Sign In to Follow Application
View All Documents & Correspondence

Rapid Molecular Method For Quantifying Corrosion Causing Microbes

Abstract: TITLE OF THE INVENTION: RAPID MOLECULAR METHOD FOR QUANTIFYING CORROSION CAUSING MICROBES Abstract Of The Invention The present invention is related to a rapid nucleic acid based method for detecting and quantifying the microbes causing biofouling and biocorrosion in various metallic assets in hydrocarbon industry. The present invention further also provides for primers for detecting and quantifying microbes causing biofouling and biocorrosion in various metallic assets in hydrocarbon industry

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
18 December 2013
Publication Number
31/2015
Publication Type
INA
Invention Field
MICRO BIOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2019-08-19
Renewal Date

Applicants

Indian Oil Corporation Limited
G-9, Ali Yavar Jung Marg, Bandra (East), Mumbai-400 051, India

Inventors

1. UPRETI, Manoj Kumar
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)
2. SINGH, Mahendra Pratap
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)
3. AMIR, Qazi Mohammad
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)
4. PURI, Suresh Kumar
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)
5. GUPTA, Anurag Ateet
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)
6. RAJAGOPAL, Santanam
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)
7. MALHOTRA, Ravinder Kumar
c/o. Indian Oil Corporation Limited, Research & Development Centre, Sector- 13, Faridabad- 121 007, Haryana (IN)

Claims

1. A group of PCR primers having SEQ ID Nos. 25-44 for detection and quantification of microorganisms causing biofouling and corrosion in pipelines of hydrocarbon industry.

2. The PCR primers as claimed in claim 1, wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), exopolymers or slime producing bacteria (SPB) and nitrite reducing bacteria (NRB).

3. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 25-28 detect and quantify sulfate-reducing bacteria (SRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 25 or portion thereof and SEQ ID No. 26 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 27 or portion thereof and SEQ ID No. 28 or portion thereof.

4. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 40-43 detect and quantify exopolymers or slime producing bacteria (SPB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 40 or portion thereof and SEQ ID No. 41 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 42 or portion thereof and SEQ ID No. 43 or portion thereof.

5. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 30-33 detect and quantify nitrite reducing bacteria (NRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 30 or portion thereof and SEQ ID No. 31 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 32 or portion thereof and SEQ ID No. 33 or portion thereof.

6. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 35-38 detect and quantify metal oxidizing bacteria (MRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 35 or portion thereof and SEQ ID No. 36 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 37 or portion thereof and SEQ ID No. 38 or portion thereof.

7. The PCR primers as claimed in claim 1, wherein the said primers enable detection and identification of microorganisms having low gene copy number in a single PCR reaction.

8. The PCR primers as claimed in claim 1, wherein copy number of gene in a single PCT reaction is as low as 9-12 copies of gene per reaction.

9. A method of detecting and quantifying microorganisms causing biofouling and corrosion of engineering pipelines of hydrocarbon industry, said method comprising the steps of: (a) extracting microbial DNA from a muck or corrosion deposits or water sample; (b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and (c) detecting and quantifying the amplification product.

10. The method as claimed in claim 9, wherein the microbes are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), exopolymers or slime producing bacteria (SPB) and nitrite reducing bacteria.

11. The method as claimed in claim 9, wherein the method enables identification and quantification of microorganisms carrying low copy number of gene/s in s single reaction.

12. The method as claimed in claims 9-11, wherein the copy number of gene/s obtained by PCR primers in a single PCR reaction is as low as 9-12 copies of a gene per reaction

13. A method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction, said method comprising the steps of: (a) extracting microbial DNA from a muck or corrosion deposits or water sample; (b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and (c) detecting and quantifying the amplification product.

14. The method as claimed in claim 13, wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria

15. The method as claimed in claim 13, wherein the copy number of gene in a single PCR reaction is as low as 9-12 copies of gene per reaction.

Specification

DESC:FIELD OF THE INVENTION
The present invention is related to a rapid nucleic acid based method for detecting and quantifying the microbes causing biofouling and biocorrosion in various metallic assets in hydrocarbon industry. The present invention further also provides for primers for detecting and quantifying microbes causing biofouling and biocorrosion in various metallic assets in hydrocarbon industry

BACKGROUND AND PRIOR ART

Biological fouling (biofouling) is defined as damage to engineered materials and processing systems that is mediated by living organisms. Oil production and distribution systems are particularly vulnerable to biofouling; in particular, microbially-influenced corrosion (MIC) activities can lead to corrosion in metallic assets and associated product losses. The understanding the ecology and activity of microorganisms in industrial systems is key to prevention of biofouling/biocorrosion. The main classes of microbes associated with biofouling are sulfate-reducing bacteria (SRB), metal-oxidizing/reducing/depositing bacteria (MRB), bacteria secreting organic acids (APB), exopolymers or slime producing bacteria (SPB), nitrite reducing bacteria/denitrifying bacteria (NRB) etc. These organisms in most of the cases coexist in naturally occurring biofilms, often forming synergistic communities that are able to affect electrochemical processes through co-operative metabolism not seen in the individual.

The understanding of the microbial species involved in microbial corrosion and their interactions with metal surfaces and with other microorganisms may be the basis for the development of new approaches for the detection, monitoring, and control of microbial corrosion. Thus the quantification of these microbes of various physiological group is essential to understand the dynamics of microbial population and devising a mitigation program as well studying the effectiveness of any mitigation program. Quantification of microbial species present in corroded sample have traditionally relied upon the use of samples obtained from pipelines and grow them on specified growth media under laboratory control conditions. As growth requirement of vast majority of microbial species is not known, so most of the microbes (~ 99%) cannot be grown in the laboratory. Thus, culture-dependent approaches underestimate the biocomplexity of microbial communities. Thus, undermining the actual propensity/prevalence of MIC.
Beside this the culture dependent methods are generally less sensitive and time consuming. These shortfalls of culture dependent methods can be overcome by using nucleic acid based methodology. These methods do not require laboratory growth of bacteria and provides unique insights into the uncultured microbial communities as well. One such method is quantitative real time PCR assay. Real-time quantitative PCR (qPCR) has been developed and used in the last few years in the medical and food research/industries to detect and quantify a number of pathogenic or infectious microorganisms. Quantitative PCR has also been used to determine the abundance of microorganisms in many different types of complex environmental samples such as sediments, water, wastewater, and marine samples. The advantage of quantitative PCR over traditional PCR is that it provides more accurate and reproducible quantification of microorganisms because quantitative PCR quantifies PCR products during the logarithmic phase of the reactions. Moreover, quantitative PCR offers a dynamic detection range of six orders of magnitude or more, does not need post-PCR manipulation, and has the capability of high throughput analysis.

The main requirement in a quantitative real time PCR assay is the specific primer set. The primer set initiate the amplification of the targeted segment of DNA i.e., gene and it is monitored in term of number of copies of the target genes (i.e., number of bacteria). The real time PCR assay may be carried out taking DNA or RNA as staring material. RNA is converted to double strand molecule by using method known in prior art for the purpose.

US 7276358 B1 discloses a set of primer pairs for amplifying a nucleic acid of a butyric acid-producing bacteria, each primer containing an oligonucleotide selected from the buk gene region of the butyric acid-producing bacteria. The primers are particularly suitable for amplifying the nucleic acid of butyric acid-producing bacteria present in gas and oil production operations.

US 7384770 B1 discloses a set of primer pairs for amplifying a nucleic acid of an acetic acid-producing bacteria, each primer containing an oligonucleotide selected from the ackA gene region of the acetic acid-producing bacteria. The primers are particularly suitable for amplifying the nucleic acid of acetic acid-producing bacteria present in gas and oil production operations.

CA 2673577 A1 discloses a method for the collection of field samples for nucleic acid extraction and subsequential detection of microorganisms from various media such as aqueous samples, sediments and biofilms (sessile bacteria). This method is a quantitative polymerase chain reaction (PCR)-based technique for detection of dissimilatory sulfite reductase (DSR), the key enzyme in the sulfate reduction pathway.

Zhu et al., Appl. Environ. Microbiol. 69(9):5354-5363, 2003 describe the characterization of microbial communities in gas industry pipelines.

Zhu et al.(“Application of Quantitative, Real-Time PCR in Monitoring Microbiologically-Influenced Corrosion (MIC) in Gas Pipelines” NACE 2005) describe the rapid detection and quantification of microbes related to microbiologically influenced corrosion using quantitative polymerase reaction. The reported assay sensitivity of this study detects about 20 and 13 gene copies per reaction for SRB and denitrifying bacteria respectively.

Leloup et al., Environmental Microbiology 9(4), 131-142, 2007, describe diversity and abundance of sulfate-reducing microorganisms in the sulfate and methane zones of a marine sediment, Black Sea.

US 6531281 relates to a method for the detection of sulphate-reducing bacteria in a sample which is likely to contain them, the said method comprising the extraction of the DNA or of the RNA from the said sample and the detection of at least one fragment of the APS reductase gene or at least one fragment of the mRNA transcribed from the APS reductase gene, an indicator of the presence of sulphate-reducing bacteria in the said sample.

CN 102242203 B relates to testing, in particular to a corrosion causing marine bacterium Rose family (Roseobacter clade) by quantitative real-time PCR technology.

CN 103088133 A provides a specific primer pair for detecting sulfate reducing bacteria and a method for detecting the sulfate reducing bacteria in an environmental sample.

Upreti et al. 2010, October 31-Nov. 3, 2010, Petrotech-2010, New Delhi, India describes a PCR based method for quick detection of microbiologically influenced corrosion.

Boudaud et al. Journal of Applied Microbiology 109 (2010) 166–179 describes about biodiversity analysis of marine bacteria associated with biocorrosion phenomena

US 20120288864 relates to the detection of Salmonella by nucleic acid amplification. The invention provides primer and probe oligonucleotides that can be used in multiplex to detect Salmonella in real-time amplification. The oligonucleotides of the invention detect all group I serovars, and have an increased Salmonella detection range: they enable to cover the seven Salmonella groups. They also have an increased sensitivity, without loss in specificity.
The presently known PCR based methods are still less sensitive considering they have been found to detect only very limited number of microbes that cause biofouling and biocorrosion in oil and gas pipelines. More particularly the presently available PCR based methods are also less sensitive considering that provide limited ability or the range to detect and quantify different types microbes.
Accordingly, there is need to develop more sensitive PCR methods which can detect more than one type of corrosion causing bacteria per assay or reaction with increased sensitivity and without loss in specificity.

SUMMARY OF THE INVENTION
Accordingly the main embodiment of the present invention provides a group of PCR primers having SEQ ID Nos. 25-44 for detection and quantification of microorganisms causing biofouling and corrosion in pipelines of hydrocarbon industry.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria.
Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 25-28 detect and quantify sulfate-reducing bacteria (SRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 25 or portion thereof and SEQ ID No. 26 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 27 or portion thereof and SEQ ID No. 28 or portion thereof.
Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 40-43 detect and quantify exopolymers or slime producing bacteria (SPB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 40 or portion thereof and SEQ ID No. 41 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 42 or portion thereof and SEQ ID No. 43 or portion thereof.
Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 30-33 detect and quantify nitrate reducing bacteria (NRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 30 or portion thereof and SEQ ID No. 31 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 32 or portion thereof and SEQ ID No. 33 or portion thereof.
Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 35-38 detect and quantify metal oxidizing bacteria (MRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 35 or portion thereof and SEQ ID No. 36 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 37 or portion thereof and SEQ ID No. 38 or portion thereof.
Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the said primers enable detection and identification of microorganisms having low gene copy number in a single PCR reaction.
Another embodiment of the present invention provides the group of PCR primers as herein described wherein copy number of gene in a single PCT reaction is as low as 9-12 copies of gene per reaction.
Yet another embodiment of the present invention provides a method of detecting and quantifying microorganisms causing biofouling and corrosion of engineering pipelines of hydrocarbon industry, said method comprising the steps of:
(a) extracting microbial DNA from a muck or corrosion deposits or water sample;
(b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and
(c) detecting and quantifying the amplification product.
Yet another embodiment of the present invention provides a method as herein described wherein the microbes are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), exopolymers or slime producing bacteria (SPB) and nitrite reducing bacteria (NRB).

Yet another embodiment of the present invention provides a method as herein described wherein the method enables identification and quantification of microorganisms carrying low copy number of genes in s single reaction.
Yet another embodiment of the present invention provides a method as herein described wherein the copy number of gene obtained by PCR primers as herein described in a single PCR reaction is as low as 9-12 copies of gene per reaction
Another embodiment of the present invention provides a method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction, said method comprising the steps of:
(a) extracting microbial DNA from a muck or corrosion deposits or water sample;
(b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and
(c) detecting and quantifying the amplification product.
Another embodiment of the present invention provides a method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria
Another embodiment of the present invention provides a method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction, wherein the copy number of gene in a single PCR reaction is as low as 9-12 copies of gene per reaction.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1: Sequences of different genes used in present invention to develop the primer/probes.
Figure 2: List of various Primer and Probes developed in the present invention.

DETAILED DESCRIPTION
While the invention is susceptible to various modifications and/or alternative processes and/or compositions, specific embodiment thereof has been shown by way of example in the drawings, graphs and tables and will be described in detail below. It should be understood, however that it is not intended to limit the invention to the particular processes and/or compositions disclosed, but on the contrary, the invention is to cover all modifications, equivalents, and alternative falling within the spirit and the scope of the invention as defined by the appended claims.

The graphs, tables, figures and protocols have been represented where appropriate by conventional representations in the drawings, showing only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the disclosure with details that will be readily apparent to those of ordinary skill in the art having benefit of the description herein.

The following description is of exemplary embodiments only and is not intended to limit the scope, applicability or configuration of the invention in any way. Rather, the following description provides a convenient illustration for implementing exemplary embodiments of the invention. Various changes to the described embodiments may be made in the function and arrangement of the elements described without departing from the scope of the invention.

The terms “comprises”, “comprising”, or any other variations thereof, are intended to cover a non-exclusive inclusion, such that one or more processes or composition/s or methods proceeded by “comprises... a” does not, without more constraints, preclude the existence of other processes, sub-processes, composition, sub-compositions, minor or major compositions or other elements or other structures or additional processes or compositions or additional elements or additional features or additional characteristics or additional attributes.

Definitions
In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:
It must be noted that, as used in the specification/description and the appended claims and examples, the singular forms “a”, “an” and "the" may include plural referents unless the context clearly dictates otherwise.

Ranges may be expressed herein as from “about” one particular value, and or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about”, it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.

As used herein, the term “Biofouling” refers to invasion of microorganisms, preferably bacteria on the surfaces of engineering structures that contributes to corrosion of the structures and to a decrease in the efficiency. The engineering structures in context of the present invention refer to pipelines of hydrocarbon industry, particularly oil and gas industry.

As used herein, the term “Bio-corrosion or Microbial Corrosion or Microbiologically Influenced Corrosion or Microbially Induced Corrosion or MIC” refers to corrosion that is influenced by the presence and activities of microorganisms and/or their metabolites. It is associated with localized, under deposited, pitting corrosion, and responsible for corrosion failures in oil transportation and storage system. The aforesaid terms imply the same meaning and may be used interchangeably.

As used herein, the term “Quantitative PCR or q-PCR” refers to quantifying the amount of template DNA present in the original reaction mixture or sample. Usually achieved by the addition of a known amount of a target sequence that is amplified by the same primer set but can be differentiated, usually by size, at the end of the reaction.

As used herein, the term “Muck samples or Corrosion deposits (CDs)” is the slurry obtained during pigging operation is any pipeline segment. The corrosion deposits or muck samples are the first choice for testing purpose because causative organisms are expected to be found in relatively high numbers at the corrosion site and muck sample obtained during pigging.

As used herein, the term “Real-time PCR” refers to detection and quantitation of an amplified PCR product based on incorporation of a fluorescent reporter dye; the fluorescent signal increases in direct proportion to the amount of PCR product produced and is monitored at each cycle, 'in real time', such that the time point at which the first significant increase in the amount of PCR product correlates with the initial amount of target template.

As used herein, the term “Gene” means a DNA sequence containing information required for expression of a polypeptide or protein.

As used herein, the term “Template” refers to a double-stranded or single-stranded nucleic acid molecule which is to be amplified, synthesized or sequenced. In the case of a double-stranded DNA molecule, denaturation of its strands to form a first and the second strand is performed before these molecules may be amplified, synthesized or sequenced. A primer, complementary to a portion of a template is hybridized under appropriate conditions and a polymerase then synthesizes a molecule complementary to the template or a portion thereof.

As used herein, the term “Amplification” refers to any in vitro method for increasing the number of copies of a nucleotide sequence with the use of a DNA polymerase. Nucleic acid amplification results in the incorporation of nucleotides into a DNA molecule or primer, thereby forming a new DNA molecule complementary to a DNA template. The formed DNA molecule and its template can be used as templates to synthesize additional DNA molecules.

As used herein, the term “Oligonucleotide/s” refers to a synthetic or natural molecule comprising a covalently linked sequence of nucleotides which are joined by a phosphodiester bond between the 3' position of the pentose of one nucleotide and the 5' position of the pentose of the adjacent nucleotide.

As used herein, the term “Primer/s or PCR primer/s” refers to a single-stranded oligonucleotide that is extended by covalent bonding of nucleotide monomers during amplification or polymerization of a nucleic acid molecule.

As used herein, the term “Primer set”, refers to one forward and one reverse primer for a specific gene.

As used herein the term, “Group of PCR primers” refers to PCR primer/s alone and/or in combination, wherein the combination means a primer set as herein described for the amplification of DNA of microbe or microorganism causing biofouling and/or corrosion in pipelines of hydrocarbon industry.

As used herein the term, “First primer” refers to the forward primer falling within the meaning of “Primer” or “Primer set” or “Group of PCR primers” as herein described.

As used herein the term, “Second primer” refers to the reverse primer falling within the meaning of “Primer” or “Primer set” or “Group of PCR primers” as herein described.

As used herein, the term “Multiplex PCR” refers to a modification of polymerase chain reaction in order to rapidly detect more than one target in single assay. This process amplifies genomic DNA samples using multiple primers and a temperature-mediated DNA polymerase in a thermal cycler.

As used herein, the term “Probe or PCR probe” refers to fluorescence oligonucleotide molecules to measure amplification at each cycle of the PCR process.
As used herein, the term “Hydrocarbon Industry” refers to any industry involved in hydrocarbon processing, production and transportation activity. The hydrocarbon industry in context of the present invention also includes oil and gas industry.

As used herein, the term “Oil and Gas Industry” refers to any industry involved in oil and gas processing, production and transportation activity.

As used herein, the term “Microorganisms or Microbes” refers to a microscopic organism, particularly bacterium or fungus. The term microorganisms or microbes as used and described herein include all the microscopic organisms including but not limited to bacteria and/or fungi that are capable of biofouling and biocorrosion in pipelines of hydrocarbon industry.

As used herein, the term “Bacteria” refers to unicellular prokaryotic microorganism. The term bacterial as used herein and described herein includes bacteria causing biofouling and biocorrosion in pipelines of hydrocarbon industry. The bacteria used and described herein includes but are not limited to sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria.

As use herein the term “Low gene copy number” refers to gene having less copies of a particular gene in any sample.

As use herein the term “Gene copy number” refers to the number of copies of a particular gene in any sample.

As use herein the term “Corroded sample” refers to metallic or otherwise sample having microbiological corrosion and corrosion products.

As use herein the term “Without loss in specificity” refers to no loss in accuracy of detection of MIC causing microbes.
As use herein “Similar or Increased sensitivity” refers to assay having better or similar detection limits for MIC causing microbes.

As use herein “Pipelines of Hydrocarbon Industry” refers to metallic pipelines used for transporting hydrocarbons.

As used herein “Conventional microbiological method or Conventional microbiological analysis or Conventional microbiological analysis” refers to method where specific microbiological growth media are used for detecting the presence of the different class of microbes.

As used herein, the term “Biological Material” means a group of microorganisms or bacteria or fungi characterized by their common functional and/or chemical characteristic/s. Here the term biological material does not include or means or refers to a single species or strain of microorganism (i.e. bacteria or fungi). The group of microorganisms or bacteria or fungi which fall within the meaning of biological material as herein described are characterized by their common functional and/or chemical characteristic which is exemplified as ability to reduce sulfate [as exemplified by sulfate-reducing bacteria (SRB)], ability for metal-oxidizing or metal-reducing or metal-depositing [exemplified by metal-oxidizing/reducing depositing bacteria (MRB)], ability to produce exopolymers or slime [exemplified as exopolymers or slime producing bacteria (SPB)] and/or ability to produce nitrate [exemplified as nitrite reducing bacteria].

The present invention provides for PCR or nucleic acid based method for detection and quantification of microorganisms causing biofouling and biocorrosion in pipelines of hydrocarbon industry. The present invention also provides for a PCR or nucleic acid based method using novel primers and/or probes for detection and quantification of microorganisms causing biofouling and biocorrosion in pipelines of hydrocarbon industry. In another scope the present invention provides for a highly sensitive PCR or nucleic acid based method which enables detection and quantification of microorganisms causing biofouling and biocorrosion in pipelines of hydrocarbon industry present at very low gene copy number.

The sensitivity and specificity of the method and primers and/probes of the present invention enable the present invention to be efficiently used for the purpose of directing type and the amount of biocidal treatment needed for eliminating the biofouling and biocorrosion bacteria from the pipelines of the hydrocarbon industry. Thus it has been found in the present invention that the method and primers as herein described enable the skilled person to help in identifying and selecting the type of treatment needed for eliminating the biofouling and biocorrosion bacteria from the pipelines of the hydrocarbon industry.

Another objective of the present invention is to arrive and develop primer and/or probes for purpose of identifying the right quality of the biocidal which can be used for eliminating biofouling and biocorrosion microbes from the pipelines of the hydrocarbon industry.

In another scope the present invention provides for novel primers and/or probes which bring sensitivity to the PCR or nucleic acid based method for the detection quantification of microorganisms causing biofouling and biocorrosion in pipelines of hydrocarbon industry. The sensitivity imparted by the primers and/or probes of the present invention is such that they enable detection and quantification of microorganisms causing biofouling and biocorrosion in pipelines of hydrocarbon industry at low gene copy number.

Another scope of the present invention provides for detection and quantification of single species or strains of microorganisms as well as microorganisms which are categorized or grouped by means of their functional attributes or functional characteristics such as but not limited to sulfur-reducing bacteria (SRB), nitrite reducing bacteria (NRB), slime producing (SPB) and metal oxidizing/reducing/depositing bacteria (MRB).

In another scope the present invention provides for PCR or nucleic acid based method that detection and quantification of different classes of biocorrosion causing microorganisms from any corroded sample with similar or increased sensitivity and without loss in specificity.

In another scope the present invention also provides for novel primers and/or probes which simultaneously ensure high sensitivity and high specificity for the detection and quantification of microorganisms from any corroded sample obtained from pipelines from a hydrocarbon industry.

In another scope the present invention provides for a PCR or nucleic acid based method for detection and quantification of microorganisms belonging to a group of but not limited to sulfate-reducing bacteria (SRB), iron-oxidizing/reducing bacteria (IRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, low nutrient bacteria in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry. Another scope of the present invention provides for a PCR or nucleic acid based novel primers and/probes for detection and quantification of microorganisms belonging to a group of but not limited to sulfate-reducing bacteria (SRB), iron-oxidizing/reducing bacteria (IRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, low nutrient bacteria in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry

In another scope the present invention for the first time also provides for a PCR or nucleic acid based method as well as novel primers and/or probes for detection and quantification of slime producing bacteria having icaA gene which is often cause corrosion in hydrocarbon transportation pipelines.

Another scope the present invention for the first time also provides for a PCR or nucleic acid based method as well as novel primers and/or probes for detection and quantification of metal oxidizing/reducing bacteria with high sensitivity and specificity from corrosion deposits/muck sample from hydrocarbon transportation pipelines.

Thus one object the present invention provides a quantitative polymerase chain reaction assay (q-PCR) that can be used to rapidly detect and quantify the microorganisms causing biofouling and biocorrosion, particularly bacteria in the pipelines of hydrocarbon industry. Another object of the present invention provides a q-PCR based method that uses novel primers and/or probes which provide high sensitivity as well as specificity for the detection and quantification microorganisms causing biofouling and biocorrosion, particularly bacteria in the pipelines of hydrocarbon industry. Another object the present invention particularly provides for a method as well as the primers and/or probes which are highly sensitive that they enable detection of low copy number of gene in a single PCR reaction.

In another object the present invention provides for detection and quantification of various group of bacteria related to biofouling and biocorrosion including but not limited to sulfate-reducing bacteria (SRB), metal-oxidizing/reducing bacteria (MRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry.

In another object the present invention provides for a q-PCR method which can detect and quantify microorganisms at low copy number of gene wherein the copy number of gene/s is as low as 9-12 copies of gene per PCR reaction or per single assay.

In one aspect, this invention features sets of primer pairs for various group of bacteria related to biofouling including but not limited to sulfate-reducing bacteria (SRB), metal-oxidizing/reducing bacteria (MRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry. The creation of the specific PCR primers comprising the primer pairs was accomplish for various functional genes like dissimilatatory sulfite reductase, nitrite reductase, 16S rDNA gene sequences, icaA N-acetylglucosamine transferase etc which are related to SRB, DNB, MRB and SPB physiological group respectively. These primers have been created to meet the requirements for real time PCR or q-PCR and these primers specifically amplify the target gene in the total DNA isolated from corroded samples.

The identification of microbial organisms as described in the present invention are not limited to any one or more specific species and/or strains belonging the group of sulfate-reducing bacteria (SRB), iron-oxidizing/reducing bacteria (IRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, low nutrient bacteria in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry.
The biological material or microorganism/s as herein described in the context of the present invention includes group/s of bacteria related to biofouling and/ or causing corrosion in the hydrocarbon industry but not limited to sulfate-reducing bacteria (SRB), iron-oxidizing/reducing bacteria (IRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, low nutrient bacteria in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry.

The term biological material in context of the present invention should be construed as a group of microorganisms, (such a bacteria) as defined by their same functional characteristics or attributes and includes more than one species and/or strains microorganisms. Therefore the term biological material in context of the present invention should be construed to recite as herein described group/s of bacteria related to biofouling and/ or causing corrosion in the hydrocarbon industry but not limited to sulfate-reducing bacteria (SRB), iron-oxidizing/reducing bacteria (IRB), slime secreting/producing bacteria (SPB), nitrate reducing bacteria, low nutrient bacteria in environmental samples, including, but not limited to, various metallic assets in hydrocarbon industry and not encompass any specific species and/or strain/s of the said group of bacteria.

The present invention provides for method and/or primer/s for the identification of any microorganism/s belonging to hydrocarbon industry. Accordingly, the method and/or primers as herein described in the context of the present invention are not limited for identification of any particular strain and/or species of the microorganism as herein described but group of bacteria which cause biofouling and/or corrosion in pipelines of hydrocarbon industry, particularly oil and gas industry.

In one aspect of the present invention, each novel primer set of group-specific PCR primer pairs contain one forward oligonucleotide primer which has been designed from either by multiple sequence alignments of various functional genes or 16S rDNA sequences of that specific physiological group of bacteria occurring commonly in Indian pipelines and one reverse oligonucleotide primer from above gene and complimentary strand of nucleic acid. In one aspect the present invention also provides for probe/s which may be used for multiplexing PCR based method.
In this present invention the PCR primers and/or probes have been developed and designed based on DNA or genetic regions of group bacterial as herein described. The various groups of bacteria as described in the present invention carry many dissimilatory genetic regions or DNA sequences which confer particular functional characteristics or attributes to these group of bacteria. The various genetic regions or DNA regions or gene regions belonging to group of bacteria as herein described has been discussed in the below sections of the description. Accordingly, the primers and/or probes as developed and designed in the present invention identify and quantify the bacterial groups as herein described are based on the various dissimilatory genes as discussed below. The PCR primers and/or probes of the present invention are unique such that they enable identification and quantification of particular bacterial group based on the low gene copy number per PCR reaction. Accordingly, the PCR primer and/or probes of the present invention identify low gene copy number per reaction of the dissimilatory gene of the groups of bacteria as herein described thereby enabling the PCR method as herein described to be highly sensitive as well as highly specific.

The sulphate reducing bacteria (SRB) are most commonly occurring bacteria in microbial corrosion. SRB are a group of diverse anaerobes which carry out dissimilatory reduction of sulfur compounds such as sulfate, sulfite, thiosulfate and even sulfur itself to sulfide and are one of the most frequent causes for bio-corrosion. SRB can utilize hydrogen, iron or nitrates as electron donors. The SRB have capabilities to form biofilms on carbon steel, and this characteristic is related with corrosion and pipelines plugging. They reduce sulfate to hydrogen sulfide which reacts with metals to produce metal sulfides as corrosion products. The gene (dsr) encodes the key enzyme dissimilatory sulfite reductase (DSR) of sulphate reducing bacteria, which catalyzes the reduction of (bi) sulfite to sulfide. dsrAB gene encoding alpha and beta subunit of DSR is highly conserved, and was used as target gene in the present invention for the detection and quantification of SRB in the gas pipeline samples.

To detect and quantify SRBs, a real-time qPCR assay has been developed by targeting the gene dsr encoding enzyme dissimilatory sulfite reductase. In one aspect, this invention features set of PCR primer pairs that has been created to meet the specific requirements of real-time qPCR, which primer pairs amplify an approximately 149-bp DNA fragment from of all major dissimilar SRB including those most commonly found in the oil production/transportation operations The creation of the specific PCR primers comprising the primer pairs was accomplished by determining the DNA sequences of dsr genes in SRB most commonly found in oil production operations /transportation. Each primer of the set of PCR primer pairs contains an oligonucleotide selected from the dsr gene region of the sulphate reducing bacteria bacteria. The set of PCR primer pairs comprises forward primers, IOC_DSR_F1and IOC_DSR_F2, having oligonucleotides selected from the group of SEQ. ID Nos. 25 and 26, respectively, and reverse primers, IOC_DSR_R1 and IOC_DSR_R2, having oligonucleotides selected from the group of SEQ. ID Nos. 27 and 28, respectively. SEQ. ID No. 29 (SEQ ID NO.5) is a probe to be use with IOC_DSR_F2 or IOC_DSR_F1 and IOC_DSR_R2 or IOC_DSR_R1 in multiplexing.

Slime-producing microorganisms that excrete acidic extracellular polysaccharides (slime) during biofilm formation on metal surfaces may influence corrosion. Slime is actually a sophisticated network of sticky strands that bind the cells to the surface and control what permeates through the deposit. In the stickiness traps all sorts of particulates that might be floating by, which, in dirty water, can result in the impression that the deposit or mound is an inorganic collection of mud and debris. Hence, contribute significantly in the corrosion process. In addition, slime film may produce anaerobic sites for SRB and can produce metabolic byproducts that are useful to enhance growth of various bacteria. Slime-forming microorganisms that have been recovered from sites of corrosion on metal surfaces include Clostridium spp., Staphylococcus sp., Flavobacterium spp., Bacillus spp., Desulfovibrio spp., Desulfotomaculum spp. and Pseudomonas spp. The ability of bacteria to aggregate and form biofilm is strictly related to the capacity of producing an extracellular mucoid substance: the slime, whose main component is of polysaccharide nature and consists of glycosaminoglycans. ica(ADBC) operon responsible for slime production. In the operon, icaA encodes for N-acetylglucosaminyltransferase, the enzymefor polysaccharide intercellular adhesin (PIA) synthesis. In one aspect, this invention features set of PCR primer pairs that has been created to meet the specific requirements of real-time qPCR, which primer pairs amplify an approximately 210-bp DNA fragment from of slime producing bacteria including those most commonly found in the metallic surface. he creation of the specific PCR primers comprising the primer pairs was accomplished by determining the DNA sequences of N-acetylglucosaminyltransferase (icaA) genes in slime producing bacteria most commonly found on corroded metallic surface. Each primer of the set of PCR primer pairs contains an oligonucleotide selected from the icaA gene region of the slime producing bacteria. The set of PCR primer pairs comprises forward primers, IOC_ICA_F1 and IOC_ICA_F2, having oligonucleotides selected from the group of SEQ. ID Nos. 40 and 41, respectively, and reverse primers, IOC_ICA_R1and IOC_ICA_R2, having oligonucleotides selected from the group of SEQ. ID NOs 42 and 43, respectively. SEQ. ID No.44 (SEQ ID No.10) is a probe to be use with IOC_ICA_F2 or IOC_ICA_F1 and IOC_ICA_R2 or IOC_ICA_R1 in multiplexing.

Denitrifying bacteria are known to accelerate the corrosion process. The key enzyme in the dissimilatory denitrification process of denitrifying bacteria is nitrite reductase (NIR), which reduces nitrite to nitric oxide (NO). Two types of nitrite reductases,nirS gene nirS gene is more widely distributed among bacteria. In one aspect, this invention features set of PCR primer pairs that has been created to meet the specific requirements of real-time qPCR, which primer pairs amplify an approximately 153-bp DNA fragment from of Denitrifying bacteria including those most commonly found in the metallic surface. The creation of the specific PCR primers comprising the primer pairs was accomplished by determining the DNA sequences of nirS genes in slime producing bacteria most commonly found on corroded metallic surface. Each primer of the set of PCR primer pairs contains an oligonucleotide selected from the nirS gene region of the Denitrifying bacteria. The set of PCR primer pairs comprises forward primers, IOC_NIR_F1and IOC_NIR_F2, having oligonucleotides selected from the group of SEQ. ID Nos. 30 and 31, respectively, and reverse primers, IOC_NIR_R1and IOC_NIR_R2, having oligonucleotides selected from the group of SEQ. ID Nos. 32 and 33, respectively. SEQ. ID N.34 is a probe to be use with IOC_NIR_F2 or IOC_NIR_F1 and IOC_NIR R_2 or IOC_NIR_R1 in multiplexing.

Metal reducing/oxising/depositing microorganisms (metal related bacteria) are known to promote corrosion of various metals and their alloys through reactions leading to the dissolution of corrosion-resistant oxide films on the metal surface, which results in the protective passive layers on e.g. stainless steel surfaces being lost or replaced by less stable reduced metal films that allow further corrosion to occur. These Bacteria participate in the biotransformation of oxides of metals such as iron and manganese . The corrosion resistance of alloys is due to the formation of a thin passive oxide film. The formation of organic and inorganic deposits by MDB on the oxide surface compromises the stability of this film. Dense accumulations of MDB on the metal surface may thus promote corrosion reactions by the deposition of cathodically-reactive ferric and manganic oxides and the local consumption of oxygen by bacterial respiration in the deposit. Major bacterial genera known to be associated with metal oxidation/reduction/deposition are from genera Siderocapsa, Pseudomonas,Shewanella Gallionella, Leptothrix, Sphaerotilus, Crenothrix and Clonothrix. We could not find any specific gene which is conserved and cause metal related activities. For this we isolated several microbes from field sample on specific media for metal oxiding bacteria and there 16S rDNA was sequenced. Based on the 16S rDNA sequences, primers and probes were developed, producing amplicon of 296bp. Each primer of the set of PCR primer pairs contains an oligonucleotide selected from the 16S rDNA sequences of metal related bacteria. The set of PCR primer pairs comprises forward primers, IOC_MRB_F1 and IOC_MRB_F2, having oligonucleotides selected from the group of SEQ. ID Nos. 35 and 36, respectively, and reverse primers, IOC_MRB_R1and IOC_MRB_R2, having oligonucleotides selected from the group of SEQ. ID Nos. 37 and 38 (SEQ ID No. 18 and 19), respectively. SEQ. ID No. 39 is a probe to be use with IOC_MRB_F2 and IOC_MRB_ R2 in multiplexing.

The primers and probe disclosed herein were designed based upon multiple alignments of partial sequences of the targeted gene retrieved from India’s cross country hydrocarbon oil transportation pipeline samples. Muck samples/corrosion deposits were collected from product and crude oil transporting pipelines network of NRPL, WRPL, ERPL, SRPL regions of Indian Oil Corporation Ltd, India during pigging operation.

The target bacteria for which the set of PCR primers/probes of this invention are a designed and developed along with sequence details and organism name are given in Figure-1. This list provides types of different sequences/microbes which were commonly found India’s cross country hydrocarbon oil transportation pipeline. To design primer multiple alignments of sequences was performed, and manual searches for alignments were also conducted to determine candidate primer sequences. All primers were checked for hairpin structure and dimmers and to check the cross-hybridization among the sequences of primers used in some assay and calculate the melting temperature (Tm) using a nearest neighbor model. For all these analysis commercially available software can be used. In addition, all primer sequences were analyzed for specificity using a BLAST SEARCH program and were found not to cross-react with any other non-target organisms and among each other.

The method of the present invention provides for most surprising and unexpected finding as the method is highly sensitive as it enables detection of low number of copies of the gene. The present invention provides for method which enables detection of low number copies of the gene as low as in the range of 9-12 copies per gene.

The present invention provides for primer or primer set which provides for detection of microorganisms causing biofouling and/or bio-corrosion wherein the said microbes which may be present in low concentration or low copy numbers in the pipelines of hydrocarbon industry are detected and quantified. The primers or primer set of the present invention are such that they enable detection of the microbes at concentration as low as 1copies per reaction.

The primers or primer set as herein described of the present invention provide for a highly sensitive method detection and quantification of the microbes as herein described. Another scope of the present invention provides for primers or primer set as herein described which enables detection and quantification of microbes in a single gene assay as well as multiplexing assay.

The PCR primers of the present invention provides for a PCR method, particularly a Real-time PCR or q-PCR assay which is highly sensitivity as it enables the detection of minimum of copies of gene/s as low as 1-12 copies per reaction. In another scope the PCR primer/s of the present invention provides for a PCR method, particularly a Real-time PCR or q-PCR assay.

For example in the present invention it has been found that the PCR primers as herein described provide for a highly sensitive PCR method which enable 10, 12, 11 and 9 copies per reaction for SRB, SPB, DNB and MRB respectively (R2 > 0.9998), under optimum conditions and muck sample obtained from oil transportation pipelines in single gene assay as well as in multiplexing.
The set of PCR primer pairs of this invention has been evaluated in SYBR Green I real-time qPCR on reference SRB, MRB, SPB, DNB as well as oil pipeline samples. The primer combination gives the best detection and quantification of bacteria commonly found corroded metallic surface. In addition to being appropriate for the real-time PCR quantification of corrosion causing bacteria, the set of primers of this invention is specific for samples fields operations and offering a dynamic detection range of 6.5 orders of magnitude or more.
In another aspect, this invention features a method for quantifying SRB, MRB, SPB, DNB simultaneously in a multiplexing assay system specifically and selectively, which may result in a kit which can used to detect and quantify these bacteria in corrosion deposit from any metallic surface.

In another aspect, this invention features a method the amount of sulphate reducing bacteria in a sample from environment in which total genomic DNA from the environmental sample is amplified by quantitative PCR using SRB specific primers set disclosed in the present inventions to form a double-stranded nucleic acid product, the nucleic acid product is contacted with a label, such as a fluorophore, e.g. SYBR Green I, in a solution for binding there between, and the SRBs is quantified by monitoring the signal produced by the bound label, the intensity of which is a function of the quantity of the respective functional gene of in the sample.

In another aspect, this invention features a method the amount of SPB in a sample from environment in which total genomic DNA from the environmental sample is amplified by quantitative PCR using SPB specific primer disclosed in the present inventions to form a double-stranded nucleic acid product, the nucleic acid product is contacted with a label, such as a fluorophore, e.g. SYBR Green I, in a solution for binding there between, and the SPBs is quantified by monitoring the signal produced by the bound label, the intensity of which is a function of the quantity of the respective functional gene of in the sample.

In another aspect, this invention features a method the amount of MRBs in a sample from environment in which total genomic DNA from the environmental sample is amplified by quantitative PCR using MRB specific primer set disclosed in the present inventions to form a double-stranded nucleic acid product, the nucleic acid product is contacted with a label, such as a fluorophore, e.g. SYBR Green I, in a solution for binding there between, and the MRBs is quantified by monitoring the signal produced by the bound label, the intensity of which is a function of the quantity of the respective functional gene of in the sample.

In another aspect, this invention features a method the amount of DNB in a sample from environment in which total genomic DNA from the environmental sample is amplified by quantitative PCR using DNB specific primers set disclosed in the present inventions to form a double-stranded nucleic acid product, the nucleic acid product is contacted with a label, such as a fluorophore, e.g. SYBR Green I, in a solution for binding there between, and the DNBs is quantified by monitoring the signal produced by the bound label, the intensity of which is a function of the quantity of the respective functional gene of in the sample.

In another aspect, this invention features a method the amount of sulphate reducing bacteria, SPB, MRB and DND simultaneously in a sample from environment in which total genomic DNA from the environmental sample is amplified by quantitative PCR and using primers set and probe disclosed in the present invention to form a double-stranded nucleic acid product, the nucleic acid product is contacted with a label, such as a fluorophore and quantified by multiplex PCR.

The microbial population in hydrocarbon oil transport pipelines in India is not well characterized. We have developed a database of sequences of DNA as well as microbes from Indian pipelines by using various microbiological and molecular biology tools. Hence, there is need to design primers based on the DNA sequences which are obtained from Indian pipelines. In view of this, the PCR primer in these inventions are designed on the basis of DNA sequences of various genes like but not limited to, dissimilatatory sulfite reductase, nitrite reductase, 16S rDNA gene sequences, N-acetylglucosaminyltransferase which were obtained from DNA sequence obtained from crude oil and product pipeline in India. Thus, PCR primers/probes that target the sequences of those bacteria most commonly encountered hydrocarbon oil transport pipelines in India yield superior results in developing real-time PCR methods to accurately quantify corrosion causing bacteria in muck/corrosion deposit samples from hydrocarbon oil transport pipelines in India and are capable of detecting the target bacteria with the highest possible sensitivity. The quantification using the real-time PCR method and primers of this invention is achieved by measuring the fluorescent signal of SYBR-Green I dye resulting from its specific binding to the double-stranded amplified fragments. Moreover, the multiplexing could make possible to detect all these microbes in a single assay.

In general, the PCR amplification process employed in the method of this invention may be carried out using procedures known to those skilled in the art, namely, denaturing, annealing, and elongation, which can be repeated as many times as necessary to produce the desired amount of the target nucleic acid. While the number of cycles may be affected by any of a number of factors, such as the nature of the sample, the number of cycles required to achieve the desired amplification in accordance with this invention is generally in the range of about 10 to about 30. However, cycles numbers outside of this range may be necessary and, thus, the statement of the above stated range is in no way intended to limit the scope of this invention.

The present invention provides for at least two set of primer pairs each having one forward and one reverse primer. The primer of the present invention has been so designed such that they comprise of 18-24 oligonucleotides. Further the primers of the present invention have been also designed to have appropriate amount of degeneracy. The degeneracy of the primers as herein described does not affect the accuracy and sensitivity of the primers and the method of the present invention. The sequence details of primers along are given in Table-2.

The set of PCR primer pairs of this invention has been evaluated in SYBR Green I real-time qPCR on microbe isolated from pipeline, muck sample obtained after pigging operation from field as well as corrosion deposits samples. The primer combination gives the best detection and quantification of biofouling related bacteria commonly found in the hydrocarbon industry.

Hence, this method for detecting and quantifying from field sample from hydrocarbon production and transport industry includes: (a) extracting bacterial DNA from a muck or corrosion deposits or water sample (b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to a primer set, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and (c) detecting the amplification product.

Further, the present method for detecting and quantifying more than one group of corrosion causing bacteria from field sample includes: (a) extracting bacterial DNA from a muck or corrosion deposits or water sample (b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to with primer sets for SRB and/or MRB and/or SPB and/or DNB along with probes having sequence IDs as herein described wherein the primers/probes are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and (c) detecting the amplification product and quantifying all four types of bacteria simultaneously.

This method can be applied to muck sample, corrosion deposit, hydrocarbon or water from hydrocarbon production, refining and transport system and done can be used to detect and quantifying microbes responsible for biofouling/corrosion, allowing the track changes in sample over time and to study the effectiveness of biocides or other mitigation approaches.

The primers disclosed in present invention, when used as pairs (at least one forward primer and at least one reverse primer), do not falsely amplify any bacteria which is not a SRB,SPB, DNB and MRB.

Accordingly the main embodiment of the present invention provides a group of PCR primers having SEQ ID Nos. 25-44 for detection and quantification of microorganisms causing biofouling and corrosion in pipelines of hydrocarbon industry.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 25-28 detect and quantify sulfate-reducing bacteria (SRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 25 or portion thereof and SEQ ID No. 26 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 27 or portion thereof and SEQ ID No. 28 or portion thereof.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 40-43 detect and quantify exopolymers or slime producing bacteria (SPB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 40 or portion thereof and SEQ ID No. 41 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 42 or portion thereof and SEQ ID No. 43 or portion thereof.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 30-33 detect and quantify nitrate reducing bacteria (NRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 30 or portion thereof and SEQ ID No. 31 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 32 or portion thereof and SEQ ID No. 33 or portion thereof.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the primers having SEQ ID Nos. 35-38 detect and quantify metal oxidizing bacteria (MRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 35 or portion thereof and SEQ ID No. 36 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 37 or portion thereof and SEQ ID No. 38 or portion thereof.

Another embodiment of the present invention provides the group of PCR primers as herein described, wherein the said primers enable detection and identification of microorganisms having low gene copy number in a single PCR reaction.

Another embodiment of the present invention provides the group of PCR primers as herein described wherein copy number of gene in a single PCT reaction is as low as 9-12 copies of gene per reaction.

Yet another embodiment of the present invention provides a method of detecting and quantifying microorganisms causing biofouling and corrosion of engineering pipelines of hydrocarbon industry, said method comprising the steps of:
(a) extracting microbial DNA from a muck or corrosion deposits or water sample;
(b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and
(c) detecting and quantifying the amplification product.

Yet another embodiment of the present invention provides a method as herein described wherein the microbes are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria.

Yet another embodiment of the present invention provides a method as herein described wherein the method enables identification and quantification of microorganisms carrying low copy number of genes in s single reaction.

Yet another embodiment of the present invention provides a method as herein described wherein the copy number of gene obtained by PCR primers as herein described in a single PCR reaction is as low as 9-12 copies of gene per reaction

Another embodiment of the present invention provides a method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction, said method comprising the steps of:

(a) extracting microbial DNA from a muck or corrosion deposits or water sample;
(b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and
(c) detecting and quantifying the amplification product.

Another embodiment of the present invention provides a method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria

Another embodiment of the present invention provides a method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction, wherein the copy number of gene in a single PCR reaction is as low as 9-12 copies of gene per reaction.

Another embodiment of the present invention provides for a method and primers and/probes of the present invention which enable the present invention to be efficiently used for the purpose of directing type and the amount of biocidal treatment needed for eliminating the biofouling and biocorrosion bacteria from the pipelines of the hydrocarbon industry. Thus it has been found in the present invention that the method and primers as herein described enable the skilled person to help in identifying and selecting the type of treatment needed for eliminating the biofouling and biocorrosion bacteria from the pipelines of the hydrocarbon industry.

Another embodiment of the present invention provides to for primer and/or probes for purpose of identifying the right quality of the biocidal which can be used for eliminating biofouling and biocorrosion microbes from the pipelines of the hydrocarbon industry.

Another embodiment of the present invention provides for primer and/or probes for purpose of identifying the right concentration or quantity of biocidal which can be used for eliminating biofouling and biocorrosion microbes from the pipelines of the hydrocarbon industry.

Another embodiment of the present invention provides for primer and/or probes for use of right concentration or quantity of biocidal for eliminating biofouling and biocorrosion microbes from the pipelines of the hydrocarbon industry.

The following description is of exemplary embodiments only and is not intended to limit the scope, applicability or configuration to the invention in any way. Rather, the following description provides a convenient illustration for implementing exemplary embodiments of the invention various changes to the described embodiments may be made in the functions and arrangement of the elements described without departing from the scope of the invention.

EXAMPLES

Example -1
Muck samples/corrosion deposits (CDs) were obtained from the crude oil transporting pipeline during pigging operation. The CDs were boiled with sterile water at 70°C for 10 minutes and dried to a constant weight at 105°C. The dry corrosion product was then grinded in liquid nitrogen in mortal pestle to achieve fine powder. Isolation of DNA from powdered CDs carried out by suitably modifying the methods given by Marty et al. [Florence Marty, Jean-François Ghiglione, Sandrine Païssé, Hervé Gueuné, Laurent Quillet, Mark C.M.van Loosdrecht & Gerard Muyzer (2012): Evaluation and optimization of nucleic acid extraction methods for the molecular analysis of bacterial communities associated with corroded carbon steel, Biofouling: The Journal of Bioadhesion and BiofilmResearch, 28:4, 363-380]. The purity and quantification of DNA samples was done spectrophotometrically. qPCR was performed on iCycler iQ5 thermocycler (Bio–Rad, USA) for quantitation of SRB, using primer having SEQ ID No.26 (IOC_DSR_F2) and SEQ ID No.28 (IOC_DSR_R2). For quantification of the SRB, each 20 µL qPCR reaction contained 10 µl 2X QuantiTect SYBR Green PCR mixture, 600 nM forward primer having SEQ ID No.26 (IOC_DSR_F2) and 600 nM reverse primer having SEQ ID No.28 (IOC_DSR_R2), one µL of template, and 1.8 µL water. The cycling conditions consisted of 10 minutes of incubation at 95°C followed by 25 cycles of 95°C for 20 sec, 52°C for 30 sec, and 72°C for 30 sec for denaturing, annealing and elongation, respectively, followed by 70°C for 30 sec, and 70°C to 99°C. to generate melting curves. Desulfovibrio vulgaris and E.coli was taken as positive and negative control. To quantify the bacteria, each targeted gene was PCR amplified from Desulfovibrio vulgaris and then cloned into the pGEM-T Easy Vector (Promega, USA).Plasmids from the proper insert clones of the each target gene were extracted and serially diluted to make calibration curve for quantitation. Triplicates for standard and unknown template were performed on a single plate.

The corrosion deposit was also subjected for microbiological analysis using media known in prior art for the same. Table-3 provides the cell count of various microbes in field sample obtained through conventional microbiological method as well as by the method disclosed in present invention.

Table 3: Count of SRB in field sample (Muck samples/corrosion deposits) through conventional microbiological method and method disclosed in present invention
Count ( cells/ g muck)
Conventional Microbiological analysis Present invention
SRB 3.5 X 102 6.3 X 103

Result indicated that the method disclosed in the present invention could successfully quantify and detect the SRB in the field samples. The higher count in the real time PCR assay in comparison to conventional microbiological assay is mainly because of the amplification of non-cultivable bacteria. This proves the high sensitivity as well as specificity of the present invention.

Example -2
Muck samples/corrosion deposits (CDs) were obtained from the field product transporting pipeline during pigging operation. The CDs were boiled with sterile water at 700C for 10 minutes and dried to a constant weight at 105OC. The dry corrosion product was then grinded in liquid nitrogen in mortal pestle to achieve fine powder. Isolation of DNA from powdered CDs carried out by suitably modifying the methods given by Tsai and Olson (1991)-direct lysis and Volussiouk et. al.( 1995)-lysis after extracting microbes. The purity and quantification of DNA samples was done spectrophotometrically. qPCR was performed on iCycler iQ5 thermocycler (Bio–Rad, USA) for quantitation of SPB, using primer having SEQ ID No.25 (IOC_ICA_F1) and SEQ ID No. 27 (IOC_ICA_R1). For quantification, each 20 µL qPCR reaction contained 10 µl 2X QuantiTect SYBR Green PCR mixture, 600 nM forward primer having SEQ ID No.25 (IOC_ICA_F1) and 600 nM reverse primer having SEQ ID No. 27 (IOC_ICA_R1), one µL of template, and 1.8 µL water. The cycling conditions consisted of 10 minutes of incubation at 95° C followed by 25 cycles of 95°C for 20 sec, 58°C for 30 sec, and 72°C for 30 sec for denaturing, annealing and elongation, respectively, followed by 70°C for 30 sec, and 70°C to 99°C to generate melting curves. Slime producing Bacillus sp. and E.coli was taken as positive and negative control. To quantify the bacteria, each targeted gene was PCR amplified from respective bacteria having closer phylogenetic relationship and then cloned into the pGEM-T Easy Vector (Promega, USA). Plasmids from the proper insert clones of the each target gene were extracted and serially diluted to make calibration curve for quantitation. Triplicates for standard and unknown template were performed on a single plate.
The corrosion deposit was also subjected for conventional microbiological analysis using media known in prior art for the same. Table 4 provides cell count of various microbes in field sample through conventional microbiological method as well the method of present invention.

Table 3: Count of SPB in field sample (Muck samples/corrosion deposits) through conventional microbiological method as well method of the present invention
Count ( cells/ g muck)
Conventional Microbiological analysis Present invention
SPB 8.9 X 106 8.0 X 107

Result indicated that the method disclosed in the present invention could successfully identify and quantify the SPB in the field samples. The higher count in the real time PCR assay in comparison to conventional microbiological assay is mainly because of the amplification of non-cultivable bacteria. This proves the high sensitivity as well as specificity of the present invention.

We added different concentrations of the SPB in another field sample (Muck samples/corrosion deposits) and it was analyzed by microbiological and real time PCR method disclosed in present invention using primer set having SEQ ID Nos. 25 and 27 (primers IOC_ICA_F2 and IOC_ICA_R2). Table-5 shows the count of SPB from the said field sample (Muck samples/corrosion deposits) after spiking with SPB through conventional microbiological method as well and method disclosed in present invention.

Table-5: Count of SPB in another field sample (Muck samples/corrosion deposits) after amending it with known concentration of bacteria through microbiological method and method disclosed in present invention

Table 5:
Count ( cells/ g muck)
Microbiological analysis Present invention
Nil Nil
120 121
350 346
1000 1005
7.8 X 102 7.9 X 102
9.6 X 105 9.0 X 105
9.1 X 108 9.1 X 108

The same sample was when spiked with other bacteria than SPB and subjected for detection and quantification using SPB related primer disclosed in the present invention, no amplification was observed. The Table-5 clearly indicates that method disclosed in present invention can detect the SPB accurately and specifically.

Example 3:

Muck samples/corrosion deposits (CDs) were obtained from the crude oil transporting pipeline during pigging operation . The CDs were boiled with sterile water at 70°C for 10 minutes and dried to a constant weight at 105°C. The dry corrosion product was then grinded in liquid nitrogen in mortal pestle to achieve fine powder. qPCR was performed on iCycler iQ5 thermocycler (Bio–Rad, USA). For quantification of the total bacteria, each 20 µL qPCR reaction contained Probe mix mixture, 500 nM forward primers having SEQ ID Nos. 26, 31, 36 and 41 (IOC_DSR_F2, IOC_ NIR_F2, IOC_MRB_F2 and IOC_ ICA_F2) and 500 nM reverse primers having SEQ ID Nos. 28, 33, 38 and 43 ( IOC_DSR_R2, IOC_ NIR_R2, IOC_MRB_R2, IOC_ ICA_R2), probes having SEQ ID No.29 (IOC_DSR_Probe(5-3)-AGTTCTACAACACCGCTTTCCTGCGC Probe reporter HEX) and having SEQ ID No.34 [Quencher BHQ-1; IOC_NIR_Probe(5-3) ATGCGACCCACCGTTATTTTCTGACA Probe reporter FAM and Quencher BHQ1]; having SEQ ID No. 39 [IOC_MRB_Probe(5-3)ACACTGGGACTGAGACACGGC Probe Reporter Texas Red] and having SEQ ID No. 44 [Quencher BHQ-2; IOC_ICA_R2Probe(5-3)- ATGCGCTGCTCTCGACGATCTACAAAG Probe reporter Cy5 and Quencher BHQ-2] two µL of template, and 1.8 µL water. The cycling conditions consisted of 10 minutes of incubation at 95°C followed by 25 cycles of 95°C for 20 sec, 50°C for 30 sec, and 72°C for 30 sec for denaturing, annealing and elongation, respectively, followed by 70°C for 30 sec, and 70°C to 99°C to generate melting curves.

The corrosion deposit was also subjected for conventional microbiological analysis using media known in prior art for the same. Table-6 provides count of various microbes in field sample through conventional microbiological method and method disclosed in present invention.

Table 6: Count of various microbes in muck
Count ( cells/ g muck)
Conventional Microbiological analysis Present invention
SRB 3.5 X 102 6.3 X 103
SPB 6.8 X 106 8.5 X 08
MRB 1.4 X 105 8.7 X 08
NRB 5.2 X 103 5.7 X 105

Result indicated that the method disclosed in the present invention could successfully quantify the SRB, NRB, SPB, MRB in the field samples in one assay. The higher count in the real time PCR assay in comparison to conventional microbiological assay is mainly because of the amplification of non-cultivable bacteria. This proves the specificity and sensitivity of the present invention.

We added different concentrations of the SPB, SRB, MRB, NRB in different combination in another field sample (Muck samples/corrosion deposits) and it was analyzed by conventional microbiological and real time PCR method disclosed in present invention using respective primer set disclosed in present inventions. Result indicated that method could detect and quantify them in all possible combination in single assay. This further proves the sensitivity and specificity of the present invention.

Examples- 4: Detection and quantification of microbes with biocidal treatment

In the laboratory test we studied in situ effectiveness of one commercial biocide composition at different concentration for MIC protection in dynamic wheel test. At 70 ppm significant reduction in microbial count was recorded after 800hrs and the system seems to be sterile but at 70 ppm significant corrosion (8.3 mpy) also occurred. This was leading to a conclusion that the problem was not because of microbes. The corrosion loss was found to be 2 mpy at biocide dosing of 130 ppm.

To understand the phenomenon, the DNA was isolated from the sample and subjected to qPCR using primers from present invention. The qPCR results were different to the microbial analysis results showed that microbial count reduction only occurs at 120 ppm. In contrary to microbial analysis result very less inhibition was noticed at 70 ppm biocide dosing in qPCR analysis. This result illustrates that at 70 ppm biocide dosing there was several microbial species which was unaffected by biocides and was contributing in corrosion process. However, at 130 ppm all cultivable or non-cultivable microbes were killed. Based on the finding, it was found appropriate to recommend biocide at 130 ppm dosing rate for effectiveness against the MIC. Hence, the primers and method can be successfully used to find out the effectiveness of the biocide treatment and devising appropriate dose of biocide.

Example-5: Comparison of primers from present invention and prior arts

Three muck samples from pigging operation in hydrocarbon product transportation pipelines were collected and subjected for microbiological analysis. The samples were subjected to real PCR based on the method and conditions defined in the prior art i.e., Zhu et al 2006, Upreti M.K et al. 2010 and then compared with the present invention. In case of Upreti M.K et al. 2010, Petrotech, the conditions were replicated in real time assay. Table-7 provides microbial count of the different field muck samples using different methods disclosed in prior art along with microbial count using present invention.

The Table -7 shows when the primers of the present invention were used for carrying out PCR as discloses by the method of Zhu et al. 2005, SRB could not be detected in field muck sample. However, the SRB were detected by the conventional microbiological analysis as well as by the method of the present invention. Likewise the bacteria MRB and SPB could not be detected using the method of Zhu et al. 2005.

Further when the primers of the present invention were used with the method as disclosed by Upreti et al. 2010 there was also no detection of SRB, SPB, MRB (Table-7). This indicates that the Upreti et al 2010 method is not suitable for quantifying the bacteria using real time PCR.

Table 7: Microbial count of the field muck sample using different methods disclosed in prior art along with microbial count using present invention.

Count ( cells/ g muck)
Microbiological analysis Zhu et al 2005 Upreti M.K et al. 2010, Petrotech Present invention
SRB 1.5 X 102 Not detected Not detected 8.2 X 103
SPB 6.7 X 106 N.A* Not detected 9.5 X 08
MRB 7.4 X 105 N.A* Not detected 8.7 X 08
NRB 6.3 X 103 Not detected N.A* 5.7 X 105
NA*- The prior arts did not identify or study the said bacteria

The result clearly indicate that the method disclosed in Zhu et al.2005 and Upreti et al. 2010 is not suitable for detection and quantifying the MIC related bacteria considering they are less sensitive. Hence the method of present invention is high specific and accurate.
,CLAIMS:We Claim:

1. A group of PCR primers having SEQ ID Nos. 25-44 for detection and quantification of microorganisms causing biofouling and corrosion in pipelines of hydrocarbon industry.

2. The PCR primers as claimed in claim 1, wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), exopolymers or slime producing bacteria (SPB) and nitrite reducing bacteria (NRB).

3. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 25-28 detect and quantify sulfate-reducing bacteria (SRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 25 or portion thereof and SEQ ID No. 26 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 27 or portion thereof and SEQ ID No. 28 or portion thereof.

4. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 40-43 detect and quantify exopolymers or slime producing bacteria (SPB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 40 or portion thereof and SEQ ID No. 41 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 42 or portion thereof and SEQ ID No. 43 or portion thereof.

5. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 30-33 detect and quantify nitrite reducing bacteria (NRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 30 or portion thereof and SEQ ID No. 31 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 32 or portion thereof and SEQ ID No. 33 or portion thereof.

6. The PCR primers as claimed in claim 1, wherein the primers having SEQ ID Nos. 35-38 detect and quantify metal oxidizing bacteria (MRB), wherein the first primer is an primer selected from the group consisting of SEQ ID No: 35 or portion thereof and SEQ ID No. 36 or portion thereof and the second primer is an primer selected from the group consisting of SEQ ID No: 37 or portion thereof and SEQ ID No. 38 or portion thereof.

7. The PCR primers as claimed in claim 1, wherein the said primers enable detection and identification of microorganisms having low gene copy number in a single PCR reaction.

8. The PCR primers as claimed in claim 1, wherein copy number of gene in a single PCT reaction is as low as 9-12 copies of gene per reaction.

9. A method of detecting and quantifying microorganisms causing biofouling and corrosion of engineering pipelines of hydrocarbon industry, said method comprising the steps of:
(a) extracting microbial DNA from a muck or corrosion deposits or water sample;
(b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and
(c) detecting and quantifying the amplification product.

10. The method as claimed in claim 9, wherein the microbes are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), exopolymers or slime producing bacteria (SPB) and nitrite reducing bacteria.

11. The method as claimed in claim 9, wherein the method enables identification and quantification of microorganisms carrying low copy number of gene/s in s single reaction.

12. The method as claimed in claims 9-11, wherein the copy number of gene/s obtained by PCR primers in a single PCR reaction is as low as 9-12 copies of a gene per reaction

13. A method for identification and quantification of microorganism causing biofouling and corrosion in pipelines of hydrocarbon industry having low copy number genes in a single PCR reaction, said method comprising the steps of:

(a) extracting microbial DNA from a muck or corrosion deposits or water sample;
(b) amplifying the extracted DNA, the amplifying step comprising hybridizing an aliquot of the DNA to primers as claimed in any one of claims 1-6, wherein the primers are complementary to one or more nucleotide sequences specific amplifying a segment of DNA defined by the hybridized amplification primers by extending the hybridized amplification primers on the segment of nucleic acid to produce an amplification product; and
(c) detecting and quantifying the amplification product.

14. The method as claimed in claim 13, wherein the microorganisms are selected comprises of sulfate-reducing bacteria (SRB), metal-oxidizing/reducing depositing bacteria (MRB), bacterial secreting organic acids (APB), exopolymers or slime producing bacteria (SPB) and nitrate producing bacteria

15. The method as claimed in claim 13, wherein the copy number of gene in a single PCR reaction is as low as 9-12 copies of gene per reaction.

Documents

Application Documents

# Name Date
1 2071-MUM-2013-FORM 1(18-12-2013).pdf 2013-12-18
2 2071-MUM-2013-CORRESPONDENCE(18-12-2013).pdf 2013-12-18
3 PROVISIONAL SPECIFICATION.pdf 2018-08-11
4 OnlinePostDating.pdf 2018-08-11
5 GPA.pdf 2018-08-11
6 Form-2(Online).pdf 2018-08-11
7 form 5.pdf 2018-08-11
8 form 3.pdf 2018-08-11
9 COMPLETE SPECIFICATION.pdf 2018-08-11
10 2071-MUM-2013-FER.pdf 2018-08-11
11 2071-MUM-2013-Correspondence-241214.pdf 2018-08-11
12 1348IN176, Figures, 20141218.pdf 2018-08-11
13 2071-MUM-2013-SEQUENCE LISTING [16-08-2018(online)].txt 2018-08-16
14 2071-MUM-2013-OTHERS [16-08-2018(online)].pdf 2018-08-16
15 2071-MUM-2013-FER_SER_REPLY [16-08-2018(online)].pdf 2018-08-16
16 2071-MUM-2013-COMPLETE SPECIFICATION [16-08-2018(online)].pdf 2018-08-16
17 2071-MUM-2013-CLAIMS [16-08-2018(online)].pdf 2018-08-16
18 2071-MUM-2013-FORM-26 [15-07-2019(online)].pdf 2019-07-15
19 2071-MUM-2013-HearingNoticeLetter17-07-2019.pdf 2019-07-17
20 2071-MUM-2013-ExtendedHearingNoticeLetter_17-07-2019.pdf 2019-07-17
21 2071-MUM-2013-Written submissions and relevant documents (MANDATORY) [26-07-2019(online)].pdf 2019-07-26
22 2071-MUM-2013-MARKED COPIES OF AMENDEMENTS [26-07-2019(online)].pdf 2019-07-26
23 2071-MUM-2013-FORM 13 [26-07-2019(online)].pdf 2019-07-26
24 2071-MUM-2013-AMMENDED DOCUMENTS [26-07-2019(online)].pdf 2019-07-26
25 2071-MUM-2013-Response to office action (Mandatory) [30-07-2019(online)].pdf 2019-07-30
26 2071-MUM-2013-PatentCertificate19-08-2019.pdf 2019-08-19
27 2071-MUM-2013-IntimationOfGrant19-08-2019.pdf 2019-08-19
28 2071-MUM-2013-ORIGINAL UR 6(1A) FORM 26-260719.pdf 2019-12-18
29 2071-MUM-2013-RELEVANT DOCUMENTS [16-03-2020(online)].pdf 2020-03-16
30 2071-MUM-2013-RELEVANT DOCUMENTS [06-10-2021(online)].pdf 2021-10-06
31 2071-MUM-2013-RELEVANT DOCUMENTS [16-09-2022(online)].pdf 2022-09-16
32 2071-MUM-2013-FORM 4 [29-12-2023(online)].pdf 2023-12-29

Search Strategy

1 2071_09-05-2018.pdf

ERegister / Renewals

3rd: 24 Oct 2019

From 18/12/2015 - To 18/12/2016

4th: 24 Oct 2019

From 18/12/2016 - To 18/12/2017

5th: 24 Oct 2019

From 18/12/2017 - To 18/12/2018

6th: 24 Oct 2019

From 18/12/2018 - To 18/12/2019

7th: 24 Oct 2019

From 18/12/2019 - To 18/12/2020

8th: 01 Dec 2020

From 18/12/2020 - To 18/12/2021

9th: 25 Nov 2021

From 18/12/2021 - To 18/12/2022

10th: 30 Nov 2022

From 18/12/2022 - To 18/12/2023

11th: 29 Dec 2023

From 18/12/2023 - To 18/12/2024

12th: 25 Nov 2024

From 18/12/2024 - To 18/12/2025

13th: 18 Dec 2025

From 18/12/2025 - To 18/12/2026