-fluorobenzaldehyde, 97% ee and 56% conversion with 4-chlorobenzaldehyde, 56% ee and 53% conversion with 4-nitrobenzaldehyde and 98% ee and 4% conversion with 4-benzyloxybenzaldehyde in the synthesis of their corresponding (R)-β-nitroalcohols.
Our attempt to study the biocatalysis of three other double variants Y14F-F179N, Y14F-F179W and Y14M-F179N was hampered by their poor protein expression. Therefore, we have decided to study them using corresponding crude cell lysates. Unfortunately, we found low specific activity in case of all three of them. Expecting to get comparable results, we did biocatalysis with 200 U of crude cell lysate of these enzymes and studied the enantioselective nitroaldol synthesis with all the twelve substrates. Disappointingly, most of them did not show any improvement in enantioselectivity in the nitroaldol reaction of most of the substrates (Table 7), except Y14F-F179W in case of 3,4,5-trimethoxybenzaldehyde (86% ee and 11% conversion).
R WT
(62.5U) Y14M-F179W
(62.5U) Y14M-F179W
(125U) Y14M-F179N
(200U-crude) Y14F-F179W
(200U-crude) Y14F-F179N
(200U-crude)
Ph 61, 98 60, 98 76, 99 4, 74 10, 18 5, 57
trans cinnamyl 7, 82 21, 95 24, 93 ND ND ND
4-Fluoro Ph ND ND 3, 82 ND ND 2, 65
4-Chloro Ph 18, 86 45, 96 56, 97 1, 43 2, 24 2, 56
4-Nitro Ph 48, 7 49, 37 53, 56 24, 7 34, 10 23, 15
2,4-Dimethoxy Ph 12, 87 17, 97 - ND ND ND
3-Chloro Ph 54, 97 52, 96 - 4, 16 6, 13 6, 56
3-Methyl Ph 8, 90 56, 99 - 1, 71 2, 50 2, 85
4-Methyl Ph 31, 98 56, 98 - 1, 48 2, 11 1, 67
3-Methoxy Ph 55, 95 54, 99 - 2, 61 3, 58 3, 60
3,4,5-Trimethoxy Ph 46, 70 48, 84 - ND 11, 86 6, 16
4-Benzyloxy Ph ND 4, 78 4, 98 ND ND ND
Table 7: AtHNL double variants catalyzed enantioselective synthesis of (R)-β-nitroalcohols.
ND: not determined; – mark: not done; % ee is highlighted in bold and % conversion is in plain.
AtHNL variants catalyzed synthesis of various (R)-β-nitroalcohols using nitroaldol reaction
Purified enzymes of the single variants F179H, F179N, F179L, and F179W from the F179 saturation library and Y14A, Y14C, Y14F, Y14M, Y14G, Y14L and Y14T from the Y14 saturation library, were used in the biocatalytic study in enantioselective synthesis of (R)-β-nitroalcohols by nitroaldol reaction. To explore the substrate scope of these variants, a dozen of diverse aldehydes were carefully chosen. The set of substrates included 4-benzyloxy benzaldehyde, an aromatic aldehyde with a bulky benzyloxy group at the para position, trans cinnamaldehyde that has a longer carbon skeleton, and ten aromatic aldehydes. The versatile substrate set of aromatic aldehydes contained single, double and triple substitutions of different functional groups (-CH3, -OCH3, -NO2, -F, -Cl,) in the aromatic ring, substituents at different positions (ortho, meta, and para) of the aromatic ring, and both electron-donating and withdrawing groups. Our initial set of biocatalysis consisted of 144 (12 enzymes × 12 aldehydes) diverse enantioselective Henry reactions (Table 5). Here we adopted modified biocatalytic conditions for these transformations, i.e., 62.5 U of AtHNL variants, 20 mM aldehyde and 1.75 M nitromethane were used. These conditions are different than that used for screening study. Subsequently, we have selected four single variants Y14F, Y14M, F179W and F179N, which performed better with most of the substrates, and tested them again in biocatalysis with 125 U of the enzyme to check for any improvement in enantioselectivity and/or conversion (Table 6). Later four double variants, i.e., Y14F-F179N, Y14F-F179W, Y14M-F179W and Y14M-F179N were created and investigated against the above twelve substrates in synthesis of corresponding (R)-β-nitroalcohols. Unfortunately, three of them, Y14F-F179N, Y14F-F179W and Y14M-F179N showed very poor expression and low specific activity. So, 200 U of crude enzyme of each of them were employed in the biocatalysis to check if they show any selectivity towards any of the substrates. But none of them showed any positive results for any of the substrates (Table 7). AtHNL-Y14M-F179W unlike the other double variants displayed better expression and good specific activity, hence, biocatalysis was performed using 62.5 U of its purified enzyme, with all substrates (Table 7). Later biocatalysis was carried out using 125 U of this enzyme with selected susbtrates to obtain further improvement in enantioselectivity and conversion (Table 7). The improved biocatalytic features for each substrate using engineered AtHNL is discussed below.
First HNL catalyzed nitroaldol reaction to synthesize (R)-NPE was reported by Asano et al. using wild type AtHNL, which showed only 30% conversion with 91% ee in 2 h.9 Yu et al. used an acyl-peptide releasing enzyme from Sulfolobus tokodaii (ST0779) to synthesize (R)-NPE from benzaldehyde using promiscuous Henry reaction, which took long reaction time (90 h) for its catalysis to obtain only 34% conversion with just 17% ee.23 This enzyme did not show uniform enantiopreference, as its enantioselectivity varied with the electronic effects of the substituents on the benzaldehyde ring. Two other (R)-selective HNLs, GtHNL, AcHNL have also been reported in the synthesis of (R)-NPE from benzaldehyde but they require metal cofactor in their catalysis unlike AtHNL.24 While wild type AcHNL and GtHNL gave low conversions and % ee in (R)-NPE synthesis, in case of AcHNL-A40H, 74% conversion with 97% ee and GtHNL-A40R, 75% conversion with 94% ee of (R)-NPE was reported at 24 h.24,15 Both the variants used 20 mM benzaldehyde and hence the product obtained is equivalent to 14.8-15 mM. In our study, we achieved 84% conversion with Y14M and 82% conversion with F179N using 20 mM benzaldehyde, hence the product concentration calculated to be 16.4 & 16.8 mM respectively in 3 h. Compared to the 24 h reaction time by AcHNL and GtHNL variants, our AtHNL variants (Y14M & F179N) produced (R)-NPE in just 3 h with comparable or better yield. Horse liver alcohol dehydrogenase (HLADH)-AtHNL cascade was another approach to produce (R)-NPE from benzylalcohol. The nitroaldol step of this cascade used 800 U of AtHNL in the benzaldehyde to (R)-NPE synthesis and gave 64% conversion with good enantioselectivity at 6 h.21 In our study, with 62.5 U of AtHNL we achieved 61% conversion and 98% ee of (R)-NPE from benzaldehyde. With 125 U of F179N and Y14M, the % conversions were increased to 82 and 84 while high % ee of 97 and 93 were observed respectively at 3 h (Table 6). Y14M-F179W showed 76% conversion with 99% ee at 3 h (Table 7). Compared to the previous studies, we improved the synthesis of (R)-NPE from benzaldehyde in terms of % conversion and enantiopurity in less time and less amount of enzyme using AtHNL variants.
We reported here for the first time the engineered AtHNL catalyzed enantioselective synthesis of (R)-(E)-1-nitro-4-phenylbut-3-en-2-ol from trans cinnamaldehyde. Earlier, immobilized AtHNL was reported with racemic trans cinnamaldehyde as substrate in the retro-Henry reaction but it showed only 5% ee and 47% conversion of the corresponding (S)-product at 9 h indicating very poor selectivity.7 In the current study, wild type AtHNL showed 7% conversion and 82% ee while F179W showed 13% conversion and 91% ee in 3 h (Table 6). The double variant Y14M-F1799W showed 24% conversion and 93% ee at 3 h (Table 7). Clearly, AtHNL engineering has enhanced both the substrate preference and enantioselectivity in the synthesis of (R)-(E)-1-nitro-4-phenylbut-3-en-2-ol.
In case of enantioselective synthesis of (R)-1-(4-fluorophenyl)-2-nitroethanol, with 125 U of Y14M we could achieve 91% ee with 5% conversion at 3 h (Table 6), while the wild type AtHNL showed only 4% conversion with 77% ee. Earlier, Asano et al. reported 80% ee using 250 U of wild type AtHNL.9 The Y14M has improved the % ee to 91 using half of the enzyme amount used in the earlier report.
Wild type AtHNL was reported to synthesize (R)-1-(4-chlorophenyl)-2-nitroethanol in 9% conversion with 87% ee.9 The ST0779 catayzed conversion of 4-chlorobenzaldehyde by Henry reaction produced 45% conversion with 78% ee of (R)-1-(4-chlorophenyl)-2-nitroethanol using 20 mg of enzyme, while the reaction took long time (60 h).23 HLADH-AtHNL cascade mediated synthesis of (R)-1-(4-chlorophenyl)-2-nitroethanol was also reported where 800 U of AtHNL was used in the nitroaldol reaction step to give only 38% conversion with 98% ee at 4 h.21 We observed 18% and 86% by the wild type AtHNL, 53% and 91% by the Y14F (Table 6) and 56% and 95% conversion and ee respectively by 125 U of Y14M-F1799W in 3 h (Table 7). Both high conversion and % ee were achieved in less time and amount of enzyme compared to previous reports using AtHNL variants.
The only enzymatic nitroaldol to synthesize (R)-1-(4-nitrophenyl)-2-nitroethanol from its corresponding aldehyde using ST0779 reported 92% conversion with 94% ee of product. However, the reaction required 20 mg of enzyme and took long reaction time of 18 h.23 In case of HLADH-AtHNL cascade, 800 U of AtHNL was used in the nitroaldol reaction, which gave 89% conversion and 69% ee at 8 h.21 We found 48% conversion and only 7% ee at 3 h by the wild type AtHNL, while, Y14F has shown 53% conversion and 16% ee and F179N has shown 50% conversion with 33% ee at 3 h (Table 6). The % ee of (R)-1-(4-nitrophenyl)-2-nitroethanol was improved to 56 by Y14M-F1799W and 53% conversion was found at 3 h using 125 U of the enzyme (Table 7).
We reported here for the first time the biocatalytic enantioselective synthesis of (R)-1-(2, 4 -dimethoxyphenyl)-2-nitroethanol by nitroaldol reaction. The WT could produce it in only 12% conversion with 87% ee. To our delight, Y14F has improved the conversion of the product to almost double, where 27% conversion and enantioselectivity also increased to 98% (Table 6).
Earlier report of WT AtHNL catalysed nitroaldol reaction produced (R)-1-(3-chlorophenyl)-2-nitroethanol using in 17% conversion with 91% ee.9 In the HLADH-AtHNL cascade to produce (R)-1-(3-chlorophenyl)-2-nitroethanol from 3-chlorobenzylalcohol, the nitroaldol step resulted in 75.8% conv, and 99% ee at 4 h.21 We observed 54% conv and 97% ee of product by the WT AtHNL catalyzed nitroaldol synthesis. Three variants, Y14F, Y14M, and F179N have appeared to be better the WT in the asymmetric nitroaldol reaction. In case of F179N, (R)-1-(3-chlorophenyl)-2-nitroethanol was obtained in 72% conversion with 98% ee while Y14M and Y14F showed 59% and 62% conversions and 97% and 98% ee, respectively at 3 h (Table 6).
Previously, AtHNL WT catalyzed nitroaldol synthesis of (R)-1-(3-methylphenyl)-2-nitroethanol resulted in 12% conversion with 96% ee.9 Our study revealed five AtHNL variants for synthesis of (R)-1-(3-methylphenyl)-2-nitroethanol by asymmetric Henry reaction. While the WT produced in 8% conversion and 90% ee, the five variants, Y14F, Y14M, F179N, F179W and Y14M-F179W, have shown significant increase in both conversion and enantioselectivity. They produced (R)-1-(3-methylphenyl)-2-nitroethanol in 30-59% conversion with 92-99% ee (Table 6 and 7). Both F179N (59% conv, 98% ee) and Y14M-F179W (56% conv, 99% ee) have proved to be the best biocatalysts so far to synthesize (R)-1-(3-methylphenyl)-2-nitroethanol.
The first attempt for the enantioselective synthesis of (R)-1-(4-methylphenyl)-2-nitroethanol was by Asano et al.9 They used wild type AtHNL for catalyzing the nitroaldol reaction that resulted in only 11% conversion and 94% ee in 2 h. This promiscuous reaction in the presence of high amount (50 mg) of human serum albumin in water when carried out for 168 h, the % conversion to (R)-1-(4-methylphenyl)-2-nitroethanol was found to be 53, however the % ee was just limited to 60.28 Our nitroaldol synthesis by the wild type AtHNL gave 31% conversion and 98% ee of (R)-1-(4-methylphenyl)-2-nitroethanol. Among the variants, four of them, i.e., Y14F, Y14M, F179N and Y14M-F179W exhibited higher conversion (46-61%) with 97-99% ee (Table 6 and 7). Y14F gave the highest enantioselectivity (99% ee) and 61% conversion towards the synthesis of (R)-1-(4-methylphenyl)-2-nitroethanol.
The first study on WT AtHNL catalyzed nitroaldol reaction in enantioselective synthesis of (R)-1-(3-methoxyphenyl)-2-nitroethanol resulted in 13% conversion and 91% ee.9 We found 55% conversion and 95% ee of (R)-1-(3-methoxyphenyl)-2-nitroethanol by the wild type AtHNL, while Y14F, Y14M, F179N and Y14M-F179W have shown 54-65% conversion and 95-99% ee (Table 6 and 7). Among them the Y14F synthesized (R)-1-(3-methoxyphenyl)-2-nitroethanol in 65% conversion, with 95% ee and still remains the best biocatalyst so far to produce this product.
We reported here for the first time the biocatalytic enantioselective synthesis of (R)-1-(3,4,5-trimethoxyphenyl)-2-nitroethanol using engineered AtHNL. The wild type AtHNL displayed 46% conversion and 70% ee in the synthesis of this product. To our delight, two variants, Y14F, and Y14M-F179W have shown higher conversion and enantioselectivity than the WT. While Y14F has produced (R)-1-(3,4,5-trimethoxyphenyl)-2-nitroethanol in 67% conversion and 91% ee (Table 6), the double variant Y14M-F179W could produce it in 48% conversion and 84% ee (Table 7).
The only biocatalytic asymmetric synthesis of (R)-1-(4-benzyloxyphenyl)-2-nitroethanol was reported using HLADH-AtHNL cascade reaction. In that study, the nitroaldol reaction provided only 2.6% conversion to (R)-1-(4-benzyloxyphenyl)-2-nitroethanol in 8 h.21 We observed that four variants, Y14F, Y14M, F179N and Y14M-F179W displayed higher % conversion and % ee of the product than the wild type AtHNL (2% conversion and 70% ee). The F179N showed 3% conversion and 88% ee, while Y14M, Y14F and Y14M-F179W showed 4-7% conversions and 95-97% ee, of (R)-1-(4-benzyloxyphenyl)-2-nitroethanol respectively (Table 6 and 7).
Overall, the engineered AtHNL variants have demonstrated enhanced conversion and enantioselectivity along with broad substrate scope in the synthesis of a broad range of (R)-β-nitroalcohols. Therefore, while the two enzyme cascade produced only 1.5% conversion to (R)-1-(4-benzyloxyphenyl)-2-nitroethanol, more than fourfold increased conversion was exhibited by the Y14M.
Enantioselective synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol using AtHNL variants
The optically pure β-nitroalcohol obtained from 4-methoxybenzaldehyde, i.e., (R)-1-(4-methoxyphenyl)-2-nitroethanol is an extensively used structural element seen in various drugs, flavours and perfumes, making it more industrially significant and commercially important chiral drug intermediate. One such drug is (R)-Tembamide, a naturally occurring β-hydroxyamide, which is isolated from Fagara hyemalis (St. Hill) Engler, belongs to Rutaceae family.29 This drug is used in traditional Indian medications as a good control for hypoglycaemia.30-31 Considering the importance of (R)-Tembamide, we aimed to synthesize (R)-1-(4-methoxyphenyl)-2-nitroethanol, which can be reduced to (R)-2-amino-1-(4-methoxyphenyl)-2-ethanol and used in the synthesis of (R)-Tembamide.32
AtHNL variant catalyzed synthesis of various (R)-1-(4-methoxyphenyl)-2-nitroethanol using nitroaldol reaction
A reaction mixture of 125 units of purified variant enzymes with n-butyl acetate in equal v/v ratio along with 1.75 M of nitromethane and 20 mM of 4-methoxybenzaladehdye were taken in a 2 mL glass vial. The reaction conditions, protocols of aliquot taking, extraction and analysis are the same as mentioned in section “Screening of AtHNL and its variants for (R)-NPE synthesis above”.
The purified variants Y14F, Y14M, F179W, F179N and Y14M- F179W (125 U) along with the wild type AtHNL were employed in the synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol where 20 mM of 4-methoxybenzaldehyde and 1.75 M of nitromethane were used as the substrates. The % conversion and % ee obtained in each case is given in Figure 3.
Figure 3: AtHNL variants catalysed enantioselective synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol.
Purified AtHNL variants, F179W, F179N, Y14F, Y14M and Y14M-F179W, (selected based on Table 5) were employed in the enantioselective synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol aiming to achieve high conversion and enantioselectivity. Earlier, Asano et al. synthesized (R)-1-(4-methoxyphenyl)-2-nitroethanol using wild type AtHNL, however, the conversion was only 2% with 79% ee at 2 h.9 Yu et al. explored ST0779 in the synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol from 4-methoxybenzaldehyde using promiscuous Henry reaction which took long reaction time (72 h) for its catalysis to obtain 32% conversion with 86% ee using 20 mg of enzyme.23
In our study to synthesize (R)-1-(4-methoxyphenyl)-2-nitroethanol using promiscuous Henry reaction, wild type AtHNL showed 47% conversion and 98% ee, while other single variants (F179N, F179W, Y14M and Y14F) showed 51-56% conversions with 96-99% ee in 3 h. The double variant, Y14M-F179W showed the highest, 70% conversion among others with > 99% ee in the synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol (Figure 3). Finally, the double variant Y14M-F179W was chosen for further experimental studies.
Preparative scale synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol using Y14M-F179W crude cell lysate
AtHNL-Y14M-F179W catalyzed preparative scale synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol was carried out using crude cell lysates. Ten mini preparative scale reactions each containing 1000 U of Y14M-F179W cell lysate along with equal v/v of n-butyl acetate, 8.75 M of nitromethane and 100 mM of 4-methoxybenzaladehdye were taken in a 50 mL round bottom flask, stirred in a magnetic stirrer at 1200 rpm, 30 oC. At the end of 2 h, each reaction mixture was extracted with 100 mL of diethyl ether, the organic layers collected were combined, dried over anhydrous Na2SO4 and solvents were evaporated in a rotary evaporator. The product was analyzed by chiral HPLC is represented in Figure 4.
Column purification of the crude product was done using hexane: ethyl acetate (90:10) to get pure (R)-1-(4-methoxyphenyl)-2-nitroethanol. The purified product was confirmed by 1H and 13C NMR.
Use of crude cell lysates in biocatalysis is often preferred, especially for preparative as well as industrial scale synthesis. This is because use of crude cell lysates in biocatalysis is economical than the purified enzymes. AtHNL-Y14M-F179W crude cell lysate (200 U) was employed to catalyze preparative scale synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol, that resulted in 70% conversion and 99% ee. Further, the biotransformation was carried out with 1000 U of crude cell lysate (Figure 4), before using higher scale of enzyme. Subsequently, ten mini preparative scale reactions each containing 1000 U of Y14M-F179W cell lysate were carried out. The final product after column purification was found to have 99% ee, and 65.4% isolated yield (Figure 5). The product was confirmed by 1H and 13C NMR (Figure 6-7).
NMR characterization of Y14M-F179W catalyzed synthesis of (R)-1-(4-methoxyphenyl)-2-nitroethanol
1H NMR (500 MHz, CDCl3) δ 7.34 (dt, J = 8.6, 1.8 Hz, 2H), 6.91 (dt, J = 8.7, 1.6 Hz, 2H), 5.42 – 5.38 (m, 1H), 4.62 (ddt, J = 13.1, 9.7, 1.7 Hz, 1H), 4.49 (ddt, J = 13.2, 3.4, 1.7 Hz, 1H), 3.81 (t, J = 1.4 Hz, 3H);13C NMR (101 MHz, CDCl3) δ 160.55, 130.81, 127.43, 114.84, 81.56, 70.97, 55.56.
Determination of the kinetic parameters purified AtHNL and its variants towards various substrates using Henry reaction
A reaction mixture consisting of 1 mg of purified enzyme and n-butyl acetate in equal v/v ratio along with 1.75 M of nitromethane and 0.5-24 mM of aldehyde concentration was taken in a 2 mL glass vial. The reaction mixture was placed on a thermomixer at 1,200 rpm for 30 min- 1 h (varied with substrate) at 30 °C. After the reaction, the remaining protocols for extraction and HPLC analysis are the same as mentioned in the screening section above. In the control, the enzyme was replaced by an equal volume of 20 mM potassium phosphate buffer (KPB) and all the reaction are done in triplicates. Purified AtHNL variants, F179W, F179N, Y14F, Y14M and Y14M-F179W were selected based on Table 5 and 7 for determining their kinetic parameters towards various substrates using Henry reaction as described in the above paragraph. Rate of the reaction against each substrate concentration was determined from the HPLC analysis based on the amount of product formed. Solver function in Microsoft excel was used to best fit the data to Michaelis – Menten equation. All experiments were performed in triplicates. The kinetic study revealed that the variant have gained higher catalytic efficiency than the wild type enzyme against all the studied substrates. Table 8 represents the fold increase in the catalytic efficiency by the variants over the wild type in the stereoselective synthesis of various β-nitroalcohols. Table 9-17, and figure 8-16 shows the detailed of kinetic parameters and Michaelis – Menten plots of the multiple kinetic studies performed using AtHNL wt, and variants.
Table 8: The fold increase in the catalytic efficiency of the variants in comparison to the wild type
Products Variant Fold increase in the variant’s catalytic efficiency than the wild type
Y14M 4.03
F179N 7.21
Y14M-F179W 5.51
Y14F 11.92
F179N 2.38
F179N 8.12
Y14F 5.99
Y14F 5.84
Y14F 3.36
Y14M-F179W 5.9
Table 9: Steady-state kinetic parameters of purified AtHNL, Y14M and F179N for the synthesis of NPE using benzaldehyde as the substrate.
Enzyme KM (mM) Vmax (U/mg) kcat (min1) kcat/KM (min1mM1)
WT 1.73±0.99 1.28±0.06 35.74± 1.74 24.30± 9.73
Y14M 1.26±0.51 4.10±0.85 114.49±23.90 98.00±26.33
F179N 0.72±0.23 4.22±0.25 118.20±7.01 175.29±47.13
Table 10: Steady-state kinetic parameters of purified AtHNL and Y14M-F179W for the synthesis of (E)-1-nitro-4-phenylbut-3-en-2-ol using trans cinnamaldehyde as the substrate.
Enzyme KM (mM) Vmax (U/mg) kcat (min1) kcat/KM (min1mM1)
WT 12.05±2.09 1.28±0.16 35.84± 4.34 3.03± 0.61
Y14M-F179W 6.90±1.63 4.16±1.25 116.58±34.87 16.70±1.29
Enzyme KM (mM) Vmax (U/mg) kcat (min1) kcat/KM (min1mM1)
WT 4.68±1.10 0.74±0.06 20.79± 1.53 4.63± 1.28
Y14F 1.85±0.29 3.56±0.33 99.65±9.34 55.22±14.89
Table 11: Steady-state kinetic parameters of purified AtHNL and Y14F for the synthesis of 4-chloro-2-nitro-1-phenyl ethanol using 4-chlorobenzaldehyde as the substrate.
Enzyme Km (mM) Vmax (U/mg) kcat (min1) kcat/Km (min1mM1)
WT 13.16±0.57 0.68±0.03 18.95± 0.75 1.44± 0.06
Y14F 4.95±0.98 1.48±0.29 41.45±7.98 8.41±0.99
Table 12: Steady-state kinetic parameters of purified AtHNL and Y14F for the synthesis of 2,4-dimethoxy-2-nitro-1-phenyl ethanol using 2,4-dimethoxybenzaldehyde as the substrate.
Table 13: Steady-state kinetic parameters of purified AtHNL and F179N for the synthesis of 3-chloro-2-nitro-1-phenyl ethanol using 3-chlorobenzaldehyde as the substrate.
Enzyme KM (mM) Vmax (U/mg) kcat (min1) kcat/KM (min1mM1)
WT 1.83±0.35 1.74±0.06 48.68± 1.68 27.31± 5.65
F179N 1.17±0.09 2.72±0.05 76.02±1.37 65.04±5.07
Enzyme KM (mM) Vmax (U/mg) kcat (min1) kcat/KM (min1mM1)
WT 3.15±0.37 0.97±0.04 27.01± 1.06 8.68± 1.35
F179N 1.71±0.29 4.22±0.06 118.16±1.71 70.47±11.58
Table 14: Steady-state kinetic parameters of purified AtHNL and F179N for the synthesis of 3-methyl-2-nitro-1-phenyl ethanol using 3-methylbenzaldehyde as the substrate.
Table 15: Steady-state kinetic parameters of purified AtHNL and Y14F for the synthesis of 4-methyl-2-nitro-1-phenyl ethanol using 4-methylbenzaldehyde as the substrate.
Enzyme Km (mM) Vmax (U/mg) kcat (min1) kcat/Km (min1mM1)
WT 2.67±0.53 0.71±0.06 19.94± 1.54 7.60± 1.08
Y14F 1.12±0.05 1.82±0.13 50.55±3.54 45.50±4.97
Enzyme Km (mM) Vmax (U/mg) kcat (min1) kcat/Km (min1mM1)
WT 30.21±5.68 4.06±0.24 113.69± 6.61 3.83± 0.56
Y14F 14.71±1.91 6.73±0.58 188.35±16.29 12.86±0.81
Table 16: Steady-state kinetic parameters of purified AtHNL and Y14F for the synthesis of 3,4,5-trimethoxy -2-nitro-1-phenyl ethanol using 3,4,5-trimethoxybenzaldehyde as the substrate.
Table 17: Steady-state kinetic parameters of purified AtHNL and Y14M-F179W for the synthesis of 4-methoxy-2-nitro-1-phenyl ethanol using 4-methoxybenzaldehyde as the substrate.
Enzyme Km (mM) Vmax (U/mg) kcat (min1) kcat/Km (min1mM1)
WT 2.10±0.36 6.23±0.81 174.37± 22.78 83.51± 6.25
Y14M-F179W 0.68±0.08 11.97±1.81 335.16±50.72 493.11±19.33
, C , C , Claims:5. CLAIMS
I/We Claim:
1. An engineered (R)-hydroxynitrile lyase of α/β hydrolase fold superfamily having the following:
amino acid sequence as shown in SEQ ID NO: 1, correspond to
nucleotide sequence as shown in SEQ IS NO: 2, in which the amino acid residue at position 14 or 179 or both, were mutated with any of the nineteen amino acid residues other than that present in the wild type, wherein the hydroxynitrile lyase has a 90% or more identity with either SEQ ID NO: 1.
2. The recombinant (R)-hydroxynitrile lyase of α/β hydrolase fold superfamily as claimed in claim 1 wherein the mutations were introduced by site saturation mutagenesis.
3. The recombinant (R)-hydroxynitrile lyase of α/β hydrolase fold superfamily produced by any one of the following steps:
(i) transformant obtained by introducing the recombinant vector comprising of any of
the HNL genes of claim 1, into a host;
(ii) culture obtained by culturing the transformant of 3.i;
(iii) enzyme obtained from the culture of 3.ii;
Was used in the screening using a suitable carbonyl compound and nitromethane towards the enantioselective synthesis of a β-nitroalcohol.
4. The recombinant (R)-hydroxynitrile lyase of α/β hydrolase fold as claimed in claim 1 wherein any of the form of 3.i to 3.iii in the production of optically pure β-nitroalcohols.
5. A method for producing enantioenriched β-nitroalcohols by treating any of the form of 3.i to 3.iii by a carbonyl compound, and nitromethane and recovering the corresponding β- nitroalcohol from the treated culture.
6. DATE AND SIGNATURE
Dated this 27th April 2023
Signature
(Mr. Srinivas Maddipati)
IN/PA 3124
Agent for applicant.
| # | Name | Date |
|---|---|---|
| 1 | 202341031597-Sequence Listing in PDF [03-05-2023(online)].pdf | 2023-05-03 |
| 2 | 202341031597-REQUEST FOR EXAMINATION (FORM-18) [03-05-2023(online)].pdf | 2023-05-03 |
| 3 | 202341031597-FORM FOR SMALL ENTITY(FORM-28) [03-05-2023(online)].pdf | 2023-05-03 |
| 4 | 202341031597-FORM 18 [03-05-2023(online)].pdf | 2023-05-03 |
| 5 | 202341031597-FORM 1 [03-05-2023(online)].pdf | 2023-05-03 |
| 6 | 202341031597-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [03-05-2023(online)].pdf | 2023-05-03 |
| 7 | 202341031597-EVIDENCE FOR REGISTRATION UNDER SSI [03-05-2023(online)].pdf | 2023-05-03 |
| 8 | 202341031597-EDUCATIONAL INSTITUTION(S) [03-05-2023(online)].pdf | 2023-05-03 |
| 9 | 202341031597-DRAWINGS [03-05-2023(online)].pdf | 2023-05-03 |
| 10 | 202341031597-COMPLETE SPECIFICATION [03-05-2023(online)].pdf | 2023-05-03 |
| 11 | 202341031597-Proof of Right [24-05-2023(online)].pdf | 2023-05-24 |
| 12 | 202341031597-FORM-26 [24-05-2023(online)].pdf | 2023-05-24 |
| 13 | 202341031597-FORM 3 [24-05-2023(online)].pdf | 2023-05-24 |
| 14 | 202341031597-ENDORSEMENT BY INVENTORS [24-05-2023(online)].pdf | 2023-05-24 |
| 15 | 202341031597-FORM-9 [03-05-2024(online)].pdf | 2024-05-03 |