Sign In to Follow Application
View All Documents & Correspondence

Regulatable Promoter

Abstract: A method of producing a protein of interest (POI) by culturing a recombinant eukaryotic cell line comprising an expression construct comprising a regulatable promoter and a nucleic acid molecule encoding a POI under the transcriptional control of said promoter comprising the steps a) cultivating the cell line with a basal carbon source repressing the promoter b) cultivating the cell line with a limited amount of a supplemental carbon source de repressing the promoter to induce production of the POI at a transcription rate of at least 15% as compared to the native pGAP promoter and c) producing and recovering the POI; and further an isolated regulatable promoter and a respective expression system.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
23 April 2014
Publication Number
21/2015
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2022-12-19
Renewal Date

Applicants

LONZA LTD
Lonzastraße CH 3930 Visp

Inventors

1. MATTANOVICH Diethard
Ignazgasse 7/3 A 1120 Vienna
2. GASSER Brigitte
Zentagasse 34/16 A 1050 Vienna
3. MAURER Michael
Rabengasse 11A/405 A 1030 Vienna
4. PRIELHOFER Roland
Brigittenauer Lände 156/6/1 A 1200 Vienna
5. KLEIN Joachim
Terbinerstraße 5b CH 3930 Visp
6. WENGER Jana
Märtmattenstraße 1a CH 3930 Visp

Specification

The invention refers to regulatable promoters and a method of producing a
protein of interest in a eukaryotic cell culture under the control of a regulatable
promoter.
Background
Successful production of recombinant proteins has been accomplished with
eukaryotic hosts. The most prominent examples are yeasts like Saccharomyces
cerevisiae, Pichia pastoris or Hansenula polymorpha, filamentous fungi like Aspergillus
awamori or Trichoderma reesei. or mammalian cells like e.g. CHO cells. While the
production of some proteins is readily achieved at high rates, many other proteins are
only obtained at comparatively low levels.
The heterologous expression of a gene in a host organism usually requires a
vector allowing stable transformation of the host organism. A vector would provide the
gene with a functional promoter adjacent to the 5' end of the coding sequence. The
transcription is thereby regulated and initiated by this promoter sequence. Most
promoters used up to date have been derived from genes that code for proteins that
are usually present at high concentrations in the cell.
EP01 03409A2 discloses the use of yeast promoters associated with expression
of specific enzymes in the glycolytic pathway, i.e. promoters involved in expression of
pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, phosphorglycerate
mutase, hexokinase 1 and 2, glucokinase, phosphofructose kinase, aldolase
and glycolytic regulation gene.
WO 97/44470 describes yeast promoters from Yarrowia lipolytica for the
translation elongation factor 1 (TEF1 ) protein and for the ribosomal protein S7 that are
suitable for heterologous expression of proteins in yeast, and EP1 951 877A1 describes
the use of the P. pastoris TEF1 promoter for the production of heterologous proteins.
WO200500331 0 provides methods for the expression of a coding sequence of
interest in yeast using a promoter of the glyceraldehyde-3-phosphate dehydrogenase
or phosphoglycerate mutase from oleaginous yeast Yarrowia lipolytica.
Promoter sequences derived from genes involved in the methanol metabolic
pathway of Pichia pastoris are disclosed in US4808537 and US4855231 (alcohol
oxidase AOX1 , AOX2) and US6730499B1 (formaldehyde dehydrogenase FLD1 ) .
US200801 531 26A1 includes mutant promoter sequences based on the AOX1
promoter.
The AOX1 promoter is induced only in response to methanol and repressed by
other carbon sources, such as glucose or ethanol. Methanol has the disadvantage that
it is unsuitable for use in the production of certain products, since it is potentially
hazardous for its toxicity and flammability. Therefore, alternatives to the AOX1
promoter are sought.
US200829961 6A1 introduces the regulatory sequences of the malate synthase
(MLS1 ) gene for heterologous gene expression in P. pastoris, which is repressed in
media containing glucose and derepressed under glucose starvation conditions or
when acetate is present. However, this system is not considered suitable for efficient
production methods, since the MLS1 promoter is weak with low activity under derepressed
conditions.
Scholer and Schuller (Mol. Cell Biol. 1994 14(6):361 3-22) describe the control
region of the isocitrate lyase gene ICL1 , which is derepressed after transfer of cells
from fermentative to non-fermentative growth conditions.
WO2008063302A2 describes the use of novel inducible promoters derived from
ADH1 (alcohol dehydrogenase), EN01 (enolase) and GUT1 genes of P. pastoris for
the expression of heterologous proteins, CN1 966688A the P. pastoris omega 3- fatty
acid dehydrogenase promoter sequence, and WO0020071 17062A1 the P. pastoris
derived auto-inducible NPS promoter, which is induced by phosphor limitation.
WO20081 28701 A2 describes the use of novel promoters, of which the promoter
derived from the THI3 (thiamine metabolism) gene of P. pastoris is repressed in
medium containing thiamine, and derepressed upon thiamine depletion.
US2009325241 A 1 describes a method of ethanol production in a yeast cell
employing a xylose-inducible promoter (FAS2 promoter).
It is desirable to provide improved recombinant eukaryotic cell lines to produce
fermentation products that can be isolated with high yields. Therefore, it is the object of
the present invention to provide for alternative regulatory elements suitable for
recombinant production methods, which are simple and efficient.
Summary of the Invention
The object is solved by the subject matter as claimed.
According to the invention there is provided a method of producing a protein of
interest (POI) by culturing a recombinant eukaryotic cell line comprising an expression
construct comprising a regulatable promoter and a nucleic acid molecule encoding a
POI under the transcriptional control of said promoter, comprising the steps
a) cultivating the cell line with a basal carbon source repressing the promoter,
b) cultivating the cell line with no or a limited amount of a supplemental carbon
source de-repressing the promoter to induce production of the POI at a transcription
rate of at least 5% as compared to the native pGAP promoter of the cell, and
c) producing and recovering the POI.
Said cultivating steps specifically comprise cultivating the cell line in the
presence of said carbon sources, thus, in a culture medium comprising said carbon
sources, or in step b) also in the absence of a supplemental carbon source.
Said induction of POI production specifically refers to induction of transcription,
specifically including further translation and optional expression of said POI.
Said transcription rate specifically refers to the amount of transcripts obtained
upon fully inducing said promoter. Said promoter is considered as de-repressed and
fully induced, if the culture conditions provide for about maximum induction, e.g. at
glucose concentrations of less than 0.4 g/L, preferably less than 0.04 g/L, specifically
less than 0.02 g/L. The fully induced promoter preferably shows a transcription rate of
at least 5%, preferably at least 20%, more preferred at least 30%, 40%, 50%, 60%,
70%, 80%, 90% and at least 100% or even higher transcription rate of at least 150% or
at least 200% as compared to the native pGAP promoter. The transcription rate may,
for example, be determined by the amount of transcripts of a reporter gene, such as
eGFP, such as described in the Example section below, which shows the relatively
high transcription rate of pG1 promoter of at least 50% as compared to the native
pGAP promoter, upon cultivating a clone in solution. Alternatively, the transcription rate
may be determined by the transcription strength on a microarray, where microarray
data show the difference of expression level between repressed and de-repressed
state and a high signal intensity in the fully induced state as compared to the native
pGAP promoter. Such microarray data specifically show a transcription rate of more
than 200% for pG1 , more than 30% for pG3 and pG4, more than 60% for pG6, more
than 30% for pG7, more than 20% for pG8, each value as compared to the native
pGAP. Prior art promoter MLS1 or ICL1 were found to be too weak and thus not
suitable for the purpose of the invention.
Said native pGAP promoter specifically is active in said recombinant eukaryotic
cell in a similar way as in a native eukaryotic cell of the same species or strain,
including the unmodified (non-recombinant) or recombinant eukaryotic cell. Such
native pGAP promoter is commonly understood to be an endogenous promoter, thus,
homologous to the eukaryotic cell, and serves as a standard or reference promoter for
comparison purposes.
For example, a native pGAP promoter of P. pastoris is the unmodified,
endogenous promoter sequence in P. pastoris, as used to control the expression of
GAPDH in P. pastoris, e.g. having the sequence shown in Figure 13 : native pGAP
promoter sequence of P. pastoris (GS1 15) (SEQ D 13). If P. pastoris is used as a host
for producing a POI according to the invention, the transcription strength or rate of the
promoter according to the invention is compared to such native pGAP promoter of P.
pastoris.
As another example, a native pGAP promoter of S. cerevisiae is the unmodified,
endogenous promoter sequence in S. cerevisiae, as used to control the expression of
GAPDH in S. cerevisiae. If S. cerevisiae is used as a host for producing a POI
according to the invention, the transcription strength or rate of the promoter according
to the invention is compared to such native pGAP promoter of S. cerevisiae.
Therefore, the relative transcription strength or rate of a promoter according to
the invention is usually compared to the native pGAP promoter of a cell of the same
species or strain that is used as a host for producing a POI.
According to a specific embodiment the basal carbon source is different from
the supplemental carbon source, e.g. quantitatively and/or qualitatively different. The
quantitative difference may provide for the different conditions to repress or de-repress
the promoter activity.
According to a further specific embodiment the basal and the supplemental
carbon sources comprise the same type of molecules or carbohydrates, preferably in
different concentrations. According to a further specific embodiment the carbon source
is a mixture of two or more different carbon sources.
Any type of organic carbon suitable used for eukaryotic cell culture may be
used. According to a specific embodiment the carbon source is a hexose such as
glucose, fructose, galactose or mannose, a disaccharide, such as saccharose, an
alcohol, such as glycerol or ethanol, or a mixture thereof.
According to a specifically preferred embodiment, the basal carbon source is
selected from the group consisting of glucose, glycerol, ethanol, or mixtures therof, and
complex nutrient material. According to a preferred embodiment, the basal carbon
source is glycerol.
According to a further specific embodiment, the supplemental carbon source is
a hexose such as glucose, fructose, galactose and mannose, a disaccharide, such as
saccharose, an alcohol, such as glycerol or ethanol, or a mixture thereof. According to
a preferred embodiment, the supplemental carbon source is glucose.
Specifically, the method may employ glycerol as the basal carbon source and
glucose as the supplemental carbon source.
The de-repressed conditions suitably may be achieved by specific means. Step
b) optionally employs a feed medium that provides for no or the supplemental carbon
source in a limited amount.
Specifically, the feed medium is chemically defined and methanol-free.
The feed medium may be added to the culture medium in the liquid form or else
in an alternative form, such as a solid, e.g. as a tablet or other sustained release
means, or a gas, e.g. carbon dioxide. Yet according to a preferred embodiment the
limited amount of the supplemental carbon source added to the cell culture medium,
may even be zero. Preferably, the concentration of the supplemental carbon source in
the culture medium is 0-1 g/L, preferably less than 0.6 g/L, more preferred less than
0.3 g/L, more preferred less than 0.1 g/L, preferably 1-50 mg/L, more preferred 1- 10
mg/L, specifically preferred 1 mg/L or even below, such as below the detection limit as
measured with a suitable standard assay, e.g. determined as a residual concentration
in the culture medium upon consumption by the growing cell culture.
In a preferred method, the limited amount of the supplemental source provides
for a residual amount in the cell culture which is below the detection limit as deter
mined in the fermentation broth at the end of a production phase or in the output of a
fermentation process, preferably upon harvesting the fermentation product.
Preferably, the limited amount of the supplemental carbon source is growth
limiting to keep the specific growth rate within the range of 0.02 h to 0.2 h ,
preferably 0.02 h to 0.1 5 h .
According to a specific aspect of the invention, the promoter is a Pichia pastoris
promoter or a functionally active variant thereof.
Herein the promoter according to the invention shall always refer to the
sequences described herein, and functionally active variants thereof. As explained in
detail below, such variants include homologs and analogs derived from species other
than Pichia pastoris.
The method according to the invention may employ a promoter which is a wildtype
promoter of P. pastoris or a functionally active variant thereof, e.g. capable of
controlling the transcription of a specific gene in a wild-type or recombinant eukaryotic
cell, e.g. a wild-type promoter for selected genes, which gene is selected from the
group consisting of G 1 (SEQ ID 7), such as coding for a (high affinity) glucose
transporter, G3 (SEQ D 8) G4 (SEQ ID 9), such as coding for a mitochondrial
aldehyde dehydrogenase, G6 (SEQ D 10), G7 (SEQ ID 11) , such as coding for a
member of the major facilitator sugar transporter family, or G8 (SEQ ID 12), such as
coding for a member of the Gti1_Pac2 superfamily, or a functionally active variant
thereof.
According to the invention there is specifically provided a promoter or a
functionally active variant thereof, which would be natively associated with one of such
genes in a wild-type yeast cell.
According to a specific embodiment, the cell line is selected from the group
consisting of mammalian, insect, yeast, filamentous fungi and plant cell lines,
preferably a yeast.
Specifically the yeast is selected from the group consisting of Pichia, Candida,
Torulopsis, Arxula, Hensenula, Yarrowia, Kluyveromyces, Saccharomyces,
Komagataella, preferably a methylotrophic yeast.
A specifically preferred yeast is Pichia pastoris, Komagataella pastoris, K.
phaffii, or K. pseudopastoris.
According to a further specific embodiment, the promoter is not natively
associated with the nucleotide sequence encoding the POL
Specifically, the POI is a eukaryotic protein, preferably a mammalian protein.
A POI produced according to the invention may be a multimeric protein,
preferably a dimer or tetramer.
According to one aspect of the invention, the POI is a recombinant or hetero
logous protein, preferably selected from therapeutic proteins, including antibodies or
fragments thereof, enzymes and peptides, protein antibiotics, toxin fusion proteins,
carbohydrate - protein conjugates, structural proteins, regulatory proteins, vaccines
and vaccine like proteins or particles, process enzymes, growth factors, hormones and
cytokines, or a metabolite of a POL
A specific POI is an antigen binding molecule such as an antibody, or a
fragment thereof. Among specific POIs are antibodies such as monoclonal antibodies
(mAbs), immunoglobulin (Ig) or immunoglobulin class G (IgG), heavy-chain antibodies
(HcAb's), or fragments thereof such as fragment-antigen binding (Fab), Fd, singlechain
variable fragment (scFv), or engineered variants thereof such as for example Fv
dimers (diabodies), Fv trimers (triabodies), Fv tetramers, or minibodies and singledomain
antibodies like VH or VHH or V-NAR.
According to a specific embodiment, a fermentation product is manufactured
using the POI, a metabolite or a derivative thereof.
According to another aspect of the invention, there is provided a method for
controlling the expression of a POI in a recombinant eukaryotic cell under the
transcriptional control of a carbon source regulatable promoter having a transcription
strength of at least 15% as compared to the native pGAP promoter of the cell, wherein
the expression is induced under conditions limiting the carbon source. The carbon
source regulatable promoter preferably has a transcription strength of at least 20% as
compared to the reference pGAP promoter, and specifically a transcription strength as
described above with respect to the transcription rate as compared to the native pGAP
promoter. Therefore, the fully induced promoter preferably has a transcription strength
of at least 5%, preferably at least 20%, more preferred at least 30%, 40%, 50%, 60%,
70%, 80%, 90% and at least 100% or an even higher transcription strength of at least
150% or at least 200% as compared to the native pGAP promoter of the cell, as
determined in the eukaryotic cell selected for producing the POI.
In a preferred embodiment such promoter is used that has a transcriptional
activity or transcription strength in the de-repressed state, which is at least 2 fold, more
preferably at least 5 fold, even more preferred at least 10 fold, more preferred at least
20 fold, more preferably at least 30, 40, 50, or 100 fold in the de-repressed state
compared to the repressed state.
According to another aspect of the invention, there is provided a method of
producing a POI in a recombinant eukaryotic cell under the transcriptional control of a
carbon source regulatable promoter, wherein said promoter has a transcription
strength as described above, i.e. at least 15% as compared to the native pGAP pro
moter of the cell. The carbon source regulatable promoter preferably has a
transcription strength of at least 20% as compared to the reference pGAP promoter,
more preferred at least 30%, 40%, 50%, 60%, 70%, 80%, 90% and at least 100% or
an even higher transcription strength of at least 150% or at least 200% as compared to
the native pGAP promoter of the cell. In a preferred embodiment such promoter is
used that has a transcriptional activity in the de-repressed state which is at least which
is at least 2 fold, more preferably at least 5 fold, even more preferred at least 10 fold,
more preferred at least 20 fold, more preferably at least 30, 40, 50, or 100 fold in the
de-repressed state compared to the repressed state. Suitably a specific promoter
according to the invention is used in such a method.
In a specifically preferred method according to the invention, the promoter is a
the regulatable promoter comprising a nucleic acid sequence selected from the group
consisting of
a) pG1 (SEQ ID 1) , pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7
(SEQ D 5), or pG8 (SEQ ID 6);
b) a sequence having at least 60% homology to pG1 (SEQ ID 1) , pG3 (SEQ ID
2), pG4 (SEQ D 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ ID 6);
c) a sequence which hybridizes under stringent conditions to pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ D
6); and
d) a fragment or variant derived from a), b) or c),
wherein said promoter is a functionally active promoter, which is a carbon
source regulatable promoter capable of expressing a POI in a recombinant eukaryotic
cell at a transcription rate of at least 15% as compared to the native pGAP promoter of
the cell.
Specifically the variant of pG1 (SEQ ID 1) , pG3 (SEQ ID 2), pG4 (SEQ ID 4),
pG6 (SEQ ID 3), pG7 (SEQ ID 5) or pG8 (SEQ ID 6) is a functionally active variant
selected from the group consisting of homologs with at least about 60% nucleotide
sequence identity, homologs obtainable by modifying the parent nucleotide sequence
by insertion, deletion or substitution of one or more nucleotides within the sequence or
at either or both of the distal ends of the sequence, preferably with a nucleotide
sequence of at least 200 bp, preferably at least 250 bp, preferably at least 300 bp,
more preferred at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at
least 800 bp, at least 900 bp, or at least 1000 bp, and analogs derived from species
other than Pichia pastoris.
Some of the preferred functionally active variants of the promoter according to
the invention are fragments of any of the pG1 , pG3, pG4, pG6, pG7 or pG8 promoter
nucleotide sequences, preferably fragments including the 3' end of a promoter
nucleotide sequence, e.g. a nucleotide sequence derived from one of the promoter
nucleotide sequences which has of a specific length and a deletion of the 5' terminal
region, e.g. a cut-off of the nucleotide sequence at the 5' end, so to obtain a specific
length with a range from the 3' end to a varying 5' end, such as with a length of the
nucleotide sequence of at least 200 bp, preferably at least 250 bp, preferably at least
300 bp, more preferred at least 400 bp, at least 500 bp, at least 600 bp, at least 700
bp, at least 800 bp, at least 900 bp, or at least 000 bp.
Examplary variants have proven to be functionally active comprising or
consisting of such fragments, e.g. fragments with a specific length within the range of
200 to 1000 bp, preferably within the range of 250 to 000 bp, more preferably within
the range of 300 to 1000 bp, e.g. including the 3' terminal sequence. For example, a
functionally active variant of pG1 is selected from the group consisting of pG1 a (SEQ
D 4 1) , pG1 b (SEQ ID 42), pG1 c (SEQ ID 43), pG1d (SEQ ID 44), pG1 e (SEQ ID 45)
and pG1 f (SEQ ID 46), thus, a nucleotide sequence within the range of 300-1 000 bp,
including the 3' terminal sequence up to nucleotide 1001 .
According to another aspect of the invention, there is provided an isolated
nucleic acid comprising a nucleic acid sequence selected from the group consisting of
a) pG1 (SEQ ID 1) , pG3 (SEQ ID 2), pG6 (SEQ ID 3), pG7 (SEQ ID 5) or pG8
(SEQ D 6),
b) a sequence having at least 60% homology to pG1 (SEQ ID 1) , pG3 (SEQ ID
2), pG6 (SEQ ID 3), pG7 (SEQ ID 5) or pG8 (SEQ D 6),
c) a sequence which hybridizes under stringent conditions to pG1 (SEQ ID 1) ,
pG3 (SEQ D 2), pG6 (SEQ ID 3) pG7 (SEQ ID 5) or pG8 (SEQ ID 6), and
d) a fragment or variant derived from a), b) or c),
wherein said nucleic acid comprises a functionally active promoter, which is a
carbon source regulatable promoter capable of expressing a POI in a recombinant
eukaryotic cell at a transcription rate of at least 15% as compared to the native pGAP
promoter of the cell.
Specifically the variant of pG1 (SEQ D 1) , pG3 (SEQ ID 2), pG6 (SEQ ID 3),
pG7 (SEQ D 5) or pG8 (SEQ ID 6) is a functionally active variant selected from the
group consisting of homologs with at least about 60% nucleotide sequence identity,
homologs obtainable by modifying the parent nucleotide sequence by insertion,
deletion or substitution of one or more nucleotides within the sequence or at either or
both of the distal ends of the sequence, preferably with a nucleotide sequence of at
least 200 bp, preferably at least 250 bp, preferably at least 300 bp, more preferred at
least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least
900 bp, or at least 1000 bp, and analogs derived from species other than Pichia
pastoris.
Some of the preferred functionally active variants of the promoter according to
the invention are fragments of any of the pG1 , pG3, pG6, pG7 or pG8 promoter
nucleotide sequences, preferably fragments including the 3' end of a promoter
nucleotide sequence, e.g. a nucleotide sequence derived from one of the promoter
nucleotide sequences which has of a specific length and a deletion of the 5' terminal
region, e.g. a cut-off of the nucleotide sequence at the 5' end, so to obtain a specific
length with a range from the 3' end to a varying 5' end, such as with a length of the
nucleotide sequence of at least 200 bp, preferably at least 250 bp, preferably at least
300 bp, more preferred at least 400 bp, at least 500 bp, at least 600 bp, at least 700
bp, at least 800 bp, at least 900 bp, or at least 1000 bp.
Examplary variants have proven to be functionally active comprising or
consisting of such fragments, e.g. fragments with a specific length within the range of
200 to 1000 bp, preferably within the range of 250 to 1000 bp, more preferably within
the range of 300 to 000 bp, e.g. including the 3' terminal sequence. For example, a
functionally active variant of pG1 is selected from the group consisting of pG1 a (SEQ
ID 4 1) , pG1 b (SEQ ID 42), pG1 c (SEQ D 43), pG1d (SEQ ID 44), pG1 e (SEQ ID 45)
and pG1 f (SEQ D 46), thus, a nucleotide sequence within the range of 300-1 000 bp,
including the 3' terminal sequence up to nucleotide 1001 .
The carbon source regulatable promoter preferably has a transcription strength
as described above, preferably at least 20% as compared to the reference pGAP
promoter, more preferred at least 30%, 40%, 50%, 60%, 70%, 80%, 90% and at least
100% or an even higher transcription strength of at least 150% or at least 200% as
compared to the native pGAP promoter. In a preferred embodiment such promoter is
used that has a transcriptional activity in the de-repressed state which is at least which
is a t least 2 fold, more preferably at least 5 fold, even more preferred at least 10 fold,
more preferred at least 20 fold, more preferably at least 30, 40, 50, or 100 fold in the
de-repressed state compared to the repressed state. Suitably a specific promoter
according to the invention is used in such a method.
Yet, according to a further aspect of the invention, there is provided an ex
pression construct comprising a promoter according to the invention, operably linked to
a nucleotide sequence encoding a POI under the transcriptional control of said pro
moter, which promoter is not natively associated with the coding sequence of the POI.
A further aspect of the invention refers to a vector comprising the construct
according to the invention.
A further aspect of the invention refers to a recombinant eukaryotic cell
comprising the construct or the vector according to the invention.
Specifically the cell is selected from the group consisting of mammalian, insect,
yeast, filamentous fungi and plant cell lines, preferably a yeast.
The yeast may suitably be selected from the group consisting of Pichia,
Candida, Torulopsis, Arxula, Hensenula, Yarrowia, Kluyveromyces, Saccharomyces,
Komagataella, preferably a methylotrophic yeast.
Preferably, the yeast is Pichia pastoris, Komagataella pastoris, K. phaffii, or K.
pseudopastoris.
According to a specific embodiment a cell is employed, which has a higher
specific growth rate in the presence of a surplus of carbon source relative to conditions
of limited carbon source.
A further aspect of the invention refers to the use of the recombinant eukaryotic
cell of the invention for the production of the POI.
According to a further aspect of the invention, there is provided a method to
screen or identify a carbon source regulatable promoter from eukaryotic cells,
comprising the steps of
a) cultivating eukaryotic cells in the presence of a carbon source in a batch
culture under cell growing conditions,
b) further cultivating the cells in a fed batch culture in the presence of a limited
amount of a supplemental carbon source,
c) providing samples of the cell culture of step a) and b), and
) performing transcription analysis in said samples to identify a regulatable
promoter that shows a higher transcriptional strength in cells of step b) than in cells of
step a).
Said higher transcriptional strength may be determined by the transcription
strength in the fully induced state, which is e.g. obtained under conditions of glucoselimited
chemostat cultivations, which is at least which is at least 2 fold, more preferably
at least 5 fold, even more preferred at least 10 fold, more preferred at least 20 fold,
more preferably at least 30, 40, 50, or 100 fold in the de-repressed state compared to
the repressed state.
Preferably the transcription analysis is quantitive or semi-quantitative, preferably
employing DNA microarrays, RNA sequencing and transcriptome analysis.
Figures
Figure 1: promoter sequence pG1 (SEQ ID 1) of P. pastoris.
Figure 2 : promoter sequence pG3 (SEQ ID 2) of P. pastoris.
Figure 3 : promoter sequence pG4 (SEQ ID 4) of P. pastoris.
Figure 4 : promoter sequence pG6 (SEQ ID 3) of P. pastoris.
Figure 5 : promoter sequence pG7 (SEQ ID 5) of P. pastoris.
Figure 6 : promoter sequence pG8 (SEQ D 6) of P. pastoris.
Figure 7 : coding sequences of gene of GS1 15 genome G 1 (SEQ ID 7) of P.
pastoris.
Figure 8 : coding sequences of gene of GS1 15 genome G3 (SEQ ID 8) of P.
pastoris.
Figure 9 : coding sequences of gene of GS1 15 genome G4 (SEQ ID 9) of P.
pastoris.
Figure 10 : coding sequences of gene of GS1 15 genome G6 (SEQ ID 10) of P.
pastoris.
Figure 11: coding sequences of gene of GS1 15 genome G7 (SEQ D 11) of P.
pastoris.
Figure 12 : coding sequences of gene of GS1 15 genome G8 (SEQ ID 12) of P.
pastoris.
Figure 13 : native pGAP promoter sequence of P. pastoris (GS1 15) (SEQ ID 13)
# Name PAS* PIPA* GS1 15 description
Glyceraldehyde-3-phosphate
pGAP TDH3 PAS_chr2-1_0437 PIPA0251 0 dehydrogenase
* PAS: ORF name in P. pastoris GS1 15 ; PIPA: ORF name in P. pastoris type
strain DSMZ70382
Figure 14 : De-repression properties of the pG1 (circle), pG3 (triangle), pG4
(diamond) and pG6 (square) promoter: the maximum transcription activity is reached
for pG1 at around 0.04 g glucose/L or less, whereas all other pG promoters reach it
already at around 4 g/L or less. In order to compare the relative induction behaviors of
the different promoters, the data were normalized by dividing each value by the D20
value of the respective promoter construct. Therefore the data are relative
fluorescence values, and the data points at D20 are 1.0.
Figure 15 : functionally active variants of the promoter sequence pG1 ; pG1 a - f
(SEQ ID 4 1 - 46) of P. pastoris.
Detailed description of the invention
Specific terms as used throughout the specification have the following meaning.
The term "carbon source " as used herein shall mean a fermentable carbon
substrate, typically a source carbohydrate, suitable as an energy source for micro
organisms, such as those capable of being metabolized by host organisms or production
cell lines, in particular sources selected from the group consisting of mono
saccharides, oligosaccharides, polysaccharides, alcohols including glycerol, in the
purified form or provided in raw materials, such as a complex nutrient material. The
carbon source may be used according to the invention as a single carbon source or as
a mixture of different carbon sources.
A "basal carbon source" such as used according to the invention typically is a
carbon source suitable for cell growth, such as a nutrient for eukaryotic cells. The
basal carbon source may be provided in a medium, such as a basal medium or
complex medium, but also in a chemically defined medium containg a purified carbon
source. The basal carbon source typically is provided in an amount to provide for cell
growth, in particular during the growth phase in a cultivation process, for example to
obtain cell densities of at least 5 g/L cell dry mass, preferably at least 10 g/L cell dry
mass, or at least 15 g/L cell dry mass, e.g. exhibiting viabilities of more than 90%
during standard sub-culture steps, preferably more than 95%.
According to the invention the basal carbon source is typically used in an
excess or surplus amount, which is understood as an excess providing energy to
increase the biomass, e.g. during the growth phase of a cell line in a fed-batch
cultivation process. This surplus amount is particularly in excess of the limited amount
of a supplemental carbon source to achieve a residual concentration in the
fermentation broth that is measurable and typically at least 10 fold higher, preferably at
least 50 fold or at least 100 fold higher than during feeding the limited amount of the
supplemental carbon source.
The term "chemically defined" with respect to cell culture medium, such as a
feed medium in a fed-batch process, shall mean a growth medium suitable for the in
vitro cell culture of a production cell line, in which all of the chemical components and
peptides are known. Typically a chemically defined medium is entirely free of animalderived
components and represents a pure and consistent cell culture environment.
A "supplemental carbon source" such as used according to the invention
typically is a supplemental substrate facilitating the production of fermentation products
by production cell lines, in particular in the production phase of a cultivation process.
The production phase specifically follows a growth phase, e.g. in batch, fed-batch and
continuous cultivation process. The supplemental carbon source specifically may be
contained in the feed of a fed-batch process.
A "limited amount " of a carbon source or a "limited carbon source" is herein
understood as the amount of a carbon source necessary to keep a production cell line
in a production phase or production mode. Such a limited amount may be employed in
a fed-batch process, where the carbon source is contained in a feed medium and
supplied to the culture at low feed rates for sustained energy delivery to produce a
POI, while keeping the biomass at low growth rates. A feed medium is typically added
to a fermentation broth during the production phase of a cell culture.
The limited amount of the supplemental carbon source may, for example, be
determined by the residual amount of the supplemental carbon source in the cell
culture broth, which is below a predetermined threshold or even below the detection
limit as measured in a standard (carbohydrate) assay. The residual amount typically
would be determined in the fermentation broth upon harvesting a fermentation product.
The limited amount of a supplemental carbon source may as well be determined
by defining the average feed rate of the supplemental carbon source to the fermenter,
e.g. as determined by the amount added over the full cultivation process, e.g. the fed
batch phase, per cultivation time, to determine a calculated average amount per time.
This average feed rate is kept low to ensure complete usage of the supplemental
carbon source by the cell culture, e.g. between 0.6 g L h 1 (g carbon source per L
initial fermentation volume and h time) and 25 g L h , preferably between between
1.6 g L h and 20 g L h .
The limited amount of a supplemental carbon source may also be determined
by measuring the specific growth rate before and during the production process, which
specific growth rate is kept low during the production phase, e.g. within a predeter
mined range, such as in the range of 0.02 h to 0.20 h , preferably between 0.02 h 1
and 0.1 5 h .
The term "cell line" as used herein refers to an established clone of a particular
cell type that has acquired the ability to proliferate over a prolonged period of time. The
term "host cell line" refers to a cell line as used for expressing an endogenous or
recombinant gene or products of a metabolic pathway to produce polypeptides or cell
metabolites mediated by such polypeptides. A "production host cell line" or "production
cell line" is commonly understood to be a cell line ready-to-use for cultivation in a
bioreactor to obtain the product of a production process, such as a POL The term
"eukaryotic host" or "eukaryotic cell line" shall mean any eukaryotic cell or organism,
which may be cultivated to produce a POI or a host cell metabolite. It is well
understood that the term does not include human beings.
The term "expression" or "expression system" or "expression cassette" refers to
nucleic acid molecules containing a desired coding sequence and control sequences in
operable linkage, so that hosts transformed or transfected with these sequences are
capable of producing the encoded proteins or host cell metabolites. In order to effect
transformation, the expression system may be included in a vector; however, the re
levant DNA may also be integrated into the host chromosome. Expression may refer to
secreted or non-secreted expression products, including polypeptides or metabolites.
"Expression constructs" or "vectors" used herein are defined as DNA sequences
that are required for the transcription of cloned recombinant nucleotide sequences, i.e.
of recombinant genes and the translation of their mRNA in a suitable host organism.
Expression vectors usually comprise an origin for autonomous replication in the host
cells, selectable markers (e.g. an amino acid synthesis gene or a gene conferring
resistance to antibiotics such as zeocin, kanamycin, G41 8 or hygromycin), a number of
restriction enzyme cleavage sites, a suitable promoter sequence and a transcription
terminator, which components are operably linked together. The terms "plasmid" and
"vector" as used herein include autonomously replicating nucleotide sequences as well
as genome integrating nucleotide sequences.
The term "variant" as used herein in the context of the present invention shall
refer to any sequence with a specific homology or analogy. The variant promoter may
e.g. be derived from the promoter sequence pG1 (SEQ ID 1) , pG3 (SEQ ID 2) pG4
(SEQ D 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5) or pG8 (SEQ ID 6) by mutagenesis to
produce sequences suitable for use as a promoter in recombinant cell lines. Such
variant promoter may be obtained from a library of mutant sequences by selecting
those library members with predetermined properties. Variant promoters may have the
same or even improved properties, e.g. improved in inducing POI production, with
increased differential effect under repressing and de-repressing conditions. The variant
promoter may also be derived from analogous sequences, e.g. from eukaryotic
species other than Pichia pastoris or from a genus other than Pichia, such as from K.
lactis, Z. rouxii, P. stipitis, H. polymorpha. Specifically, the analogous promoter
sequences natively associated with genes analogous to the corresponding P. pastoris
genes may be used as such or as parent sequences to produce functionally active
variants thereof. Specifically,
- a promoter analogous to pG1 is characterised that it is natively associated with
a gene analogous to G 1 (high affinity glucose transporter; P. pastoris GS1 15
description: Putative transporter, member of the sugar porter family; coding sequence
SEQ ID 7);
- a promoter analogous to pG3 is characterised that it is natively associated with
a gene analogous to G3 (coding sequence SEQ ID 8);
- a promoter analogous to pG4 is characterised that it is natively associated with
a gene analogous to G4 (P. pastoris GS1 15 : predicted mitochondrial aldehyde
dehydrogenase; coding sequence SEQ ID 9);
- a promoter analogous to pG6 is characterised that it is natively associated with
a gene analogous to G6 (coding sequence SEQ ID 10);
- a promoter analogous to pG7 is characterised that it is natively associated with
a gene analogous to G7 (P. pastoris GS1 15 : member of the major facilitator sugar
transporter family; coding sequence SEQ D 11) ;
- a promoter analogous to pG8 is characterised that it is natively associated with
a gene analogous to G8 (P. pastoris GS1 15 : member of the Gti1_Pac2 superfamily;
coding sequence SEQ ID 12).
The properties of such analogous promoter sequences or functionally active
variants thereof may be determined using standard techniques.
The "functionally active" variant of a nucleotide or promoter sequence as used
herein means a sequence resulting from modification of a parent sequence by
insertion, deletion or substitution of one or more nucleotides within the sequence or at
either or both of the distal ends of the sequence, and which modification does not
affect (in particular impair) the activity of this sequence.
Specifically, the functionally active variant of the promoter sequence according
to the invention is selected from the group consisting of
- homologs with at least about 60% nucleotide sequence identity,
- homologs obtainable by modifying the parent nucleotide sequence by
insertion, deletion or substitution of one or more nucleotides within the sequence or at
either or both of the distal ends of the sequence, preferably with (i.e. comprising or
consisting of) a nucleotide sequence of at least 200 bp, preferably at least 300 bp,
more preferred at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at
least 800 bp, at least 900 bp, or at least 1000 bp, and
- analogs derived from species other than Pichia pastoris.
Specifically preferred functionally active variants are those derived from a
promoter according to the invention by modification and/or fragments of the promoter
sequence, with (i.e. comprising or consisting of) a nucleotide sequence of at least
200 bp, preferably at least 250 bp, preferably at least 300 bp, more preferred at least
400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least
900 bp, or at least 1000 bp.
Some of the preferred functionally active variants of the promoter according to
the invention are fragments of any of the pG1 , pG3. pG4, pG6, pG7 or pG8 promoter
nucleotide sequences, preferably fragments including the 3' end of a promoter
nucleotide sequence, e.g. a nucleotide sequence derived from one of the promoter
nucleotide sequences which has of a specific length and a deletion of the 5' terminal
region, e.g. a cut-off of the nucleotide sequence at the 5' end, so to obtain a specific
length with a range from the 3' end to a varying 5' end, such as with a length of the
nucleotide sequence of at least 200 bp, preferably at least 250 bp, preferably at least
300 bp. more preferred at least 400 bp, at least 500 bp, at least 600 bp, at least
700 bp, at least 800 bp, at least 900 bp, or at least 1000 bp.
Examplary variants have proven to be functionally active comprising or
consisting of such fragments, e.g. fragments with a specific length within the range of
200 to 1000 bp, preferably within the range of 250 to 1000 bp, more preferably within
the range of 300 to 1000 bp, e.g. including the 3' terminal sequence. For example, a
functionally active variant of pG1 is selected from the group consisting of pG1 a (SEQ
ID 4 1) , pG1 b (SEQ ID 42), pG1 c (SEQ ID 43), pG1d (SEQ ID 44), pG1 e (SEQ ID 45)
and pG1 f (SEQ ID 46), thus, a nucleotide sequence within the range of 300-1 000 bp,
including the 3' terminal sequence up to nucleotide 1001 .
The term "regulatable" with respect to a promoter as used herein shall refer to a
promoter that is repressed in a eukaryotic cell in the presence of an excess amount of
a carbon source (nutrient substrate) in the growth phase of a batch culture, and derepressed
to exert strong promoter activity in the production phase of a production cell
line, e.g. upon reduction of the amount of carbon, such as upon feeding of a growth
limiting carbon source (nutrient substrate) to a culture according to the fed-batch
strategy. In this regard, the term "regulatable" is understood as "carbon source-limit
regulatable" or "glucose-limit regulatable", referring to the de-repression of a promoter
by carbon consumption, reduction, shortcoming or depletion, or by limited addition of
the carbon source so that it is readily consumed by the cells.
The functionally active promoter according to the invention is a relatively strong
regulatable promoter that is silenced or repressed under cell growth conditions (growth
phase), and activated or de-repressed under production condition (production phase),
and therefore suitable for inducing POI production in a production cell line by limitating
the carbon source. Therefore, the functionally active variant of a promoter has at least
such regulatable properties.
The strength of the regulatable promoter according to the invention refers to its
transcription strength, represented by the efficiency of initiation of transcription
occurring at that promoter with high or low frequency. The higher transcription strength
the more frequently transcription will occur at that promoter. Promoter strength is
important because it determines how often a given mRNA sequence is transcribed,
effectively giving higher priority for transcription to some genes over others, leading to
a higher concentration of the transcript. A gene that codes for a protein that is required
in large quantities, for example, typically has a relatively strong promoter. The RNA
polymerase can only perform one transcription task at a time and so must prioritize its
work to be efficient. Differences in promoter strength are selected to allow for this
prioritization. According to the invention the regulatable promoter is relatively strong in
the fully induced state, which is typically understood as the state of about maximal
activity. The relative strength is commonly determined with respect to a standard
promoter, such as the respective pGAP promoter of the cell as used as the host cell.
The frequency of transcription is commonly understood as the transcription rate, e.g.
as determined by the amount of a transcript in a suitable assay, e.g. RT-PCR or
Northern blotting. For example, the transcription strength of a promoter according to
the invention is determined in the host cell which is P. pastoris and compared to the
native pGAP promoter of P. pastoris.
The pGAP promoter initiates expression of the gap gene encoding
glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a constitutive
promoter present in any microorganism capable of growing on glucose. GAPDH (EC
1\2\1\1 2), a key enzyme of glycolysis, plays a crucial role in catabolic and anabolic
carbohydrate metabolism.
The regulatable promoter according to the invention exerts a relatively high
transcription strength, reflected by a transcription rate or transcription strength of at
least 15% as compared to the native pGAP promoter in the host cell, sometimes called
"homologous pGAP promoter". Preferably the transcription rate or strength is at least
20%, in specifically preferred cases at least 30%, at least 40%, at least 50%, at least
60%, at least 70%, at least 80%, at least 90% and at least 100% or even higher, such
as at least 150% or at least 200% as compared to the native pGAP promoter, e.g.
determined in the eukaryotic cell selected as host cell for producing the POL
Specifically preferred is a regulatable promoter, which has in the induced state
at least a transcription strength of one of the pG1 , pG3, PG4, pG6, pG7 or pG8
promoter. The comparative transcription strength employing the pGAP promoter as a
reference may be determined by standard means, such as by measuring the quantity
of transcripts, e.g. employing a microarray, or else in a cell culture, such as by
measuring the quantity of respective gene expression products in recombinant cells.
An exemplary test is illustrated in the Examples section.
Specifically the promoter according to the invention is carbon source regulatable
with a differential promoter strength as determined in a test comparing its strength in
the presence of glucose and glucose limitation, showing that it is still repressed at
relatively high glucose concentrations, preferably at concentrations of at least 10 g/L,
preferably at least 20 g/L. Specifically the promoter according to the invention is fully
induced at limited glucose concentrations and glucose threshold concentrations fully
inducing the promoter, which threshold is less than 20 g/L, preferably less than 10 g/L,
less than 1 g/L, even less than 0,1 g/L or less than 50 mg/L, preferably with a full
transcription strength of e.g. at least 50% of the native, homologous pGAP promoter,
at glucose concentrations of less than 40 mg/L.
Preferably the differential promoter strength is determined by the initiation of
POI production upon switching to inducing conditions below a predetermined carbon
source threshold, and compared to the strength in the repressed state. The trans
cription strength commonly is understood as the strength in the fully induced state, i.e.
showing about maximum activities under de-repressing conditions. The differential
promoter strength is, e.g. determined according to the efficiency or yield of POI pro
duction in a recombinant host cell line under de-repressing conditions as compared to
repressing conditions, or else by the amount of a transcript. The regulatable promoter
according to the invention has a preferred differential promoter strength, which is at
least 2 fold, more preferably at least 5 fold, even more preferred at least 10 fold, more
preferred at least 20 fold, more preferably at least 30, 40, 50, or 100 fold in the derepressed
state compared to the repressed state, also understood as fold induction.
Such differential promoter strength may be determined by a test as illustrated by the
enclosed Examples.
Prior art promoter (MLS1 promoter or ICL1 promoter) turned out to have a
differential promoter strength of significantly less than the 2 fold induction. Such prior
art promoter was also not useful for industrial POI production, with a promoter strength
of around 5% as compared to the pGAP promoter standard. This has been proven in a
direct comparison with the promoter according to the invention.
The term "homology" indicates that two or more nucleotide sequences have the
same or conserved base pairs at a corresponding position, to a certain degree, up to a
degree close to 100%. A homologous sequence typically has at least about 50%
nucleotide sequence identity, preferably at least about 60% identity, more preferably at
least about 70% identity, more preferably at least about 80% identity, more preferably
at least about 90% identity, more preferably at least about 95% identity.
The homologous promoter sequence according to the invention preferably has a
certain homology to any of the pG1 , pG3, pG4, pG6, pG7 or pG8 promoter nucleotide
sequences of P. pastoris in at least specific parts of the nucleotide sequence, such as
including the 3' region of the respective promoter nucleotide sequence, preferably a
part with a specific length up to the 3' end of the respective promoter nucleotide
sequence, such as a part with a length of at least 200 bp, preferably at least 250 bp,
preferably at least 300 bp, more preferred at least 400 bp, at least 500 bp, at least
600 bp, at least 700 bp, at least 800 bp, at least 900 bp, or at least 000 bp, and
analogs derived from species other than Pichia pastoris. Specifically at least those
parts are preferably homologous within the range of 300-1 000 bp, including the 3'
terminal sequence of the respective promoter nucleotide sequence.
Analogous sequences are typically derived from other species or strains. It is
expressly understood that any of the analogous promoter sequences of the present
invention that are derived from species other than Pichia pastoris may comprise a
homologous sequence, i.e. a sequence with a certain homology as described herein.
Thus, the term "homologous" may also include analogous sequences. On the other
hand, it is understood that the invention also refers to analogous sequences and
homologs thereof that comprise a certain homology.
"Percent (%) identity" with respect to the nucleotide sequence of a gene is
defined as the percentage of nucleotides in a candidate DNA sequence that is identical
with the nucleotides in the DNA sequence, after aligning the sequence and introducing
gaps, if necessary, to achieve the maximum percent sequence identity, and not
considering any conservative substitutions as part of the sequence identity. Alignment
for purposes of determining percent nucleotide sequence identity can be achieved in
various ways that are within the skill in the art, for instance, using publicly available
computer software. Those skilled in the art can determine appropriate parameters for
measuring alignment, including any algorithms needed to achieve maximal alignment
over the full length of the sequences being compared.
The term "mutagenesis" as used in the context of the present invention shall
refer to a method of providing mutants of a nucleotide sequence, e.g. through
insertion, deletion and/or substitution of one or more nucleotides, so to obtain variants
thereof with at least one change in the non-coding or coding region. Mutagenesis may
be through random, semi-random or site directed mutation. Typically large randomized
gene libraries are produced with a high gene diversity, which may be selected
according to a specifically desired genotype or phenotype.
The term "protein of interest (POI)" as used herein refers to a polypeptide or a
protein that is produced by means of recombinant technology in a host cell. More
specifically, the protein may either be a polypeptide not naturally occurring in the host
cell, i.e. a heterologous protein, or else may be native to the host cell, i.e. a
homologous protein to the host cell, but is produced, for example, by transformation
with a self replicating vector containing the nucleic acid sequence encoding the POI, or
upon integration by recombinant techniques of one or more copies of the nucleic acid
sequence encoding the POI into the genome of the host cell, or by recombinant
modification of one or more regulatory sequences controlling the expression of the
gene encoding the POI, e.g. of the promoter sequence. In some cases the term POI as
used herein also refers to any metabolite product by the host cell as mediated by the
recombinantly expressed protein.
The term "recombinant" as used herein shall mean "being prepared by or the
result of genetic engineering". Thus, a "recombinant microorganism" comprises at least
one "recombinant nucleic acid". A recombinant microorganism specifically comprises
an expression vector or cloning vector, or it has been genetically engineered to contain
a recombinant nucleic acid sequence. A "recombinant protein" is produced by
expressing a respective recombinant nucleic acid in a host. A "recombinant promoter"
is a genetically engineered non-coding nucleotide sequence suitable for its use as a
functionally active promoter as described herein.
It surprisingly turned out that eukaryotic cells are capable of inducing the
production of a POI by limiting the availability of the carbon source. Carbon starvation
conditions were found to trigger induction of strong promoter activity, which was
heretofore unknown in the art. The MLS1 promoter of Pichia pastoris as described in
US200829961 6A1 to be derepressed under sugar limitations, was actually a
comparably weak regulatable promoter for POI production. It was therefore surprising
that such strong regulatable promoter of P. pastoris could be identified and could be
used in eukaryotic production cell lines, in particular for recombinant POI production.
Though the 9.43 Mbp genomic sequence of the GS1 15 strain of P. pastoris has
been determined and disclosed in US201 10021 378A1 , the properties of individual
sequences, such as promoter sequences, have not been investigated in detail. For
instance, the pG4 sequence (SEQ ID 4) as described herein was identified as a
promoter sequence in US201 10021 378A1 , however, its regulatable properties or its
use under carbon starvation conditions were not known. It was even surprising that
such promoter could be effectively used in the method according to the invention.
Regulated promoters of the prior art such as used in industrial scale POI production
were mainly derived from the methanol metabolic pathway and needed the addition of
methanol to induce POI production, which is often not desired. The method according
to the invention has the advantage that it may provide for an increased production by
an enhanced expression, and has the reduced risk of contamination due to the specific
promoter regulation, in particular when using a chemically defined medium, free of
methanol.
It turned out that the regulatable promoter according to the invention would
excert their regulatable activity only upon use of very specific culture media suitable for
establishing promoter repressing and de-repressing conditions. As an example, P.
pastoris could be successfully cultivated under conditions of an industrial production
process. First a batch culture on a basal carbon source, such as glycerol, was
employed, followed by a fed batch with limited feed of a supplemental carbon source,
such as glucose. Samples were taken close to the end of the first batch phase, and in
limited growth conditions, e.g. using a limited amount of supplemental carbon source.
Transcriptome analysis with DNA micoarrays revealed specific genes that are strongly
active on the supplemental carbon source and weak or inactive in the presence of
surplus carbon, i.e. the basal carbon source in excess amount. At least six promoter
sequences were identified as regulatable promoter according to the invention, i.e. pG1
(SEQ ID 1) , pG3 (SEQ D 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5) and
pG8 (SEQ ID 6). The comparable MLS1 or ICL1 promoter of the prior art was only
weak, with less than 1/1 0 of the strength of the pG1 promoter, and no detectable
regulation.
The features of repressing recombinant gene expression on the basal carbon
source, and strong expression on limited supplemental carbon source, i.e. induction by
substrate change could be verified in fermentation processes.
The nucleotide sequences that could be used as regulatory sequences
according to the invention, which would provide for an improved recombinant protein
production, can be obtained from a variety of sources. The origin of the promoter
according to the invention is preferably from a yeast cell, most preferably from
methylotrophic yeast such as from the Pichia genus or from the P. pastoris species,
which promoter may then be used as a parent sequence to produce suitable variants,
e.g. mutants or analogs.
It is contemplated that a series of yeast cells, in particular of Pichia strains, may
be suitable to obtain respective promoter sequences that are responsible for protein
production under carbon starving conditions, or respective analogs in different species.
Variants of the identified P. pastoris promoter, including functionally active
variants, such as homologs and analogs may be produced employing standard
techniques. The promoter may e.g. be modified to generate promoter variants with
altered expression levels and regulatory properties.
For instance, a promoter library may be prepared by mutagenesis of the
promoter sequences according to the invention, which may be used as parent
molecules, e.g. to fine-tune the gene expression in eukayotic cells by analysing
variants for their expression under different fermentation strategies and selecting
suitable variants. A synthetic library of variants may be used, e.g. to select a promoter
matching the requirements for producing a selected POL Such variants may have
increased expression efficiency in eukaryotic host cells and high expression upon
depletion of a carbon source.
The differential fermentation strategies would distinguish between a growth
phase, such as step a) according to the present invention, and a production phase,
such as step b).
Growth and/or production can suitably take place in batch mode, fed-batch
mode or continuous mode. Any suitable bioreactor can be used, including batch, fedbatch,
continuous, stirred tank reactor, or airlift reactor.
It is advantageous to provide for the fermentation process on a pilot or industrial
scale. The industrial process scale would preferably employ volumina of at least 10 L,
specifically at least 50 L, preferably at least 1 m3, preferably at least 10 m3, most
preferably at least 100 m3.
Production conditions in industrial scale are preferred, which refer to e.g. fed
batch cultivation in reactor volumes of 100 L to 10 m3 or larger, employing typical
process times of several days, or continuous processes in fermenter volumes of appr.
50 - 1000 L or larger, with dilution rates of approximately 0.02 - 0.1 5 h .
The suitable cultivation techniques may encompass cultivation in a bioreactor
starting with a batch phase, followed by a short exponential fed batch phase at high
specific growth rate, further followed by a fed batch phase at a low specific growth rate.
Another suitable cultivation technique may encompass a batch phase followed by a
continuous cultivation phase at a low dilution rate.
A preferred embodiment of the invention includes a batch culture to provide
biomass followed by a fed-batch culture for high yields POI production.
For example, the cell line may be grown in step a) according to the invention on
glycerol or glucose to obtain biomass.
It is preferred to cultivate the host cell line according to the invention in a
bioreactor under growth conditions to obtain a cell density of at least 1 g/L cell dry
weight, more preferably at least 0 g/L cell dry weight, preferably at least 20 g/L cell
dry weight. It is advantageous to provide for such yields of biomass production on a
pilot or industrial scale.
A growth medium allowing the accumulation of biomass, specifically a basal
growth medium, typically comprises a carbon source, a nitrogen source, a source for
sulphur and a source for phosphate. Typically, such a medium comprises furthermore
trace elements and vitamins, and may further comprise amino acids, peptone or yeast
extract.
Preferred nitrogen sources include NH4H2P0 4, or NH3 or (NH4)2S0
Preferred sulphur sources include MgS0 , or (NH4)2S0 or K2S0 ;
Preferred phosphate sources include NH H2P0 or H3P0 or NaH2P0 ,
KH2P0 4, Na2HP0 4 or K2HP0 4 ;
Further typical medium components include KCI, CaCI2, and Trace elements
such as: Fe, Co, Cu, Ni, Zn, Mo, Mn, I , B;
Preferably the medium is supplemented with vitamin B7;
A typical growth medium for P. pastoris comprises glycerol or glucose,
NH4H P0 , MgS0 , KCI, CaCI2, biotin, and trace elements.
In the production phase a production medium is specifically used with only a
limited amount of a supplemental carbon source.
Preferably the host cell line is cultivated in a mineral medium with a suitable
carbon source, thereby further simplifying the isolation process significantly. An
example of a preferred mineral medium is one containing an utilizable carbon source
(e.g. glucose, glycerol or methanol), salts containing the macro elements (potassium,
magnesium, calcium, ammonium, chloride, sulphate, phosphate) and trace elements
(copper, iodide, manganese, molybdate, cobalt, zinc, and iron salts, and boric acid),
and optionally vitamins or amino acids, e.g. to complement auxotrophies.
The cells are cultivated under conditions suitable to effect expression of the
desired POI, which can be purified from the cells or culture medium, depending on the
nature of the expression system and the expressed protein, e.g. whether the protein is
fused to a signal peptide and whether the protein is soluble or membrane-bound. As
will be understood by the skilled artisan, cultivation conditions will vary according to
factors that include the type of host cell and particular expression vector employed.
Induction of the POI production by the promoter according to the invention is
preferably controlled by cultivating the cells on a supplemental carbon source in a
limited amount as the sole source of carbon and energy. The cells grow very slowly
under carbon limited conditions, but produce high yields of the POI under the control of
the regulatable promoter.
The difference in the promoter activity specifically is at least 2 fold, preferably at
least 5 fold, more preferred at least 10 fold, more preferred at least 20 fold, more
preferably at least 30, 40, 50, or 100 fold in the de-repressed state compared to the
repressed state.
By selecting the suitable promoter sequence according to the invention,
optionally in combination with further preferred regulatory sequences, it is possible to
provide for, under comparable conditions, at least the same, or at least about a 1.5-
fold, or at least about 2-fold, or at least about a 5-fold, 10-fold, or at least up to about a
15-fold activity as represented by the promoter activity or transcription strength, or
regulated by the promoter strength relative to a GAP promoter that is homologous to
the production cell, a native pGAP, or isolated from P. pastoris.
A typical production medium comprises the supplemental carbon source, and
further NH4H2PO4, MgSO , KCI, CaCI2, biotin, and trace elements.
For example the feed of the supplemental carbon source added to the fermen
tation may comprise a carbon source with up to 50 wt % fermentable sugars. The low
feed rate of the supplemental medium will limit the effects of product inhibition on the
cell growth, thus a high product yield based on substrate provision will be possible.
The fermentation preferably is carried out at a pH ranging from 3 to 7.5.
Typical fermentation times are about 24 to 120 hours with temperatures in the
range of 20 °C to 35 °C, preferably 22-30 °C.
ln general, the recombinant nucleic acids or organisms as referred to herein
may be produced by recombination techniques well known to a person skilled in the
art. In accordance with the present invention there may be employed conventional
molecular biology, microbiology, and recombinant DNA techniques within the skill of
the art. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch
& Sambrook, "Molecular Cloning: A Laboratory Manual ( 1982).
According to a preferred embodiment of the present invention, a recombinant
construct is obtained by ligating the promoter and relevant genes into a vector. These
genes can be stably integrated into the host cell genome by transforming the host cell
using such vectors.
Expression vectors may include but are not limited to cloning vectors, modified
cloning vectors and specifically designed plasmids. The preferred expression vector as
used in the invention may be any expression vector suitable for expression of a
recombinant gene in a host cell and is selected depending on the host organism. The
recombinant expression vector may be any vector which is capable of replicating in or
integrating into the genome of the host organisms, also called host vector.
In the present invention, it is preferred to use plasmids derived from pPUZZLE
as the vector.
Appropriate expression vectors typically comprise further regulatory sequences
suitable for expressing DNA encoding a POI in a eukaryotic host cell. Examples of
regulatory sequences include operators, enhancers, ribosomal binding sites, and
sequences that control transcription and translation initiation and termination. The
regulatory sequences may be operably linked to the DNA sequence to be expressed.
To allow expression of a recombinant nucleotide sequence in a host cell, the
expression vector may provide the promoter according to the invention adjacent to the
5' end of the coding sequence, e.g. upstream from a signal peptide gene. The
transcription is thereby regulated and initiated by this promoter sequence.
A signal peptide may be a heterologous signal peptide or a hybrid of a native
and a heterologous signal peptide, and may specifically be heterologous or homologous
to the host organism producing the protein. The function of the signal peptide is
to allow the POI to be secreted to enter the endoplasmatic reticulum. It is usually a
short (3-60 amino acids long) peptide chain that directs the transport of a protein
outside the plasma membrane, thereby making it easy to separate and purify the
heterologous protein. Some signal peptides are cleaved from the protein by signal
peptidase after the proteins are transported.
Exemplary signal peptides are signal sequences from S. cerevisiae alphamating
factor prepro peptide and the signal peptide from the P. pastoris acid
phosphatase gene (PH01 ) .
A promoter sequence is understood to be operably linked to a coding sequence,
if the promotor controls the transcription of the coding sequence. If a promoter
sequence is not natively associated with the coding sequence, its transcription is either
not controlled by the promoter in native (wild-type) cells or the sequences are
recombined with different contiguous sequences.
To prove the function of the relevant sequences, expression vectors comprising
one or more of the regulatory elements may be constructed to drive expression of a
POI, and the expressed yield is compared to constructs with conventional regulatory
elements. A detailed description of the experimental procedure can be found in the
examples below. The identified genes may be amplified by PGR from P. pastoris using
specific nucleotide primers, cloned into an expression vector and transformed into a
eukaryotic cell line, e.g. using a yeast vector and a strain of P. pastoris, for high level
production of various different POI. To estimate the effect of the promoter according to
the invention on the amount of recombinant POI so produced, the eukaryotic cell line
may be cultured in shake flask experiments and fedbatch or chemostat fermentations
in comparison with strains comprising a conventional, non carbon source regulatable
promoter, such as for example the standard pGAP promoter in the respective cell. In
particular, the choice of the promoter has a great impact on the recombinant protein
production.
Preferred methods of transformation for the uptake of the recombinant DNA
fragment by the microorganism include chemical transformation, electroporation or
transformation by protoplastation. Transformants according to the present invention
can be obtained by introducing such a vector DNA, e.g. plasmid DNA, into a host and
selecting transformants which express the relevant protein or host cell metabolite with
high yields.
The POI can be produced using the recombinant host cell line by culturing a
transformant, thus obtained in an appropriate medium, isolating the expressed product
or metabolite from the culture, and optionally purifying it by a suitable method.
Transformants according to the present invention can be obtained by intro
ducing such a vector DNA, e.g. plasmid DNA, into a host and selecting transformants
which express the POI or the host cell metabolite with high yields. Host cells are
treated to enable them to incorporate foreign DNA by methods conventionally used for
transformation of eukaryotic cells, such as the electric pulse method, the protoplast
method, the lithium acetate method, and modified methods thereof. P. pastoris is
preferably transformed by electroporation.
The preferred host cell line according to the invention maintains the genetic
properties employed according to the invention, and the production level remains high,
e.g. at least at a mg level, even after about 20 generations of cultivation, preferably at
least 30 generations, more preferably at least 40 generations, most preferred of at
least 50 generations. The stable recombinant host cell is considered a great advantage
when used for industrial scale production.
Several different approaches for the production of the POI according to the
method of the invention are preferred. Substances may be expressed, processed and
optionally secreted by transforming a eukaryotic host cell with an expression vector
harbouring recombinant DNA encoding a relevant protein and at least one of the
regulatory elements as described above, preparing a culture of the transformed cell,
growing the culture, inducing transcription and POI production, and recovering the
product of the fermentation process.
The POI is preferably expressed employing conditions to produce yields of at
least 1 mg/L, preferably at least 10 mg/L, preferably at least 00 mg/L, most preferred
at least 1 g/L.
The host cell according to the invention is preferably tested for its expression
capacity or yield by the following test: ELISA, activity assay, HPLC, or other suitable
tests.
It is understood that the methods disclosed herein may further include culti
vating said recombinant host cells under conditions permitting the expression of the
POI, preferably in the secreted form or else as intracellular product. A recombinantly
produced POI or a host cell metabolite can then be isolated from the cell culture
medium and further purified by techniques well known to a person skilled in the art.
The POI produced according to the invention typically can be isolated and
purified using state of the art techniques, including the increase of the concentration of
the desired POI and/or the decrease of the concentration of at least one impurity.
f the POI is secreted from the cells, it can be isolated and purified from the
culture medium using state of the art techniques. Secretion of the recombinant
expression products from the host cells is generally advantageous for reasons that
include facilitating the purification process, since the products are recovered from the
culture supernatant rather than from the complex mixture of proteins that results when
yeast cells are disrupted to release intracellular proteins.
The cultured transformant cells may also be ruptured sonically or mechanically,
enzymatically or chemically to obtain a cell extract containing the desired POI, from
which the POI is isolated and purified.
As isolation and purification methods for obtaining a recombinant polypeptide or
protein product, methods, such as methods utilizing difference in solubility, such as
salting out and solvent precipitation, methods utilizing difference in molecular weight,
such as ultrafiltration and gel electrophoresis, methods utilizing difference in electric
charge, such as ion-exchange chromatography, methods utilizing specific affinity, such
as affinity chromatography, methods utilizing difference in hydrophobicity, such as
reverse phase high performance liquid chromatography, and methods utilizing
difference in isoelectric point, such as isoelectric focusing may be used.
The highly purified product is essentially free from contaminating proteins, and
preferably has a purity of at least 90%, more preferred at least 95%, or even at least
98%, up to 00%. The purified products may be obtained by purification of the cell
culture supernatant or else from cellular debris.
As isolation and purification methods the following standard methods are
preferred: Cell disruption (if the POI is obtained intracellular^), cell (debris) separation
and wash by Microfiltration or Tangential Flow Filter (TFF) or centrifugation, POI
purification by precipitation or heat treatment, POI activation by enzymatic digest, POI
purification by chromatography, such as ion exchange ( EX), hydrophobic ointeraction
chromatography (HIC), Affinity chromatography, size exclusion (SEC) or HPLC
Chromatography, POI precipitation of concentration and washing by ultrafiltration
steps.
The isolated and purified POI can be identified by conventional methods such
as Western blot, HPLC, activity assay, or ELISA.
The POI can be any eukaryotic, prokaryotic or synthetic polypeptide. It can be a
secreted protein or an intracellular protein. The present invention also provides for the
recombinant production of functional homologs, functional equivalent variants,
derivatives and biologically active fragments of naturally occurring proteins. Functional
homologs are preferably identical with or correspond to and have the functional
characteristics of a sequence.
A POI referred to herein may be a product homologous to the eukaryotic host
cell or heterologous, preferably for therapeutic, prophylactic, diagnostic, analytic or
industrial use.
The POI is preferably a heterologous recombinant polypeptide or protein,
produced in a eukaryotic cell, preferably a yeast cell, preferably as secreted proteins.
Examples of preferably produced proteins are immunoglobulins, immunoglobulin
fragments, aprotinin, tissue factor pathway inhibitor or other protease inhibitors, and
insulin or insulin precursors, insulin analogues, growth hormones, interleukins, tissue
plasminogen activator, transforming growth factor a or b, glucagon, glucagon-like
peptide 1 (GLP-1 ) , glucagon-like peptide 2 (GLP-2), GRPP, Factor VII, Factor VIII,
Factor XIII, platelet-derived growth facto r 1 , serum albumin, enzymes, such as lipases
or proteases, or a functional homolog, functional equivalent variant, derivative and
biologically active fragment with a similar function as the native protein. The POI may
be structurally similar to the native protein and may be derived from the native protein
by addition of one or more amino acids to either or both the C- and N-terminal end or
the side-chain of the native protein, substitution of one or more amino acids at one or a
number of different sites in the native amino acid sequence, deletion of one or more
amino acids at either or both ends of the native protein or at one or several sites in the
amino acid sequence, or insertion of one or more amino acids at one or more sites in
the native amino acid sequence. Such modifications are well known for several of the
proteins mentioned above.
A POI can also be selected from substrates, enzymes, inhibitors or cofactors
that provide for biochemical reactions in the host cell, with the aim to obtain the
product of said biochemical reaction or a cascade of several reactions, e.g. to obtain a
metabolite of the host cell. Examplary products can be vitamins, such as riboflavin,
organic acids, and alcohols, which can be obtained with increased yields following the
expression of a recombinant protein or a POI according to the invention.
In general, the host cell, which expresses a recombinant product, can be any
eukaryotic cell suitable for recombinant expression of a POI.
Examples of preferred mammalian cells are BHK, CHO (CHO-DG44, CHODUXB1
1, CHO-DUKX, CHO-K1 , CHOK1 SV, CHO-S), HeLa, HEK293, MDCK.
NIH3T3, NSO, PER.C6, SP2/0 and VERO cells.
Examples of preferred yeast cells used as host cells according to the invention
include but are not limited to the Saccharomyces genus (e.g. Saccharomyces
cerevisiae), the Pichia genus (e.g. P. pastoris, or P. methanolica), the Komagataella
genus (K. pastoris, K. pseudopastoris or K. phaffii), Hansenula polymorpha or
Kluyveromyces lactis.
Newer literature divides and renames Pichia pastoris into Komagataella
pastoris, Komagataella phaffii and Komagataella pseudopastoris. Herein Pichia
pastoris is used synonymously for all, Komagataella pastoris, Komagataella phaffii and
Komagataella pseudopastoris.
The preferred yeast host cells are derived from methylotrophic yeast, such as
from Pichia or Komagataella, e.g. Pichia pastoris, or Komagataella pastoris, or K.
phaffii, or K. pseudopastoris. Examples of the host include yeasts such as P. pastoris.
Examples of P. pastoris strains include CBS 704 (=NRRL Y-1603 = DSMZ 70382),
CBS 261 2 (=NRRL Y-7556), CBS 7435 (=NRRL Y-1 1430), CBS 9 173-91 89 (CBS
strains: CBS-KNAW Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures,
Utrecht, The Netherlands), and DSMZ 70877 (German Collection of Microorganisms
and Cell Cultures), but also strains from Invitrogen, such as X-33, GS1 15,
KM71 and SMD1 168. Examples of S. cerevisiae strains include W303, CEN.PK and
the BY-series (EUROSCARF collection). All of the strains described above have been
successfully used to produce transformants and express heterologous genes.
A preferred yeast host cell according to the invention, such as a P. pastoris or S.
cerevisiae host cell, contains a heterologous or recombinant promoter sequences,
which may be derived from a P. pastoris or S. cerevisiae strain, different from the pro
duction host. In another specific embodiment the host cell according to the invention
comprises a recombinant expression construct according to the invention comprising
the promoter originating from the same genus, species or strain as the host cell.
The promoter may be a promoter according to the invention or any other DNA
sequence which shows transcriptional activity in the host cell and may be derived from
genes encoding proteins either homologous or heterologous to the host. The promoter
is preferably derived from a gene encoding a protein homologous to the host cell.
For example, a promoter according to the invention may be derived from yeast,
such as a S. cerevisiae strain, and be used to express a POI in a yeast. A specifically
preferred embodiment relates to a promoter according to the invention originating from
P. pastoris for use in a method to produce a recombinant POI in a P. pastoris producer
host cell line. The homologous origin of the nucleotide sequence facilitates its
incorporation into the host cell of the same genus or species, thus enabling stable
production of a POI, possibly with increased yields in industrial manufacturing
processes. Also, functionally active variants of the promoter from other suitable yeasts
or other fungi or from other organisms such as vertebrates or plants can be used.
If the POI is a protein homologous to the host cell, i.e. a protein which is
naturally occurring in the host cell, the expression of the POI in the host cell may be
modulated by the exchange of its native promoter sequence with a promoter sequence
according to the invention.
This purpose may be achieved e.g. by transformation of a host cell with a
recombinant DNA molecule comprising homologous sequences of the target gene to
allow site specific recombination, the promoter sequence and a selective marker
suitable for the host cell. The site specific recombination shall take place in order to
operably link the promoter sequence with the nucleotide sequence encoding the POI.
This results in the expression of the POI from the promoter sequence according to the
invention instead of from the native promoter sequence.
In a specifically preferred embodiment of the invention the promoter sequence
has an increased promoter activity relative to the native promoter sequence of the POI.
According to the invention it is preferred to provide a P. pastoris host cell line
comprising a promoter sequence according to the invention operably linked to the
nucleotide sequence coding for the POI.
According to the invention it is also possible to provide a wildcard vector or host
cell according to the invention, which comprises a promoter according to the invention,
and which is ready to incorporate a gene of interest encoding a POI. The wildcard cell
line is, thus, a preformed host cell line, which is characerized for its expression
capacity. This follows an innovative "wildcard" platform strategy for the generation of
producer cell lines, for the POI production, e.g. using site-specific recombinasemediated
cassette exchange. Such a new host cell facilitates the cloning of a gene of
interest (GOI), e.g. into predetermined genomic expression hot spots within days in
order to get reproducible, highly efficient production cell lines.
According to a preferred embodiment the method according to the invention
employs a recombinant nucleotide sequence encoding the POI, which is provided on a
plasmid suitable for integration into the genome of the host cell, in a single copy or in
multiple copies per cell. The recombinant nucleotide sequence encoding the POI may
also be provided on an autonomously replicating plasmid in a single copy or in multiple
copies per cell.
The preferred method according to the invention employs a plasmid, which is a
eukaryotic expression vector, preferably a yeast expression vector. Expression vectors
may include but are not limited to cloning vectors, modified cloning vectors and
specifically designed plasmids. The preferred expression vector as used in the
invention may be any expression vector suitable for expression of a recombinant gene
in a host cell and is selected depending on the host organism. The recombinant
expression vector may be any vector which is capable of replicating in or integrating
into the genome of the host organisms, also called host vector, such as a yeast vector,
which carries a DNA construct according to the invention. A preferred yeast expression
vector is for expression in yeast selected from the group consisting of methylotrophic
yeasts represented by the genera Hansenula, Pichia. Candida and Torulopsis.
In the present invention, it is preferred to use plasmids derived from pPICZ,
pGAPZ, pPIC9, pPICZalfa, pGAPZalfa, pPIC9K, pGAPHis or pPUZZLE as the vector.
According to a preferred embodiment of the present invention, a recombinant
construct is obtained by ligating the relevant genes into a vector. These genes can be
stably integrated into the host cell genome by transforming the host cell using such
vectors. The polypeptides encoded by the genes can be produced using the recom
binant host cell line by culturing a transformant, thus obtained in an appropriate
medium, isolating the expressed POI from the culture, and purifying it by a method
appropriate for the expressed product, in particular to separate the POI from
contaminating proteins.
Expression vectors may comprise one or more phenotypic selectable markers,
e.g. a gene encoding a protein that confers antibiotic resistance or that supplies an
autotrophic requirement. Yeast vectors commonly contain an origin of replication from
a yeast plasmid, an autonomously replicating sequence (ARS), or alternatively, a
sequence used for integration into the host genome, a promoter region, sequences for
polyadenylation, sequences for transcription termination, and a selectable marker.
The procedures used to ligate the DNA sequences, e.g. coding for the
precursing sequence and/or the POI, the promoter and the terminator, respectively,
and to insert them into suitable vectors containing the information necessary for
integration or host replication, are well known to persons skilled in the art, e.g.
described by J. Sambrook et al., "Molecular Cloning 2nd ed.", Cold Spring Harbor
Laboratory Press ( 1989).
It will be understood that the vector, which uses the regulatory elements
according to the invention and/or the POI as an integration target, may be constructed
either by first preparing a DNA construct containing the entire DNA sequence coding
for the regulatory elements and/or the POI and subsequently inserting this fragment
into a suitable expression vector, or by sequentially inserting DNA fragments
containing genetic information for the individual elements, such as the signal, leader or
heterologous protein, followed by ligation.
Also multicloning vectors, which are vectors having a multicloning site, can be
used according to the invention, wherein a desired heterologous gene can be
incorporated at a multicloning site to provide an expression vector. In expression
vectors, the promoter is placed upstream of the gene of the POI and regulates the
expression of the gene. In the case of multicloning vectors, because the gene of the
POI is introduced at the multicloning site, the promoter is placed upstream of the
multicloning site.
The DNA construct as provided to obtain a recombinant host cell according to
the invention may be prepared synthetically by established standard methods, e.g. the
phosphoramidite method. The DNA construct may also be of genomic or cDNA origin,
for instance obtained by preparing a genomic or cDNA library and screening for DNA
sequences coding for all or part of the polypeptide of the invention by hybridization
using synthetic oligonucleotide probes in accordance with standard techniques
(Sambrook et al., Molecular Cloning: A Laboratorv Manual, Cold Spring Harbor, 1989).
Finally, the DNA construct may be of mixed synthetic and genomic, mixed synthetic
and cDNA or mixed genomic and cDNA origin prepared by annealing fragments of
synthetic, genomic or cDNA origin, as appropriate, the fragments corresponding to
various parts of the entire DNA construct, in accordance with standard techniques.
In another preferred embodiment, the yeast expression vector is able to stably
integrate in the yeast genome, e. g. by homologous recombination.
A iransformani host cell according to the invention obtained by transforming the
cell with the regulatory elements according to the invention and/or the POI genes may
preferably first be cultivated at conditions to grow efficiently to a large cell number with
out the burden of expressing a heterologous protein. When the cell line is prepared for
the POI expression, cultivation techniques are chosen to produce the expression
product.
The subject matter of the following definitions is considered embodiments of the
present invention:
1. A method of producing a protein of interest (POI) by culturing a recombinant
eukaryotic cell line comprising an expression construct comprising a regulatable
promoter and a nucleic acid molecule encoding a POI under the transcriptional control
of said promoter, comprising the steps
a) cultivating the cell line with a basal carbon source repressing the promoter,
b) cultivating the cell line with no or a limited amount of a supplemental carbon
source de-repressing the promoter to induce production of the POI at a transcription
rate of at least 15% as compared to the native pGAP promoter of the cell, and
c) producing and recovering the POI.
2. Method according to definition 1, wherein the basal carbon source is selected
from the group consisting of glucose, glycerol, ethanol and complex nutrient material.
3. Method according to definition 1 or 2, wherein the supplemental carbon
source is a hexose such as glucose, fructose, galactose or mannose, a disaccharide,
such as saccharose, an alcohol, such as glycerol or ethanol, or a mixture thereof.
4 . Method according to any of definitions 1 to 3, wherein the basal carbon
source is glycerol, and the supplemental carbon source is glucose.
5. Method according to any of definitions 1 to 4 , wherein step b) employs a feed
medium that provides for no or the supplemental carbon source in a limited amount,
preferably 0-1 g/L in the culture medium.
6. Method according to definition 5, wherein the feed medium is chemically
defined and methanol-free.
7. Method according to any of defnitions 1 to 6, wherein the limited amount of
the supplemental carbon source is growth limiting to keep the specific growth rate
within the range of 0.02 h to 0.2 h , preferably 0.02 h to 0.1 5 h .
8. Method according to definition 7, wherein the limited amount of the
supplemental source provides for a residual amount in the cell culture which is below
the detection limit.
9. Method according to any of definitions 1 to 8, wherein the promoter is capable
of controlling the transcription of a gene in a wild-type eukaryotic cell, which gene is
selected from the group consisting of G 1 (SEQ D 7), G3 (SEQ ID 8), G4 (SEQ ID 9),
G6 (SEQ D 10), G7 (SEQ D 11) or G8 (SEQ D 12), or a functionally active variant
thereof.
10. Method according to definition 9, wherein said functionally active variants
are selected from the group consisting of homologs with at least about 60% nucleotide
sequence identity, homologs obtainable by modifying the parent nucleotide sequence
by insertion, deletion or substitution of one or more nucleotides within the sequence or
at either or both of the distal ends of the sequence, preferably comprising or consisting
of a nucleotide sequence of at least 200 bp, and analogs derived from species other
than Pichia pastoris.
11. Method according to definition 9 or 10, wherein the functionally active
variant of pG1 is selected from the group consisting of pG1 a (SEQ D 4 1) , pG1 b (SEQ
ID 42), pG1 c (SEQ ID 43), pG1 d (SEQ ID 44), pG1 e (SEQ ID 45) and pG1 f (SEQ ID
46).
12. Method according to any of definitions 1 to 11, wherein the promoter is a
Pichia pastoris promoter or a functionally active variant thereof.
13. Method according to any of definitions 1 to 12, wherein the cell line is
selected from the group consisting of mammalian, insect, yeast, filamentous fungi and
plant cell lines, preferably a yeast.
14. Method according to definition 13, wherein the yeast is selected from the
group consisting of Pichia, Candida, Torulopsis, Arxula, Hensenula, Yarrowia,
Kluyveromyces, Saccharomyces, Komagataella, preferably a methylotrophic yeast.
15. Method according to definition 14 , wherein the yeast is Pichia pastoris,
Komagataella pastoris, K. phaffii, or K. pseudopastoris.
16. Method according to any of definitions 1 to 15, wherein the promoter is not
natively associated with the nucleotide sequence encoding the POL
17. Method according to any of definitions 1 to 16, wherein the POI is a
heterologous protein, preferably selected from therapeutic proteins, including
antibodies or fragments thereof, enzymes and peptides, protein antibiotics, toxin fusion
proteins, carbohydrate - protein conjugates, structural proteins, regulatory proteins,
vaccines and vaccine like proteins or particles, process enzymes, growth factors,
hormones and cytokines, or a metabolite of a POI.
18. Method according to any of definitions 1 to 17, wherein the POI is a
eukaryotic protein, preferably a mammalian protein.
19. Method according to any of definitions 1 to 18, wherein the POI is a
multimeric protein, preferably a dimer or tetramer.
20. Method according to any of definitions 1 to 19, wherein the POI is an antigen
binding molecule such as an antibody, or a fragment thereof.
2 1. Method according to any of definitions 1 to 20, wherein a fermentation
product is manufactured using the POI, a metabolite or a derivative thereof.
22. Method for controlling the expression of a POI in a recombinant eukaryotic
cell under the transcriptional control of a carbon source regulatable promoter having a
transcription strength of at least 15% as compared to the native pGAP promoter of the
cell, wherein the expression is induced under conditions limiting the carbon source.
23. Method of producing a POI in a recombinant eukaryotic cell under the
transcriptional control of a carbon source regulatable promoter, wherein said promoter
has a transcription strength of at least 15% as compared to the native pGAP promoter
of the cell.
24. Method according to any of definitions 1 to 23, wherein the regulatable
promoter comprises a nucleic acid sequence selected from the group consisting of
a) pG1 (SEQ D 1) , pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7
(SEQ ID 5), or pG8 (SEQ ID 6);
b) a sequence having at least 60% homology to pG1 (SEQ ID 1) , pG3 (SEQ ID
2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ D 6);
c) a sequence which hybridizes under stringent conditions to pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ D 3), pG7 (SEQ ID 5), or pG8 (SEQ ID
6); and
d) a fragment or variant derived from a), b) or c),
wherein said promoter is a functionally active promoter, which is a carbon
source regulatable promoter capable of expressing a POI in a recombinant eukaryotic
cell at a transcription rate of at least 15% as compared to the native pGAP promoter of
the cell.
25. Method according to definition 24, wherein the variant of pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ ID
6), is a functionally active variant selected from the group consisting of homologs with
at least about 60% nucleotide sequence identity, homologs obtainable by modifying
the parent nucleotide sequence by insertion, deletion or substitution of one or more
nucleotides within the sequence or at either or both of the distal ends of the sequence,
preferably comprising or consisting of a nucleotide sequence of at least 200 bp, and
analogs derived from species other than Pichia pastoris.
26. Method according to definition 24 or 25, wherein the functionally active
variant of pG1 is selected from the group consisting of pG1 a (SEQ ID 4 1) , pG1 b (SEQ
ID 42), pG1 c (SEQ ID 43), pG1 d (SEQ D 44). pG1 e (SEQ ID 45) and pG1 f (SEQ ID
46).
27. An isolated nucleic acid comprising a nucleic acid sequence selected from
the group consisting of
a) pG1 (SEQ D 1) , pG3 (SEQ ID 2), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8
(SEQ ID 6);
b) a sequence having at least 60% homology to pG1 (SEQ ID 1) , pG3 (SEQ ID
2), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ ID 6);
c) a sequence which hybridizes under stringent conditions to pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ D 6); and
d) a fragment or variant derived from a), b) or c),
wherein said nucleic acid comprises a functionally active promoter, which is a
carbon source regulatable promoter capable of expressing a POI in a recombinant
eukaryotic cell at a transcription rate of at least 15% as compared to the native pGAP
promoter of the cell.
28. Nucleic acid according to definition 27, wherein the variant of pG1 (SEQ ID
1) , pG3 (SEQ ID 2), pG6 (SEQ D 3), pG7 (SEQ ID 5), or pG8 (SEQ ID 6) is a
functionally active variant selected from the group consisting of homologs with at least
about 60% nucleotide sequence identity, homologs obtainable by modifying the parent
nucleotide sequence by insertion, deletion or substitution of one or more nucleotides
within the sequence or at either or both of the distal ends of the sequence, preferably
with a nucleotide sequence of at least 200 bp, and analogs derived from species other
than Pichia pastoris.
29. Nucleic acid according to definition 27 or 28, wherein the functionally active
variant of pG1 is selected from the group consisting of pG1 a (SEQ ID 4 1) , pG1 b (SEQ
ID 42), pG1 c (SEQ ID 43), pG1 d (SEQ D 44), pG1 e (SEQ ID 45) and pG1 f (SEQ ID
46).
30. An expression construct comprising a nucleic acid according to any of the
definitions 27 to 29 operably linked to a nucleotide sequence encoding a POI under the
transcriptional control of said promoter, which nucleic acid is not natively associated
with the nucleotide sequence encoding the POI.
3 1. Vector comprising the construct according to definition 30.
32. A recombinant eukaryotic cell comprising the construct of definition 30, or
the vector of definition 3 1.
33. A cell according to definition 3 1 , which is selected from the group consisting
of mammalian, insect, yeast, filamentous fungi and plant cell lines, preferably a yeast.
34. A cell according to definition 32, wherein the yeast is selected from the
group consisting of Pichia, Candida, Torulopsis, Arxula, Hensenula, Yarrowia,
Kluyveromyces, Saccharomyces, Komagataella, preferably a methylotrophic yeast.
35. A cell according to definition 34, wherein the yeast is Pichia pastoris,
Komagataella pastoris, K phaffii, or K. pseudopastoris.
36. A cell of any of definitions 32 to 35, which has a higher specific growth rate
in the presence of a surplus of carbon source relative to conditions of limited carbon
source.
37. Method to identify a carbon source regulatable promoter from eukaryotic
cells, comprising the steps of
a) cultivating eukaryotic cells in the presence of a carbon source in a batch
culture under cell growing conditions,
b) further cultivating the cells in a fed batch culture in the presence of a limited
amount of a supplemental carbon source,
c) providing samples of the cell culture of step a) and b), and
d) performing transcription analysis in said samples to identify a regulatable
promoter that shows a higher transcriptional strength in cells of step b) than in cells of
step a).
38. Method according to definition 37, wherein the transcription analysis is
quantitive or semi-quantitative, preferably employing DNA microarrays, RNA
sequencing and transcriptome analysis.
Specific examples relate to fed-batch fermentation of a recombinant production
P. pastoris cell line producing reporter proteins, employing a glycerol batch medium
and a glucose fed batch medium. Comparative promoter activity studies have proven
that the promoter according to the invention may be successfully activated to induce
recombinant protein production.
According to a further example, human serum albumin (HSA) was produced as
a POI under the control of the glucose-limit induced promoters, and the HSA yield and
gene copy number determined.
According to another example, fed-batch cultivation of P. pastoris strains
expressing HSA under the control of a promoter according to the invention was
performed. Induction of the promoter activity under glucose-limiting conditions was
found to be even more than 20 fold with pG1 , and more than 20 fold with pG6,
compared to the repressed state.
Further examples refer to expressing a porcine carboxypeptidase B as model
protein under transcriptional control of pG1 and pG6 promoter.
Yet, a further example refers to the expression of an antibody fragment under
the transcriptional control of pG1 .
A further example proves the functional activity of variants of a promoter
according to the invention, such as fragments of pG1 with a length in the range of 300
to 1000 bp. Additional exeperiments have shown that even shorter fragments of pG1
were functionally active in a similar setting, such as fragments ranging between 200
and 1000 bp, or fragments ranging between 250 and 1000.
The foregoing description will be more fully understood with reference to the
following examples. Such examples are, however, merely representative of methods of
practicing one or more embodiments of the present invention and should not be read
as limiting the scope of invention.
Examples
Examples below illustrate the materials and methods used to indentify new
regulatable promoters and to analyze their expression properties in Pichia pastoris.
Example 1: Identification of strong, efficiently regulated genes in P. pastoris in
glucose-limited conditions
In order to identify strong, efficiently regulated genes and their respective
promoters of P. pastoris in glucose-limit conditions, analysis of gene expression
patterns was done using microarrays. P. pastoris cells grown in a glycerol batch
(surplus of carbon source) were compared to cells which were cultivated in conditions
where glucose was growth limiting (chemostat), thereby simulating the course of a
protein production process, which is usually done in fed batch mode.
a) Strain
A wild type P. pastoris strain (CBS261 2, CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands), which can
grow on minimal media without supplements, was used.
b) Cultivation of P. pastoris
Fermentations were performed with Minifors reactors (Infors-HT, Switzerland)
with a final working volume of 2.5 L.
Following media were used:
PTM-i trace salts stock solution contained per liter
6.0 g CuS0 4. 5H20 , 0.08 g Nal, 3.36 g MnS0 4. H20 , 0.2 g Na2Mo0 4. 2H20 , 0.02
g H3BO3, 0.82 g CoCI2, 20.0 g ZnCI2, 65.0 g FeS0 4. 7H20 , 0.2 g biotin and 5.0 ml
H2S0 4 (95 %-98 %).
Glycerol Batch medium contained per liter
2 g Citric acid monohydrate (C6H80 7' H20), 39.2 g Glycerol, 20.8 g NH4H2P0 4,
0.5 g MgS0 4-7H20 , .6 g KCI, 0.022 g CaCI2
«2H20 , 0.8 mg biotin and 4.6 ml PTM1
trace salts stock solution. HCI was added to set the pH to 5.
Glycerol fed-batch medium contained per liter
632 g glycerol, 8 g MgS0 4'7H 20 , 22 g KCI, and 0.058 g CaCI2
»2H20 .
Chemostat medium contained per liter
2 g Citric acid monohydrate ( 6H8O ·H2O) , 99.42 g glucose monohydrate, 22 g
NH4H2PO4, 1.3 g MgSO4 7H2O, 3.4 g KCI, 0.02 g CaCI2-2H2O, 0.4 mg biotin and
3.2 ml PTM1 trace salts stock solution. HCI was added to set the pH to 5.
The dissolved oxygen was controlled at DO = 20 % with the stirrer speed (500 -
250 rpm). Aeration rate was 60 L h air, the temperature was controlled at 25 °C and
the pH setpoint of 5 was controlled with addition of NH4OH (25%).
To start the fermentation, 1.5 L batch medium was sterile filtered into the
fermenter and P. pastoris was inoculated (from an overnight pre-culture in YPG, 180
rpm, 28 °C) with a starting optical density (OD600) of 1. The batch phase of
approximately 25 h reached a dry biomass concentration of approximately 20 g/L, it
was followed by a 10 h exponential fed batch with glucose medium, leading to a dry
biomass concentration of approximately 50 g/L. Then, the volume was reduced to
1.5 L and the chemostat cultivation was started with a feed/harvest rate of 0.1 5 L h ,
resulting in a constant growth rate of m= 0.1 . The fermentation was terminated 50 h
after the chemostat start.
This fermentation has been performed three times to obtain the biological
replicates necessary for reliable microarray analysis.
Carbon limited conditions (no detectable residual glucose) during the chemostat
were verified by HPLC analysis of the culture supernatant.
c) Sampling
Samples were taken at the end of the glycerol batch phase and in steady state
conditions of the glucose chemostat. Routine sampling as determination of optical
density or yeast dry mass, qualitative microscopic inspection and cell viability analysis
was done alongside during each fermentation. For microarray analysis, samples were
taken and treated as follows: For optimal quenching, 9 ml_ cell culture broth was
immediately mixed with 4.5 ml_ of ice cold 5% phenol (Sigma) solution (in Ethanol
abs.), and aliquoted. Each 2 ml_ were centrifuged ( 13200 rpm for 1 minute) in precooled
collection tubes (GE healthcare, NJ), supernatant was removed completely and
the tubes were stored at -80 °C until RNA purification.
d) RNA purification and sample preparation for microarray hybridization
The RNA was isolated using TRI reagent according to the suppliers instructions
(Ambion, US). The cell pellets were resuspended in TRI reagent and homogenized
with glass beads using a FastPrep 24 (M.P. Biomedicals, CA) at 5 m s for 40
seconds. After addition of chloroform, the samples were centrifuged and the total RNA
was precipitated from the aqueous phase by adding isopropanol. The pellet was
washed with 70% ethanol, dried and re-suspended in RNAse free water. RNA concen
trations were determined by measuring OD260 using a Nanodrop 1000 spectrophoto
meter (NanoDrop products, DE). Remaining DNA from the samples was removed
using the DNA free Kit (Ambion, CA). Sample volume equal to 10 g RNA was diluted
to 50 m I_ in RNAse free water, then DNAse buffer I and rDNAse were added and
incubated at 37°C for 30 minutes. After addition of DNAse Inactivation Reagent, the
sample was centrifuged and the supernatant was transferred into a fresh tube. RNA
concentrations were determined again as described above. Additionally, RNA integrity
was analyzed using RNA nano chips (Agilent). To monitor the microarray workflow
from amplification and labelling to hybridisation of the samples, the Spike In Kit
(Agilent, Product Nr.: 5 188-5279) was used as positive control. It contains 10 different
polyadenylated transcripts from an adenovirus, which are amplified, labelled and
cohybridised together with the own RNA samples. The samples were labelled with Cy
3 and Cy 5 using the Quick Amp Labelling Kit (Agilent, Prod. No. : 5 190-0444). There
fore 500 ng of purified sample RNA were diluted in 8.3 m I_ RNAse free water, 2 m I_
Spike A or B, and 1.2 m I_ T7 promoter primer were added. The mixture was denatured
for 10 minutes at 65 °C and kept on ice for 5 minutes. Then 8.5 m I_ cDNA mastermix
(per sample: 4 m I_ 5x first strand buffer, 2 m I_ 0.1 M DTT, 1 m I_ 10 mM dNTP mix, 1 m I_
MMLV-RT, 0.5 m I RNAse out) were added, incubated at 40 °C for 2 hours, then trans
ferred to 65 °C for 15 minutes and put on ice for 5 minutes. The transcription mastermix
(per sample: 15.3 m I_ nuclease free water, 20 m I_ transcription buffer, 6 m I_ 0.1 M DTT,
6.4 m I_ 50% PEG, 0.5 m I RNAse Inhibitor, 0.6 m I_ inorg. phosphatase, 0.8 m I T7 RNA
Polymerase, 2.4 m I_ Cyanin 3 or Cyanin 5) was prepared and added to each tube and
incubated at 40 °C for 2 hours. In order to purify the obtained labelled cRNA, the
RNeasy Mini Kit (Qiagen, Cat.No. 741 04) was used. Samples were stored at -80 °C.
Quantification of the cRNA concentration and labelling efficiency was done at the
Nanodrop spectrophotometer
e) Microarray analysis
In order to indentify strong, efficient regulated genes in glucose-limited
chemostat cultivations, the three biological sample replicates thereof were compared
with the same reference and in one dyeswap each. The reference sample was
generated by combining the glycerol batch cultivation samples in equal amounts.
The Gene Expression Hybridisation Kit (Agilent, Cat. No. 5 188-5242) was used
for hybridisation of the labelled sample cRNAs. For the preparation of the hybridisation
samples each 300 ng cRNA (Cy3 and Cy 5) and 6 m I_ 10-fold blocking agent were
diluted with nuclease free water to a final volume of 24 m I_. After addition of 1 m I_ 25-
fold fragmentation buffer, the mixture was incubated at 60 °C for 30 minutes. Then
25 m _ GEx Hybridisation Buffer HI-RPM was added to stop the reaction. After centrifugation
for one minute with 13,200 rpm, the sample was chilled on ice and used for
hybridisation immediately. In-house designed P. pastoris specific oligonucleotide
arrays (AMAD-ID: 026594, 8x1 5K custom arrays, Agilent) were used. Microarray
hybridisation was done according to the Microarray Hybridisation Chamber User Guide
(Agilent G2534A). First, the gasket slide was uncovered and put onto the chamber
base, Agilent label facing up. The sample (40 m I_ per array) was loaded in the middle of
each of the eight squares. Then the microarray slide was carefully put onto the gasket
slide (Agilent label facing down) and the chamber cover was placed on and fixed with
the clamp. Hybridisation was done in the hybridisation oven for 17 hours at 65 °C.
Before scanning, the microarray chip was washed. Therefore, the chamber was d is
mantled, and the sandwich slides were detached from each other while submerged in
wash buffer 1. The microarray was directly transferred into another dish with wash
buffer 1, washed for 1 minute, transferred into wash buffer 2 (temperature at least
30 °C) and washed for another minute. After drying of the microarray slide by touching
the slide edge with a tissue, it was put into the slide holder (Agilent label facing up).
The slide holder was put into the carousel and scanning was started
f) Data acquisition and statistical evaluation of microarray data
Images were scanned at a resolution of 50 nm with a G2565AA Microarray
scanner (Agilent) and were imported into the Agilent Feature Extraction 9.5 software.
Agilent Feature Extraction 9.5 was used for the quantification of the spot intensities.
The raw mean spot intensity data was then imported into the open source software R
for further normalisation and data analysis.
For data preprocessing and normalization the R packages limma, vsn and
marray were used. The intensity data was not background corrected and normalized
with VSN, after normalization it was transformed into log2 ratios of the Cy5 channel
against the Cy3 channel. Differential expression was calculated using the Imfit and
eBayes function of the limma package.
The microarray data was browsed for entries with both, high difference in
expression level between repressed to induced state (fold change) as well as high
signal intensity in the induced state in order to identify strongly expressed, efficiently
regulated genes. A list of the selected genes is shown in Table 1, with the fold change
meaning the signal intensity in the induced state divided by the signal intensity in the
repressed state. The data of pGAP and pMLS1 , plCL1 are added as references.
Table 1: Microarray data of the promoters selected for further characterization
and of pGAP, ICL1 and MLS1 as controls
* of induced state in green channel
Example 2 : Comparative promoter activity studies of the newly identified
promoters in P. pastoris using eGFP as intracellular^ expressed reporter gene
In order to analyze the properties of the newly identified promoters under
glucose limit conditions, shake flask screenings were performed as follows: Pre-culture
for 24 hours was done with rich medium containing glycerol as carbon source -
simulating the batch phase of the process (repressed state of the promoters), which
was followed by the main culture with minimal medium and glucose feed beads -
simulating the glucose-limited fed batch phase of the process (induced state of the
promoters).
a) Strain & expression vector
The P. pastoris wild type strain (CBS261 2, CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) was used
as host strain. Transformation of the strain was carried out with an in-house vector
named pPUZZLE (Stadlmayr et al. J. Biotechnoi 201 0 Dec;1 50(4):51 9-29), comprising
of an origin of replication for E. coli (pUC1 9), an antibiotic resistance cassette (Sh ble
gene conferring resistance to Zeocin) for selection in E. coli and yeast, an expression
cassette for the gene of interest (GOI) consisting of a multiple cloning site and the S.
cerevisiae CYC1 transcription terminator, and a locus for integration into the P.
pastoris genome (3 OC1 region).
b) Amplification and cloning of the newly identified promoters pG1 , pG3, pG4 and
pG6 into pPUZZLE expression vector containing eGFP as GOI
A list of the newly identified promoter sequences and their respective genes
(see Example 1) is shown in Table 2. 1000bp of the 5'-non coding region of the
respective genes up to the start codon ATG were amplified by PGR (Phusion
Polymerase, New England Biolabs) as promoter sequences using the primers shown
in Table 2. These sequences were cloned into the pPUZZLE expression vector
pPM1 aZ1 0_eGFP, resulting in pPM1 aZ1 0_pG1_eGFP, pP 1aZ1 0_pG3_eGFP,
pPM1 aZ1 0_pG4_eGFP and pPM1 aZ1 0_pG6_eGFP. Additionally, the vector
pPM1 aZ1 0_pGAP_eGFP, containing the commonly used promoter of glyceraldehyde
3-phosphate dehydrogenase promoter (pGAP of P. pastoris, here SEQ D 25) was
used as reference. The promoters were inserted upstream of the start codon of the
eGFP gene using the Apal and the Sbfl restriction sites (see Tables 2 and 3). The
correctness of the promoter sequences was verified by Sanger sequencing.
Name Target Sequence T Restriction site
SEQ ID 14
GATAGGGCCCCAAACA GCT
pG1 fw pG1 CCCCCTAGTCTC 70.8 Apal
SEQ ID 15
GATACCTGCAGGAAGGGTGGAA
pG1_ back pGl TTTTAAGGATCTTTTAT 69.8 Sbfl
Name Target Sequence T Restriction site
SEQ D 16
GATAGGGCCCCAGCAATCCAGT
pG3 fw pG3 AACC M CTGAAT 70.4 Apal
SEQ ID 17
GATACCTGCAGGTTGAGTTCAAT
pG3 back pG3 AAATTGTCCGGGA 70.2 Sbfl
SEQ ID 18
GATAGGGCCCTGGACTGTTCAAT
pG4 fw pG4 TTGAAGTCGATG 70.4 Apal
SEQ ID 19
GATACCTGCAGGGGATAAAGGTA
pG4 back pG4 AGGGAAAAAAGCAA 70 Sbfl
SEQ ID 20
GATAGGGCCCAGACCAGCAG
pG6Jw pG6 AACTACGCAAATC 70.6 Apal
SEQ ID 2 1
GATACCTGCAGGCTTTTCTTTGGG
pG6 back pG6 CAAGGAAAAATC 70.7 Sbfl
SEQ ID 22
GATAGGGCCCAATTGATTAAGTTCAGT
pG7 fw pG7 GAAA I CAAAC 69.1 Apal
SEQ ID 23
GATACCTGCAGGATTATATTATGGGGA
pG7 back pG7 ATAATGAAGAGAAGG 70.9 Sbfl
SEQ ID 24
GATAGGGCCCCTGCACAACCATTGCC
pG8 fw pG8 AGTAAGG 7 1.5 Apal
SEQ ID 25
GATACCTGCAGGTTTTTAGAAGAGGG
pG8_back pG8 AGAACTTAGATTGG 70.4 Sbfl
Table 2 : Primers for PGR amplification of the promoters
Cloning enzyme Fragment
promoter 5 primer 3 primer 5' 3' length
pG1 pG1_fw pG1_back Apal Sbfl 988
pG3 pG3_fw pG3_back Apal Sbfl 10 11
pG4 pG4_fw pG4_back Apal Sbfl 1022
pG6 pG6_fw pG6_back Apal Sbfl 1022
Cloning enzyme Fragment
promoter 5 primer 3 primer 5' 3 length
pG7 pG7_fw pG7_back Apal Sbfl 1022
pG8 pG8_fw pG8_back Apal Sbfl 1022
Table 3 : Amplification primers, cloning enzymes and the length of the cloned
promoters
c) Expression of eGFP in P. pastoris for analysis of the promoter activity
All plasmids were linearized with Ascl within the 3 OC genome integration
region prior to electroporation (2 kV, 4 ms, GenePulser, BioRad) into electrocompetent
P. pastoris.
Selection of positive transformants was performed on YPD plates (per liter: 10 g
yeast extract, 20 g peptone, 20 g glucose, 20 g agar-agar) plates containing 25 mg/mL
of Zeocin (Invivogen, CA). Colony PGR was used to ensure the presence of the
transformed plasmid. Therefore, genomic DNA was gained by cooking and freezing of
P. pastoris colonies for 5 minutes each and directly applied for PGR with the appro
priate primers. For expression screening, a single colony was inoculated in liquid YPGZeo
medium (per liter: 20 g peptone, 10 g yeast extract, 12.6 g glycerol and 25 mg
Zeocin) as pre-culture. After approximately 24h the pre-culture was used to inoculate
the main culture with an OD600 of 0.1 in 10 ml YP medium (per liter: 20 g peptone,
10 g yeast extract) and 2 glucose feed beads (Kuhner, CH). Glucose- limiting growth
conditions were achieved due to the slow glucose release kinetics of these feed beads,
which is described by the following equation: (Glucose)=1 .63*t0.74 [mg/Disc]. Samples
were taken at the end of the pre-culture, and 24 and 48 hours after inoculation of the
main culture. Cell density was determined by measuring OD600, eGFP expression
was analyzed by flow cytometry as described in Stadlmayr et al. (J. Biotechnology
201 0 Dec;1 50(4) :51 9-29). For each sample 10,000 cells were analyzed. Autofluorescence
of P. pastoris was measured using untransformed P. pastoris wild type
cells and subtracted from the signal. Relative eGFP expression levels (fluorescence
intensity related to cell size) are shown as percentage of eGFP expression level of a
clone expressing eGFP under the control of the constitutive pGAP promoter.
Further similar studies are done with the promoters pG7 and pG8. Cloning is done as
described in example 2b, except that the wild type P. pastoris strain X-33 (Invitrogen)
was used for the transformation of pPM1 aZ1 0_pG7_eGFP and
pPM1 aZ1 0_pG8_eGFP. Used primers and cloning fragments are listed in Tables 2
and 3. The results are shown in Table 4 .
Table 4 : Screening results of eGFP expressing P. pastoris clones under the
control of the novel promoters; Shown data (Fluorescence/cell size) is related to
pGAP;
d) Determination of eGFP gene copy numbers (GCN) in selected eGFPexpressing
clones
Expression strength is often correlated to the number of expression cassettes
integrated into the P. pastoris genome. Therefore the gene copy number of eGFP was
determined. Genomic DNA was isolated using the DNeasy Blood&Tissue Kit (Quiagen,
Cat.No. 69504). Gene copy numbers were determined using quantitative PGR. There
fore, SensiMix SYBR Kit (Bioline, QT605-05) was used. The Sensi Mix SYBR was
mixed with the primers and the sample and applied for real time analysis in a real-time
PGR cycler (Rotor Gene, Qiagen). A list of the primers is shown in Table 5. All
samples were analyzed in tri- or quadruplicates. Rotor Gene software was used for
data analysis. The actin gene ACT1 was used as calibrator. Results are shown in
Table 6.
primer target sequence T [ °C] product lengh
SEQ D 26
CCTGAGGC I I IGTTCC
PpACT1_Up Act ACCCATCT 6 1.3 148 bp
SEQ ID 27
GGAACATAGTAGTACC
PpACT1_Low Act ACCGGACATAACGA 6 1.4 148 bp
SEQ ID 28
TCGCCGACCACTACCA
PpeGFP_Up GFP GCAGAA 6 1.4 124 bp
SEQ ID 29
ACCATGTGATCGCGCT
PpeGFP_Low GFP TCTCGTT 6 1.6 124 bp
Table 5 : Primers for gene copy nuber determination by real-time PGR
Table 6 : Screening results (fluorescence/cell size related to pGAP) and gene
copy numers of chosen P. pastoris clones expressing eGFP under the control of
pG1 and pG6;
e) Analysis of pG1 promoter strength in fed-batch fermentation of one eGFP clone
Fed batch fermentations were performed in DASGIP reactors with a final
working volume of 0.7 L.
Following media were used:
PTMi trace salts stock solution contained per liter
6.0 g CuSO4. 5H2O, 0.08 g Na , 3.36 g MnS0 4. H20 , 0.2 g Na2MoO4 2H2O, 0.02
g H3BO3, 0.82 g CoCI2, 20.0 g ZnCI2, 65.0 g FeS0 4. 7H20 , 0.2 g biotin and 5.0 ml
H2S0 4 (95%-98%).
Glycerol Batch medium contained per liter
2 g Citric acid monohydrate (C6H8O7' H2O), 39.2 g Glycerol, 2.6 g NH4H2P0 4,
0.5 g gS0 4'7H 20 , 0.9 g KCI. 0.022 g CaCI2 2H20 , 0.4 mg biotin and 4.6 ml PTM1
trace salts stock solution. HCI was added to set the pH to 5.
Glucose fed batch medium contained per liter
464 g glucose monohydrate, 5.2 g MgS0 4-7H20, 8.4 g KCI, 0.28 g CaCI2-2H20 ,
0.34 mg biotin and 10.1 ml_ PTM1 trace salts stock solution.
The dissolved oxygen was controlled at DO = 20% with the stirrer speed (400 -
1200 rpm). Aeration rate was 24 L h air, the temperature was controlled at 25 °C and
the pH setpoint of 5 was controlled with addition of NH4OH (25%).
To start the fermentation, 400 ml_ batch medium was sterile filtered into the
fermenter and P. pastoris clone pG1_eGFP#8 was inoculated (from pre-culture) with a
starting optical density (OD600) of 1. The batch phase of approximately 25 h (reaching
a dry biomass concentration of approximately 20 g/L) was followed by a glucoselimited
fed batch starting with an exponential feed for 7 h and a constant feed rate of
15 g/L for 13 h, leading to a final dry biomass concentration of approximately
100 g/L. Samples were taken during batch and fed batch phase, and analyzed for
eGFP expression using a plate reader (Infinite 200, Tecan, CH). Therefore, samples
were diluted to an optical density (OD600) of 5. Results are shown in Table 7 as
relative fluorescence per bioreactor (FL/r).
pGAP_eGFP#2 pG1__eGFP#8
t [h] FL/r t [h] FL/r
- 1 .7 176.77 -0.38 13 1.95
0.0 166.52 0.00 108.76
0.5 199.59 0.28 100.35
1.0 195.94 0.62 12 1.36
1.5 173.68 1. 12 16 1. 16
2.0 2 19.00 1.62 162.69
3.0 321 . 14 2.1 2 148.34
7.0 494.60 3.1 2 205.20
19.1 1150.96 7.1 2 373.08
20.0 1000.37 19.70 1745.65
2 1. 12 1831 .52
Table 7 : Relative fluorescence per bioreactor of two different P. pastoris clones
expressing eGFP under the control of pGAP or pG1 in an optimized fed batch
fermentation.
Example 3 : Comparative promoter activity studies of the newly identified
promoters in P. pastoris using human serum albumin (HSA) as extracellular expressed
reporter gene
In order to analyze the properties of the newly identified promoters under
glucose limit conditions, shake flask screenings were performed as follows: Pre-culture
for 24 hours was done with rich medium containing glycerol as carbon source -
simulating the batch phase of the process (repressed state of the promoters), which
was followed by the main culture with minimal medium and glucose feed beads -
simulating the glucose-limited fed batch phase of the process (induced state of the
promoters).
a) Strain & expression vector
The P. pastoris wild type strain (CBS261 2, CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) was used
as host strain. Transformation of the strain was carried out with an in-house vector
named pPUZZLE (Stadlmayr et al. J. Biotechnol 201 0 Dec; 150(4):51 9-29), selection
of positive transformants was based on the Zeocin resistance. For secretory
expression of human serum albumin (HSA) its native secretion leader was used.
b) Amplification and cloning of the newly identified promoters pG1 , pG3, pG4 and
pG6 into an in-house expression vector
The four promoters amplified in Example 2b were cloned into the pPUZZLE
expression vector pP 1aZ1 0_HSA, resulting in pPM1 aZ1 0_pG1_HSA,
pPM1 aZ1 0 G3_HSA, pPM1 aZ1 0_pG4_HSA and pPM1 aZ1 0_pG6_HSA.
Additionally, the vector pPM 1aZ1 0_pGAP_HSA, containing the commonly used
promoter of glyceraldehyde 3-phosphate dehydrogenase promoter (pGAP) was used
as reference. The promoters were inserted upstream of the start codon of the HSA
gene using the Apal and the Sbfl restriction sites (see Table 3). The correctness of the
promoter sequences was verified by Sanger sequencing.
c) Expression of HSA in P. pastoris under control of the newly identified glucoselimit
induced promoters
All plasmids were linearized using Ascl restriction enzyme prior to
electroporation (using a standard transformation protocol for P. pastoris) into P.
pastoris. Selection of positive transformants was performed on YPD plates (per liter:
10 g yeast extract, 20 g peptone, 20 g glucose, 20 g agar-agar) plates containing
25 g/mL of Zeocin. Colony PGR was used to ensure the presence of the transformed
plasmid as described in Example 2c.
For HSA expression screening, a single colony was inoculated in liquid YPGZeo
medium (per liter: 20 g peptone, 10 g yeast extract, 12.6 g glycerol and 25 mg
Zeocin) as pre-culture. After approximately 24h the pre-culture was used to inoculate
the main culture with an OD600 of 1 in YP medium (per liter: 20 g peptone, 10 g yeast
extract) and glucose feed beads (Kuhner, CH). Glucose- limiting growth conditions
were achieved due to the slow glucose release kinetics of these feed beads, which is
described by the following equation: (Glucose)=1 .63* t° 4 [mg/Disc]. Samples were
taken at the end of the pre-culture, and 24 and 48 hours after inoculation of the main
culture. Biomass concentration was determined by measuring OD600 or wet cell
weight. HSA concentration in the culture supernatant was quantified by the Human
Albumin ELISA Quantitation Set (Cat.No. E80-1 29, Bethyl Laboratories, TX, USA)
following the supplier ' s instruction manual. The HSA standard was used with a starting
concentration of 400 ng ml_ . Samples were diluted accordingly in sample diluent
(50 mM Tris-HCI, 140 mM NaCI, 1% (w/v) BSA, 0.05% (v/v) Tween20, pH 8.0). HSA
titers from screening of several clones of each construct are presented in Table 8.
Table 8 : Screening results of HSA expressing P. pastoris clones under the
control of pGAP, pG1 and pG6
d) Determination of HSA gene copy numbers
Genomic DNA isolation and qPCR measurement were performed as in Example
2d, using the primers given in Table 9. Results are shown in Table 10.
Table 9 : Primers for gene copy nuber determination by real-time PGR
Table 10 : Screening and gene copy numer results of chosen P. pastoris clones
expressing HSA under the control of pGAP, pG1 and pG6;
e) Fed-batch cultivation of P. pastoris strains expressing HSA under control of the
pG1 and pG6 promoter
The fermentations were performed in DASGIP bioreactors with a final working
volume of 0.7 L. The strain pG1_HSA#23 had two HSA gene copies, the strain
pG6_HSA#36 carried only one HSA gene copy. Therefore two different P. pastoris
strains expressing HSA under control of pGAP (pGAP_HSA#3 having one HSA gene
copy, and pGAP_HSA#4 having two HSA gene copies) were cultivated as reference.
All fermentations were performed in duplicates.
Following media were used:
PTM-i trace salts stock solution contained per liter
6.0 g CuS0 4. 5H20 , 0.08 g Nal, 3.36 g MnS0 4. H20 , 0.2 g Na2Mo0 4. 2H20 ,
0.02 g H3BO3, 0.82 g CoCI2, 20.0 g ZnCI2, 65.0 g FeS0 4. 7H20 , 0.2 g biotin and 5.0 ml
H2S0 4 (95%-98%).
Glycerol Batch medium contained per liter
39.2 g Glycerol, 27.9 g H3P0 4 (85%), 7.8 g MgS0 4'7H 20 , 2.6 g KOH, 9.5 g
K2S0 4, 0.6 g CaS0 4*2H20, 0.4 mg biotin and 4.6 ml PTM1 trace salts stock solution.
The pH was adjusted to 5.85 after sterile filtering into the fermenter.
Glucose fed batch medium contained per liter
550 g glucose monohydrate, 6.5 g MgS0 7H20 , 10 g KCI, 0.35 g CaCI2*2H20 ,
0.4 mg biotin and 12 ml PTM1 trace salts stock solution.
The dissolved oxygen was controlled at DO = 20% with the stirrer speed (400 -
1200 rpm). Aeration rate was 24 I h 1 air, the temperature was controlled at 25 °C and
the pH setpoint of 5.85 was controlled with addition of NH4OH (25%).
To start the fermentation, 400 ml batch medium was sterile filtered into the
fermenter and P. pastoris was inoculated (from pre-culture) with a starting optical
density (OD600) of 1. The batch phase of approximately 25 h reached a dry biomass
concentration of approximately 20 g/L and it was followed by a constant fed batch (for
100 hours) with glucose medium, leading to a dry biomass concentration of
approximately 100 g/L. The pH was 5.85 during batch, and kept at 5.85 throughout the
fermentation. Samples were taken during batch and fed batch phase. HSA concen
tration was quantified using the Human Albumin ELISA Quantitation Set (Bethyl,
Cat.No. E80-1 29) as described in Example 3c. Biomass concentration and HSA titers
are shown in Table 11, the product yield (amount of HSA secreted per biomass,
HSA/YDM) at the end of the batch (repressing conditions for pG1 and pG6) and the
end of the fed batch (inducing conditions for pG1 and pG6) are given in Table 12.
Thereby the induction strategy could be verified. pG1 and pG6 are repressed under
carbon source surplus (in glycerol batch), showing nearly no detectable HSA in
contrast to the pGAP driven clones. Induction of pG1 and pG6 occurred upon the
switch to C-limited conditions with the start of the fed batch phase. Induction of pG1
(HSA/YDM) was more than 120-fold compared to the repressed state, induction of pG6
was more than 20-fold compared to the repressed state, while nearly no change was
observed for pGAP (3-fold increase in HSA/YDM compared to batch phase).
Table 11: Yeast dry mass and HSA titers at batch end and fed batch end of 7
fermentations of P. pastoris clones expressing HSA under the control of pGAP, pG1 or
pG6.
Table 12 : HSA titer per yeast dry mass at batch end and fed batch end of 7
fermentations of P pastoris clones expressing HSA under the control of pGAP, pG1
pG6.
Example 4 : Comparative promoter activity studies in various glucose
concentrations of the newly identified promoters in P. pastoris using eGFP as
intracellular expressed reporter gene.
In order to analyze the properties of the newly identified promoters in various
glucose concentrations, shake flask screenings were performed as follows: Pre-culture
for 24 hours was done with rich medium containing glycerol as carbon source
(repressed state of the promoters), which was followed by the main culture with
minimal medium and glucose as carbon source (induced state of the promoters);
a) Strain & expression vector
The P. pastoris wild type strain (CBS261 , CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) is used as
host strain. Transformation of the strain was carried out with an in-house vector named
pPUZZLE (Stadlmayr et al. J. Biotechnol 201 0 Dec;1 50(4):51 9-29), selection of
positive transformants was based on the Zeocin resistance.
b) Amplification and cloning of the newly identified promoters pG1 , pG3, pG4 and
pG6 into pPUZZLE expression vector containing eGFP as GOI
Amplification and cloning is done as described in example 2.
c) Expression of eGFP in P. pastoris for analysis of the promoter activity
Transformation and clone selection is done as described in Example 2.
For expression screening, a single colony is inoculated in liquid YPG-Zeo
medium (per liter: 20 g peptone, 10 g yeast extract, 12.6 g glycerol and 25 mg Zeocin)
as pre-culture. After approximately 24h the pre-culture is used to inoculate the main
culture with an OD600 of 0.01 in 10 ml YP medium (per liter: 20 g peptone, 10 g yeast
extract) and glucose as carbon source. Glucose is used in various concentrations from
20 to 0,001 g L_ .
Samples are taken after 1-8 hours after inoculation of the main culture. eGFP
expression is analyzed by flow cytometry as described in Stadlmayr et al. (J. Biotech
nology 201 0 Dec;1 50(4):51 9-29), selection of positive transformants is based on the
Zeocin resistance. For each sample 10,000 cells are analyzed. Auto-fluorescence of P.
pastoris is measured using untransformed P. pastoris wild type cells.
Example 5 : Comparative promoter activity studies of the newly identified
promoters in P. pastoris using porcine carboxypeptidase B (CpB) as extracellular
expressed reporter gene
ln order to analyze the properties of the newly identified promoters under
glucose limit conditions, shake flask screenings is performed as follows: Pre-culture for
24 hours is done with rich medium containing glycerol as carbon source - simulating
the batch phase of the process (repressed state of the promoters), which is followed by
the main culture with minimal medium and glucose feed beads - simulating the
glucose-limited fed batch phase of the process (induced state of the promoters);
a) Strain & expression vector
The P. pastoris wild type strain (CBS261 2, CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) is used as
host strain. Transformation of the strain is carried out with an in-house vector named
pPUZZLE (Stadlmayr et al. J. Biotechnol 201 0 Dec; 150(4):51 9-29), selection of
positive transformants is based on the Zeocin resistance. For secretory expression of
porcine carboxypeptidase B (CpB) yeast alpha mating factor leader is used.
b) Amplification and cloning of the newl identified promoters pG1 , pG3, pG4 and
pG6 into an in-house expression vector
Two promoters amplified in Example 2b are cloned into the pPUZZLE
expression vector pP 1aZ30_aMF_CpB, resulting in pPM1 aZ30_pG1_aMF_CpB and
pPM1 aZ30_pG6_aMF_CpB. Additionally, the vector pPM1 dZ30_pGAP_CPB,
containing the commonly used promoter of glyceraldehyde 3-phosphate
dehydrogenase promoter (pGAP) is used as reference. The promoters are inserted
upstream of the start codon of the CpB gene using the Apal and the Sbfl restriction
sites The correctness of the promoter sequences is verified by Sanger sequencing.
c) Expression of CpB in P. pastoris under control of the newly identified glucoselimit
induced promoters
Plasmids are linearized using Spel or Sapl restriction enzyme prior to
electroporation (using a standard transformation protocol for P. pastoris) into P.
pastoris. Selection of positive transformants is performed on YPD plates (per liter: 10 g
yeast extract, 20 g peptone, 20 g glucose, 20 g agar-agar) plates containing 25 g/mL
of Zeocin. Colony PGR is used to ensure the presence of the transformed plasmid as
described in Example 2c.
For CpB expression screening, a single colony is inoculated in liquid YPG-Zeo
medium (per liter: 20 g peptone, 10 g yeast extract, 12.6 g glycerol and 25 mg Zeocin)
as pre-culture. After approximately 24h the pre-culture is used to inoculate the main
culture with an OD600 of 1 in YP medium (per liter: 20 g peptone, 10 g yeast extract)
and glucose feed beads (Kuhner, CH). Glucose- limiting growth conditions are
achieved due to the slow glucose release kinetics of these feed beads, which is
described by the following equation: (Glucose)=1 .63* t° 4 [mg/Disc]. Samples are taken
at the end of the pre-culture, and 24 and 48 hours after inoculation of the main culture.
Biomass concentration is determined by measuring OD600 or wet cell weight. CpB
concentration in the culture supernatant is quantified by an enzymatic assay, based on
the conversion of hippuryl-L-arginine to hippuric acid by the CpB. Reaction kinetics are
measured by monitoring the absorption at 254nm at 25 °C using a Hitachi U-291 0
Spectrophotometer when the reaction is started. Samples and standards are buffered
with assay buffer (25 mM Tris, 100 mM HCI, pH 7.65) and are activated using
activation buffer (0.01 mgL-1 Trypsin, 300 mM Tris, 1mM ZnCI2, pH 7.65). Activation
buffer without trypsin is used instead of sample as negative control. The reaction is
started by adding the substrate solution ( 1 mM hippuryl-L-arginine in assay buffer)
d) Fed-batch cultivation of P. pastoris strains expressing CpB under control of the
pG6 promoter
Fed batch fermentation is done as described in example 3e. The clone
pPM1 aZ1 0_pG6_CpB#4 produced no detectable CpB in the batch and more than
2 10 mg/L CpB at the end of the fed batch.
Example 6 : Comparative promoter activity studies of the newly identified
promoters pG1 and pG6 in P. pastoris multicopy clones using human serum albumin
(HSA) as extracellular expressed reporter gene
In order to analyze the properties of the newly identified promoters under
glucose limit conditions, shake flask screenings are performed as follows: Pre-culture
for 24 hours is done with rich medium containing glycerol as carbon source -
simulating the batch phase of the process (repressed state of the promoters), which is
followed by the main culture with minimal medium and glucose feed beads -
simulating the glucose-limited fed batch phase of the process (induced state of the
promoters);
a) Strain & expression vector
The P. pastoris wild type strain (CBS261 2, CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) is used as
host strain. Transformation of the strain is carried out with an in-house vector named
pPUZZLE (Stadlmayr et al. J. Biotechnol 201 0 Dec;1 50(4):51 9-29), selection of
positive transformants is based on the Zeocin resistance. For secretory expression of
human serum albumin (HSA) its native secretion leader is used.
b) Amplification and cloning of the newly identified promoters pG1 and pG6 into
an in-house expression vector
Two promoters amplified in Example 2b are cloned into the pPUZZLE
expression vector pPM1 nZ30_HSA, resulting in pP 1nZ30_pG1_HSA and
pPM1 nZ30_pG6_HSA.
The promoters are inserted upstream of the start codon of the HSA gene using
the Apal and the Sbfl restriction sites. The correctness of the promoter sequences is
verified by Sanger sequencing.
c) Expression of HSA in P. pastoris under control of the newly identified
glucose-limit induced promoters
All plasmids are linearized using Ascl restriction enzyme prior to electroporation
(using a standard transformation protocol for P. pastoris) into P. pastoris. Selection of
positive transformants is performed on YPD plates (per liter: 10 g yeast extract, 20 g
peptone, 20 g glucose, 20 g agar-agar) plates containing 25 mg/mL of Zeocin. Gene
copy number amplification is done as described in Marx et al. (FEMS Yeast Res. 2009
Dec;9(8):1 260-70). Colony PGR is used to ensure the presence of the transformed
plasmid as described in Example 2c.
For HSA expression screening, a single colony is inoculated in liquid YPG-Zeo
medium (per liter: 20 g peptone, 10 g yeast extract, 12.6 g glycerol and 25 mg Zeocin)
as pre-culture. After approximately 24h the pre-culture is used to inoculate the main
culture with an OD600 of 1 in YP medium (per liter: 20 g peptone, 10 g yeast extract)
and glucose feed beads (Kuhner, CH). Glucose- limiting growth conditions are
achieved due to the slow glucose release kinetics of these feed beads, which is des
cribed by the following equation: (Glucose)=1 .63*t0.74 [mg/Disc]. Samples are taken at
the end of the pre-culture, and 24 and 48 hours after inoculation of the main culture.
Biomass concentration is determined by measuring OD600 or wet cell weight. HSA
concentration in the culture supernatant is quantified by the Human Albumin ELISA
Quantitation Set (Cat.No. E80-1 29, Bethyl Laboratories, TX, USA) following the
supplier ' s instruction manual. The HSA standard is used with a starting concentration
of 400 ng ml_ 1. Samples are diluted accordingly in sample diluent (50 mM Tris-HCI,
140 mM NaCI, 1% (w/v) BSA, 0.05% (v/v) Tween20, pH 8.0). HSA titers from a
screening of several multicopy clones and single copy clones from Example 3c are
presented in Table 13.
Table 13 : Screening results of P. pastoris multicopy clones expressing HSA
under the control of pGAP, pG1 and pG6
d) Determination of HSA gene copy numbers
Genomic DNA isolation and qPCR measurement are performed as in Example 2d,
using the primers given in Table 9. Results are shown in Table 14 .
Table 14 : Screening and gene copy numer results of chosen P. pastoris multicopy
clones expressing HSA under the control of pGAP, pG1 and pG6
e) Fed-batch cultivation of multicopy P. pastoris strains expressing HSA under
control of the pG1 and pG6 promoter
Fed batch fermentations are done as described in example 3e. The clones
pPM1 nZ30_pG1_HSA#4 * 1000 and pPM1 nZ30_pG6_HSA#C6 reached 060 and
728 mg/L HSA at the end of the fed batch, respectively.
Example 7 : Comparative promoter activity studies of the newl identified
promoter pG1 in P. pastoris using antibody fragment (Fab) as extracellular expressed
reporter gene
In order to analyze the properties of the newly identified promoters under
glucose limit conditions, shake flask screenings is performed as follows: Pre-culture for
24 hours is done with rich medium containing glycerol as carbon source - simulating
the batch phase of the process (repressed state of the promoters), which is followed by
the main culture with minimal medium and glucose feed beads - simulating the
glucose-limited fed batch phase of the process (induced state of the promoters);
a) Strain & expression vector
The P. pastoris wild type strain (CBS261 2, CBS-KNAW Fungal Biodiversity
Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) is used as
host strain. Transformation of the strain is carried out with an in-house vector named
pPUZZLE (Stadlmayr et al. J. Biotechnol 201 0 Dec;1 50(4):51 9-29), selection of
positive transformants is based on the Zeocin resistance. For secretory expression of
an antibody Fab fragment, yeast alpha mating factor leader is used.
b) Amplification and cloning of the newl identified promoter pG1 into an in-house
expression vector
The pG1 promoter amplified in Example 2b is cloned into the pPUZZLE
expression vector containing Fab as GOI as described in example 5b. The promoter is
inserted upstream of the start codon of the Fab gene using the Apal and the Sbfl
restriction sites. The correctness of the promoter sequence is verified by Sanger
sequencing.
c) Expression of Fab in P. pastoris under control of the newly identified glucoselimit
induced promoter pG1
Plasmids are linearized using Spel or Sapl restriction enzyme prior to electroporation
(using a standard transformation protocol for P. pastoris) into P. pastoris.
Selection of positive transformants is performed on YPD plates (per liter: 10 g yeast
extract, 20 g peptone, 20 g glucose, 20 g agar-agar) plates containing 25 g/mL of
Zeocin. Colony PGR is used to ensure the presence of the transformed plasmid as
described in Example 2c.
For Fab expression screening, a single colony is inoculated in liquid YPG-Zeo
medium (per liter: 20 g peptone, 10 g yeast extract, 12.6 g glycerol and 25 mg Zeocin)
as pre-culture. After approximately 24h the pre-culture is used to inoculate the main
culture with an OD600 of 1 in YP medium (per liter: 20 g peptone, 10 g yeast extract)
and glucose feed beads (Kuhner, CH). Glucose- limiting growth conditions are
achieved due to the slow glucose release kinetics of these feed beads, which is
described by the following equation: (Glucose)=1 .63* t° 4 [mg/Disc]. Samples are taken
at the end of the pre-culture, and 24 and 48 hours after inoculation of the main culture.
Biomass concentration is determined by measuring OD600 or wet cell weight. Fab
expression levels are quantified by ELISA using Anti-Human Kappa Light Chains
(Bound and Free)-Alkaline Phosphatase antibody produced in goat. Fab titers from a
screening of several Fab expressing clones under the control of pGAP and pG1 are
presented in Table 15.
Fab (mg/L)
pP 1 Z30 pGAP Fab#2 0.00
pPM 1dZ30 _pGAP_Fab#5 0.70
pP 1dZ30 pGAP Fab#7 0.68
pPM 1aZ30_pG 1 Fab#2 2.02
pP 1aZ30 pG1_Fab#3 0.70
pPM 1aZ30_pG 1 Fab#4 1.10
pP 1aZ30 pG1_Fab#5 0.00
pPM 1aZ30_pG 1 Fab#6 0.56
pPM 1aZ30 G1_Fab#9 0.66
pPM 1aZ30 pG1 Fab#1 0 1.80
pP 1aZ30 pG1 Fab#1 1 1.64
pPM 1aZ30_pG 1_Fab#1 2 2.31
pPM 1aZ30 pG1 Fab#1 3 2.35
pPM 1aZ30_pG 1 Fab#1 4 2.27
pP 1aZ30 pG1_Fab# 15 1.60
pPM 1aZ30_pG 1 Fab#1 6 1.45
pPM 1aZ30 pG1_Fab#B9 2.89
pPM 1aZ30_pG l Fab#B1 0 2.32
pPM 1aZ30 pG1_Fab#B1 1 6.45
pP 1aZ30 pG1 Fab#B1 2 3.24
pPM 1aZ30_pG 1_Fab#B 13 2.57
Fab (mg/L)
pPM 1aZ30 pG1 Fab#B1 4 3 .14
pPM 1aZ30_pG 1 Fab#B1 5 3.23
pP 1aZ30 pG1_Fab#B1 6 2.61
pP 1aZ30_pG 1 Fab#C1 10.58
pP 1aZ30 pG1_Fab#C2 1.46
pPM 1aZ30_pG 1 Fab#C3 12.38
pPM 1aZ30 pG1_Fab#C4 9.91
pPM 1aZ30_pG 1 Fab#C5 1.96
pP 1aZ30 pG1 Fab#C6 2.87
pP aZ30_pG 1_Fab#C7 7.03
pPM 1aZ30 pGl Fab#C8 6.37
Table 15 : Screening results of P. pastoris clones expressing Fab under the control
of pGAP and pG1
d) Fed-batch cultivation of P. pastoris strains expressing Fab under control of
the pG1 promoter.
Fed batch fermentations are done similar as described in example 3e, but
glucose fed batch as described in example 2e is used. The clones
pPM1 aZ30_pG1_ Fab#C4 and pP 1aZ30_pG1_Fab#C7 reached 165 and
13 1 mg/L Fab at the end of the fed batch, respectively.
Example 8 : Exponential Fed-batch Fermentation to control the specific growth
rate at the maximal volumetric productivity of the newly identified promoters
Chemostat cultivations of P. pastoris clones expressing a reporter gene under
the control of the newly identified promoters are used to determine the specific and
volumetric productivity at different growth rates. As described by Maurer et al. (Microb
Cell Fact. 2006 Dec 11;5:37), exponential fed-batch fermentations can be used to grow
a P. pastoris clone at a certain growth rate for improved production during the whole
feed phase. Thereby the space-time yield can be optimized. An optimized feed was
applied and the space-time yield of the fed batch phase was improved by more than
35%.
Example 9 : Determination of promoter/ transcription strength: Comparative
promoter activity study to identify promoter regulation on different glucose concen
trations using eGFP as intracellular expressed reporter gene
Regulation properties of a promoter are analyzed by screening clones ex
pressing eGFP under the control of said promoter. Therefore, a single colony is
inoculated in liquid YPG-Zeo medium (per liter: 20 g peptone, 10 g yeast extract,
12.6 g glycerol and 25 mg Zeocin) as pre-culture. After approximately 24 h the preculture
is used to inoculate the main culture with an OD600 of 0.01 in 10 ml YP
medium (per liter: 20 g peptone, 10 g yeast extract) and glucose in different concen
trations (20, 10, 5, 2.5, 1.25, 0.625, 0.31 3, 0.1 56, 0.078, 0.039, 0.020, 0.01 0, 0.005
and 0.002 g/L). A sample is taken after 6 hours and analyzed by flow cytometry as
described by Stadlmayr et al. (J Biotechnol. 201 0 Dec;1 50(4):51 9-29). Fluorescence
related to cell size (forward scatter to the power of 1.5) is calculated for each cell/data
point and the geometric mean thereof is used to compare eGFP expression levels pro
duced in different glucose concentrations. A clone expressing eGFP under the control
of pGAP is used as reference (pGAP of P. pastoris, here SEQ ID 25). Auto-fluor
escence of P. pastoris is measured using untransformed P. pastoris wild type cells and
subtracted from the signal. Table 16 shows the full induction of pG1 promoter at about
40 mg/L glucose or less, and its transcription strength as compared to the native pGAP
promoter.
% of Glucose
pGAP (g/L)
14.7 20
17.4 10
23.7 5
25.4 2.5
28.2 1.25
30.6 0.625
36.9 0.31 25
44.5 0.1 5625
50.9 0.0781 25
56.2 0.0390625
55.0 0.01 9531 3
57.5 0.0097656
59.2 0.0048828
59.6 0.002441 4
Table 16 : Relative eGFP expression (related to pGAP) of a P. pastoris clone
expressing eGFP under the control of the pG1 promoter in different glucose
concentrations (20 - 0.002 g/L)
Further similar studies were made to compare the relative transcription strength
of the de-repressed promoters pG1 , pG3, pG4, pG6 and pG7. A clone expressing
eGFP under the control of one of the promoters was cultivated in YPG (20 g/L glycerol,
repressed state) and then inoculated in YP medium containing different amounts of
glucose (20 to 0.002 g/L (D20, D 10... .D0.002), induced state) and cultivated for 5-6
hours. Cells were analyzed by flow cytometry and results were evaluated as follows:
The fluorescence was related to cell size (forward scatter to the power of .5) for each
cell and the geometric mean thereof was used for comparison of different glucose
concentrations. The concluding result of these screenings are shown in Figure 14 , a
diagram showing the logarithmic glucose concentrations against relative fluorescence,
giving a good picture of the induction behaviour of glucose-limit regulatable promoters.
Figure 14 shows the full induction of pG1 promoter at about 40 mg/L glucose or less,
and of the promoters pG3, pG4 and pG6 at about 4 g/L or less, and the transcription
strength as compared to the native pGAP promoter. The induction behaviour of pG7 is
similar to pG1 (Data not shown). Based on the previous results with pG8 it is assumed
that its induction behavior is in the range of the other promoters.
Example 10 : Comparison of prior art plCL1 and pMLS1 promoters to pG1 in the
glucose concentration screening assay.
The comparative promoter activity study is performed according to Example 9,
employing the plCL1 and pMLS1 promoters as a reference to compare with the pG1
promoter according to the invention.
The activity of both plCL1 and pMLS1 promoters is found to be very weak, with
no significant difference at high (D20: 20 g/L/ Repression) or low (DO.04: 0.04 g/L
Induction = De-Repression) glucose concentration. In any case the activity is far less
than the activity of the repressed pG1 promoter in the same setting. Results are shown
in Table 17 as promoter activity in % relative to the pGAP promoter.
D20/Repression D0.04/lnduction
pGl #8 9.95 +/- 2.60 48.41 +/- 2.76
plCL1 2.68 +/- 1.78 5.07 +/- 0.90
pMLS1 - 1 .26 +/- 0.54 0.58 +/- 0.22
Table 17 : Relative fluorescence of strains expressing eGFP under control of
pG1 , plCL1 and pMLS1 , respectively, grown either in medium containing 20 g/L
glucose (D20) or 0.04 g/L (DO.04).
Example 11: Comparison of variants of pG1
Shorter variants of the pG1 promoter are cloned as described in example 2a
and screened similar as described in example 2c, but in a downscaled setup using 24-
well plates (Whatman, UK, Art. Nr. 7701 -51 10) and quarters of feed beeds ( 12 mm,
Kuhner, CH) instead of total ones. Clones expressing under the control of pG1 and
pGAP are used as controls. Forward primers and lengths of pG1 and its variants are
listed in Table 18. There was no significant difference in the relative fluorescence of
cells expressing eGFP under the control of pG1 and the pG1 variants a-f.
Table 18 : pG1 and its variants: forward primers and 5' start and 3'end positions
in the pG1 sequence (SEQ ID 1) . Sequences of pG1 a-f see Figure 15 (SEQ ID 4 1-46).

Claims
1. A method of producing a protein of interest (POI) by culturing a recombinant
eukaryotic cell line comprising an expression construct comprising a regulatable
promoter and a nucleic acid molecule encoding a POI under the transcriptional control
of said promoter, comprising the steps
a) cultivating the cell line with a basal carbon source repressing the promoter,
b) cultivating the cell line with no or a limited amount of a supplemental carbon
source de-repressing the promoter to induce production of the POI at a transcription
rate of at least 15% as compared to the native pGAP promoter of the cell, and
c) producing and recovering the POI.
2. Method according to claim 1, wherein the basal carbon source is selected
from the group consisting of glucose, glycerol, ethanol, a mixture thereof, and complex
nutrient material.
3. Method according to claim 1 or 2, wherein the supplemental carbon source is
a hexose such as glucose, fructose, galactose or mannose, a disaccharide, such as
saccharose, an alcohol, such as glycerol or ethanol, or a mixture thereof.
4 . Method according to any of claims 1 to 3, wherein step b) employs a feed
medium that provides for no or the supplemental carbon source in a limited amount,
preferably of 0-1 g/L in the culture medium.
5. Method according to any of claims 1 to 4 , wherein the limited amount of the
supplemental carbon source is growth limiting to keep the specific growth rate within
the range of 0.02 h to 0.2 h , preferably 0.02 h 1 to 0.1 5 h .
6. Method according to any of claims 1 to 5 wherein the promoter is capable of
controlling the transcription of a gene in a wild-type eukaryotic cell, which gene is
selected from the group consisting of G 1 (SEQ ID 7), G3 (SEQ ID 8), G4 (SEQ ID 9),
G6 (SEQ D 10), G7 (SEQ ID 11) and G8 (SEQ ID 12), or a functionally active variant
thereof.
7. Method according to claim 6, wherein said functionally active variants are
selected from the group consisting of homologs with at least about 60% nucleotide
sequence identity, homologs obtainable by modifying the parent nucleotide sequence
by insertion, deletion or substitution of one or more nucleotides within the sequence or
at either or both of the distal ends of the sequence, preferably with a nucleotide
sequence of at least 200 bp, and analogs derived from species other than Pichia
pastoris.
8. Method according to claim 6 or 7, wherein the functionally active variant of
pG1 is selected from the group consisting of pG1 a (SEQ ID 4 1) , pG1 b (SEQ D 42),
pG1 c (SEQ ID 43), pG1 d (SEQ D 44), pG1 e (SEQ ID 45) and pG1 f (SEQ D 46).
9. Method according to any of claims 1 to 8, wherein the cell line is selected
from the group consisting of mammalian, insect, yeast, filamentous fungi and plant cell
lines, preferably a yeast.
10. Method according to any of claims 1 to 9, wherein the POI is a heterologous
protein, preferably selected from therapeutic proteins, including antibodies or
fragments thereof, enzymes and peptides, protein antibiotics, toxin fusion proteins,
carbohydrate - protein conjugates, structural proteins, regulatory proteins, vaccines
and vaccine like proteins or particles, process enzymes, growth factors, hormones and
cytokines, or a metabolite of a POI.
11. Method for controlling the expression of a POI in a recombinant eukaryotic
cell under the transcriptional control of a carbon source regulatable promoter having a
transcription strength of at least 15% as compared to the native pGAP promoter of the
cell, wherein the expression is induced under conditions limiting the carbon source.
12. Method of producing a POI in a recombinant eukaryotic cell under the
transcriptional control of a carbon source regulatable promoter, wherein said promoter
has a transcription strength of at least 15% as compared to the native pGAP promoter
of the cell.
13. Method according to any of claims 1 to 12, wherein the regulatable promoter
comprises a nucleic acid sequence selected from the group consisting of
a) pG1 (SEQ ID 1) , pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ D 3), pG7
(SEQ ID 5), or pG8 (SEQ ID 6);
b) a sequence having at least 60% homology to pG1 (SEQ ID 1) , pG3 (SEQ ID
2), pG4 (SEQ ID 4), pG6 (SEQ D 3), pG7 (SEQ ID 5), or pG8 (SEQ D 6);
c) a sequence which hybridizes under stringent conditions to pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ ID
6); and
d) a fragment or variant derived from a), b) or c),
wherein said promoter is a functionally active promoter, which is a carbon
source regulatable promoter capable of expressing a POI in a recombinant eukaryotic
cell at a transcription rate of at least 15% as compared to the native pGAP promoter of
the cell.
14 . Method according to claim 13, wherein the variant of pG1 (SEQ D 1) , pG3
(SEQ D 2), pG4 (SEQ ID 4), pG6 (SEQ ID 3), pG7 (SEQ D 5), or pG8 (SEQ ID 6) is a
functionally active variant selected from the group consisting of homologs with at least
about 60% nucleotide sequence identity, homologs obtainable by modifying the parent
nucleotide sequence by insertion, deletion or substitution of one or more nucleotides
within the sequence or at either or both of the distal ends of the sequence, preferably
with a nucleotide sequence of at least 200 bp, and analogs derived from species other
than Pichia pastoris.
15. Method according to claim 13 or 14 , wherein the functionally active variant
of pG1 is selected from the group consisting of pG1 a (SEQ ID 4 1) , pG1 b (SEQ ID 42),
pG1 c (SEQ ID 43), pG1 d (SEQ ID 44), pG1 e (SEQ ID 45) and pG1 f (SEQ ID 46).
16. An isolated nucleic acid comprising a nucleic acid sequence selected from
the group consisting of
a) pG1 (SEQ ID 1) , pG3 (SEQ ID 2), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8
(SEQ D 6);
b) a sequence having at least 60% homology to pG1 (SEQ ID 1) , pG3 (SEQ ID
2), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ ID 6);
c) a sequence which hybridizes under stringent conditions to pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG6 (SEQ ID 3), pG7 (SEQ ID 5), or pG8 (SEQ ID 6); and
d) a fragment or variant derived from a), b) or c),
wherein said nucleic acid comprises a functionally active promoter, which is a
carbon source regulatable promoter capable of expressing a POI in a recombinant
eukaryotic cell at a transcription rate of at least 15% as compared to the native pGAP
promoter of the cell.
17. Nucleic acid according to claim 16, wherein the variant of pG1 (SEQ ID 1) ,
pG3 (SEQ ID 2), pG6 (SEQ ID 3), pG7 (SEQ ID 5) or pG8 (SEQ ID 6) is a functionally
active variant selected from the group consisting of homologs with at least about 60%
nucleotide sequence identity, homologs obtainable by modifying the parent nucleotide
sequence by insertion, deletion or substitution of one or more nucleotides within the
sequence or at either or both of the distal ends of the sequence, preferably with a
nucleotide sequence of at least 200 bp, and analogs derived from species other than
Pichia pastoris.
18. Nucleic acid according to claim 16 or 17, wherein the functionally active
variant of pG1 is selected from the group consisting of pG1 a (SEQ ID 4 1) , pG1 b (SEQ
ID 42). pG1 c (SEQ ID 43), pG1 d (SEQ ID 44), pG1 e (SEQ ID 45) and pG1 f (SEQ ID
46).
19. An expression construct comprising a nucleic acid according to claim 16 to
18 operably linked to a nucleotide sequence encoding a POI under the transcriptional
control of said promoter, which nucleic acid is not natively associated with the
nucleotide sequence encoding the POI.
20. A recombinant eukaryotic cell comprising the construct of claim 19.
2 1. Method to identify a carbon source regulatable promoter from eukaryotic
cells, comprising the steps of
a) cultivating eukaryotic cells in the presence of a carbon source in a batch
culture under cell growing conditions,
b) further cultivating the cells in a fed batch culture in the presence of a limited
amount of a supplemental carbon source,
c) providing samples of the cell culture of step a) and b), and
d) performing transcription analysis in said samples to identify a regulatable
promoter that shows a higher transcriptional strength in cells of step b) than in cells of
step a).

Documents

Application Documents

# Name Date
1 3419-DELNP-2014.pdf 2014-05-13
2 Sequence Listing_PCT-EP2012-069757.txt 2014-06-02
3 Form-5.pdf 2014-06-02
4 Form-3.pdf 2014-06-02
5 Figure of Abstract.jpg 2014-06-02
6 Drawings_PCT-EP2012-069757.pdf 2014-06-02
7 Complete Specification_PCT-EP2012-069757.pdf 2014-06-02
8 3419-DELNP-2014_Petition u.r 138.pdf 2014-11-13
9 3419-DELNP-2014-Power of Attorney-241114.pdf 2014-12-08
10 3419-DELNP-2014-Correspondence-241114.pdf 2014-12-08
11 Other Document [31-05-2017(online)].pdf 2017-05-31
12 Form 26 [31-05-2017(online)].pdf 2017-05-31
13 Form 13 [31-05-2017(online)].pdf 2017-05-31
14 3419-DELNP-2014-Power of Attorney-060617.pdf 2017-06-08
15 3419-DELNP-2014-Correspondence-060617.pdf 2017-06-08
16 3419-DELNP-2014-FORM 3 [28-08-2017(online)].pdf 2017-08-28
17 3419-DELNP-2014-FER.pdf 2018-10-24
18 3419-DELNP-2014-SEQUENCE LISTING [09-04-2019(online)].txt 2019-04-09
19 3419-DELNP-2014-PETITION UNDER RULE 137 [09-04-2019(online)].pdf 2019-04-09
20 3419-DELNP-2014-OTHERS [09-04-2019(online)].pdf 2019-04-09
21 3419-DELNP-2014-FORM 3 [09-04-2019(online)].pdf 2019-04-09
22 3419-DELNP-2014-FER_SER_REPLY [09-04-2019(online)].pdf 2019-04-09
23 3419-DELNP-2014-DRAWING [09-04-2019(online)].pdf 2019-04-09
24 3419-DELNP-2014-COMPLETE SPECIFICATION [09-04-2019(online)].pdf 2019-04-09
25 3419-DELNP-2014-CLAIMS [09-04-2019(online)].pdf 2019-04-09
26 3419-DELNP-2014-FORM 3 [20-05-2019(online)].pdf 2019-05-20
27 3419-DELNP-2014-Response to office action (Mandatory) [10-07-2019(online)].pdf 2019-07-10
28 3419-delnp-2014-Response to office action (Mandatory) [24-09-2019(online)].pdf 2019-09-24
29 3419-DELNP-2014-FORM 3 [30-03-2020(online)].pdf 2020-03-30
30 3419-DELNP-2014-FORM 3 [19-09-2020(online)].pdf 2020-09-19
31 3419-DELNP-2014-FORM 3 [21-03-2021(online)].pdf 2021-03-21
32 3419-DELNP-2014-FORM 3 [08-09-2021(online)].pdf 2021-09-08
33 3419-DELNP-2014-US(14)-HearingNotice-(HearingDate-20-01-2022).pdf 2021-12-29
34 3419-DELNP-2014-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [14-01-2022(online)].pdf 2022-01-14
35 3419-DELNP-2014-US(14)-ExtendedHearingNotice-(HearingDate-09-03-2022).pdf 2022-02-16
36 3419-DELNP-2014-Correspondence to notify the Controller [07-03-2022(online)].pdf 2022-03-07
37 3419-DELNP-2014-Written submissions and relevant documents [23-03-2022(online)].pdf 2022-03-23
38 3419-DELNP-2014-MARKED COPIES OF AMENDEMENTS [23-03-2022(online)].pdf 2022-03-23
39 3419-DELNP-2014-FORM 13 [23-03-2022(online)].pdf 2022-03-23
40 3419-DELNP-2014-AMMENDED DOCUMENTS [23-03-2022(online)].pdf 2022-03-23
41 3419-DELNP-2014-FORM 3 [06-04-2022(online)].pdf 2022-04-06
42 3419-DELNP-2014-Response to office action [15-07-2022(online)].pdf 2022-07-15
43 3419-DELNP-2014-FORM 3 [15-09-2022(online)].pdf 2022-09-15
44 3419-DELNP-2014-Response to office action [10-10-2022(online)].pdf 2022-10-10
45 3419-DELNP-2014-PatentCertificate19-12-2022.pdf 2022-12-19
46 3419-DELNP-2014-IntimationOfGrant19-12-2022.pdf 2022-12-19

Search Strategy

1 search_23-10-2018.pdf

ERegister / Renewals

3rd: 14 Mar 2023

From 05/10/2014 - To 05/10/2015

4th: 14 Mar 2023

From 05/10/2015 - To 05/10/2016

5th: 14 Mar 2023

From 05/10/2016 - To 05/10/2017

6th: 14 Mar 2023

From 05/10/2017 - To 05/10/2018

7th: 14 Mar 2023

From 05/10/2018 - To 05/10/2019

8th: 14 Mar 2023

From 05/10/2019 - To 05/10/2020

9th: 14 Mar 2023

From 05/10/2020 - To 05/10/2021

10th: 14 Mar 2023

From 05/10/2021 - To 05/10/2022

11th: 14 Mar 2023

From 05/10/2022 - To 05/10/2023

12th: 21 Sep 2023

From 05/10/2023 - To 05/10/2024

13th: 25 Sep 2024

From 05/10/2024 - To 05/10/2025

14th: 23 Sep 2025

From 05/10/2025 - To 05/10/2026